Modulating the tumor immune microenvironment via targeting regulatory t cells (TREGS) with chimeric antigen receptor (CAR) t cell therapy

Abstract

Disclosed are chimeric antigen receptors that target glycoprotein A repetitions predominant (GARP) and methods of their use in the treatment of cancer including, but not limited to breast cancer, bladder cancer, glioblastoma, or leukemia or other malignancies characterized with GARP+ Tregs.

Description

[0001] MODULATING THE TUMOR IMMUNE MICROENVIRONMENT VIA TARGETING REGULATORY T CELLS (TREGS) WITH CHIMERIC ANTIGEN RECEPTOR (CAR) T CELL THERAPY

[0002] I. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0003] This invention was made with government support under grant / contract numbers P01 CA186866, R01 AI077283, R01 CA213290, R01CA255334. and R01 CA262069 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0004] II. CROSS-REFERENCE TO RELATED APPLICATIONS

[0005] This application claims the benefit of U.S. Provisional Application 63 / 678,901. filed on August 2, 2024; U.S. Provisional Application 63 / 610,289, filed on December 14, 2023; and U.S. Provisional Application 63 / 587,973, filed on October 4, 2023; applications which are incorporated herein by reference in their entireties.

[0006] III. BACKGROUND

[0007] Gliomas are the most common malignant primary tumor of the central nervous system, afflicting approximately 3.19 per 100,000 people per year in the United States. The prognosis for high-grade glioma (HGG) remains dismal at less than 2 years survival following diagnosis. Low-grade glioma (LGG) represents an earlier disease stage, which will unequivocally progress. The most well-studied and common form of HGG is Grade IV astrocytoma or glioblastoma (GBM), which presents a significant therapeutic challenge due to its molecular heterogeneity, low neoantigen burden, highly immunosuppressive tumor microenvironment (TME), and inherent therapeutic resistance. What are needed are new therapies to treat glioblastoma as well as other cancer.

[0008] IV. SUMMARY

[0009] Disclosed are methods and compositions related to chimeric antigen receptor immune cells that target anti-glycoprotein A repetitions predominant (GARP).

[0010] Disclosed herein are chimeric antigen receptor (CAR) immune cells (including, but not limited to a T cell, B cell, NK cell, NK T cell, or macrophage) comprising an anti-glycoprotein A repetitions predominant (GARP) binding molecule. In some aspects, the CAR further comprises a CD28. 41BB, 0X40, Myd88. ICOS, CD2, CD226. BAFF-R, TACI, or IL2RB signaling domain. In one aspect, disclosed herein are CAR immune cells of any preceding aspect, wherein the anti-GARP binding molecule comprises i) a variable heavy chain (VH) complementarity determining region 1 (CDR1), CDR2, and CDR3 as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively and ii) a variable light chain (VL) complementarity determining region 1 (CDR1), CDR2, and CDR3 as set forth in SEQ ID NO: 4, SEQ ID NO: 5. and SEQ ID NO: 6, respectively.

[0011] Also disclosed herein are CAR immune cells of any preceding aspect, wherein the anti- GARP binding molecule comprises a VH domain at least about 80%, 90%, 95%, 98% or 99% identical to the VH domain of the humanized PIIO-1 (huPIIO-1) antibodies as set forth in SEQ ID NO: 7, 8, 9 or 10 and / or a VL domain at least about 80% 90%, 95%, 98% or 99% identical to the VL domain of the huPIIO-1 antibodies as set forth in SEQ ID NO: 11, 12, or 13. In one aspect, the anti-GARP binding molecule comprises a VH domain as set forth in SEQ ID NO: 7, 8, 9, or 10 and / or a VL domain as set forth in SEQ ID NO: 11, 12 or 13.

[0012] In one aspect, disclosed herein are CAR immune cells of any preceding aspect, wherein the anti-GARP binding molecule comprises a VH domain as set forth in SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 12 (VH1VL1), a VH domain as set forth in SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 13 (VH1VL2), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 12 (VH2VL1), SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 11 (VH1VL3), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 13 (VH2VL2), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 11 (VH2VL3), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 12 (VH3VL1), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 13 (VH3VL2), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 11 (VH3VL3), a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 12 (VH4VL1), a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 13 (VH4VL2), or a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 11 (VH4VL3).

[0013] In one aspect, disclosed herein are methods of treating, inhibiting, reducing, decreasing, ameliorating, and / or preventing a cancer and / or metastasis (such as, for example, a GARP positive (GARP+) cancer and / or cancer comprising GARP+ T regulator cells in the tumor microenvironment, including, but not limited to a glioblastoma, bladder cancer, breast cancer, or leukemia or other malignancies characterized with GARP+ Tregs) in a subject comprising administering to the subject an effective amount of the CAR immune cell (including, but not limited to a T cell, B cell, NK cell. NK T cell, or macrophage) of any preceding aspect. For example, in one aspect, disclosed herein are methods of treating, inhibiting, reducing, decreasing, ameliorating, and / or preventing a cancer and / or metastasis (such as, for example, a GARP positive (GARP+) cancer and / or cancer comprising GARP+ T regulator cells in the tumor microenvironment, including, but not limited to a glioblastoma, bladder cancer, breast cancer, or leukemia or other malignancies characterized with GARP+ Tregs) in a subject comprising administering to the subject a chimeric antigen receptor (CAR) immune cell comprising an anti -glycoprotein A repetitions predominant (GARP) binding molecule. In some aspects, the CAR further comprises a CD28, 4 IBB, 0X40, Myd88. ICOS, CD2, CD226. BAFF- R, TACI, or IL2RB signaling domain.

[0014] Also disclosed herein are methods of treating, inhibiting, reducing, decreasing, ameliorating, and / or preventing a cancer and / or metastasis of any preceding aspect, wherein the anti-GARP binding molecule comprises i) a variable heavy chain (VH) complementarity determining region 1 (CDR1). CDR2, and CDR3 as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively and ii) a variable light chain (VL) complementarity determining region 1 (CDR1), CDR2, and CDR3 as set forth in SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, respectively.

[0015] In one aspect, disclosed herein are methods of treating, inhibiting, reducing, decreasing, ameliorating, and / or preventing a cancer and / or metastasis of any preceding aspect, wherein the anti-GARP binding molecule comprises a VH domain at least about 80%, 90%, 95%, 98% or 99% identical to the VH domain of the humanized PIIO-1 (huPIIO-1) antibodies as set forth in SEQ ID NO: 7, 8, 9 or 10 and / or a VL domain at least about 80% 90%, 95%, 98% or 99% identical to the VL domain of the huPIIO-1 antibodies as set forth in SEQ ID NO: 11, 12, or 13. In one aspect, the anti-GARP binding molecule comprises a VH domain as set forth in SEQ ID NO: 7, 8, 9, or 10 and / or a VL domain as set forth in SEQ ID NO: 11, 12 or 13.

[0016] Also disclosed herein are methods of treating, inhibiting, reducing, decreasing, ameliorating, and / or preventing a cancer and / or metastasis of any preceding aspect, wherein the anti-GARP binding molecule comprises a VH domain as set forth in SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 12 (VH1VL1), a VH domain as set forth in SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 13 (VH1VL2), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 12 (VH2VL1), SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 11 (VH1VL3), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 13 (VH2VL2), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 11 (VH2VL3), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 12 (VH3VL1), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 13 (VH3VL2), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 11 (VH3VL3), a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 12 (VH4VL1), a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 13 (VH4VL2), or a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 11 (VH4VL3).

[0017] Also disclosed herein are methods of modulating, reducing, inhibiting, decreasing, and / or suppressing immunosuppressive T regulatory (Treg) cells (including, but not limited to GARP+ Tregs) in a tumor microenvironment (TME) of a cancer (such as, for example, a GARP positive (GARP+) cancer and / or cancer comprising GARP+ T regulator cells in the tumor microenvironment, including, but not limited to a glioblastoma, bladder cancer, breast cancer, or leukemia or other malignancies characterized with GARP+ Tregs) in a subject, comprising administering to the subject a therapeutically effective amount of the CAR immune cell (including, but not limited to a T cell, B cell, NK cell, NK T cell, or macrophage) of any preceding aspect. For example, in one aspect, disclosed herein are methods of modulating, reducing, inhibiting, decreasing, and / or suppressing immunosuppressive T regulatory (Treg) cells (including, but not limited to GARP+ Tregs) in a tumor microenvironment (TME) of a cancer such as, for example, a GARP positive (GARP+) cancer and / or cancer comprising GARP+ T regulator cells in the tumor microenvironment, including, but not limited to a glioblastoma, bladder cancer, breast cancer, or leukemia or other malignancies characterized with GARP+ Tregs) in a subject comprising administering to the subject a therapeutically effective amount of a chimeric antigen receptor (CAR) immune cell (including, but not limited to a T cell, B cell, NK cell, NK T cell, or macrophage) comprising an anti-glycoprotein A repetitions predominant (GARP) binding molecule. In some aspects, the CAR further comprises a CD28, 41BB, 0X40, Myd88, ICOS, CD2. CD226, BAFF-R, TACI, or IL2RB signaling domain.

[0018] In one aspect disclosed herein are methods of modulating, reducing, inhibiting, decreasing, and / or suppressing immunosuppressive T regulatory (Treg) cells in a tumor microenvironment (TME) of a cancer of any preceding aspect, wherein the anti-GARP binding molecule comprises i) a variable heavy chain (VH) complementarity determining region 1 (CDR1), CDR2, and CDR3 as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively and ii) a variable light chain (VL) complementarity determining region 1 (CDR1), CDR2. and CDR3 as set forth in SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6. respectively.

[0019] Also disclosed herein are methods of modulating, reducing, inhibiting, decreasing, and / or suppressing immunosuppressive T regulatory (Treg) cells in a tumor microenvironment (TME) of a cancer of any preceding aspect, wherein the anti-GARP binding molecule comprises a Vn domain at least about 80%, 90%, 95%, 98% or 99% identical to the VH domain of the humanized PIIO-1 (huPIIO-1) antibodies as set forth in SEQ ID NO: 7, 8, 9 or 10 and / or a VL domain at least about 80% 90%, 95%, 98% or 99% identical to the VL domain of the huPIIO-1 antibodies as set forth in SEQ ID NO: 11. 12. or 13. In one aspect, the anti-GARP binding molecule comprises a Vn domain as set forth in SEQ ID NO: 7, 8, 9, or 10 and / or a VL domain as set forth in SEQ ID NO: 11, 12 or 13.

[0020] In one aspect disclosed herein are methods of modulating, reducing, inhibiting, decreasing, and / or suppressing immunosuppressive T regulatory (Treg) cells in a tumor microenvironment (TME) of a cancer of any preceding aspect, wherein the anti-GARP binding molecule comprises a VH domain as set forth in SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 12 (VH1 VL1), a Vn domain as set forth in SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 13 (VH1VL2), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 12 (VH2VL1), SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 11 (VH1 VL3), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 13 (VH2VL2), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 11 (VH2VL3), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 12 (VH3VL1), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 13 (VH3VL2), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 11 (VH3VL3), a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 12 (VH4VL1), a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 13 (VH4VL2), or a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 11 (VH4VL3).

[0021] V. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments and together with the description illustrate the disclosed compositions and methods.

[0023] Figures 1 A, IB, 1C, ID, and IE show public data mining results. Figure 1 A shows survival analysis of overall GBM datasets. The GARP high group is defined as samples with a 10% top GARP expression value. The GARP low group is defined as samples with a 10% bottom GARP expression value. Figure IB shows survival analysis of the mesenchymal subtype between the GARP high group and the GARP low group. Figure 1C shows GARP expression for TCGA-GBM-2013 dataset. “M” is a mesenchymal subtype (49 samples), and “non_M"’ is non-mesenchymal (94 samples). Figure ID shows GSEA analysis of angiogenesis, myeloid compartment, T cell signature, and T cell exhaustion for TCGA-GBM-2013 dataset. Figure IE shows a heatmap showing myeloid compartment signature gene expression in the mesenchymal and non-mesenchymal groups.

[0024] Figures 2A, 2B, 2C, 2D, 2E, 2F, 2G. 2H, and 21 show high GARP expression correlates with immune cell exclusion in human GBM. Figures 2A,m 2B, and 2C show paraffinized human GBM samples w ere stained with a multiplex IF strategy and evaluated for GARP expression and local TME findings. High GARP level (2A) correlated to low TIL infiltration, with the opposite true for low GARP regions (2B and 2C). Figures 2D, 2E, 2F, 2G, 2H, and 21 show quantification of tissue differences. There was more overall GARP low area (2D), similar cell density in GARP high areas (2E), increased CD1 lb+ and reduced CD4+, CD8+, and FoxP3+infiltrating (2F, 2G, 2H, and 21) lymphocytes in the GARP high areas. *=p<0.05; **=p<0.01; two-tailed paired Student’s T -test

[0025] Figures 3A, 3B, 3C, and 3D show the evaluation of GARP Expression on Glioma Stem Cells and Neoangiogenic Cells (3A) Public ATAC-seq data visualization. The IGV showcases the LRRC32 gene promoter region based on the hg 19 human reference genome. Figures 3B, 3C, and 3D show' immunofluorescent staining results of 10 LGG and HGG paired samples for various stem cell markers and GARP. Percentages of GARP+ cells of each type were compared with the Wilcoxon rank-sum test.

[0026] Figures 4A, 4B, 4C, and 4D show the in vitro efficacy of murine and human PIIO-1 CAR-T cells against GBM in a GARP-dependent fashion. Figure 4A shows a proliferation assay of murine CAR-T cells co-cultured with GL261 or CT-2A and their overexpressing counterparts. Figures 4B shows the visualization of the change in CAR-T percentage within the population at the end of the experiment shown in (4A). Figure 4C show s cytotoxicity’ assays for each cell line and its hGARP-overexpressing counterpart with different effector: target ratios of the CAR-T cells. Figure 4D shows cytokine measurements via ELISA from the supernatant collected from the cytotoxicity experiments shown in (4C). ** p<0.01; ***p<0.001;

[0027] ****pO .0001; All statistical tests were two-tailed independent student’s T tests for comparison of means. Figures 5A, 5B, 5C, 5D, 5E. and 5F show the in vivo safety of P1IO-1 CAR-T cells in hGARP knock-in mice and in vivo efficacy of PIIO-1 CAR-T cells in an immunodeficient mouse model. Figures 5A, 5B, and 5C show weight, serum cytokine measurements, and platelet counts of non-tumor-bearing hGARP KI mice after infusion of either IxlO6PIIO-1 CAR-T cells or EGFRvIII CAR-T cells. Figures 5D, 5E, and 5F show bioluminescence imaging of NSG mice implanted with IxlO5U87 hGARP OE cells receiving either EV CAR-T or PIIO-1 CAR-T on day 8 after tumor implant, followed for 100 days. Mice receiving PIIO-1 CAR-T rejected their tumors very' early and had significantly improved survival and luminescence readings (D&E). Additionally, histological evaluation showed that mice receiving PIIO-1 CAR-T had no discernable tumor on H&E or immunofluorescence for GARP, whereas EV CAR-T mice had large tumors with necrotic cores. “ns”=not significant *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001. Survival outcomes compared via Log-rank testing. Luminescence and cytokine data compared via two-tailed independent student’s T-test at each time point.

[0028] Figures 6A, 6B, 6C, 6D, 6E, 6F. and 6G anti-GARP chimeric antigen receptor T cells (PIIO-1 CAR-T) efficacy and safety in immunocompetent model of glioblastoma. Figure 6A shows schematic describing experiment timeline. Figure 6B shows luminescence imaging of mice receiving CAR-T vs empty vector (EV) T cells. Mice were imaged at 1-2 week intervals. Figure 6C show quantified photon counts of luminescence images. *=p<0.05; evaluated by two- way ANOVA. Figure 6D shows Kaplan-Meier curve comparing mice in each group. ***=p<0.001. Figures6E shows normalized percentage of mouse weight over time. ****=p<0.0001; evaluated via mixed effects model. Figures 6F and 6G show the evaluation of complete blood counts components from each group at weekly timepoints. No significant difference was noted in the counts.

[0029] Figures 7A, 7B, 7C, 7D, 7E, 7F, and 7G show supplementary to data mining results: Figures 7A, 7B, 7C, and 7D show survival analyses were conducted between the GARP high group and the GARP low group in terms of the overall TCGA-GBM-2013 dataset, classical subtype, neural subty pe, and proneural subtype. Figure 7E shows the gene list for the GARP- TGF0 axis (GARP activation factors). Figure 7F shows GARP activation scores are visualized by different GBM subtypes for the TCGA-GBM-2013 dataset. Figure 7G shows GSEA enrichment analysis results for the other three T cell exhaustion panel gene lists.

[0030] Figures 8A, 8B, 8C, 8D, 8E, 8F, 8G. and 8H show clustering of Immune Cells According to Lineage in GBM Microenvironment. Figures 8A, 8B, 8C, and 8D show images obtained at 20x magnification from selected, stained FFPE slides of human GBM, showing clustering of CDl lb+, CD8+, and CD4+ cells. Figures 8E, 8F, 8G, and 8H show nearest neighbor analyses of immune cells within the microenvironment of GBM, with each cell type as the reference for other types. Statistical comparison performed with two-tailed, paired students T-testing. NS=not significant; *=p<0.05; **=p<0.01

[0031] Figures 9A, 9B, 9C, 9D, 9E, and 9F show that GARP Expression is Present Across a Range of Glioma Grades. Figures 9A, 9B. and 9C show immunofluorescent staining results of three different LGG tissue sections, demonstrating a range of GARP expression from high (9 A) to none (9C). Figure 9D shows a histogram visualization of the relative percentage of GARP “high” tissue within 12 each of LGG and HGG paired FFPE slides. NS=not significant. Figure 9E shows immunofluorescent visualization of tissue microarray slices of normal brain and glioblastoma, demonstrating the difference in GARP expression. Figure 9F shows graphical representation of the percentage of qualitatively GARP positive cores in four commercially obtained human tissue microarrays of glioma (n=l 80 GBM, n=121 low grade glioma, and n=46 normal brain cores).

[0032] Figure 10. TISCH2 single-cell RNA-seq data exploration. The figure showcases the four GBM datasets’ gene expression across different cell subtypes. For each panel, the top UMAP displays the cell subsets, and the bottom violin plot visualizes LRRC32, CD44, PROMI, and SOX2 gene expression.

[0033] Figures 11A, 1 IB, 11C, 1 ID, and 1 IE show additional information regarding cell line staining and CAR structure. Figures 11 A shows a depiction of the general structure of the CAR construct, with a variable heavy (VH) and light (VL) chain, a linker (L), a CD8a transmembrane (TM) region, 4-1BB and CD3z intracellular signaling domain. Figures 11B and 11C show immunofluorescent evaluation of three parent and human GARP -overexpressing cell lines used in experiments in the article. All cells were grown on sterile culture slides and fixed directly to the slide to preserve cytoarchitecture. Figures 1 ID and 1 IE show immunofluorescent evaluation of GARP expression in FFPE mouse organs from our human LRRC32 knock-in (hLRRC32K) mouse model (1 ID) and a commercial human tissue microarray (1 IE). Negatively stained organs not shown.

[0034] Figures 12A, 12B, 12C, 12D, and 12E show elevated GARP expression in human glioblastoma correlates with reduced overall survival, mesenchymal subtype, and aggressive gene signatures. Figure 12A shows the overall survival analysis of GBM cohorts from the Chinese Glioma Genome Atlas (CGGA) (left n = 636; LRRC32 low n = 318; LRRC32 high n = 318) and The Cancer Genome Atlas combined glioblastoma and lower-grade glioma (TCGA- GBMLGG) (right, n = 667; LRRC32 low n = 333; LRRC32 high n = 334) cohorts stratified by median relative expression of LRRC32 mRNA; Survival analysis was performed via Log-Rank Mantel-Cox comparison of survival curves. Figure 12B shows a comparison of relative LRRC32 mRNA expression by tumor grade from the CGGA (left, n = 650) and TCGA-GBMLGG (righty n = 620) cohorts. Expression comparison was performed with Brown-Forsythe One-Way ANOVA with Dunnett’s T3 multiple comparisons test (CGGA) or via One-Way ANOVA with Tukey’s multiple comparisons test (TCGA-GBMLGG). Figure 12C shows the relative mRNA expression of LRRC32 across GBM patients stratified by subtype from the CGGA (right, n = 435) and IVY GAP (left, n = 270) cohorts; Expression comparison was performed via One-Way ANOVA with Tukey’s multiple comparison correction. Figures 12D shows a comparison of ranked, average relative mRNA expression of mesenchymal subtype associated genes across LRRC32 mRNA low (LRRC32 mRNA low designated as samples with the lowest LRRC32 mRNA expression; n = 44) and high (LRRC32 mRNA high designated as samples in the upper quartile for LRRC32 mRNA expression; n = 44) pediatric glioma patient samples from the pediatric brain cancer Clinical Proteomic Tumor Analysis Consortium / Children’s Hospital of Philadelphia (CPTAC / CHOP) cohort. Figure 12E shows LRRC32 pathway expression quantified by genes set variation analysis (GSVA) score for the TCGA-GBM-2013 dataset with “M” designating samples with mesenchymal subtyping (49 samples), and “non_M” designating samples with non-mesenchymal subtyping (94 samples). Statistical analysis was performed via Wilcoxon Rank-sum test to compare LRRC32 pathway expression. *p<0.05 ***p<0.001

[0035] Figures 13A, 13B, 13C, 13D, 13E, 13F, and 13G GARP expression in the tumor microenvironment is associated with reduced tumor infiltrating lymphocytes. Multiplex immunofluorescence staining of ten human GBM specimens collected from patients treated at The Ohio State University. Specimens were stained for GARP and a panel of immune cell markers including CD4, CD8, FOXP3, and CDl lb; specimens were whole-slide imaged and analyzed using InForm software. Figure 13A shows representative tumor region with low GARP levels (‘GARP LOW’; <250 GARP+cells / mm2). Figure 13B shows representative tumor region with high GARP levels (‘GARP HIGH’; >250 GARP+cells / mm2). Figure 13C shows quantification of total number of GARP LOW and GARP HIGH regions per specimen, represented as percent of scanned area. GARP expression did not alter overall cell density (data not shown). Figures 13D, 13E, 13F, and 13G show quantification of immune cell subsets in GARP LOW vs GARP HIGH regions for each GBM specimen. High GARP regions had significantly more CDl lb+cells (13D) and significantly fewer CD8+(13E), CD4+(13F) and CD4+ / FoxP3+(13G) cells. Samples were paired (e.g., patient A GARP HIGH vs patient A GARP LOW regions) for purposes of statistical analysis. *p<0.05; **p<0.01; Wilcoxon matched-pairs signed-rank test. Figures 14A. 14B, 14C, 14D, 14E. 14F, and 14G show GARP is expressed by glioma stem cells and neoangiogenic vessels in the tumor microenvironment. Figure 14A shows representative images for multiplex immunofluorescent staining of normal brain and glioblastoma patient samples for expression of GARP (y ellow) and DAPI (blue) (left), and quantification of percentage of GARP positive cores relative to tumor grade and type (right): specimens were whole-slide imaged and analyzed using InForm software from four commercially obtained human tissue microarrays of glioma (n=180 GBM, n=121 low grade glioma, and n=46 normal brain cores). Figures 14B, 14C, 14D, 14E, 14F, and 14G show multiplex immunofluorescence staining of paired samples from patients diagnosed with low- grade glioma and subsequently HGG. Specimens were stained for GARP and stem cell-like markers, including CD44, SOX2, and CD133; specimens were whole-slide imaged and analyzed using InForm software. Figures 14B, 14C, and 14D show representative tumor regions containing mesenchymal-like glioma stem cells (CD44+ / SOX2+, 14B); oligodendro-like glioma stem cells (CD1337SOX21, 14C); and neoangiogenic cells (CD133 / CD31 7 14D). Relative frequency of GARP expression in oligodendro-like (14E) and mesenchymal-like ( 14F) glioma stem cells (GSCs) were compared to non-GSCs in both LGG and HGG specimens. Relative frequency of GARP expression in neoanti genic cells (14G) were compared between LGG and HGG specimens. Both LGG and HGG expressed similar levels of GARP on GSC subtypes and neoantigenic cells. Comparisons were performed using Wilcoxon matched-pairs signed-rank test within grade (LGG vs LGG, HGG vs HGG). HGG: High Grade Glioma, LGG: Low Grade Glioma, ns = nonsignificant.

[0036] Figures 15A, 15B, 15C, 15D, and 15E show in vitro and in vivo activity’ of anti-GARP CAR-T cells against murine syngeneic GBM tumors in a clinically relevant human GARP knockin mouse model. Figure 15A shows CAR expression by murine T cells transduced with anti-GARP CAR-expressing lentivirus. Representative flow cytometry’ histogram stained using Protein L. EV, empty' vector control. Figures 15B shows cytotoxicity data from co-culture assays containing increasing effector-to-target ratios of CAR-T (GARP CAR-T or EV T) with GARP- overexpressing CT-2A or GL261 murine glioma cells (CT-2A-hGARP, GL261-hGARP). Figure 15C shows cytokine measurements from co-culture supernatant in (15B), measured via ELISA. Figure 15D shows experimental schema for in vivo assessment of GARP CAR-T vs. EV-T against murine GBM in immune-competent hLRRC32KImice C56BL / 6 mice. Figure 15E shows bioluminescence imaging and quantification of tumors in mice receiving anti-GARP CAR-T vs. EV T cells. Figures 16A. 16B, 16C, and 16D show systemic administration of anti-GARP-CAR-T cells to human GARP knockin mice do not cause overt toxicity. Figure 16A show the percent change from baseline body weight, (16B) platelet counts, and (16C and 16D) serum cytokines after IV infusion of either GARP- or EGFRvIII- CAR-T cells in lymphodepleted tumor free hLRRC32K!mice.

[0037] Figures 17A, 17B, 17C, 17D, 17E, 17F, 17G, and 17H show supplementary to data mining results. Figure 17A shows the gene list for the GARP-TGF0 axis (GARP associated factors). Figure 17B shows GARP associated pathway enrichment scores are visualized by different GBM subtypes for the TCGA-GBM-2013 dataset. Figures 17C, 17D, 17E, 17F, and 17G show overall survival analysis of the total TCGA-GBM-2013 dataset, mesenchymal subtype, classical subtype, neural and proneural subtypes stratified by LRRC32 mRNA expression, with the LRRC32 high group defined as samples in the top ten percent of LRRC32 mRNA expression and LRRC32 mRNA low group designated as samples in the bottom ten percent of LRRC32 mRNA expression; Survival analysis was performed via Log-Rank comparison of survival curves. Figure 17H shows GSEA analysis of angiogenesis, myeloid compartment, T cell signature, and T cell exhaustion for mesenchymal patients in the TCGA- GBM-2013 dataset.

[0038] Figures 18A, 18B, 18C, 18D, 18E. 18F, 18G, and 18H show clustering of immune cells according to lineage in GBM microenvironment. Figures 18 A, 18B, 18C, and 18D show images obtained at 20x magnification from selected, stained FFPE slides of human GBM, showing clustering of CDl lb+, CD8+, and CD4+ cells. Figures 18E, 18F, 18G, and 18H show nearest neighbor analyses of immune cells within the microenvironment of GBM, with each cell type as the reference for other types. Statistical comparison performed with two-tailed, paired students T-testing. NS=not significant; *=p<0.05; **=p<0.01.

[0039] Figures 19A, 19B, 19C, 19D, and 19E show that GARP expression is present across a range of glioma grades. Figures 19A, 19B, and 19C show immunofluorescent staining results of three different LGG tissue sections, demonstrating a range of GARP expression from high (19A) to none (19C). Figure 19D shows a Histogram visualization of the relative percentage of GARP ‘'high” tissue within 8 each of LGG and HGG paired FFPE slides. NS=not significant. Figure 19E shows a public ATAC-seq data visualization via Integrated Genomics Viewer (IGV) software demonstrating chromatin accessibility of the LRRC32 gene promoter region based on the hg!9 human reference genome.

[0040] Figure 20 shows TISCH2 single-cell RNA-seq data exploration. The figure showcases the four GBM datasets’ gene expression across different cell subtypes. For each panel, the top UMAP displays the cell subsets, and the bottom violin plot visualizes LRRC32, CD44, PR0M1. and SOX2 gene expression.

[0041] Figure 21 shows the GARP CAR-T cytotoxicity against the HEL erythroleukemia cell line. Three differently genetically manipulated (EV. GARP-OE and GARP-KO) HEL cell lines were cocltured with either PIIO-1 GARP CAR-T or mock T cells for 24h. The cytotoxicity’ was calculated using and LDH based assay using the following formula: %Cytotoxicity= (ODCAR T treated sample” ODmock T treated sample )* 100 / (OD max" ODmock T treated sample)

[0042] Figure 22 shows a schematic illustration of Treg in vitro cytotoxicity assay

[0043] Figure 23 shows the fold change in the proportion of either hGARP or GARPKO Treg cells within CD45.2+ cells after 20h co-incubation with mouse PIIO-1 GARP CAR-T cells in various Effector: Target cell ratios (a), and representative dot plots from the Flow Cytometry staining (b).

[0044] Figure 24 shows the fold change of the % of Treg cells (hGARP Tregs in the left, and GARPKO Tregs in the right) within CD45.2+ cells to baseline after co-culture with either PIIO- 1 CAR-T or mock T cells.

[0045] Figure 25. The bars represent the % Cytotoxicity of human PIIO-1 GARP CAR-T cells (left) or mock T cells (right) against either hGARP (blue) or GARPKO (red) in vitro converted Tregs cells, after 18h co-incubation

[0046] Figure 26 shows in the left panel, the bars show the ratio of CTV+:CTV- cells, which represents the fraction of target cells in the culture at the end of the assay, after the co-incubation with either the PIIO-1 GARP CAR-T or the mock T cells. In the right panel, the graphs show the Cytotoxicity of human PIIO-1 GARP CAR-T cells or mock T cells on the CD4+Foxp3+ Treg cells within the CTV+ TILs.

[0047] Figure 27 shows immuno-competent hLrrc32KI mice were treated with GARP CAR-Ts after receiving 5Gy of TBI, 10 days post tumor implantation (250,000 PyVT cells / mouse orthotopically). Two days after CAR-T injections, tumors were harvested, and the tumor infiltrating lymphocytes were assessed with Flow Cytometry.

[0048] Figure 28 shows the Treg proportion within+CD4+ TILs after GARP CAR-T infusion in breast cancer bearing hGARP mice, as assessed with Flow Cytometry between mock- and CAR- T cell treated mice. Representative dot plots are shown in the right panel.

[0049] Figure 29 shows flow cytometric analysis of the CD8+ TILs showed there are significantly less exhausted PD1+TIM3+ T cells in the mice received the GARP CAR-T cells compared to the mock treatment. Representative dot plots are shown in the right panel. VI. DETAILED DESCRIPTION

[0050] Before the present compounds, compositions, articles, devices, and / or methods are disclosed and described, it is to be understood that they are not limited to specific synthetic methods or specific recombinant biotechnology methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may. of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0051] A. Definitions

[0052] As used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a pharmaceutical carrier” includes mixtures of two or more such carriers, and the like.

[0053] Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that when a value is disclosed that “less than or equal to” the value, “greater than or equal to the value” and possible ranges between values are also disclosed, as appropriately understood by the skilled artisan. For example, if the value “10” is disclosed the “less than or equal to 10”as well as “greater than or equal to 10” is also disclosed. It is also understood that the throughout the application, data is provided in a number of different formats, and that this data, represents endpoints and starting points, and ranges for any combination of the data points. For example, if a particular data point “10” and a particular data point 15 are disclosed, it is understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15 are considered disclosed as well as between 10 and 15. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.

[0054] In this specification and in the claims which follow, reference will be made to a number of terms which shall be defined to have the following meanings: “Optional” or “optionally” means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.

[0055] An "increase" can refer to any change that results in a greater amount of a symptom, disease, composition, condition or activity. An increase can be any individual, median, or average increase in a condition, symptom, activity, composition in a statistically significant amount. Thus, the increase can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% increase so long as the increase is statistically significant.

[0056] A "decrease" can refer to any change that results in a smaller amount of a symptom, disease, composition, condition, or activity. A substance is also understood to decrease the genetic output of a gene when the genetic output of the gene product with the substance is less relative to the output of the gene product without the substance. Also for example, a decrease can be a change in the symptoms of a disorder such that the symptoms are less than previously observed. A decrease can be any individual, median, or average decrease in a condition, symptom, activity, composition in a statistically significant amount. Thus, the decrease can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% decrease so long as the decrease is statistically significant.

[0057] "Inhibit," "inhibiting." and "inhibition" mean to decrease an activity, response, condition, disease, or other biological parameter. This can include but is not limited to the complete ablation of the activity, response, condition, or disease. This may also include, for example, a 10% reduction in the activity, response, condition, or disease as compared to the native or control level. Thus, the reduction can be a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%. or any amount of reduction in between as compared to native or control levels.

[0058] By “reduce” or other forms of the word, such as “reducing” or “reduction,” is meant lowering of an event or characteristic e.g., tumor growlh). It is understood that this is ty pically in relation to some standard or expected value, in other words it is relative, but that it is not always necessary for the standard or relative value to be referred to. For example, “reduces tumor growth” means reducing the rate of growth of a tumor relative to a standard or a control.

[0059] By “prevent” or other forms of the word, such as “preventing” or “prevention,” is meant to stop a particular event or characteristic, to stabilize or delay the development or progression of a particular event or characteristic, or to minimize the chances that a particular event or characteristic will occur. Prevent does not require comparison to a control as it is typically more absolute than, for example, reduce. As used herein, something could be reduced but not prevented, but something that is reduced could also be prevented. Likewise, something could be prevented but not reduced, but something that is prevented could also be reduced. It is understood that where reduce or prevent are used, unless specifically indicated otherwise, the use of the other word is also expressly disclosed.

[0060] The term “subject’' refers to any individual who is the target of administration or treatment. The subject can be a vertebrate, for example, a mammal. In one aspect, the subject can be human, non-human primate, bovine, equine, porcine, canine, or feline. The subject can also be a guinea pig, rat, hamster, rabbit, mouse, or mole. Thus, the subject can be a human or veterinary patient. The term “patient” refers to a subject under the treatment of a clinician, e.g., physician.

[0061] The term “therapeutically effective” refers to the amount of the composition used is of sufficient quantity to ameliorate one or more causes or symptoms of a disease or disorder. Such amelioration only requires a reduction or alteration, not necessarily elimination.

[0062] The term “treatment” refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is. treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder.

[0063] "Biocompatible" generally refers to a material and any metabolites or degradation products thereof that are generally non-toxic to the recipient and do not cause significant adverse effects to the subject.

[0064] "Comprising" is intended to mean that the compositions, methods, etc. include the recited elements, but do not exclude others. "Consisting essentially of' when used to define compositions and methods, shall mean including the recited elements, but excluding other elements of any essential significance to the combination. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants from the isolation and purification method and pharmaceutically acceptable carriers, such as phosphate buffered saline, preservatives, and the like. "Consisting of' shall mean excluding more than trace elements of other ingredients and substantial method steps for administering the compositions provided and / or claimed in this disclosure. Embodiments defined by each of these transition terms are within the scope of this disclosure.

[0065] A “control” is an alternative subject or sample used in an experiment for comparison purposes. A control can be "positive" or "negative."

[0066] “Effective amount” of an agent refers to a sufficient amount of an agent to provide a desired effect. The amount of agent that is “effective” will vary from subject to subject, depending on many factors such as the age and general condition of the subject, the particular agent or agents, and the like. Thus, it is not always possible to specify a quantified “effective amount.” However, an appropriate “effective amount” in any subject case may be determined by one of ordinary skill in the art using routine experimentation. Also, as used herein, and unless specifically stated otherwise, an “effective amount” of an agent can also refer to an amount covering both therapeutically effective amounts and prophylactically effective amounts. An “effective amount” of an agent necessary to achieve a therapeutic effect may vary according to factors such as the age, sex. and weight of the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.

[0067] A "pharmaceutically acceptable" component can refer to a component that is not biologically or otherwise undesirable, i.e., the component may be incorporated into a pharmaceutical formulation provided by the disclosure and administered to a subject as described herein without causing significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the formulation in which it is contained. When used in reference to administration to a human, the term generally implies the component has met the required standards of toxicological and manufacturing testing or that it is included on the Inactive Ingredient Guide prepared by the U.S. Food and Drug Administration.

[0068] "Pharmaceutically acceptable carrier" (sometimes referred to as a “carrier”) means a carrier or excipient that is useful in preparing a pharmaceutical or therapeutic composition that is generally safe and non-toxic and includes a carrier that is acceptable for veterinary and / or human pharmaceutical or therapeutic use. The terms "carrier" or "pharmaceutically acceptable carrier" can include, but are not limited to, phosphate buffered saline solution, water, emulsions (such as an oil / water or water / oil emulsion) and / or various types of wetting agents. As used herein, the term "carrier" encompasses, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations and as described further herein. “Pharmacologically active’7(or simply “active”), as in a “pharmacologically active” derivative or analog, can refer to a derivative or analog (e.g., a salt, ester, amide, conjugate, metabolite, isomer, fragment, etc.) having the same type of pharmacological activity7as the parent compound and approximately equivalent in degree.

[0069] “Therapeutic agent” refers to any composition that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects, e.g., treatment of a disorder or other undesirable physiological condition, and prophylactic effects, e.g., prevention of a disorder or other undesirable physiological condition (e.g., a non-immunogenic cancer). The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically mentioned herein, including, but not limited to, salts, esters, amides, proagents, active metabolites, isomers, fragments, analogs, and the like. When the terms “therapeutic agent” is used, then, or when a particular agent is specifically identified, it is to be understood that the term includes the agent per se as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, proagents, conjugates, active metabolites, isomers, fragments, analogs, etc.

[0070] “Therapeutically effective amount” or “therapeutically effective dose” of a composition (e.g. a composition comprising an agent) refers to an amount that is effective to achieve a desired therapeutic result. In some embodiments, a desired therapeutic result is the control of ty pe I diabetes. In some embodiments, a desired therapeutic result is the control of obesity. Therapeutically effective amounts of a given therapeutic agent will ty pically vary with respect to factors such as the type and severity of the disorder or disease being treated and the age, gender, and weight of the subject. The term can also refer to an amount of a therapeutic agent, or a rate of delivery of a therapeutic agent (e.g., amount over time), effective to facilitate a desired therapeutic effect, such as pain relief. The precise desired therapeutic effect will vary according to the condition to be treated, the tolerance of the subject, the agent and / or agent formulation to be administered (e.g., the potency of the therapeutic agent, the concentration of agent in the formulation, and the like), and a variety of other factors that are appreciated by those of ordinary skill in the art. In some instances, a desired biological or medical response is achieved following administration of multiple dosages of the composition to the subject over a period of days, weeks, or years.

[0071] Throughout this application, various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this pertains. The references disclosed are also individually and specifically incorporated by reference herein for the matenal contained in them that is discussed in the sentence in which the reference is relied upon.

[0072] B. Compositions

[0073] Disclosed are the components to be used to prepare the disclosed compositions as well as the compositions themselves to be used within the methods disclosed herein. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutation of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a particular anti-GARP chimeric antigen receptor (CAR) immune cell is disclosed and discussed and a number of modifications that can be made to a number of molecules including the anti- GARP CAR immune cell are discussed, specifically contemplated is each and every combination and permutation of anti-GARP CAR immune cell and the modifications that are possible unless specifically indicated to the contrary. Thus, if a class of molecules A, B. and C are disclosed as well as a class of molecules D, E, and F and an example of a combination molecule, A-D is disclosed, then even if each is not individually recited each is individually and collectively contemplated meaning combinations, A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are considered disclosed. Likewise, any subset or combination of these is also disclosed. Thus, for example, the sub-group of A-E, B-F, and C-E would be considered disclosed. This concept applies to all aspects of this application including, but not limited to, steps in methods of making and using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific embodiment or combination of embodiments of the disclosed methods.

[0074] Glycoprotein A-repetitions predominant (GARP) is a type I transmembrane protein that is expressed by activated regulatory T cells (Tregs) and platelets. It binds and activates multiple isoforms of latent TGFp in the tumor microenvironment (TME), contributing to cancer immune evasion and treatment resistance. GARP has been found to be aberrantly expressed by glioma cells, identifying it as a potential target for immunotherapy. Herein, we demonstrated that elevated GARP expression in human high-grade glioma confers overall worsened prognosis, and correlates with mesenchymal gene signature, angiogenesis, immune exclusion, and CD8+T cell exhaustion in the TME. Furthermore, we developed a unique anti-GARP-chimeric antigen receptor that targets tumor cells, but not platelets. T cells stably expressing anti-GARP CAR were show n to be effective against multiple preclinical models of high-grade glioma in mice without significant toxicity. Thus. GARP -targeted cell therapy is a promising new therapy for GBM.

[0075] 1. (CAR)-T cell platform to treat glioblastoma

[0076] Based on expression patterns of key genes including PDGFRA, IDH1, EGFR, and NF1, GBM can be classified into classical, mesenchymal, proneural, and neural subtypes. The mesenchymal subtype exhibit an enrichment in tumor infiltrating immune populations, including regulatory T cells and tumor associated macrophages, relative to the proneural or classical subty pes. Proneural GBM exhibits the highest rates of IDH1 mutation and responsiveness to IDH1 inhibitors, whereas both proneural and mesenchymal subtypes have higher TP53 mutation rate. The mesenchymal subtype GBM exh i bi t the poorest overall survival while the proneural subtype correlates to better survival but also younger patient age. The current standard of care for patients with newly diagnosed GBM includes maximal tumor resection, followed by radiotherapy with concomitant temozolomide (TMZ) chemotherapy (Stupp protocol) and subsequent maintenance treatment with TMZ and tumor treating fields (TTF). Despite substantial ongoing research and many clinical trials, the overall survival (OS) for patients diagnosed with GBM has not improved significantly over the past two decades, especially for patients with relapsed disease. Therein, new treatments and alternative strategies are urgently needed.

[0077] Genetic engineering of T cell receptors (TCRs) led to the idea and the development of chimeric antigen receptor (CAR) T cell therapy (CAR-T), comprised of antigen-specific singlechain variable fragments (scFvs) fused to T cell signaling domains transduced into T cells. These cells can bind tumor-specific antigens without MHC restriction, allowing for fully primed CAR-T cells to infiltrate tumors and perform antitumor effector functions. To date, most clinical success with CAR-T cell therapy has been reported in hematologic cancers; however, ongoing research aims to identity' new antigens to target a range of solid malignancies, including GBM.

[0078] CAR-T-targeted antigens in GBM include interleukin- 13 receptor alpha2 (IL13Ra2) , epidermal growth factor receptor variant III (EGFRvIII), human epidermal growth factor 2 (HER2), and erythropoietin-producing hepatocellular carcinoma A2 (EphA2). Recently, a new' T cell modality’ expressing a CAR to target EGFRvIII as w ell as secreting T-cell-engaging antibody molecules for w ild-type EGFR, show ed profound but transient responses in a phase 1 clinical trial. No CAR-T products have shown conclusive and robust benefit to patients with GBM in larger controlled trials, due to a multitude of reasons including antigenic escape. Because of these limitations, further study into CAR-T-targetable tumor antigens in GBM is needed. Transforming grow th factor P (TGFP) is an essential cytokine that is highly expressed in the tumor and facilitates cancer immune evasion through direct and indirect mechanisms. It promotes cancer-associated fibroblasts to produce excess collagen, trapping T cells in the periphery and restricting their ability to kill tumor cells. Moreover, TGFP can induce differentiation of immunosuppressive cell populations such as regulatory T cells (Tregs), M2 macrophages, and myeloid-derived suppressor cells that stunt antitumor immunity. TGFP can also directly inhibit CD8+T cell function by blunting cytotoxic gene programs, limiting trafficking to the tumor, and attenuating TCR stimulation. As such, TGFP offers an attractive target for immunotherapy. However, long-term inhibition of TGFP has shown inflammatory, autoimmune, and cardiovascular side effects, and systemic inhibition via TGFP-trap or small molecule inhibitors of TGFP signaling pathway have proven clinically unsuccessful. Thus, uncovering innovative approaches for targeting and modulating local TGFP inhibition is of strategic importance.

[0079] Glycoprotein-A repetitions predominant (GARP). encoded by I.RRC32. is a cell surface, non-signaling, docking and activating receptor for latent TGFP (LTGFP). Expressed by platelets, activated Tregs, mesenchymal stromal cells, and tumor cells, GARP is an important post- translational regulator of TGFP biogenesis as it associates with latency-associated peptide (LAP) of LTGFP to cooperate with integrins and other mechanisms in activating LTGFp. We previously demonstrated that GARP is highly expressed by a variety of primary human solid tumors, such as prostate and non-small cell lung cancer, but not by normal epithelial cells. Using immunohistochemistry , Zimmer et al found that GARP has elevated expression in GBM but not normal brain. Furthermore, we found that the genetic deletion of Lrrc32 in murine Tregs or platelets - both of which can infiltrate the TME - enhanced tumor control in colitis-associated colorectal cancer and MC38 colon cancer, respectively. These findings suggest GARP expression on various cells in the TME may elevate the local concentration of active TGFP, resulting in TGFp-dependent immune evasion. This w ork led to our development of a humanized anti-GARP monoclonal antibody (PIIO-1), which is currently under consideration for clinical trials. This antibody binds to the LAP binding pocket of GARP and ablates the GARP -TGFP signaling axis by preventing the association of LTGFP and GARP. Due to GARP's selective expression in GBM but not normal brains, we hypothesized that the singlechain variable fragment (scFv) of PIIO-1 may be used to target recurrent GBM by incorporating it into a CAR-T platform. Herein, we examine the role GARP plays in both low- and high-grade glioma and report a novel anti-GARP CAR-T therapy with preclinical efficacy and safety against multiple models of GBM. Disclosed herein are chimeric antigen receptor (CAR) immune cells (including, but not limited to a T cell, B cell, NK cell, NK T cell, or macrophage) comprising an anti-glycoprotein A repetitions predominant (GARP) binding molecule. In some aspects, the CAR immune cell can be a chimeric antigen receptor (CAR) T cells (such as for example, CD8+T cells and / or CD4+T cells), CAR B cells. CAR Natural Killer (NK) cells, CAR NK T cells, CAR and / or CAR macrophage (CARMA). The immune cells can be genetically engineered to express antigen receptors such as engineered TCRs. For example, the autologous T-cells are modified to express a T cell receptor (TCR) having antigenic specificity for a cancer antigen.

[0080] Chimeric antigen receptors

[0081] In some embodiments, the CAR contains an extracellular antigen-recognition domain that specifically binds to an antigen. In some embodiments, the antigen is a protein expressed on the surface of cells. In some embodiments, the CAR is a TCR-like CAR and the antigen is a processed peptide antigen, such as a peptide antigen of an intracellular protein, which, like a TCR. is recognized on the cell surface in the context of a major histocompatibility complex (MHC) molecule.

[0082] In some embodiments, the chimeric antigen receptors (CARs), include activating or stimulatory CARs, costimulatory CARs (see WO2014 / 055668), and / or inhibitory CARs (iCARs, see Fedorov et al., Set. Transl. Medicine, 5(215) (2013). The CARs generally include an extracellular antigen (or ligand) binding domain linked to one or more intracellular signaling components, in some aspects via linkers and / or transmembrane domain(s). Such molecules typically mimic or approximate a signal through a natural antigen receptor, a signal through such a receptor in combination with a costimulalory receptor, and / or a signal through a costimulatory receptor alone.

[0083] In some embodiments, CAR is constructed with a specificity for a particular antigen (or marker or ligand), such as an antigen expressed in a particular cell type to be targeted by adoptive therapy, e.g., a cancer marker, and / or an antigen intended to induce a dampening response, such as an antigen expressed on a normal or non-diseased cell type. Thus, the CAR ty pically includes in its extracellular portion one or more antigen binding molecules, such as one or more antigen-binding fragment, domain, or portion, or one or more antibody variable domains, and / or antibody molecules. In some embodiments, the CAR includes an antigenbinding portion or portions of an antibody molecule, such as a single-chain antibody fragment (scFv) derived from the variable heavy (VH) and variable light (VL) chains of a monoclonal antibody (mAb). In some aspects, the antigen-specific binding, or recognition component is linked to one or more transmembrane and intracellular signaling domains. In some embodiments, the CAR includes a transmembrane domain fused to the extracellular domain of the CAR. In one embodiment, the transmembrane domain that naturally is associated with one of the domains in the CAR is used. In some instances, the transmembrane domain is selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins to minimize interactions with other members of the receptor complex.

[0084] The transmembrane domain in some embodiments is derived either from a natural or from a synthetic source. Where the source is natural, the domain in some aspects is derived from any membrane-bound or transmembrane protein. Transmembrane regions include those derived from (i.e. comprise at least the transmembrane region(s) of) the alpha, beta or zeta chain of the T- cell receptor, CD28, CD3 epsilon, CD45. CD4, CD5, CDS, CD9, CD 16, CD22, CD33. CD37, CD64, CD80. CD86. CD 134, CD137. CD 154. Alternatively, the transmembrane domain in some embodiments is synthetic. In some aspects, the synthetic transmembrane domain comprises predominantly hydrophobic residues such as leucine and valine. In some aspects, a triplet of phenylalanine, tryptophan and valine will be found at each end of a synthetic transmembrane domain.

[0085] The CAR generally includes at least one intracellular signaling component or components. In some embodiments, the CAR includes an intracellular component of the TCR complex, such as a TCR CD3+chain that mediates T-cell activation and cytotoxicity, e.g., CD3 zeta chain. Thus, in some aspects, the antigen binding molecule is linked to one or more cell signaling modules. In some embodiments, cell signaling modules include CD3 transmembrane domain, CD3 intracellular signaling domains, and / or other CD transmembrane domains. In some embodiments, the CAR further includes a portion of one or more additional molecules such as Fc receptor y, CD8, CD4, CD25, or CD 16. For example, in some aspects, the CAR includes a chimeric molecule between CD3-zeta (CD3-Q or Fc receptor y and CD8. CD4. CD25 or CD16.

[0086] In some aspect, the CAR can further include an intracellular co-stimulatory signaling motif. As used herein, “intracellular co-stimulatory signaling motifs” are defined as components or domains within the engineered receptors (CARs) that provide additional signals to T cells upon engagement with their target antigens. Co-stimulatory motifs are often derived from natural signaling proteins involved in T cell activation, such as CD28, 41BB, 0X40, Myd88, ICOS, CD2, CD226, BAFF-R, TACI, or IL2RB. Co-stimulatory motifs used herein, enhance T cell proliferation, cytokine secretion, cytotoxicity7, and memory7formation, ultimately improving the efficacy of CAR therapy. Accordingly, disclosed herein are anti-GARP CARs further comprising a CD28, 41BB, 0X40, Myd88, ICOS, CD2, CD226, BAFF-R, TACI, or IL2RB signaling domain.

[0087] The T cell therapy and anti-platelet agent may be administered by the same route of administration or by different routes of administration. In some embodiments, the T cell therapy and / or anti-platelet agent is administered intratumorally, intravenously, intramuscularly, subcutaneously, topically, orally, transdermally, intraperitoneally, intraorbi tally, by implantation, by inhalation, intrathecally, intraventricularly, or intranasally. An effective amount of the T cell therapy and anti-platelet agent may be administered for prevention or treatment of disease. The appropriate dosage of the T cell therapy and anti-platelet agent be determined based on the type of disease to be treated, severity and course of the disease, the clinical condition of the individual, the individual's clinical history' and response to the treatment, and the discretion of the attending physician.

[0088] It is understood and herein contemplated that the anti-GARP receptor of the CAR can comprise features of anti-GARP antibodies, antibody fragments (such as, for example, ScFv's Variable Heavy' (VH) chains, and Variable Light (VL) chains including the complementarity7determining regions (CDRs)), and antibody like particles (such as, for example, nanobodies, diabodies, bi-specific T cell engagers (BiTEs) that bind to GARP such as those described in Table 1.

[0089] Table 1. GARP CAR ScFv heavy and light chains

[0090] In one aspect, disclosed herein are CAR immune cells, wherein the anti-GARP binding molecule comprises i) a variable heavy chain (VH) complementarity determining region 1 (CDR1), CDR2, and CDR3 as set forth in SEQ ID NO: 1. SEQ ID NO: 2, and SEQ ID NO: 3, respectively and ii) a variable light chain (VL) complementarity determining region 1 (CDR1), CDR2, and CDR3 as set forth in SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, respectively.

[0091] Also disclosed herein are CAR immune cells, wherein the anti-GARP binding molecule comprises a VH domain at least about 80%, 90%, 95%, 98% or 99% identical to the VH domain of the humanized PIIO-1 (huPIIO-1) antibodies as set forth in SEQ ID NO: 7, 8, 9 or 10 and / or a VL domain at least about 80% 90%, 95%, 98% or 99% identical to the VL domain of the huPIIO- 1 antibodies as set forth in SEQ ID NO: 11. 12. or 13. In one aspect, the anti-GARP binding molecule comprises a VH domain as set forth in SEQ ID NO: 7, 8, 9, or 10 and / or a VL domain as set forth in SEQ ID NO: 11, 12 or 13.

[0092] In one aspect, disclosed herein are CAR immune cells, wherein the anti-GARP binding molecule comprises a VH domain as set forth in SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 12 (VH1 VL1), a VH domain as set forth in SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 13 (VH1VL2), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 12 (VH2VL1), SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 11 (VH1VL3), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 13 (VH2VL2), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 11 (VH2VL3), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 12 (VH3VL1), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 13 (VH3VL2), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 11 (VH3VL3), a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 12 (VH4VL1 ), a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 13 (VH4VL2), or a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 11 (VH4VL3).

[0093] 2. Antibodies

[0094] (1) Antibodies Generally

[0095] The term “antibodies” is used herein in a broad sense and includes both polyclonal and monoclonal antibodies. In addition to intact immunoglobulin molecules, also included in the term “antibodies” are fragments or polymers of those immunoglobulin molecules, and human or humanized versions of immunoglobulin molecules or fragments thereof, as long as they are chosen for their ability to interact with GARP. The antibodies can be tested for their desired activity using the in vitro assays described herein, or by analogous methods, after which their in vivo therapeutic and / or prophylactic activities are tested according to known clinical testing methods. There are five major classes of human immunoglobulins: IgA, IgD, IgE. IgG and IgM, and several of these may be further divided into subclasses (isotypes), e g., IgG-1, IgG-2, IgG-3, and IgG-4; IgA-1 and IgA-2. One skilled in the art would recognize the comparable classes for mouse. The heavy chain constant domains that correspond to the different classes of immunoglobulins are called alpha, delta, epsilon, gamma, and mu, respectively.

[0096] The term “monoclonal antibody” as used herein refers to an antibody obtained from a substantially homogeneous population of antibodies, i.e., the individual antibodies within the population are identical except for possible naturally occurring mutations that may be present in a small subset of the antibody molecules. The monoclonal antibodies herein specifically include "chimeric" antibodies in which a portion of the heavy and / or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, as long as they exhibit the desired antagonistic activity.

[0097] The disclosed monoclonal antibodies can be made using any procedure which produces mono clonal antibodies. For example, disclosed monoclonal antibodies can be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature, 256:495 (1975). In a hybridoma method, a mouse or other appropriate host animal is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent. Alternatively, the lymphocytes may be immunized in vitro.

[0098] The monoclonal antibodies may also be made by recombinant DNA methods. DNA encoding the disclosed monoclonal antibodies can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). Libraries of antibodies or active antibody fragments can also be generated and screened using phage display techniques, e.g., as described in U.S. Patent No. 5,804,440 to Burton et al. and U.S. Patent No. 6,096,441 to Barbas et al.

[0099] In vitro methods are also suitable for preparing monovalent antibodies. Digestion of antibodies to produce fragments thereof, particularly. Fab fragments, can be accomplished using routine techniques known in the art. For instance, digestion can be performed using papain. Examples of papain digestion are described in WO 94 / 29348 published Dec. 22, 1994 and U.S. Pat. No. 4,342,566. Papain digestion of antibodies typically produces two identical antigen binding fragments, called Fab fragments, each with a single antigen binding site, and a residual Fc fragment. Pepsin treatment yields a fragment that has two antigen combining sites and is still capable of cross-linking antigen.

[0100] As used herein, the term “antibody or fragments thereof’ encompasses chimeric antibodies and hybrid antibodies, with dual or multiple antigen or epitope specificities, and fragments, such as F(ab’)2, Fab’, Fab, Fv, sFv, scFv, and the like, including hybrid fragments. Thus, fragments of the antibodies that retain the ability to bind their specific antigens are provided. For example, fragments of antibodies which maintain GARP binding activity are included within the meaning of the term “antibody or fragment thereof.” Such antibodies and fragments can be made by techniques known in the art and can be screened for specificity and activity according to the methods set forth in the Examples and in general methods for producing antibodies and screening antibodies for specificity and activity (See Harlow and Lane. Antibodies. A Laboratory Manual. Cold Spring Harbor Publications, New York, (1988)).

[0101] Also included within the meaning of “antibody or fragments thereof’ are conjugates of antibody fragments and antigen binding proteins (single chain antibodies).

[0102] The fragments, whether attached to other sequences or not, can also include insertions, deletions, substitutions, or other selected modifications of particular regions or specific amino acids residues, provided the activity of the antibody or antibody fragment is not significantly altered or impaired compared to the non-modified antibody or antibody fragment. These modifications can provide for some additional property7, such as to remove / add amino acids capable of disulfide bonding, to increase its bio-longevity, to alter its secretory characteristics, etc. In any case, the antibody or antibody fragment must possess a bioactive property, such as specific binding to its cognate antigen. Functional or active regions of the antibody or antibody fragment may be identified by mutagenesis of a specific region of the protein, followed by expression and testing of the expressed polypeptide. Such methods are readily apparent to a skilled practitioner in the art and can include site-specific mutagenesis of the nucleic acid encoding the antibody or antibody fragment. (Zoller, M.J. Curr. Opin. Biotechnol. 3:348-354, 1992).

[0103] As used herein, the term “antibody” or “antibodies” can also refer to a human antibody and / or a humanized antibody. Many non-human antibodies (e.g.. those derived from mice, rats, or rabbits) are naturally antigenic in humans, and thus can give rise to undesirable immune responses when administered to humans. Therefore, the use of human or humanized antibodies in the methods serves to lessen the chance that an antibody administered to a human will evoke an undesirable immune response.

[0104] (2) Human antibodies

[0105] The disclosed human antibodies can be prepared using any technique. The disclosed human antibodies can also be obtained from transgenic animals. For example, transgenic, mutant mice that are capable of producing a full repertoire of human antibodies, in response to immunization, have been described (see, e.g., Jakobovits et al., Proc. Natl. Acad. Sci. USA, 90:2551-255 (1993); Jakobovits et al.. Nature, 362:255-258 (1993); Bruggermann et al.. Year in Immunol., 7:33 (1993)). Specifically, the homozy gous deletion of the antibody heavy chain joining region (1(H)) gene in these chimeric and germ-line mutant mice results in complete inhibition of endogenous antibody production, and the successful transfer of the human germ-line antibody gene array into such germ-line mutant mice results in the production of human antibodies upon antigen challenge. Antibodies having the desired activity are selected using Env-CD4-co-receptor complexes as described herein.

[0106] (3) Humanized antibodies

[0107] Antibody humanization techniques generally involve the use of recombinant DNA technology to manipulate the DNA sequence encoding one or more polypeptide chains of an antibody molecule. Accordingly, a humanized form of a non-human antibody (or a fragment thereof) is a chimeric antibody or antibody chain (or a fragment thereof, such as an sFv, Fv, Fab, Fab’, F(ab’)2, or other antigen-binding portion of an antibody) which contains a portion of an antigen binding site from a non-human (donor) antibody integrated into the framework of a human (recipient) antibody.

[0108] To generate a humanized antibody, residues from one or more complementarity determining regions (CDRs) of a recipient (human) antibody molecule are replaced by residues from one or more CDRs of a donor (non-human) antibody molecule that is known to have desired antigen binding characteristics (e.g., a certain level of specificity and affinity for the target antigen). In some instances, Fv framework (FR) residues of the human antibody are replaced by corresponding non-human residues. Humanized antibodies may also contain residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies. Humanized antibodies generally contain at least a portion of an antibody constant region (Fc), ty pically that of a human antibody (Jones et al., Nature, 321 :522-525 (1986), Reichmann et al., Nature, 332:323-327 (1988), and Presta, Curr. Opin. Struct. Biol., 2:593-596 (1992)).

[0109] Methods for humanizing non-human antibodies are well known in the art. For example, humanized antibodies can be generated according to the methods of Winter and co-workers (Jones et al., Nature, 321:522-525 (1986), Riechmann et al., Nature, 332:323-327 (1988), Verhoeyen et al., Science, 239: 1534-1536 (1988)), by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Methods that can be used to produce humanized antibodies are also described in U.S. Patent No. 4,816,567 (Cabilly et al.), U.S. Patent No. 5,565,332 (Hoogenboom et al.), U.S. Patent No. 5,721,367 (Kay et al.), U.S. Patent No. 5.837,243 (Deo et al.), U.S. Patent No. 5, 939.598 (Kucherlapati et al.). U.S. Patent No. 6,130,364 (Jakobovits et al ), and U.S. Patent No. 6,180,377 (Morgan et al ).

[0110] 3. Pharmaceutical carriers / Delivery of pharmaceutical products

[0111] As described above, the compositions can also be administered in vivo in a pharmaceutically acceptable carrier. By "pharmaceutically acceptable" is meant a material that is not biologically or otherwise undesirable, i.e., the material may be administered to a subject, along with the nucleic acid or vector, without causing any undesirable biological effects or interacting in a deleterious manner w ith any of the other components of the pharmaceutical composition in which it is contained. The carrier would naturally be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject, as would be well known to one of skill in the art.

[0112] The compositions may be administered orally, parenterally (e.g., intravenously), by intramuscular injection, by intraperitoneal injection, transdermally, extracorporeally, topically or the like, including topical intranasal administration or administration by inhalant. As used herein, "topical intranasal administration" means delivery of the compositions into the nose and nasal passages through one or both of the nares and can comprise delivery by a spraying mechanism or droplet mechanism, or through aerosolization of the nucleic acid or vector. Administration of the compositions by inhalant can be through the nose or mouth via delivery by a spraying or droplet mechanism. Delivery can also be directly to any area of the respirator}7system (e.g., lungs) via intubation. The exact amount of the compositions required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity of the allergic disorder being treated, the particular nucleic acid or vector used, its mode of administration and the like. Thus, it is not possible to specify an exact amount for every composition. However, an appropriate amount can be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein.

[0113] Parenteral administration of the composition, if used, is generally characterized by injection. Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution of suspension in liquid prior to injection, or as emulsions. A more recently revised approach for parenteral administration involves use of a slow release or sustained release system such that a constant dosage is maintained. See, e.g., U.S. Patent No. 3,610,795, which is incorporated by reference herein.

[0114] The materials may be in solution, suspension (for example, incorporated into microparticles, liposomes, or cells). These may be targeted to a particular cell type via chimeric antigen receptor. The follow ing references are examples of the use of this technology7to target specific proteins to tumor tissue (Senter, et al., Bioconjugate Chem., 2:447-451, (1991); Bagshawe, K.D , Br. J. Cancer, 60:275-281, (1989); Bagshawe, et al., Br. J. Cancer, 58:700- 703, (1988); Senter, et al., Bioconjugate Chem., 4:3-9, (1993); Battelli, et al., Cancer Immunol. Immunother ., 35:421-425, (1992); Pietersz and McKenzie, Immunolog. Reviews, 129:57-80, (1992); and Roffler, et al., Biochem. Pharmacol, 42:2062-2065, (1991)). Vehicles such as "stealth" and other antibody conjugated liposomes (including lipid mediated drug targeting to colonic carcinoma), receptor mediated targeting of DNA through cell specific ligands, lymphocyte directed tumor targeting, and highly specific therapeutic retroviral targeting of murine glioma cells in vivo. The following references are examples of the use of this technology to target specific proteins to tumor tissue (Hughes et al., Cancer Research, 49:6214-6220, (1989); and Litzinger and Huang, Biochimica et Biophysica Acta, 1104: 179-187, (1992)). In general, receptors are involved in pathways of endocytosis, either constitutive or ligand induced. These receptors cluster in clathrin-coated pits, enter the cell via clathrin-coated vesicles, pass through an acidified endosome in which the receptors are sorted, and then either recycle to the cell surface, become stored intracellularly, or are degraded in lysosomes. The internalization pathways serve a variety of functions, such as nutrient uptake, removal of activated proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, dissociation and degradation of ligand, and receptor-level regulation. Many receptors follow more than one intracellular pathway, depending on the cell ty pe, receptor concentration, type of ligand, ligand valency, and ligand concentration. Molecular and cellular mechanisms of receptor-mediated endocytosis has been reviewed (Brown and Greene, DNA and Cell Biology 10:6, 399-409 (1991)). a) Pharmaceutically Acceptable Carriers

[0115] The compositions, including chimeric antigen receptor immune cells (including, but not limited to CAR T cells, CAR B cells, CAR NK cells, CAR NK T cells, and / or CARMAC cells), can be used therapeutically in combination with a pharmaceutically acceptable carrier.

[0116] Suitable carriers and their formulations are described in Remington: The Science and Practice of Pharmacy (19th ed.) ed. A.R. Gennaro, Mack Publishing Company, Easton, PA 1995. Typically, an appropriate amount of a pharmaceutically-acceptable salt is used in the formulation to render the formulation isotonic. Examples of the pharmaceutically-acceptable carrier include, but are not limited to, saline, Ringer's solution and dextrose solution. The pH of the solution is preferably from about 5 to about 8, and more preferably from about 7 to about 7.5. Further carriers include sustained release preparations such as semipermeable matrices of solid hydrophobic polymers containing the CAR immune cell, which matrices are in the form of shaped articles, e.g., films, liposomes or microparticles. It will be apparent to those persons skilled in the art that certain carriers may be more preferable depending upon, for instance, the route of administration and concentration of composition being administered.

[0117] Pharmaceutical carriers are known to those skilled in the art. These most typically would be standard carriers for administration of drugs to humans, including solutions such as sterile water, saline, and buffered solutions at physiological pH. The compositions can be administered intramuscularly or subcutaneously. Other compounds will be administered according to standard procedures used by those skilled in the art.

[0118] Pharmaceutical compositions may include carriers, thickeners, diluents, buffers, preservatives, surface active agents and the like in addition to the molecule of choice. Pharmaceutical compositions may also include one or more active ingredients such as antimicrobial agents, antiinflammatory agents, anesthetics, and the like.

[0119] The pharmaceutical composition may be administered in a number of ways depending on whether local or systemic treatment is desired, and on the area to be treated. Administration may be topically (including ophthalmically, vaginally, rectally, intranasally), orally, by inhalation, or parenterally, for example by intravenous drip, subcutaneous, intraperitoneal or intramuscular injection. The disclosed CAR immune cells can be administered intravenously, intraperitoneally, intramuscularly, subcutaneously, intracavity, or transdermally. In one aspect disclosed herein are methods for treating, inhibiting, reducing, decreasing, ameliorating, and / or preventing a cancer and / or metastasis, wherein the CAR immune cell is in a pharmaceutically acceptable composition. In some specific aspects, the CAR immune cell is administered systemically. In other aspects, the CAR immune cell is administered intratumorally, intravenously, intradermally, intratumorally, intramuscularly, intraperitoneally, subcutaneously, or locally.

[0120] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like. Formulations for topical administration may include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the tike may be necessary or desirable.

[0121] Compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets, or tablets. Thickeners, flavorings, diluents, emulsifiers, dispersing aids or binders may be desirable..

[0122] Some of the compositions may potentially be administered as a pharmaceutically acceptable acid- or base- addition salt, formed by reaction with inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid, or by reaction with an inorganic base such as sodium hydroxide, ammonium hydroxide, potassium hydroxide, and organic bases such as mono-, di-, trialkyl and aryl amines and substituted ethanolamines. b) Therapeutic Uses

[0123] Effective dosages and schedules for administering the compositions may be determined empirically, and making such determinations is within the skill in the art. The dosage ranges for the administration of the compositions are those large enough to produce the desired effect in which the symptoms of the disorder are effected. The dosage should not be so large as to cause adverse side effects, such as unwanted cross-reactions, anaphylactic reactions, and the tike. Generally, the dosage will vary' with the age, condition, sex and extent of the disease in the patient, route of administration, or whether other drugs are included in the regimen, and can be determined by one of skill in the art. The dosage can be adjusted by the individual physician in the event of any counterindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products. For example, guidance in selecting appropriate doses for CAR immune cells can be found in the literature. A typical daily dosage of the CAR immune cell used alone might range from about 1 pg / kg to up to 100 mg / kg of body weight or more per day, depending on the factors mentioned above.

[0124] C. Method of treating cancer

[0125] The disclosed compositions can be used to treat any disease where uncontrolled cellular proliferation occurs such as cancers. A representative but non-hmiting list of cancers that the disclosed compositions can be used to treat is the following: lymphomas such as B cell lymphoma and T cell lymphoma; mycosis fungoides; Hodgkin’s Disease; myeloid leukemia (including, but not limited to acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), and chronic myeloid leukemia (CML)); bladder cancer; brain cancer; nervous system cancer; head and neck cancer; squamous cell carcinoma of head and neck; renal cancer; lung cancers such as small cell lung cancer, non-small cell lung carcinoma (NSCLC), lung squamous cell carcinoma (LUSC). and Lung Adenocarcinomas (LU AD); neuroblastoma / glioblastoma; ovarian cancer; pancreatic cancer; prostate cancer; skin cancer; hepatic cancer; melanoma; squamous cell carcinomas of the mouth, throat, larynx, and lung; cervical cancer; cervical carcinoma; breast cancer including, but not limited to triple negative breast cancer; genitourinary’ cancer; pulmonary’ cancer; esophageal carcinoma; head and neck carcinoma; large bowel cancer; hematopoietic cancers; testicular cancer; and colon and rectal cancers or other malignancies characterized yvith GARP+ Tregs.

[0126] It is understood and herein contemplated that the disclosed CARs can work not only bydirecting an immune cell to a GARP+ cancer cell, but also by interacting with Tregs in the tumor microenvironment. In essence, CD4+ regulatory T cells marked by expression of a master transcription factor Foxp3 is critically important in preventing peripheral tolerance. Both mice and human yvith Foxp3 mutation suffers from severe T cell mediated autoimmune diseases and death. The immune tolerance function of Tregs in the homeostatic state is thought to be mediated by the ability of Tregs to suppress priming of self reactive T cells via CTLA4, competing for IL-2 as well as other still yet unidentified mechanisms. In inflammatory conditions including severe infection and cancer, regulatory’ T cells are further activated to endow much more potent suppressive function. These so called activated Tregs (as opposed to resting Tregs) express a new set of molecules intracellularly as well as on the cell surface. It has been found that GARP is expressed by activated Tregs not resting Tregs. The level of GARP can be induced by T cell receptor activation. Furthermore, GARP+ Tregs have been shoyvn to accumulate in the tumor microenvironment to suppress anti-cancer immunity7. The difference in GARP expression by activated Tregs not resting Tregs created an opportunity' for us to target the former selectively. Indeed, we have generated GARP-targeted antibody PIIO-1, and made T cells that express chimeric antigen receptor (CAR) against GARP utilizing PIIO-1 ScFV. In mice, if one categorically depletes Tregs genetically, mice develop fatal inflammatory conditions. However, we have found that GARP directed CAR-T cells only deplete GARP+ Tregs in mice. These animals continue to have GARP- Tregs which are apparently sufficient to maintain tolerance and thus do not develop severe autoimmune diseases. In short, GARP- targeted approach is promised to improve T cell immunity against cancer yvithout compromising tolerance to self antigens through selective elimination of activated Tregs, leaving homeostatic resting Tregs for tolerance untouched.

[0127] In one aspect, disclosed herein are methods of treating, inhibiting, reducing, decreasing, ameliorating, and / or preventing a cancer and / or metastasis (such as, for example, a GARP positive (GARP+) cancer and / or cancer comprising GARP+ Tregs in the tumor microenvironment, including, but not limited to a glioblastoma, bladder cancer, breast cancer (such as, for example, triple negative breast cancer), or leukemia (such as, for example, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic ly mphocytic leukemia (CLL), and chronic myeloid leukemia (CML) or other malignancies characterized with GARP+ Tregs) in a subject comprising administering to the subject an effective amount of the CAR immune cell (including, but not limited to a T cell, B cell, NK cell, NK T cell, or macrophage) in a subject comprising administering to the subject any of the anti-GARP chimeric antigen receptor immune cells disclosed herein. For example, in one aspect, disclosed herein are methods of treating, inhibiting, reducing, decreasing, ameliorating, and / or preventing a cancer and / or metastasis (such as, for example, a GARP positive (GARP+) cancer and / or cancer comprising GARP+ T regulator (Treg) cells in the tumor microenvironment including, but not limited to a glioblastoma, bladder cancer, breast cancer (such as, for example, triple negative breast cancer), or leukemia (such as. for example, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), and chronic myeloid leukemia (CML) or other malignancies characterized with GARP+ Tregs) in a subject comprising administering to the subject an effective amount of the CAR immune cell (including, but not limited to a T cell, B cell, NK cell. NK T cell, or macrophage)) in a subject comprising administering to the subject a chimeric antigen receptor (CAR) immune cell comprising an antiglycoprotein A repetitions predominant (GARP) binding molecule. In some aspects, the CAR further comprises a CD28, 41BB, 0X40, Myd88, ICOS, CD2, CD226, BAFF-R, TACI, or IL2RB signaling domain.

[0128] As noted throughout this document, a major concern with targeting GARP via CAR-T cells is potential for on-target, off-tumor toxicity, possibly causing downregulation of regulatory T cells and platelets that assist in peripheral immune tolerance thus leading to autoimmune disease. However, we have found that GARP directed CAR-T cells only deplete GARP+ Tregs in mice. These animals continue to have GARP- Tregs which are apparently sufficient to maintain tolerance and thus do not develop severe autoimmune diseases. Additionally, targeting Tregs in the TME is a valid treatment strategy in other solid tumors, as it will improve effector T cell infiltration and anti-tumor immune activity. Accordingly, it is understood and herein contemplated that GARP negative caners can be treated by using anti-GARP CAR immune cells to modulate GARP+ Tregs in the TME thereby reducing Treg immune suppression. Thus, in one aspect, disclosed herein are methods of treating, inhibiting, reducing, decreasing, ameliorating, and / or preventing a GARP- cancer and / or malignancy in a subject comprising administering to the subject any of the GARP targeting CAR immune cells disclosed herein, wherein the TME of the cancer and / or metastasis comprising GARP+ Tregs in the TME.

[0129] Also disclosed herein are methods of treating, inhibiting, reducing, decreasing, ameliorating, and / or preventing a cancer and / or metastasis, wherein the anti-GARP binding molecule of the CAR comprises i) a variable heavy chain (VH) complementarity determining region 1 (CDR1), CDR2, and CDR3 as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively and ii) a variable light chain (VL) complementarity determining region 1 (CDR1), CDR2, and CDR3 as set forth in SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, respectively.

[0130] In one aspect, disclosed herein are methods of treating, inhibiting, reducing, decreasing, ameliorating, and / or preventing a cancer and / or metastasis, wherein the anti-GARP binding molecule of the CAR comprises a Vn domain at least about 80%, 90%, 95%, 98% or 99% identical to the VH domain of the humanized PIIO-1 (huPIIO-1) antibodies as set forth in SEQ ID NO: 7, 8, 9 or 10 and / or a VL domain at least about 80% 90%. 95%. 98% or 99% identical to the VL domain of the huPIIO-1 antibodies as set forth in SEQ ID NO: 11, 12, or 13. In one aspect, the anti-GARP binding molecule comprises a VH domain as set forth in SEQ ID NO: 7, 8, 9, or 10 and / or a VL domain as set forth in SEQ ID NO: 11, 12 or 13.

[0131] Also disclosed herein are methods of treating, inhibiting, reducing, decreasing, ameliorating, and / or preventing a cancer and / or metastasis, wherein the anti-GARP binding molecule comprises a VH domain as set forth in SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 12 (VH1 VL1), a VH domain as set forth in SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 13 (VH1VL2), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 12 (VH2VL1), SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 11 (VH1VL3), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 13 (VH2VL2), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 11 (VH2VL3), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 12 (VH3VL1), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 13 (VH3VL2), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 11 (VH3VL3), a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 12 (VH4VL1), a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 13 (VH4VL2), or a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 11 (VH4VL3).

[0132] Again, as noted throughout this document, a major concern with targeting GARP via CAR-T cells is potential for on-target, off-tumor toxicity, possibly causing downregulation of regulatory T cells and platelets that assist in peripheral immune tolerance thus leading to autoimmune disease. However, we have found that GARP directed CAR-T cells only deplete GARP+ Tregs in mice. These animals continue to have GARP- Tregs which are apparently sufficient to maintain tolerance and thus do not develop severe autoimmune diseases. Additionally, targeting Tregs in the TME is a valid treatment strategy in other solid tumors, as it will improve effector T cell infiltration and anti-tumor immune activity. Thus, the disclosed anti-GARP CAR immune cells can also modulate the immunosuppressive Tregs in a TME.

[0133] Thus, also disclosed herein are methods of modulating, reducing, inhibiting, decreasing, and / or suppressing immunosuppressive T regulatory (Treg) cells (including, but not limited to GARP+ Tregs) in a tumor microenvironment (TME) of a cancer (such as, for example, a GARP positive (GARP+) cancer and / or cancer comprising GARP+ T regulator cells in the tumor microenvironment, including, but not limited to a glioblastoma, bladder cancer, breast cancer, or leukemia or other malignancies characterized with GARP+ Tregs) in a subject, comprising administering to the subject a therapeutically effective amount of the CAR immune cell (including, but not limited to a T cell, B cell, NK cell, NK T cell, or macrophage). For example, in one aspect, disclosed herein are methods of modulating, reducing, inhibiting, decreasing, and / or suppressing immunosuppressive T regulatory (Treg) cells (including, but not limited to GARP+ Tregs) in a tumor microenvironment (TME) of a cancer such as, for example, a GARP positive (GARP+) cancer and / or cancer comprising GARP+ T regulator cells in the tumor microenvironment, including, but not limited to a glioblastoma, bladder cancer, breast cancer, or leukemia or other malignancies characterized with GARP+ Tregs) in a subject comprising administering to the subject a therapeutically effective amount of a chimeric antigen receptor (CAR) immune cell (including, but not limited to a T cell, B cell. NK cell, NK T cell, or macrophage) comprising an anti-glycoprotein A repetitions predominant (GARP) binding molecule. In some aspects, the CAR further comprises a CD28, 41BB, 0X40, Myd88, ICOS, CD2, CD226, BAFF-R, TACI, or IL2RB signaling domain.

[0134] In one aspect disclosed herein are methods of modulating, reducing, inhibiting, decreasing, and / or suppressing immunosuppressive T regulatory (Treg) cells in a tumor microenvironment (TME) of a cancer, wherein the anti-GARP binding molecule comprises i) a variable heavy chain (VH) complementarity' determining region 1 (CDR1), CDR2, and CDR3 as set forth in SEQ ID NO: 1. SEQ ID NO: 2, and SEQ ID NO: 3. respectively and ii) a variable light chain (VL) complementarity determining region 1 (CDR1), CDR2, and CDR3 as set forth in SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, respectively.

[0135] Also disclosed herein are methods of modulating, reducing, inhibiting, decreasing, and / or suppressing immunosuppressive T regulatory (Treg) cells in a tumor microenvironment (TME) of a cancer, wherein the anti-GARP binding molecule comprises a VH domain at least about 80%, 90%, 95%, 98% or 99% identical to the VH domain of the humanized PIIO-1 (huPIIO-1) antibodies as set forth in SEQ ID NO: 7, 8, 9 or 10 and / or a VL domain at least about 80% 90%, 95%, 98% or 99% identical to the VL domain of the huPIIO-1 antibodies as set forth in SEQ ID NO: 11, 12, or 13. In one aspect, the anti-GARP binding molecule comprises a VH domain as set forth in SEQ ID NO: 7, 8, 9, or 10 and / or a VL domain as set forth in SEQ ID NO: 11, 12 or 13.

[0136] In one aspect disclosed herein are methods of modulating, reducing, inhibiting, decreasing, and / or suppressing immunosuppressive T regulatory (Treg) cells in a tumor microenvironment (TME) of a cancer, wherein the anti-GARP binding molecule comprises a VH domain as set forth in SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 12 (VH1VL1), a VH domain as set forth in SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 13 (VH1VL2), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 12 (VH2VL1), SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 1 1 (VH1VL3), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 13 (VH2VL2), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 11 (VH2VL3), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 12 (VH3VL1). a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 13 (VH3VL2), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 11 (VH3VL3), a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 12 (VH4VL1), a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 13 (VH4VL2), or a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 11 (VH4VL3).

[0137] In one aspect disclosed herein are methods for treating, inhibiting, reducing, decreasing, ameliorating, and / or preventing a cancer and / or metastasis and , methods of modulating, reducing, inhibiting, decreasing, and / or suppressing immunosuppressive T regulator)’ (Treg) cells in a tumor microenvironment (TME) of a cancer wherein the CAR immune cell is in a pharmaceutically acceptable composition. In some specific aspects, the CAR immune cell is administered systemically. In other aspects, the CAR immune cell is administered intravenously, intradermally, intratumorally, intramuscularly, intraperitoneally, subcutaneously, or locally.

[0138] It is understood and herein contemplated that the disclosed treatment regimens can used alone or in combination with any anti-cancer therapy known in the art including, but not limited to Abemaciclib, Abiraterone Acetate, ABITREXATE® (Methotrexate), ABRAXANE® (Paclitaxel Albumin-stabilized Nanoparticle Formulation), ABVD, ABVE, ABVE-PC, AC, AC- T, ADCETRIS® (Brentuximab Vedotin), ADE, Ado-Trastuzumab Emtansine, ADRIAMYCIN® (Doxorubicin Hydrochloride), Afatinib Dimaleate, AFINITOR® (Everolimus), AKYNZEO® (Netupitant and Palonosetron Hydrochloride). ALDARA® (Imiquimod), Aldesleukin, ALECENSA® (Alectinib), Alectinib, Alemtuzumab, ALIMTA® (Pemetrexed Disodium), ALIQOPA® (Copanlisib Hydrochloride), ALKERAN™ for Injection (Melphalan Hydrochloride), ALKERAN™ Tablets (Melphalan), ALOXI® (Palonosetron Hydrochloride), ALUNBRIG® (Brigatinib), AMBOCHLORIN® (Chlorambucil), AMBOCLORIN® (Chlorambucil), Amifostine. Aminolevulinic Acid, Anastrozole, Aprepitant, AREDIA® (Pamidronate Disodium), ARIMIDEX® (Anastrozole), AROMASIN® (Exemestane),ARRANON® (Nelarabine), Arsenic Trioxide, ARZERRA® (Ofatumumab), Asparaginase Erwinia chrysanthemi, Atezolizumab. AVASTIN® (Bevacizumab), Avelumab, Axitinib, Azacitidine, BAVENCIO® (Avelumab), BEACOPP, BECENUM® (Carmustine), BELEODAQ® (Belinostat), Belinostat, Bendamustine Hydrochloride, BEP, BESPONSA® (Inotuzumab Ozogamicin) , Bevacizumab, Bexarotene, BEXXAR® (Tositumomab and Iodine I 131 Tositumomab), Bicalutamide, BICNU® (Carmustine), Bleomy cin, Blinatumomab, BLINCYTO® (Blinatumomab), Bortezomib, BOSULIF® (Bosutinib), Bosutinib, Brentuximab Vedotin, Brigatinib, BuMeL Busulfan. BUSULFEX® (Busulfan), Cabazitaxel. CABOMETYX® (Cabozantmib-S-Malate), Cabozantinib-S-Malate, CAF, CAMPATH® (Alemtuzumab), CAMPTOSAR® (Irinotecan Hydrochloride), Capecitabine, CAPOX, CARAC® (Fluorouracil— Topical), Carboplatin. CARBOPLATIN-TAXOL, Carfilzomib, CARMUBRIS® (Carmustine), Carmustine. Carmustine Implant, CASODEX® (Bicalutamide), CEM, Ceritinib, CERUBIDINE® (Daunorubicin Hydrochloride), CERVARIX® (Recombinant HPV Bivalent Vaccine), Cetuximab, CEV, Chlorambucil, CHLORAMBUCIL-PREDNISONE, CHOP, Cisplatin, Cladribine, CLAFEN® (Cyclophosphamide), Clofarabine, CLOFAREX® (Clofarabine), CLOLAR® (Clofarabine), CMF. Cobimetinib. COMETRIQ® (Cabozantinib-S- Malate), Copanlisib Hydrochloride, COPDAC, COPP, COPP-ABV, COSMEGEN® (Dactinomycin), COTELLIC® (Cobimetinib), Crizotinib, CVP, Cyclophosphamide, CYFOS® (Ifosfamide), CYRAMZA® (Ramucirumab), Cytarabine, Cytarabine Liposome, CYTOSAR- U® (Cytarabine), CYTOXAN® (Cyclophosphamide), Dabrafenib. Dacarbazine. DACOGEN® (Decitabine), Dactinomycin, Daratumumab, DARZALEX® (Daratumumab), Dasatinib, Daunorubicin Hydrochloride, Daunorubicin Hydrochloride and Cytarabine Liposome, Decitabine, Defibrotide Sodium. DEFITELIO® (Defibrotide Sodium), Degarelix, Denileukin Diftitox, Denosumab, DEPOCYT® (Cytarabine Liposome), Dexamethasone, Dexrazoxane Hydrochloride, Dinutuximab, Docetaxel, DOXIL® (Doxorubicin Hydrochloride Liposome), Doxorubicin Hydrochloride, Doxorubicin Hydrochloride Liposome, DOX-SL® (Doxorubicin Hydrochloride Liposome), DTIC-DOME® (Dacarbazine), Durvalumab, EFUDEX® (Fluorouracil— Topical), ELITEK® (Rasburicase), ELLENCE® (Epirubicin Hydrochloride). Elotuzumab, ELOXATIN® (Oxaliplatin), Eltrombopag Olamine, EMEND® (Aprepitant), EMPLICITI® (Elotuzumab), Enasidenib Mesylate, Enzalutamide, Epirubicin Hydrochloride , EPOCH, ERBITUX® (Cetuximab), Eribulin Mesylate, ERIVEDGE® (Vismodegib), Erlotinib Hydrochloride. ERWINAZE® (Asparaginase Erwinia chrysanthemi), ETHYOL® (Amifostine). Etopophos ETOPOPHOS® (Etoposide Phosphate). Etoposide, Etoposide Phosphate.

[0139] EV ACET® (Doxorubicin Hydrochloride Liposome), Everolimus, EVTSTA® (Raloxifene Hydrochloride), EVOMELA® (Melphalan Hydrochloride), Exemestane, 5-FU® (Fluorouracil Injection), 5-FU® (Fluorouracil— Topical), FARESTON® (Toremifene), FARYDAK® (Panobinostat). FASLODEX® (Fulvestrant), FEC, FEMARA® (Letrozole), Filgrastim, FLUDARA® (Fludarabine Phosphate), Fludarabine Phosphate, FLUOROPLEX® (Fluorouracil - -Topical), Fluorouracil Injection, Fluorouracil— Topical, Flutamide, FOLEX® (Methotrexate), FOLEX PFS® (Methotrexate), FOLFIRI, FOLFIRI-BEVACIZUMAB, FOLFIRI- CETUXIMAB, FOLFIRINOX, FOLFOX, FOLOTYN® (Pralatrexate), FU-LV, Fulvestrant, GARDAS1L® (Recombinant HPV Quadrivalent Vaccine), GARD AS IL 9® (Recombinant HPV Nonaval ent Vaccine), GAZYVA® (Obinutuzumab), Gefitinib, Gemcitabine Hydrochloride, GEMCITABINE-CISPLATIN, GEMCITABINE-OXALIPLATIN, Gemtuzumab Ozogamicin, GEMZAR® (Gemcitabine Hydrochloride), GILOTRIF® (Afatinib Dimaleate), GLEEVEC® (Imatinib Mesylate), GLIADEL® (Carmustine Implant), GLIADEL WAFER® (Carmustine Implant), Glucarpidase, Goserelin Acetate, HALAVEN® (Eribulin Mesylate), HEMANGEOL® (Propranolol Hydrochloride), HERCEPTIN® (Trastuzumab), HPV Bivalent Vaccine, Recombinant, HPV Nonavalent Vaccine, Recombinant, HPV Quadrivalent Vaccine, Recombinant, HYCAMTIN® (Topotecan Hydrochloride), HYDREA® (Hydroxyurea), Hydroxyurea, Hyper-CVAD, IBRANCE® (Palbociclib), Ibritumomab Tiuxetan, Ibrutinib, ICE, ICLUSIG® (Ponatinib Hydrochloride), IDAMYCIN® (Idarubicin Hydrochloride), Idarubicin Hydrochloride, Idelalisib, IDHIFA® (Enasidenib Mesylate), IFEX® (Ifosfamide), Ifosfamide, 1F0SFAMIDUM® (Ifosfamide), IL-2 (Aldesleukin), Imatinib Mesylate. IMBRUV1CA® (Ibrutinib), IMFINZI® (Durvalumab), Imiquimod, IMLYGIC® (Talimogene Laherparepvec), INLYTA® (Axitinib), Inotuzumab Ozogamicin, Interferon Alfa-2b, Recombinant, Interleukin-2 (Aldesleukin), INTRON A® (Recombinant Interferon Alfa-2b), Iodine 1 131 Tositumomab and Tositumomab, Ipilimumab, IRES SA® (Gefitinib), Irinotecan Hydrochloride. Irinotecan Hydrochloride Liposome, ISTODAX® (Romidepsin), Ixabepilone, Ixazomib Citrate, IXEMPRA® (Ixabepilone), JAKAFI® (Ruxolitmib Phosphate), JEB, JEVTANA® (Cabazitaxel), KADCYLA® (Ado-Trastuzumab Emtansine), KEOXIFENE® (Raloxifene Hydrochloride), KEPIVANCE® (Palifermin). KEYTRUDA® (Pembrolizumab), KISQALI® (Ribociclib), KYMRIAH® (Tisagenlecleucel), KYPROLIS® (Carfilzomib), Lanreotide Acetate, Lapatinib Ditosylate, LARTRUVO® (Olaratumab), Lenalidomide, Lenvatinib Mesylate, LENVIMA® (Lenvatinib Mesylate), Letrozole, Leucovorin Calcium, LEUKERAN® (Chlorambucil), Leuprolide Acetate. LEUSTATIN® (Cladribine), LEVULAN® (Aminolevulinic Acid), LINFOLIZIN® (Chlorambucil), LIPODOX® (Doxorubicin Hydrochloride Liposome), Lomustine, LONSURF® (Trifluridine and Tipiracil Hydrochloride), LUPRON® (Leuprolide Acetate), LUPRON DEPOT® (Leuprolide Acetate), LUPRON DEPOT-PED® (Leuprolide Acetate), LYNPARZA® (Olaparib), MARQIBO® (Vincristine Sulfate Liposome), MATULANE® (Procarbazine Hydrochloride), Mechlorethamine Hydrochloride, Megestrol Acetate, MEKINIST® (Trametinib), Melphalan, Melphalan Hydrochloride, Mercaptopurine, Mesna, MESNEX® (Mesna), METHAZOLASTONE® (Temozolomide), Methotrexate, METHOTREXATE LPF® (Methotrexate), Methylnaltrexone Bromide. MEXATE® (Methotrexate), MEXATE-AQ® (Methotrexate), Midostaurin, Mitomycin C, Mitoxantrone Hydrochloride. M1T0ZYTREX® (Mitomycin C). MOPP, MOZOBIL® (Plerixafor), MUSTARGEN® (Mechlorethamine Hydrochloride) , MUTAMYCIN® (Mitomycin C), MYLERAN® (Busulfan), MYLOSAR® (Azacitidine), MYLOTARG® (Gemtuzumab Ozogamicin), NANOPARTICLE PACLITAXEL® (Paclitaxel Albumin-stabilized Nanoparticle Formulation), NAVELBINE® (Vinorelbine Tartrate), Necitumumab, Nelarabine, NEOSAR® (Cyclophosphamide), Neratinib Maleate, NERLYNX® (Neratinib Maleate), Netupitant and Palonosetron Hydrochloride, NEULASTA® (Pegfilgrastim), NEUPOGEN® (Filgrastim), NEXAVAR® (Sorafenib Tosylate), NILANDRON® (Nilutamide), Nilotinib, Nilutamide, NINLARO® (Ixazomib Citrate), Niraparib Tosylate Monohydrate, Nivolumab, NOLVADEX® (Tamoxifen Citrate), NPLATE® (Romiplostim), Obinutuzumab, ODOMZO® (Sonidegib), OEPA, Ofatumumab, OFF, Olaparib, Olaratumab, Omacetaxine Mepesuccinate, ONCASPAR® (Pegaspargase), Ondansetron Hydrochloride. 0N1VYDE® (Irinotecan Hydrochloride Liposome), ONTAK® (Denileukin Diftitox), OPDIVO® (Nivolumab), OPP A, Osimertinib, Oxaliplatin, Paclitaxel, Paclitaxel Albumin-stabilized Nanoparticle Formulation, PAD, Palbociclib, Palifermin, Palonosetron Hydrochloride. Palonosetron Hydrochloride and Netupitant, Pamidronate Disodium, Panitumumab, Panobinostat. PARAPLAT® (Carboplatin), PARAPLATIN® (Carboplatin), Pazopanib Hydrochloride, PCV, PEB, Pegaspargase, Pegfilgrastim, Peginterferon Alfa-2b, PEG-INTRON® (Peginterferon Alfa-2b), Pembrolizumab, Pemetrexed Disodium, PERJETA® (Pertuzumab), Pertuzumab, PLATINOL® (Cisplatin), PLATINOL-AQ® (Cisplatin), Plerixafor, Pomalidomide, POMALYST® (Pomalidomide), Ponatinib Hydrochloride, PORTRAZZA® (Necitumumab), Pralatrexate, Prednisone, Procarbazine Hydrochloride, PROLEUKIN® (Aldesleukin), PROLIA® (Denosumab), PROMACTA® (Eltrombopag Olamine), Propranolol Hydrochloride, PROVENGE® (Sipuleucel-T), PURINETHOL® (Mercaptopurine), PURIXAN® (Mercaptopurine), Radium 223 Dichloride, Raloxifene Hydrochloride. Ramucirumab. Rasburicase. R-CHOP, R-CVP, Recombinant Human Papillomavirus (HPV) Bivalent Vaccine, Recombinant Human Papillomavirus (HPV) Nonaval ent Vaccine, Recombinant Human Papillomavirus (HPV) Quadrivalent Vaccine, Recombinant Interferon Alfa-2b, Regorafenib, RELISTOR® (Methylnaltrexone Bromide), R- EPOCH, REVLIMID® (Lenalidomide), RHEUMATREX® (Methotrexate). Ribociclib. R-ICE. RITUXAN® (Rituximab), RITUXAN HYCELA® (Rituximab and Hyaluronidase Human), Rituximab, Rituximab and , Hyaluronidase Human, ,Rolapitant Hydrochloride, Romidepsin, Romiplostim, RUBIDOMYCIN® (Daunorubicin Hydrochloride), RUB RAC A® (Rucaparib Camsylate), Rucaparib Camsylate, Ruxolitinib Phosphate, RYDAPT® (Midostaurin), Sclerosol Intrapleural Aerosol (Talc), Siltuximab. Sipuleucel-T. SOMATULINE DEPOT® (Lanreotide Acetate), Sonidegib, Sorafenib Tosylate, SPRYCEL® (Dasatinib), STANFORD V, Sterile Talc Powder (Talc), STERITALC® (Talc), STIVARGA® (Regorafenib), Sunitinib Malate, SUTENT® (Sunitinib Malate), SYLATRON® (Peginterferon Alfa-2b), SYLVANT® (Siltuximab). Synribo SYNRIBO® (Omacetaxine Mepesuccinate), TABLOID® (Thioguanine), TAC, TAFINLAR® (Dabrafenib), TAGRISSO® (Osimertinib), Talc, Talimogene Laherparepvec, Tamoxifen Citrate, TARABINE PFS® (Cytarabine), TARCEVA® (Erlotinib Hydrochloride), TARGRETIN® (Bexarotene), TASIGNA® (Nilotinib), TAXOL® (Paclitaxel), TAXOTERE® (Docetaxel), TECENTRIQ® (Atezolizumab). TEMODAR® (Temozolomide). Temozolomide, Temsirolimus, Thalidomide, THALOMID® (Thalidomide), Thioguanine, Thiotepa, Tisagenlecleucel, TOLAK® (Fluorouracil— Topical), Topotecan Hydrochloride, Toremifene, TORISEL® (Temsirolimus), Tositumomab and Iodine I 131 Tositumomab, TOTECT® (Dexrazoxane Hydrochloride), TPF, Trabectedin. Trametinib, Trastuzumab. TREANDA® (Bendamustine Hydrochloride), Trifluridine and Tipiracil Hydrochloride, TRISENOX® (Arsenic Trioxide), TYKERB® (Lapatinib Ditosylate) , UNITUXIN® (Dinutuximab), Uridine Triacetate, VAC, Vandetanib, VAMP, VARUBI® (Rolapitant Hydrochloride), VECTIBIX® (Panitumumab), VelP, VELBAN® (Vinblastine Sulfate), VELCADE® (Bortezomib), VELSAR® (Vinblastine Sulfate), Vemurafenib, VENCLEXTA® (Venetoclax), Venetoclax, VERZENIO® (Abemaciclib), VIADUR® (Leuprolide Acetate), VID AZA® (Azacitidine), Vinblastine Sulfate, VINCASAR PFS® (Vincristine Sulfate). Vincristine Sulfate, Vincristine Sulfate Liposome. Vinorelbine Tartrate, VIP. Vismodegib. VISTOGARD® (Undine Triacetate), VORAXAZE® (Glucarpidase), Vonnostat, VOTRIENT® (Pazopanib Hydrochloride), VYXEOS® (Daunorubicin Hydrochloride and Cytarabine Liposome), WELLCOVORIN® (Leucovorin Calcium), XALKORI® (Crizotinib), XELODA® (Capecitabine), XELIRI. XELOX. XGEVA® (Denosumab), XOFIGO® (Radium 223 Dichloride), XT ANDI® (Enzalutamide), YERVOY® (Ipilimumab), YONDELIS® (Trabectedin), ZALTRAP® (Ziv-Aflibercept), ZARXIO® (Filgrastim), ZEJULA® (Niraparib Tosylate Monohydrate), ZELBORAF® (Vemurafenib), ZEVALIN® (Ibritumomab Tiuxetan), ZINECARD® (Dexrazoxane Hy drochloride), Ziv-Aflibercept, ZOFRAN® (Ondansetron Hydrochloride), ZOLADEX® (Goserelin Acetate), Zoledronic Acid, ZOLINZA® (Vorinostat), ZOMETA® (Zoledronic Acid), ZYDELIG® (Idelalisib), ZYKADIA® (Ceritinib), and / or ZYTIGA® (Abiraterone Acetate). The treatment methods can include or further include checkpoint inhibitors including, but are not limited to antibodies that block PD-1 (such as, for example, Nivolumab (BMS-936558 or MDX1106), pembrolizumab, cemiplimab , CT-011, MK- 3475), PD-L1 (such as, for example, atezolizumab, avelumab, durvaiumab. MDX-1105 (BMS- 936559), MPDL3280A, or MSB0010718C), PD-L2 (such as, for example, rHIgM12B7), CTLA- 4 (such as, for example, Ipilimumab (MDX-010), Tremelimumab (CP-675,206)), IDO, B7-H3 (such as, for example, MGA271, MGD009, omburtamab), B7-H4, B7-H3, T cell immunoreceptor with Ig and IT1M domains (TIGIT)(such as, for example BMS-986207. OMP- 313M32, MK-7684, AB-154, ASP-8374, MTIG7192A, or PVSRIPO), CD96, B- and T- lymphocyte attenuator (BTLA), V-doraain Ig suppressor of T cell activation (VISTA)(such as, for example, JNJ-61610588, CA-170), TIM3 (such as, for example, TSR-022, MBG453, Sym023, INCAGN2390. LY3321367. BMS-986258. SHR-1702, RO7121661), LAG-3 (such as, for example, BMS-986016, LAG525, MK-4280, REGN3767, TSR-033, BI754111, Sym022, FS118, MGD013, and Immutep). In some aspects the additional anticancer agent comprises a TGFp inhibitor (such as, for example, LY2157299, trabedersen, fresolimumab, LY2382770, lucanix, or PF-03446962).

[0140] Other factors that cause DNA damage have been used extensively to treat cancer include what are commonly known as y-rays, X-rays, and / or the directed delivery’ of radioisotopes to tumor cells. Other forms of DNA damaging factors are also contemplated, such as microwaves, proton beam irradiation (U.S. Patents 5,760,395 and 4,870,287), and UV-irradiation. It is most likely that all of these factors affect a broad range of damage on DNA, on the precursors of DNA, on the replication and repair of DNA. and on the assembly and maintenance of chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to single doses of 2000 to 6000 roentgens. Dosage ranges for radioisotopes vary’ widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells.

[0141] The skilled artisan will understand that additional immunotherapies may be used in combination or in conjunction with methods of the embodiments. In the context of cancer treatment, immunotherapeutics, generally, rely on the use of immune effector cells and molecules to target and destroy cancer cells. Rituximab (RITUXAN®) is such an example. The immune effector may be, for example, an antibody specific for some marker on the surface of a tumor cell. The antibody alone may serve as an effector of therapy or it may recruit other cells to actually affect cell killing. The antibody also may be conjugated to a drug or toxin (chemotherapeutic, radionuclide, ricin A chain, cholera toxin, pertussis toxin, etc.) and serve as a targeting agent. Alternatively, the effector may be a lymphocyte carrying a surface molecule that interacts, either directly or indirectly, with a tumor cell target. Various effector cells include cytotoxic T cells and NK cells

[0142] Antibody-drug conjugates have emerged as a breakthrough approach to the development of cancer therapeutics. Cancer is one of the leading causes of deaths in the world. Antibodydrug conjugates (ADCs) comprise monoclonal antibodies (MAbs) that are covalently linked to cell-killing drugs. This approach combines the high specificity of MAbs against their antigen targets with highly potent cytotoxic drugs, resulting in “armed” MAbs that deliver the payload (drug) to tumor cells with enriched levels of the antigen (Carter et al., 2008; Teicher 2014; Leal el al., 2014). Targeted deliver}' of the drug also minimizes its exposure in normal tissues, resulting in decreased toxicity and improved therapeutic index. The approval of two ADC drugs, ADCETRIS® (brentuximab vedotin) in 2011 and KADCYLA® (trastuzumab emtansine or T- DM1) in 2013 by FDA validated the approach. There are currently more than 30 ADC drug candidates in various stages of clinical trials for cancer treatment (Leal et al. , 2014). As antibody engineering and linker-payload optimization are becoming more and more mature, the discover^' and development of new ADCs are increasingly dependent on the identification and validation of new targets that are suitable to this approach (Teicher 2009) and the generation of targeting MAbs. Two criteria for ADC targets are upregulated / high levels of expression in tumor cells and robust internalization.

[0143] In one aspect of immunotherapy, the tumor cell must bear some marker that is amenable to targeting, / .<?., is not present on the majority of other cells. Many tumor markers exist and any of these may be suitable for targeting in the context of the present embodiments. Common tumor markers include CD20, carcinoembryonic antigen, tyrosinase (p97), gp68, TAG-72. HMFG, Sialyl Lewis Antigen, MucA, MucB, PLAP, laminin receptor, erb B, and pl 55. An alternative aspect of immunotherapy is to combine anticancer effects with immune stimulator}' effects. Immune stimulating molecules also exist including: cytokines, such as IL-2, IL-4, IL- 12, GM-CSF, gamma-IFN, chemokines. such as MIP-1, MCP-1, IL-8, and growth factors, such as FLT3 ligand.

[0144] Examples of immunotherapies currently under investigation or in use are immune adjuvants, e.g., Mycobacterium bovis, Plasmodium falciparum, dinitrochlorobenzene, and aromatic compounds (U.S. Patents 5,801,005 and 5,739,169; Hui and Hashimoto, 1998; Christodoulides et al., 1998); cytokine therapy, e.g.. interferons a, 0, and y, IL-1, GM-CSF, and TNF (Bukowski et al., 1998; Davidson et al., 1998; Hellstrand et al., 1998); gene therapy, e.g., TNF, IL-1, IL-2, and p53 (Qin et al., 1998; Austin-Ward and Villaseca, 1998; U.S. Patents 5,830,880 and 5,846,945); and monoclonal antibodies, e.g., anti-CD20, anti-ganglioside GM2, and anti-pl85 (Hollander, 2012; Hanibuchi et al., 1998; U.S. Patent 5,824,311). It is contemplated that one or more anti-cancer therapies may be employed with the antibody therapies described herein.

[0145] In some embodiments, the immunotherapy may be an immune checkpoint inhibitor. Immune checkpoints are molecules in the immune system that either turn up a signal (e.g., costimulatory molecules) or turn down a signal. Inhibitor}' checkpoint molecules that may be targeted by immune checkpoint blockade include adenosine A2A receptor (A2AR), B7-H3 (also known as CD276), B and T lymphocyte attenuator (BTLA), cytotoxic T-lymphocyte-associated protein 4 (CTLA-4, also known as CD152), indoleamine 2,3-dioxygenase (IDO), killer-cell immunoglobulin (KIR), lymphocyte activation gene-3 (LAG3). programmed death 1 (PD-1), T- cell immunoglobulin domain and mucin domain 3 (TIM-3) and V-domain Ig suppressor of T cell activation (VISTA). In particular, the immune checkpoint inhibitors target the PD-1 axis and / or CTLA-4. The immune checkpoint inhibitors may be drugs such as small molecules, recombinant forms of ligand or receptors, or, in particular, are antibodies, such as human antibodies (e.g., International Patent Publication W02015016718; Pardoll, Nat Rev Cancer, 12(4): 252-64, 2012; both incorporated herein by reference). Known inhibitors of the immune checkpoint proteins or analogs thereof may be used, in particular chimerized, humanized or human forms of antibodies may be used. As the skilled person will know, alternative and / or equivalent names may be in use for certain antibodies mentioned in the present disclosure. Such alternative and / or equivalent names are interchangeable in the context of the present invention. For example it is know n that lambrolizumab is also known under the alternative and equivalent names MK-3475 and pembrolizumab.

[0146] In some embodiments, the PD-1 binding antagonist is a molecule that inhibits the binding of PD-1 to its ligand binding partners. In a specific aspect, the PD-1 ligand binding partners are PDL1 and / or PDL2. In another embodiment, a PDL1 binding antagonist is a molecule that inhibits the binding of PDL1 to its binding partners. In a specific aspect, PDL1 binding partners are PD-1 and / or B7-1 . In another embodiment, the PDL2 binding antagonist is a molecule that inhibits the binding of PDL2 to its binding partners. In a specific aspect, a PDL2 binding partner is PD- 1. The antagonist may be an antibody, an antigen binding fragment thereof, an immunoadhesin, a fusion protein, or oligopeptide. Exemplary antibodies are described in U.S. Patent Nos. US8735553, US8354509, and US8008449, all incorporated herein by reference. Other PD-1 axis antagonists for use in the methods provided herein are known in the art such as described in U.S. Patent Application No. US20140294898, US2014022021, and US20110008369, all incorporated herein by reference.

[0147] In some embodiments, the PD-1 binding antagonist is an anti-PD-1 antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody). In some embodiments, the anti- PD-1 antibody is selected from the group consisting of nivolumab, pembrolizumab, and CT-011. In some embodiments, the PD-1 binding antagonist is an immunoadhesin (e.g., an immunoadhesin comprising an extracellular or PD-1 binding portion of PDL1 or PDL2 fused to a constant region (e.g, an Fc region of an immunoglobulin sequence). In some embodiments, the PD-1 binding antagonist is AMP- 224. Nivolumab, also known as MDX- 1106-04, MDX- 1106, ONO-4538, BMS-936558, and OPDIVO®, is an anti-PD-1 antibody described in W02006 / 121168. Pembrolizumab, also known as MK-3475, Merck 3475, lambrolizumab. KEYTRUDA®, and SCH-900475, is an anti-PD-1 antibody descnbed in W02009 / 114335. CT- 011, also known as hBAT or hBAT-1, is an anti-PD-1 antibody described in W02009 / 101611. AMP-224, also known as B7-DClg. is a PDL2-Fc fusion soluble receptor described in W02010 / 027827 and WO2011 / 066342.

[0148] Another immune checkpoint that can be targeted in the methods provided herein is the cytotoxic T-lymphocyte-associated protein 4 (CTLA-4), also known as CD152. The complete cDNA sequence of human CTLA-4 has the Genbank accession number LI 5006. CTLA-4 is found on the surface of T cells and acts as an ‘"off” switch when bound to CD80 or CD86 on the surface of antigen-presenting cells. CTLA4 is a member of the immunoglobulin superfamily that is expressed on the surface of Helper T cells and transmits an inhibitory signal to T cells. CTLA4 is similar to the T-cell co-stimulatory protein, CD28, and both molecules bind to CD80 and CD86, also called B7-1 and B7-2 respectively, on antigen-presenting cells. CTLA4 transmits an inhibitory signal to T cells, whereas CD28 transmits a stimulatory signal. Intracellular CTLA4 is also found in regulatory7T cells and may be important to their function. T cell activation through the T cell receptor and CD28 leads to increased expression of CTLA-4, an inhibitory receptor for B7 molecules.

[0149] In some embodiments, the immune checkpoint inhibitor is an anti-CTLA-4 antibody (e.g. , a human antibody, a humanized antibody, or a chimeric antibody), an antigen binding fragment thereof, an immunoadhesin, a fusion protein, or oligopeptide.

[0150] Approximately 60% of persons with cancer will undergo surgery of some type, which includes preventative, diagnostic or staging, curative, and palliative surgery'. Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and / or destroyed and may be used in conjunction with other therapies, such as the treatment of the present embodiments, chemotherapy, radiotherapy, hormonal therapy, gene therapy, immunotherapy, and / or alternative therapies. Tumor resection refers to physical removal of at least part of a tumor. In addition to tumor resection, treatment by surgery7includes laser surgery, cry osurgery', electrosurgery', and microscopically-controlled surgery' (Mohs’ surgery').

[0151] Upon excision of part or all of cancerous cells, tissue, or tumor, a cavity7may be formed in the body. Treatment may be accomplished by perfusion, direct injection, or local application of the area with an additional anti-cancer therapy. Such treatment may be repeated, for example, every71, 2, 3, 4, 5, 6, or 7 days, or every' 1, 2, 3, 4, and 5 weeks or every71, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. These treatments may be of varying dosages as well.

[0152] D. Examples

[0153] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices and / or methods claimed herein are made and evaluated, and are intended to be purely exemplary and are not intended to limit the disclosure. Efforts have been made to ensure accuracy with respect to numbers (e g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in °C or is at ambient temperature, and pressure is at or near atmospheric.

[0154] 1. Example 1 Glycoprotein A Repetitions Predominant (GARP) is a Key Contributor to the Immunosuppressive Microenvironment of Glioma and is Targetable via a Novel Anti-GARP CAR-T Cell Platform

[0155] Gliomas are the most common malignant primary tumor of the central nervous system (CNS). afflicting approximately 3. 19 / 100.000 people per year in the United States. The prognosis for high-grade glioma (HGG) remains grim [approximately 1-2 years survival from diagnosis], and low-grade glioma (LGG) represents an earlier time point of the disease which will unequivocally progress. The most well-studied and most common forms, Grade IV astrocytoma or glioblastoma (GBM), present a significant challenge to physicians and researchers alike, because of their inherent heterogeneity, low neoantigen burden, and highly immunosuppressive tumor microenvironment (TME).

[0156] Because of the relative failure of gold-standard chemotherapy and radiation to provide long-term survival improvements in GBM, many centers have begun developing cell-based therapeutics targeting glioma cells directly. Chimeric antigen receptor (CAR)-T cells have revolutionized solid tumor immunotherapy research and are being widely studied in brain tumors. There have been attempts at targeting interleukin- 13 receptor alpha 2 (IL13Ra2) or epidermal growth factor-receptor variant III (EGFRvIII) in GBM that expresses these molecules, but patients are subject to recurrence from antigenic escape. Recently, CAR-T therapy for diffuse midline glioma that targets disialoganglioside D2 (GD2) has been employed with some early success, but there remain patients who do not respond to any of the above treatments. Because of these limitations, further study into targetable tumor antigens in GBM are needed.

[0157] Glycoprotein A-repetitions predominant (GARP) is a type I transmembrane that is expressed by activated regulatory T cells, platelets, and many t pes of cancer cells. It is a powerful modulator of latent TGF|3 activation that is not expressed under normal healthy conditions and serves to release mature TGFp from the latency associated peptide (LAP) and permit its function. It impairs immune invasion into the TME and represents target of anticancer immunotherapy and is currently being investigated as a monoclonal antibody treatment in various clinical trials (NCT05822752, NCT03821935, NCT05483530, NCT05606380). Herein, we demonstrate that GARP is vital to the tumor biology of both low - and high-grade glioma. We also report a novel anti-GARP CAR-T therapy that showed preclinical efficacy and safety against multiple models of GBM. a) RESULTS

[0158] (1) High GARP expression in GBM correlates with mesenchymal gene signature, increased angiogenesis, worsened T cell exhaustion signature, and worsened prognosis

[0159] GARP has been reported to be expressed by GBM cells. Given the identified role of GARP in regulating the TME in solid tumors, we sought to determine its role in GBM tumor biology. To this end. we aggregated and performed an analysis of publicly available RNAseq data from The Cancer Genome Atlas (TCGA) to determine the effects of high GARP expression on survival and overall genetic phenotype of GBM. First, we explored the overall survival rate from collected TCGA datasets based on GARP gene expression, in which we categorized patients into two groups across four GBM subtypes based on GARP gene (Lrrc32) expression level. We discovered that tumors highly expressing GARP demonstrated a worsened prognosis (Figure 1 A). Specifically, the chosen TCGA dataset (TCGA-GBM-2013) consisted of 152 patients and was annotated according to five GBM genotypic subtypes, including 39 classical, 49 mesenchymal, 26 neural, 29 proneural, and nine others. After excluding the “other’" group due to the limited number of patients, our analysis demonstrated that patients with the highest GARP expression in their tumors had significantly shorter median overall survival than those with the lower degrees of GARP expression in the mesenchymal subtype group (Figure IB, Figures 7A-D).

[0160] Furthermore, we implemented previously defined GARP activation genes (i.e., nine GARP-TGFP axis genes) (Figure 7E), calculated gene activity scores using the GSVA enrichment method, and compared enrichment scores among four GBM subtypes. As a result (Figure 1C and Figure 7F), we concluded that the mesenchymal group presented significantly higher GARP activation functions compared to the non-mesenchymal group. TGFP signaling in gliomas is known to promote the development of myeloid cells, increase neoangiogenesis in response to tumor hypoxia, and may lead to increased T cell exhaustion, so we sought to evaluate these pathways in our analysis. Based on geneset enrichment analysis, we found that pathways of angiogenesis, myeloid compartment expansion, T cell signature, and T cell exhaustion were showing an up regulatory' activity in mesenchymal tumors (Figure ID and Figure 7G). Additionally, we generated a heatmap to determine relative gene expression of the myeloid compartment between mesenchymal and non-mesenchymal tumors (Figure IE), and found that the genes ITGB2, ITGAM, S100A11, and FCGR2A were upregulated in the former, among others. These genes have been associated with the enrichment of tumor-associated macrophages / microglia, promotion of glioma cell proliferation, lack of response to immune checkpoint blockade, and overall worsened prognosis.

[0161] (2) GARP expression in the tumor microenvironment leads to decreased CD4 and CD8 T cells, and increases in myeloid cells

[0162] To further elucidate the role of GARP in the TME of GBM, we evaluated the presence of GARP in biopsy-proven human GBM samples obtained from our institution’s department of pathology'. Basic patient characteristics for these samples are found in Table 2. Ten of these tissue slides were first stained for an array of markers (CD4, CD8, FOXP3. CD1 lb, GARP) to show the relative effect that GARP had on immune cells in the TME. All 10 of the GBM samples were found to have heterogeneous GARP expression. Areas that highly expressed GARP demonstrated significantly reduced lymphocyte infiltrate (Figure 2A), while areas with lower GARP expression showed either a highly lymphocytic immune infiltrate (Figure 2B) indicated by elevated levels of CD4. FOXP3, and CD8. or show a highly myeloid infiltrate (Figure 2C) as indicated by CD1 l b expression. Based on quantitative analysis of areas with low GARP expression (defined as <250 GARP-positive cells per mm2) compared to areas with high GARP expression (defined as >250 GARP-positive cells per mm2), several differences w ere observed among 10 confirmed cases of GBM.

[0163] Firstly, the percentage of GARP-high tumor region was significantly lower, around 10- 12% of the total scanned area for each tumor (Figure 2D). There was no significant difference in mean cell density of tumors betw een the two classifications (Figure 2E). The relative percentages of CD4 non-Treg (CD47FOXP3 ), Treg (CD4+ / FOXP3+), and CD8+cells were all significantly lower in areas that expressed a high amount of GARP compared to areas that expressed lower GARP (Figure 2F-I). In contrast, the CD1 lb+cells were relatively elevated in the high GARP regions. It is known that myeloid cells assist in the progression of HGG, in part due to increased TGFp signaling in gliomas. Moreover, as mentioned above, the myeloid and T cell compartments tended to be separate in terms of TME landscape (Figure 8A-D). Nearest neighbor analysis of these regions determined that immune cells of the same type tended to cluster nearer to each other than to other cell types (i.e. CD4+or CD8+cells w ere more distant from CD1 lb+cells than other CD4+or CD8 cells) (Figure 8E-H), especially CD8+T cells and CD4+T cells. Clustering w as stronger in low-GARP areas of tumor, with cells being closer to each other on average in these regions (Figure 8B) than in high GARP tumor. This may be related to immune cell attempts at cross-talk in the highly immunosuppressive TME of GBM. To provide additional evidence of GARP expression in glioma, we obtained 12 paired samples of low-grade glioma (LGG) that was confirmed to have progressed to HGG / GBM where both resective surgeries occurred at our medical center (Table 2). These samples were subjected to GARP staining in our IF protocol. All 12 of the HGG / GBM samples and 11 / 12 LGG samples had areas labeled "high-GARP” by the segmentation algorithm (Figure 9A-C). There was a non-significant but large difference in the average proportion of '‘high-GARP” tissue area in the HGG samples vs the LGG samples (Figure 9D). Additionally, four commercial tissue microarrays of GBM (Table 2) were stained for GARP. with about 33% of GBM samples and 50% of LGG samples staining positive for GARP, with a very low percentage of normal brain staining positive (Figure 9E&F). These data provide evidence that GARP expression is present across the glioma spectrum in varying degrees.

[0164] Table 2 Basic characteristics of analyzed patient samples from The Ohio State University

[0165] In total, the data presented above indicate that GARP is expressed widely in both LGG and HGG / GBM. GARP may also play a role in shaping the immune compartment of the TME, providing a signal for immune exclusion while promoting tumor cell promulgation and preventing immune cell cross-talk by separating them spatially. However, singular antigens that are known to be expressed by GBM have been targeted in the past, and while therapy is initially successful (IL13Ra2, EGFRvIII), the tumor recurs in widespread fashion. This is partly due to an ability to down-regulate targeted antigen on glioma stem cells, the major cell niche through which gliomas recur and is an important therapeutic challenge for this disease. To this end, we sought to determine whether glioma stem cells expressed GARP in a significant fashion. (3) GARP Expression in Glioma Stem Cells

[0166] To explore the GARP role in the glioma stem cell (GSC), GARP expression, encoded by the LRRC32 gene, was first checked based on TISCH2 single-cell database. We found a low expression of LRRC32 compared with other GSC markers (e.g., SOX2, CD44, and CD133) (Figure 10). To further investigate, we evaluated the chromatin accessibility for LRRC32 using public ATAC-seq data. Based on human, treatment-naive GSC ATAC-seq data, we observed the LRRC32 promotor region was open for access, indicating that LRRC32 was expressed and can be regulated (Figure 3A).

[0167] We validated the ATAC-seq results at the protein level using multiplex IF. Using the paired samples from patients who had both a low-grade glioma and a high-grade glioma (Table 2), we subjected them to a panel of antibodies for GARP, CD133, CD44, SOX2, and CD31. With this panel, determination of GARP expression in oligodendrocyte-progenitor-like (OPC)- like GSCs (CD133+ / SOX2+), mesenchymal-like GSCs (CD44+ / SOX2+), and neoangiogenic vessels (CD31 7CD133 / SOX2') is possible. We found that a significant portion of both OPC- like and mesenchymal-like GSCs expressed GARP in both low and high-grade glioma samples (Figure 3B and 3C). Additionally, about half of neoangiogenic vessels expressed GARP (Figure 3D), signaling that anti-GARP therapy will not only target mature tumor cells, but will additionally allow for targeting of two major types of GSCs and neoangiogenic vessels which are vital to tumor recurrence.

[0168] (4) Generation and characterization of GARP-CAR T cells.

[0169] Given the above data signaling the importance of GARP to the tumor biology of both high- and low-grade glioma, we hypothesized that strategies targeting GARP is an effective way to treat this disease and improve outcomes. Given the relative success of other CAR-T therapies in liquid tumors and emerging cellular therapies of different types in glioma and other solid tumors, we sought to focus on creating anti-GARP chimeric antigen receptors. We first cloned single-chain variable fragments (scFvs) derived from our humanized anti-GARP monoclonal antibody PI1O-1 and connected them to a CD8a hinge / transmembrane domain and the intracellular domains of human 4-1BB and CD3^ to create our humanized CAR construct (Figure 11 A). This humanized CAR was placed in a plasmid, and the construct was used to generate CAR-T cells via lentiviral transduction in both murine and human CAR-T cells. Additionally, we created human GARP-overexpressing cell lines from U87-MG. CT2A. and GL261 to support experiments in both immunocompromised and immunocompetent models (hereby referred to as U87-WT, U87-hGARP OE, CT2A-WT, CT2A-hGARP OE, GL261-WT and GL261-hGARP OE). CT2A and GL261 are known models that were developed from a C57 / BL6 mouse background. Stable human GARP expression was confirmed by immunofluorescent evaluation (Figure 11B&C). Moreover, as described in Li et al20, we developed and bred a homozygous, hvman-Lrrc32 knock-in mouse line from C57BL / 6 mice (herein referred to as hLRRC32K1mice) to use as our immunocompetent host for both tumor and CAR-T cell experiments. This hLRRC32K1mouse line expresses GARP (Figure 1 ID) under the control of the endogenous mouse Lrrc32 promoter and the staining pattern in the brain was similar to what was seen in a healthy normal human tissue microarray (Figure 1 IE).

[0170] (5) PIIO-1 CAR T cells demonstrate antigen-specific effort function against GBM cells in vitro

[0171] To confirm the functionality of PIIO-1 CAR-T against GARP+tumor cells, we tested whether chronic antigen stimulation could specifically enhance PIIO-1 CAR-T cell proliferation and expansion (Figure 4A). To this end, murine CAR-T cells were co-cultured with either wildtype or GARP over-expressing irradiated mouse glioma cells for 14 days in vitro, moving the CAR-T cells to a new plate every 48 hours. Repeated stimulation with GARP-expressing cells indeed allowed T cells to continue to expand, whereas lack of antigen stimulation on T cells led to culture growth arrest. Proliferating CAR-T cells were also harvested to investigate CAR enrichment on GARP+tumor cell contact. In contrast to CAR-T cells cocultured with antigennegative glioma cells, contact with GARP+tumor cells enriched the CAR-T positive population from 50% to 85% on day 14 (Figure 4B).

[0172] We next examined if PIIO-1 CAR-T cells can reliably recognize GARP on glioma cells to elicit cytotoxicity7. To this end, we cultured U87-WT (which has native GARP expression) and U87-hGARP OE in the presence of CAR-T cells at different effector: target ratios. We also performed experiments simultaneously using empty vector-transduced T cells (hereby referred to as EV-T cells). Tumor cell killing was more efficient in U87-hGARP OE cells than in U87- WT cells, indicating that the CAR-T cells used were stimulated by GARP on the surface of the human GBM cells (Figure 4C). To ensure our murine T cells would successfully express functional CAR, we performed the same experiment in our CT2A cell lines and GL261 cell lines. In contrast to target antigen-negative mouse GL261 and CT-2A cells, our murine PIIO-1 CAR-T cells effectively eliminated only high-level GARP expressing cells. To further confirm antigen-specific CAR-T cell activation, the six cell lines were cocultured separately with species-appropriate PIIO-1 CAR-T cells for 24h. Subsequently, secreted cytokine levels (IL-2. IFN-y, and TNF-a) in the cell culture medium were determined by enzyme-linked immunosorbent assay (ELISA). Both human and mouse CAR-T cells significantly produced cytokines in response to GARP expressing GBM cells with no substantial effect on cell lines that do not express the target antigen (Figure 4D). In summary. PI1O-1 CAR-T cells demonstrated cytolytic activity, cytokine production, and specific proliferation in response to target antigen stimulation in vitro.

[0173] (6) Anti-GARP CAR T cells were safe in relevant preclinical models and showed efficacy against human GBM in xenograft mouse models

[0174] Our anti-GARP PIIO-1 antibody does not recognize GARP on platelets because, unlike tumor cells and Tregs, the GARP epitope on platelets are inaccessible to the antibody due to preassociation with LTGFp. To ensure the general safety of anti-GARP-CAR-T approach, we next evaluated any potential on -target / off-tumor toxicity of PIIO-1 CAR-T in our hLRRC32K1mice (Figure 5). We assessed infusions of IxlO6murine PIIO-1 CAR-T cells compared to functional control CAR-T (EGFRvIII) cells in non-tumor-bearing, lymphodepleted hLRRC32KImice after 5Gy total body irradiation (TBI). Mice were monitored for body weight, mortality, and serum / tissue parameters until 60 days after infusion. We did not observe any significant body weight loss or mortality (Figure 5A and 5B), nor changes in platelet numbers between the PIIO- 1 CAR-T injected and EGFRvIII CAR-T injected group (Figure 5C). Finally, to ensure further safely, we evaluated serum cytokine levels at 1-3 weeks post-infusion to evaluate for any increases in baseline inflammation. CAR-T cell activation often produces a cytokine release syndrome (CRS) by inducing crucial proinflammatoiy cytokines such as interleukin-6 (IL-6) and interferon-gamma (IFN-g). As shown in Figure 5D, the serum levels of both IL-6 and IFN-y demonstrated no significant differences between the two groups. In summary, PIIO-1 CAR-T cells are safe in non-tumor bearing, syngeneic human GARP knock-in mice.

[0175] Next, to assess the efficacy of the PIIO-1 CAR T cells in vivo, we performed xenograft tumor implantation in Nod-scid gamma mice (NSG, Jackson Laboratories). Each NSG mouse received 5xlQ4luciferase-expressing U87-hGARP OE tumor cells (U87-hGARP-OE) implanted into the right hemisphere of the brain in a volume of 2 pL as described in the methods. Five to 7 days following implantation, tumors were confirmed via in vivo luminescence imaging (I VI S), and the mice (10 / group) were treated either with IxlO6PIIO-1 CAR-T (based on CAR+percentage) or an equivalent total dose of empty' vector-transduced T cells (EV-T) via intratumoral injection through the same injection craniotomy as the tumor (Figure 5E). In contrast to mice intracranially injected with EV-T cells, we observed significant improvement in tumor burden in mice implanted with PIIO-1 CAR-T cells, via total tumor luminescence differences. This significant decrease in tumor burden led to a drastically improved survival curve; median survival w as not reached for the PIIO-1 CAR-T group, vs 55 days for the EV-T group (Figure 5F). We also sacrificed the mice at removal criteria or at 100 days post-CAR-T implantation and performed H&E staining and GARP immunofluorescence to evaluate tumor cell burden (Figure 5G). Mice receiving EV-T still had significant tumor burden, signaled by GARP expression in the necrotic and expansive tumor region, vs the mice receiving PIIO-1 CAR-T having little to no GARP expression. Together, these experiments confirm that PIIO-1 CAR-T cells can effectively eliminate an orthotopic mouse model of human GBM.

[0176] (7) Anti-GARP CAR-T cells safely extend survival of mice with GBM in an intracranially injected, immunocompetent model

[0177] After confirming that our PIIO-1 CAR-T cells successfully activate and treat tumor cells in vivo in an immunodeficient mouse model, we sought to evaluate their effectiveness in immune competent syngeneic hLRRC32KImouse model. We first implanted hLRRC32KImice with IxlO5CT2A-hGARP cells and allowed tumors to develop for 2 weeks. We confirmed tumor presence via IVIS, randomized the mice based on tumor size to receive either CAR-T or EV-T, and treated them with 5Gy of TBI. Then, they received 2x l 05CAR+PIIO-1 CAR-T cells (total 1.3xl06T cells) on Day 14 post- tumor implantation, and they were followed w eekly for complete blood counts, body w eight, and IVIS measurements of tumor volume (Figure 6A). The mice that received PIIO-1 CAR-T had arrest of tumor growth, with several of them receding at the 1-week-post-CAR-T IVIS imaging (Figure 6B). This effect was durable through week 2. This is counter to the EV-T mice, whom all progressed. The total luminescence counts w ere significantly different betw een groups at 1 w eek and 2 w eeks post-treatment, with the EV-T mice having significantly larger increases in their tumor burden than the CAR-T mice (Figure 6C). Moreover, the PIIO-1 CAR-T mice had significantly prolonged survival, with a median overall survival of 37 days post-treatment compared to 21 (pO.OOOl, log-rank test).

[0178] Regarding safety, the PIIO-1 CAR-T mice had a stable weight curve over 21 days from treatment, compared to the EV-T, who dropped precipitously due to tumor progression (pO.OOOl. mixed effects model) [Figure 6E], Additionally, when measuring their blood for WBC and platelets, there was an initial drop from baseline due to the radiation, but there were equal rates of recovery between the PIIO-1 CAR-T group and the EV-T group for both parameters (Figure 6F&G). These data together indicate that the proliferation of PIIO-1 CAR-T did not adversely affect platelet count or bone marrow recovery in the period following treatment. Finally, in an independent experiment, we isolated tumor-infiltrating immune cells from the PIIO-1 CAR-T treated group as well as the control group. We performed high dimensional flow' cytometry analysis of both CD4+(including Tregs) and CD8+T cells. Our data showed that anti-GARP-CAR-T caused significant reduction of activated Tregs and increase of effector CD8+ T cells [data to be included]. Overall, the anti-GARP CAR-T cells are safe and able to extend survival in a syngeneic, immunocompetent model of human GBM. b) DISCUSSION

[0179] Cellular immunotherapies continue to expand in scale and indication, with solid tumor targets gaining traction with each new iteration. Optimal target antigens are those that are vital to tumor biogenesis and contribute to the immunosuppressive TME. Glioblastoma and high-grade glioma are excellent candidates for novel antigen-targeted CAR-T cells because of their difficulty with treatment and overall poor outcomes with current therapies. Our data indicate that GARP is a suitable target antigen for solid tumor CAR-T therapy because of its unique combination of importance to glioma immune suppression / proliferation and low peripheral expression under healthy conditions.

[0180] A major concern with targeting GARP via CAR-T cells is potential for on-target, off- tumor toxicity, possibly causing downregulation of regulatory T cells and platelets that assist in peripheral immune tolerance thus leading to autoimmune disease. However, we have found that GARP directed CAR-T cells only deplete GARP+ Tregs in mice. These animals continue to have GARP- Tregs which are apparently sufficient to maintain tolerance and thus do not develop severe autoimmune diseases. Additionally, targeting Tregs in the TME is a valid treatment strategy in other solid tumors, as it will improve effector T cell infiltration and anti-tumor immune activity. Moreover, the construct that serves as the scFv for our CAR is only able to target free GARP that is not bound to LAP, a conformation that is restricted to activated Tregs and not seen in soluble GARP or platelet GARP. Further, a testing infusion of a large dose of PI1O-1 CAR-T in our healthy hLRRC32KImice (Figure 5) did not result in adverse off-tumor side effects over 6 weeks, nor did any mice in our tumor-bearing cohort that received CAR-T (Figure 6) suffer significant deviations in recovery from their radiation in terms of platelet or leukocyte counts. These data indicate that using anti-GARP CAR-T cells will be safe in human patients.

[0181] Because of difficulty with crossing the blood-brain barrier, CAR-T cells initially had a difficult time taking hold in the brain tumor sphere. Initial clinical experience with many anticancer treatments have included ways to break down the BBB, for example with high intensity ultrasound or radiation. However, patient adherence to complicated treatment regimens can affect their overall efficacy, and delivery of therapeutic is of paramount importance to CAR-T therapy. As such, the optimal delivery route of CAR-T cells for treating brain tumors has remained an outstanding question. Although several ongoing CAR-T clinical trials for the treatment of GBM [e.g. NCT01109095. NCT01454596, NCT02844062, NCT02209376] are delivering CAR-T cells by intravenous infusion, recent studies indicate that direct intracerebral CAR-T placement has superior efficacy and excellent tolerability wi th very few off-target toxicities noted. This includes a distinct reduction in the incidence of cytokine release syndrome and CAR-T neurotoxicity when cells are delivered intracerebrally. Additionally, the ease of access via subcutaneous reservoir and lack of requirement for pre-infusion lymphodepletion improve patient quality of life and reduce the additional complications associated with very low WBC counts. Our data show that implantation of anti-GARP CAR-T cells directly into the brain does not come with reduced effectiveness, indicating further that this route of delivery is applicable in brain tumors.

[0182] Given the persistent lack of advancements in therapy for HGG / GBM in recent decades, unique targets represent new avenues that must be explored. GARP expression by both glioma cells and regulatory T cells in the TME indicates that the CAR-T treatment can lead to activity on multiple fronts and have a multipronged mechanism of action. Even more excitingly, glioma stem cells and neoangiogenic vessels express GARP as shown via ATAC-seq and immunofluorescence (Figure 3, Figure 10), meaning the niche from which gliomas recur and the blood supply of the growing tumor can be effectively attacked by targeting GARP. Because of these characteristics, we indicate that GARP will evolve into an important target for immunotherapy in glioma. Our PIIO-1 CAR-T cells possess a novel CAR construct that has excellent in vivo activity7against GARP on glioma cells as well as Tregs, representing an agent with translational characteristics that can be used in GBM patients to improve outcomes. c) METHODS

[0183] (1) TCGA data collection

[0184] Gene expression matrix values were obtained from The Cancer Genome Atlas (TCGA) using RNA-seq data available in the cBioPortal database, specifically the TCGA-GBM-2013 dataset. LRRC32 high group was define by the top ten percent LRRC32 expression, and LRRC32 low group was defined by the bottom ten percent LRRC32 expression.

[0185] (a) Downstream analysis

[0186] Kaplan-Meier curves were used to visualize survival between the LRRC32 high and LRRC32 low group in terms of unstratified and stratified GBM subtypes. The log-rank test was used to quantify significance. GSVA enrichment score for each sample was performed for the GARP activation pathway defined in Figure 7E using the GSVA package (v.1.49). The p-value was calculated using the Wilcoxon rank-sum test to compare the GARP pathway activity score between the mesenchymal group and the non-mesenchymal group. GSEA enrichment analysis for angiogenesis, myeloid compartment. T cell signature, and T cell exhaustion for TCGA- GBM-2013 dataset using desktop GSEA software (v.4.3.2) with default settings.

[0187] (b) GSC ATAC-seq data collection and visualization

[0188] The human GSC ATAC-seq datasets aligned on hg!9 reference genome with bigwig format were downloaded from GSE163853, and 12 oncological treatment naive samples were selected, including U3005MG-1, U3005MG-2, U3008MG-1, U3008MG-2, U3046MG-1, U3046MG-2, U3056MG-1, U3056MG-2, U3164MG-1, U3164MG-2, U3085MG-1, and U3085MG-2. GSE163853. Integrative Genomics Viewer (IGV, v. 2.4.1) was implemented to visualize the collected bigwig data using the hgl9 reference genome.

[0189] (2) Cell lines and culture methods.

[0190] Human glioblastoma U87-MG cell line was obtained from the American Type Culture Collection (ATCC® HTB-14™ Manassas, VA). Mouse glioma cell line GL261, obtained from NCI Tumor Repository (Frederik, MD). CT-2A mouse cell line, generated from a malignant astrocytoma, was purchased from EMD Millipore (Cat. No: SCC194, Burlington, MA). All cells were cultured in Dulbecco's Modified Eagle Medium supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin (ThermoFisher Scientific, Waltham. MA). For cell lines containing puromycin-dependent cassettes, puromycin from Gibco (Cat. No: Al 113803) was also added into the solution, at a 1 ug / mL concentration, to ensure selection of cassetteexpressing cells.

[0191] (3) Construction of lentiviral vectors.

[0192] The lentiviral vector backbone plasmid (herein, pLenti-PIIO-l-CAR) was generated by following modifications from Addgene's pLenti CMV / TO Hygro empty (w214-l), Plasmid #17484). Briefly, the CMV promoter was replaced with the human elongation factor- 1 alpha (EF-1 alpha) promoter, and the woodchuck hepatitis virus post-transcriptional regulatory element WPRE was replaced by 50-mer sequences (GTGACGAACATGGGGCAGATTGCTTCCAGTGCTTGCTGGGCATTGCTGAT)(SEQ ID NO: 14) to increase transgene expression (synthesized by GeneScript, Piscataway, NJ). Lastly, an unnecessary selection marker (hygromycin) and its promoter were removed from the original pLenti CMV / TO Hygro vector. Our lab’s monoclonal antibody (clone, 4D3) (anqi paper) targeting human GARP was first humanized and renamed PIIO-1 (AbStudio, Hayward, CA 94545 USA). Synthetic oligonucleotide encoding for the GGGGSGGGGSGGGGS (SEQ ID NO: 15) amino acid linker sequence was used to join the VH and VL DNA sequences to create PIIO-1 scFv. Briefly, PIIO-1 scFv is connected with the CD8a hinge and transmembrane domains, and the intracellular signaling domain contains the co-stimulation domain consisting of 4-1BB and the CD3^ domain. Subsequently, the second generation PIIO-1 scFv CAR coding sequence was synthesized by GeneScript and then cloned into Xmal / PacI sites of the pLenti- EF1 alpha vector. To generate GARP overexpressing cell lines, the human GARP gene was amplified from a shuttle plasmid and subcloned into Nhel / BstBI sites of Addgenes's pLJMl- EGFP (Plasmid #19319) by replacing the EGFP gene.

[0193] (4) Generation of human and mouse GARP CAR T cells by using lentiviruses.

[0194] Two plasmids were gifts from Bob Weinberg (Addgene plasmid #8454 and #8455). To generate lentiviruses, HEK293FT cells (Thermo Fisher Scientific, Waltham, MA) were transfected with Addgene’s pCMV-VSV-G (Plasmid #8454), pCMV-dR8.9 (Plasmid #8455), and pLenti-EFl alpha -scFv (PIIO-l)-CAR using TransIT-293 Transfection Reagent (Minis Bio LLC, Madison, WI) or Lipofectamine 3000 (Thermo Fisher Scientific, Waltham. MA). The media on the HEK293FT cells was replaced with fresh media 24 hr post-transfection to remove the transfection reagent. At 72 hr posttransfection, the lentiviral media was filtered through a 0.45 pm filter. The supernatant was then concentrated using ami con viral concentration ultrafiltration 100 kDa tubes (Merck Millipore, Burlington, MA) with centrifugation at 1,200g for 15 min at 4°C. The freshly collected concentrated virus supernatant was used for spintransduction by centrifugation at 800 g for 90 minutes at 32°C. For the human T cell transduction, Peripheral Blood mononuclear cells (PBMCs, obtained from deidentified healthy donors under an institutional review board-approved protocol) were first isolated Ficoll-Paque density gradient centrifugation using a 50 ml SepMate™-tube (Stemcell Technologies. Vancouver, Canada). Subsequently, untouched T cells were enriched with a Pan T Cell Isolation Kit (Miltenyi Biotec, Auburn, CA). The isolated T-cells (5 x 106) were resuspended in a 3 ml medium per well of a 6-well plate and stimulated with a 1 : 1 ratio CD3 / CD28 beads (Life Technologies, Carlsbad, CA) and IL-2 (Peprotech, Rocky Hill, NJ, 100 U / ml) for overnight. Next, the media (2 ml / well) was gently removed without disturbing clustering T-cells, and 1 ml pLenti-PIIO-l-CAR fresh concentrated virus particles were added (final 3 ml / well). T-cells were then cultured with the lentiviral virus for 24 hr in a TexMAX cell medium (Miltenyi Biotec) containing 10% fetal bovine serum and IL-2 (100 U / ml). For the mouse CAR-T cell generation, mouse T cells were first isolated from the spleen of C57BL / 6 mice with a mouse T Cell-specific Isolation Kit (Miltenyi Biotec, Cat# 130-095-130). Similar transductions procedures were followed. Generated mouse CAR-T cells were maintained in TexMAX cell medium (Miltenyi Biotec) containing 5% FBS (Sigma), IL -2 (100 U / ml), IL-7 (lOng / mL), and IL- 15 (lOng / mL). Three days after transduction, the percentage of CAR-T- positive cells was determined by flow cytometry.

[0195] (5) Flow cytometric analysis.

[0196] To detect CAR expression. 1 x 106CAR-T or control T cells transduced with empty pLenti-EFl alpha vector were first harvested and washed two times with 1 ml of ice-cold 1 x PBS containing 4% bovine serum albumin (BSA). After wash, cells were resuspended in 0.2 ml of the ice-cold wash buffer and incubated with of protein L-PE conjugate (AcroBioSy stems, Newark, DE) at 4°C for 30 minutes. To detect CD4 and CD8 surface antigens, CD4 antibody conjugated with allophycocyanin Cyanine? (APC-Cy7, Biolegend) and CD8 antibody conjugated with phycoerythrin Cyanine? (PE-Cy7, eBiosciences) were added. To detect human GARP surface expression on GBM cell lines, cells were stained with GARP antibody conjugated with phycoerythrin (PE, Biolegend). All samples' fluorescent data were collected with a Cytek Aurora flow cytometer, and all data were analyzed with FlowJo software.

[0197] (6) Cytotoxicity and Proliferation assay.

[0198] The ability of GARP-specific CAR-T cells to kill targets was tested in a 24-hour luciferase-based killing assay. All cell lines (U87. GL261, and CT-2A) were engineered to stably express firefly luciferase (Cellomics Technology, Hallethorpe, MD, USA). These engineered cell lines served as targets for the killing assay. Briefly, the effectors (CAR-T or Control T cells) and luciferase-expressing target cells were mixed together at the indicated E:T ratios and cultured in 96-well flat-bottom plates with 5 x io4target cells in a total volume of 200 pl per well in T cell medium for overnight. Target cells alone were seeded at the same cell density to determine the maximal luciferase expression (relative light units; RLUmax). After 24h hours, 100 pl of supernatant per well was removed, and 100 pl of luciferase substrate (Bright-Glo, Promega) was added to the remaining supernatant and cells. Emitted light was measured after five minutes of incubation using the Spectra Max ID5 plate reader (Molecular Devices, San Jose, CA). Lysis was determined as [1 - (RLUsample) / (RLUmax)] x 100. Two independent experiments were performed, and each was performed in duplicate. For the proliferation assay, mouse GBM tumor cells were first irradiated (2,000 rads) and seeded at 2.5 x 105per well of 24 Well plate. T cells were added at 1 x 106in a culture medium containing 5% FBS plus 100 lU / ml human IL-2 for a week culture. T cells were split to maintain suitable density and restimulated with tumor cells weekly. The number of T cells was determined with a TC20 cell counter (Bio-Rad, Hercules, CA, USA) with try pan blue every 3 or 4 days for two weeks. After two weeks, the percentage of CAR-Ts was quantified by flow cytometry. (7) Cytokine ELISA.

[0199] Cytokine release assays were performed by coculturing 5 * 104CAR-T or Control T cells with 5 x io4target cells per well in triplicate in 96- well flat-bottom plates in a final volume of 200 pl of T cell media in the absence of cytokines. After 16-18 hours, coculture supernatants were assayed for IL-2, IFN-y, and TNF-a using the individual ELISA Kits, according to the manufacturer's instructions (R&D Systems, Minneapolis, MN).

[0200] (8) Monoplex Immunohistochemistry - Cell Cultures

[0201] When validating the antibody for GARP in the immunofluorescent imaging system, slides were created from freshly fixed cell cultures. Briefly, cells from each cell line (CT-2A, CT-2A-hGARP, GL261, GL261-hGARP, U87, U87-hGARP. and DBTRG) were grown on sterile cell culture plates in the appropriate medium, seeded at 100,000 cells / chamber. These were grown until a level of 80-90% confluency was reached, at which point the cells were fixed to the culture plate with 10% neutral buffered formalin for 15 minutes. Then, the cells were placed into permeabilization buffer (lx Tris-buffered saline (TBS) with 1% Tween-20 v / v) [TBST] for 20 minutes followed by blocking buffer (lx TBS. 5% v / v normal goat serum, 2% w / v bovine serum albumin, and 0.3% Triton-XlOO) for 60 minutes. After this, endogenous peroxide quenching was performed with 3% H2O2 in ddH2O for 8 minutes, then the slides were placed on hydration chambers after encircling the tissue with a hydrophobic barrier pen. Primary antibody against GARP (Enzo ALX-804-867-C100, clone PLATO-1) was placed on the slides at a concentration of 1 :500 in Opal / Antibody diluent (Akoya Biosciences. Cat. No. ARD1001EA) for 60 minutes at room temperature, then slides were washed in TBST with agitation on a shaker plate for 2 minutes three separate times. The slides were replaced on the hydration chamber and the secondary' antibody (SignalStain® Boost IHC Detection Reagent, Cell Signaling Technology) was placed on the slides for 10 minutes at room temperature. This was followed by 3, 2-minute washes with TBST on the slide shaker, then replacement on the hydration chamber again. At this time, the opal fluorophore 570 (Akoya Biosciences) was placed on the slides at a concentration of 1 :200 in lx Amplification Diluent (Akoya Biosciences, Cat. No. FP1488001KT) for 8 minutes at room temperature, followed by three more washes in TBST. Finally, the slides were incubated in 1 : 15000 nuclear counterstain (Hoechst 33342. Trihydrochloride, Trihydrate; Invitrogen) for 7 minutes at room temperature. At this point, the slides were washed with TBST x2 and ddH2O x2, then the hydrophobic barrier pen was removed with xylene-soaked cotton tip applicators and the slides were mounted with Invitrogen SlowFade Gold Mounting Reagent and coverslipped with FisherFinest coverglass slips. The slides were then stored at room temperature in the dark overnight and scanned on the Akoya Vectra Polaris Fluorescent Microscope system, with the reference exposure time coming from the U87-hGARP cell line used for all of the cell line pictures. Snapshots were taken via the Akoya Phenochart Image Viewer (Akoya Biosciences) at 20x magnification.

[0202] (9) Multiplex Immunohistochemistry - FFPE slides

[0203] Paraffin-embedded slides of know n low-grade glioma, high-grade glioma, and glioblastoma samples were obtained from the Ohio State University Department of Pathology via a collaborative IRB (OSU IRB# 2020C0062). No informed consent was required for use of these samples because of the deidentified, retrospective nature of the review with no identifying health information being retained. The basic characteristics of the patients are listed in Table 2. They were paraffinized according to standard operating procedures in the histology' lab at the medical center. Additional samples were obtained as commercially available tissue microarrays (USBiomax Inc.). Mouse samples were taken from our in vivo experiments.

[0204] Slides were first baked on a hot plate at 60C for 1-2 hours, followed by deparaffinization via xylene soaks and rehydration via an alcohol-water gradient and water w ashes afterward. Next, antigen retrieval was performed in pH9. EDTA-buffered solution (Leica Biosciences Cat No. AR9640) by placing the slides in an appropriate level of pre-warmed buffer and heating them in a pressure cooker for 1 min on high pressure, followed by 20 additional minutes of time in the cooker. After this, the slides w ere allowed to return to room temperature on a shaker plate. This was followed by permabilization via TBST incubation and then incubation in blocking buffer as mentioned above. Next, endogenous peroxide quenching was performed as above, and primary antibody, secondary antibody, and opal fluorophore were loaded in a manner similar to the monoplex IHC methods. After the opal, three w ashes w ere performed with TBST, then the slides w ere placed back into the antigen retrieval buffer and exposed to another round of pressure cooking, to strip and poorly bound antibody and expose the antigens for the next antibody in the panel. A rest period to allow room temperature cooling was performed after each subsequent antigen retrieval, and endogenous peroxide quenching was performed for each antibody as well. The panel reached its conclusion (a total of 6 primary antibodies per panel) and then the nuclear counterstain with Hoescht as mentioned in the monoplex IHC methods was performed. Slide coverslipping and scanning was performed in a similar way, with each slide being subject to one set of exposure times and a spectral unmixing protocol. After scanning, the slides were stored at room temperature in the dark to preserve for possible re-scanning as needed. Images were stored on the lab computers and sent to the image analysis pipeline. Antibodies for panels used in this experiment are found in Table 3. Table 3 Primary and secondary antibodies and dilutions used for multi-plex

[0205] (10) Multiplex IHC Image Analysis

[0206] After multiplexed immunofluorescence images had been obtained according to the protocol above, images in q / i / fformat were uploaded into InForm Tissue Analysis software (Akoya Biosciences). Briefly, this software allows for spectral unmixing, marker identification, phenotyping, and quantification of cells within a sample. First, representative sections from each sample were taken and uploaded into the training set to make an ‘'algorithm” for the software to process the full images. Each sample had one or two representative images in the training set. From there, the tissues were segmented into “high GARP” and “low GARP” regions based on input and manual notation from the research team and then via algorithm training until the accuracy calculated by the program was >97%. After tissue segmentation, cell segmentation based on nuclear staining (DAPI), cytoplasmic staining, and cell membrane staining, depending on the panel available. Once a reliable cell segmentation algorithm was obtained, phenoty ping occurred. The phenotype was determined as positive for the various combinations of markers of interest or “other”, denoting nuclei of cells that did not fit into the schema or were not stained for markers in the panel. This was performed until the algorithm reliably identified the cell phenoty pes, at which point the algorithm was saved and run on the full images for each sample. This analysis imputed a quantification of the numbers and locations of each phenotyped cell, in addition to percentages of total tissue segmentation for the high and low GARP regions. After full quantification and analysis of each sample image, the data was consolidated, summanzed. and reports created to easily visualize and understand the data using the R4.3.0 plugin phenoptr Reports (Akoya Biosciences). Statistical analysis was performed in GraphPad PRISM Software.

[0207] (11) In vivo studies.

[0208] All animal study procedures were carried out by following per under National Institutes of Health guide for the care and use of Laboratory animals and conducted with the approval of the Ohio State University Institutional Animal Care and Use Committee. For the intracranial injections (5 x 104cells), U87-WT, U87-hGARP, GL261-WT, GL261-hGARP, CT2A-WT, or CT2A-hGARP were first infected with luciferase-expressing lentivirus (Cellomics Technology’, Hallethorpe, MD) and selected with Ipg / rnL puromycin (Thermo Fisher Scientific, Waltham, MA). Bioluminescent imaging was performed with the Xenogen IVIS Spectrum (Caliper Life Sciences, Waltham, MA) to confirm that tumor burdens were roughly equivalent and that no dissemination of tumor into the spinal canal had occurred (data not shown). Animals that failed to meet these criteria were excluded from further studies. Seven to 14 days after tumor implantations, treatments with CAR-T or control T cells were performed by implantation into the same tumor location. CAR-T doses were adjusted based on CAR+percentage determined via flow cytometry using Protein L-PE (AcroBioSystems). All mice were observed daily and sacrificed when neurological symptoms developed, body score decreased, or at defined time points for the histological analysis. At necropsy, brains were collected, fixed overnight with 10% formalin, paraffin-embedded, cut into sections for slide preparation, and stained as described in IHC methods. To determine the primary tumor growth in vivo, bioluminescence imaging studies were conducted before treatment, then weekly. Animals received an intraperitoneal injection of 100 uL of 15 mg / mL D-Luciferin. Potassium Salt (Gold Biotechnology, St. Louis. MO, USA; Cat. No. Luck- 100) and were continuously maintained under isoflurane gas anesthesia. Images were obtained 5-10 minutes after luciferin administration. The bioluminescence intensity’ was quantified using Living Image Software (version 3. 1, Caliper, Waltham, MA). Signal intensity was quantified as the sum of detected photons per second within the region of interest. The lower detection threshold was set at 200 photons / sec / cm2 / steradian. For the survival analysis, mice were observed for up to 100 days or until tumor endpoint criteria were reached (ill, visible lameness, pain or severe weight loss), at which time they were humanely euthanized. Immunocompromised experiments were performed on NOD-scid IL2Rgnu11(NSG) mice from Jackson Laboratory (Bar Harbor, ME, USA) when mice were between 6 and 20 weeks of age. Immunocompetent experiments w ere performed on our lab’s hLRRC32KImice which are of a C57BL / 6 background and are stably homozy gous for the human allele for GARP. (12) Statistical analysis

[0209] Statistical analysis was performed using GraphPad PRISM software, and independent sample t testing, paired sample t testing, Wilcoxon Rank-sum testing, and mixed effect model / ANOVA were used to determine significance for experiments in this study. Survival curves were plotted using the Kaplan-Meier method, and log-rank tests were used to compare curves between groups. P values are represented as *, P < 0.05; **, P < 0.01, ***, P < 0.001 and ****, p < 0.0001.

[0210] 2. Example 2: Targeting TGF|J docking receptor Glycoprotein A Repetitions Predominant (GARP) via novel chimeric antigen receptor a) RESULTS

[0211] (1) Elevated GARP expression in human glioblastoma correlates with reduced overall survival and mesenchymal subtype.

[0212] Given the role of GARP in regulating oncogenesis via modulating TGFP bioavailability in the TME, we first sought to determine the role of GARP in several aspects of GBM’s clinical behavior. Therein, we analyzed publicly available transcriptomic data from The Cancer Genome Atlas (TCGA) to determine the effects of GARP expression on overall survival in GBM and examine whether GARP correlated with disease grade or certain GBM subtypes. Overall, we found that patients with GBM expressing elevated mRNA levels of GARP (LRRC32) demonstrated worsened prognosis (Figure 12A) in both the Chinese Glioma Genome Atlas (CGGA) and TCGA-GBMLGG cohorts. Furthermore, comparison of LRRC32 expression across patients with different tumor grade demonstrated elevated expression of GARP in high grade relative to low grade counterparts (Figure 12B) in both the CGGA and TCGA-GBMLGG cohorts.

[0213] Furthermore, in both the CGGA and IvyGap GBM cohorts, we found that LRRC32 expression was significantly elevated in the mesenchy mal subtype relative to classical and proneural counterparts of GBM (Figure 12C). In line with this, tumors with elevated LRRC32 mRNA expression demonstrated upregulation of core mesenchymal subtype associated transcripts including TGM2, S100A4 and STAT3 (Figure 12D). To further substantiate the relationship between GARP and mesenchymal subty pe status, we analy zed expression of a previously defined GARP associated mRNA signature (i.e.. nine GARP-TGFP axis genes) (Figure 17A) and compared enrichment scores among four GBM subtypes. We found that the mesenchymal group presented significantly higher GARP associated signature compared to the non-mesenchymal groups (Figure 12E and Figure 17B). Importantly, we found that mesenchymal subtype patients with the highest GARP expression exhibited significantly shorter median overall survival than those with the lower degrees of GARP expression (Figures 17C-G). Additionally, consistent with the roles of TGF , we found that pathways of angiogenesis, myeloid compartment expansion, T cell signature, and T cell exhaustion were showing an up regulatory activity in mesenchymal tumors (Figure 17H).

[0214] (2) Intratumoral areas of high GARP expression correlate with decreased CD4+and CD8+T cells and increased myeloid cells.

[0215] To further elucidate the role of GARP in the TME of GBM. we utilized multispectral immunofluorescence to evaluate human GBM specimens obtained from The Ohio State University’s Department of Pathology. Basic patient characteristics for these samples are outlined in Table 2. Specimens from ten unique patients were stained for GARP and immune cell markers (CD4. CD8, FOXP3, CDl lb). All specimens showed regions of heterogeneous GARP expression, which we designated as “low GARP” (Figure 13 A; <250 GARP1cells / mm2) and “high GARP” (Figure 13B, >250 GARP+cells / mm2). High GARP regions only comprised 10-12% of the total scanned area for each tumor (Figure 13C). There was no significant difference in mean cell density of tumors between the two classifications (data not shown). In high GARP regions, there was a significant relative increase in CD1 lb+cells compared to low GARP regions (Figure 13D). CD8+T cells, CD4+non-Tregs (CD4 / FOXP3 ), Tregs (CD4+ / FOXP3+) were all significantly lower in high GARP regions (Figure 13E-G). Thus, we conclude that high GARP expression correlates significantly with lymphocyte exclusion and enrichment of myeloid cells.

[0216] Myeloid cells are known to induce HGG progression, in part due to increased TGFP signaling. Moreover, as mentioned above, the myeloid and T cell compartments tended to be separate within the TME (Figure 18A-D). Nearest neighbor analysis of these regions determined that immune cells of the same type tended to cluster nearer to each other than to other cell types (i.e. CD4+or CD8+cells were more distant from CD1 lb+cells than other CD4+or CD8+cells) (Figure 18E-H). Clustering was stronger in low-GARP areas of tumor, with cells being closer to each other on average in these regions (Figure 18B) than in high GARP tumor.

[0217] To examine the potential role of GARP in malignant transformation in glioma, we obtained paired samples from 8 unique patients with low-grade glioma (LGG) that progressed to high-grade glioma (HGG) (Table 4) and also utilized four commercial tissue microarrays, which included all grades of glioma and normal brain controls, to further substantiate our findings. Normal brain samples exhibited no to very low staining of GARP, relative to high staining apparent in GBM tissue samples (Figure 14A). By comparison, all the high- and low-grade samples had areas labeled “high-GARP” by the segmentation algorithm (Figure 19A-C). There was a non-significant difference in the average proportion of “high-GARP” tissue area in the HGG samples vs the LGG samples (Figure 19D). Additionally, within the four tissue microarrays of GBM, -33% of GBM samples and -50% of LGG samples were stained positive for GARP (Figure 14A, right). In total, these results suggest that GARP is heterogeneously expressed in both LGG and HGG and its expression correlates with aggressive features, including lymphocytic exclusion.

[0218] Table 4 Basic clinical summary of paired patient samples

[0219] (3) GARP expression in glioma stem cells.

[0220] Glioma stem cells (GSCs) are the major cell niche through which gliomas recur and are an important therapeutic challenge for this disease. Herein, we examined whether glioma stem cells expressed GARP and how expression influenced the TME. LRRC32 transcript has been difficult to detect by scRNAseq probably due to low level or poor mRNA stability. Indeed, utilizing the TISCH2 single-cell database we observed very low expression of LRRC32 compared with other GSC markers (e.g., SOX2, CD44, and CD133) (Figure 20). However, based on a public ATAC-seq dataset, we found that the LRRC32 promotor region was open for access in human, treatment-naive GSCs. suggesting that LRRC32 was expressed by GSCs (Figure 19E).

[0221] We validated the ATAC-seq results at the protein level using multiplex IF. Using the paired samples from patients who had both a LGG and a HGG (Table 4), we stained them with a panel of antibodies for GARP. CD 133, CD44. SOX2. and CD31 (Table 3). With this panel, we examined the GARP expression in oligodendrocyte-progenitor-hke (OPC)-like GSCs (CD133+ / SOX2+), mesenchymal-like GSCs (CD44+ / SOX2+), and neoangiogenic vessels (CD317CD1337SOX2'). We found that a significant portion of both OPC-like and mesenchymal-like GSCs expressed GARP in both LGG and HGG samples (Figure 14B-C, 14E- F). A large portion of neoangiogenic vessels also expressed GARP (Figure 14D, 14G). These data suggest that GARP is expressed by tumor cells, two major types of GSCs, and neoangiogenic vessels, all of which are vital to oncogenesis and cancer recurrence.

[0222] (4) Generation of anti-GARP CAR-T cells and multiple GBM cell lines with stable human GARP expression.

[0223] Given the above findings, we believe that GARP can serve as a therapeutic target for GBM. Our group previously generated a humanized and affinity -matured monoclonal antibody (named PIIO-1) targeting human GARP (hGARP), which we tested in multiple mouse models of cancer. This anti-GARP antibody diminished TGFP signaling in the TME and significantly reduced metastasis in models of triple-negative breast cancer. It showed single-agent activity against multiple cancer types and can promote CD8+T cell function in vivo. It also improved therapeutic efficacy of anti-PD-1 in multiple murine models of cancer, including lung cancer, breast cancer, and bladder cancer.

[0224] To generate an anti-GARP CAR, we cloned the single-chain variable fragment (scFv) of PIIO-1 into a CAR construct comprised of a CD8a hinge and transmembrane domains and the intracellular domains of human 4-1BB and CD3^ (Figure HA). This anti-GARP CAR construct was cloned into a third-generation lentiviral vector and shown to be expressed successfully after transduction into human T cells. Furthermore, we created human GARP (hGARP)- overexpressing (OE) glioma cell lines derived from the parental wild type (U87-WT and U87- hGARP OE [human]; C57BL / 6 syngeneic GBM line CT2A-WT and CT2A-hGARP OE [C57BL / 6]; GL261-WT and GL261 -hGARP OE [C57BL / 6]). Stable hGARP expression was confirmed by flow cytometry and immunofluorescence (Figure 11B-C). All parental cell lines were engineered to co-express luciferase for downstream in vivo imaging.

[0225] (5) Human GARP CAR-T cells elicit activity against GBM in a GARP-dependent fashion.

[0226] Next, we examined the anti -tumor activity of human-derived anti-GARP CAR-T cells against human glioma U87. We found that anti-GARP CAR-T cells induced tumor cell lysis in vitro (Figure 4C), and co-culture led to secretion of IFNy, TNFa, and IL-2 in a GARP-dependent manner.

[0227] To evaluate anti-tumor efficacy of human anti-GARP CAR-T in vivo, we used an orthotopic xenograft model of GBM in NOD-SCID-gamma (NSG) mice (experimental schema). We observed significant improvement in tumor burden (via IVIS) in mice treated with anti- GARP CAR-T cells as compared to control (Figure 5D). This significant decrease in tumor burden resulted in an improvement in overall survival; median survival was not reached for the anti-GARP CAR-T treated mice group, vs 59 days for the control group (Figure 5E; p<0.0001, log-rank test). We sacrificed the mice either at removal criteria or at 100 days post tumor inoculation for the surviving mice and performed H&E staining and GARP immunofluorescence on brains to evaluate tumor cell burden. Mice who received EV T had significant tumor burden, with GARP expression in the necrotic and tumor regions; anti-GARP CAR-T-treated mice showed no evidence of disease or aberrant GARP expression from residual tumor (Figure 5F). These data affirm that human derived anti-GARP CAR-T cells effectively eliminate orthotopic tumors in murine models of human GBM.

[0228] (6) In vitro and in vivo activity of anti-GARP CAR-T cells against murine syngeneic GBM tumors in a clinically relevant human LRRC32 knockin mouse model.

[0229] Next, we examined the anti-tumor activity of murine-derived anti-GARP CAR-T cells against murine glioma. Splenic T cells from C57BL / 6 mice were activated with anti-CD3 / CD28 antibody followed by lentiviral transduction of anti-GARP CAR. GARP expression was demonstrated by flow cytometry (Figure 15A). We then co-cultured CT-2A and GL-261 (wild Npe and hGARP overexpressing) in the presence of anti-GARP CAR-T at different E:T ratios. Like human anti-GARP CAR-T cells, the murine CAR-T cells elicited significant cytotoxicity against hGARP-expressing murine GBM cells (Figure 15B), with concurrent secretion of multiple cytokines in a GARP-dependent manner (Figure 15C).

[0230] We previously reported creating a homozygous human-£rrc32 knock-in strain on an immune competent C57BL / 6 background (referred to as hLRRC32KImice). Similarly to the healthy normal human tissue microarray, the brain of hLRRC32K1mice did not express GARP (Figure 11D-E). We next determined the efficacy and safety of anti-GARP CAR-T in this highly relevant preclinical hLRRC32klmouse model (Figure 15D, experimental schema). Mice treated with anti-GARP CAR-T showed a reduction in luminescence, indicating tumor regression. Several mice in the anti-GARP CAR-T treatment group show ed complete regression of tumor, with durable results for several w eeks following treatment (Figure 15E and 6F). By comparison, 100% of the mice in the control group had rapid tumor progression. Total luminescence was significantly different between groups post-treatment, with the mice receiving anti-GARP CAR- T showing significantly reduced tumor burden than control mice (Figure 15E; p= 0.0007, mixed effects analysis). Moreover, mice treated with anti-GARP CAR-T showed significantly prolonged survival, with a median overall survival of 51 days compared to 35 in control group (Figure 6D; pO.OOOl. log-rank test). To monitor treatment tolerability, we collected weekly blood draws. The initial drop in WBC and platelet counts from baseline was likely due to TBI. Anti-GARP CAR-T treated mice did not suffer from more thrombocytopenia or other hematological toxicities compared with control T cell treated group (Figure 6G and 6F). These data together suggest that a single dose of CAR-T against GARP administered intracranially into a glioma tumor specifically targets tumor cells and prolongs survival, while not eliciting toxicity or overt immune-related adverse events.

[0231] (7) Anti-GARP CAR-T cells did not elicit overt toxicity when administered systemically.

[0232] To demonstrate the safety of this anti-GARP CAR-T approach further, we evaluated potential for on-target / off-tumor toxicity via intravenous infusion of our regimen into hLRRC32KImice. We administered IxlO6murine anti-GARP CAR-T or control CAR-T (against EGFRvIII) via tail vein injection into non-tumor-bearing, lymphodepleted hLRRC32KImice following 5 Gy TBI. Mice were monitored for body weight, mortality, and serum cytokine parameters for 60 days. No mortality events were observed and there were no significant changes in body weight (Figure 16A). Platelet counts and serum cytokine levels were stable in both groups (Figure 16B-D). These data further underscore the safety of our anti-GARP CAR-T. b) DISCUSSION

[0233] Cellular immunotherapies continue to expand in scale and indication, with solid tumor targets gaining traction with each new iteration. Besides tumor-specific expression, optimal target antigens are those that are vital to tumor biogenesis and contribute to the immunosuppressive TME. Glioblastoma and high-grade glioma are excellent candidates for novel antigen-targeted CAR-T cells because of their difficulty with local treatment such as surgery and radiation therapy and overall poor outcomes with current therapies. Our data suggest that GARP is a suitable target antigen for CAR-T therapy of GBM because of its unique combination of importance to glioma immune suppression / proliferation and low peripheral expression under healthy conditions.

[0234] Given the persistent lack of clinical advancements in therapy for HGG / GBM in recent decades, unique targets represent new avenues that must be explored. We showed that GARP is an ideal glioma target, because: a) it is expressed by GBM cells but not normal brain; b) GARP expression may drive underlying oncogenic process through activating latent TGF ; c) Even more excitingly, glioma stem cells and neoangiogenic vessels express GARP as shown via ATAC-seq and multi-pex immunofluorescence microscopy, indicating that the niche from which gliomas recur and the blood supply of the growing tumor can be effectively eliminated by targeting GARP; d) GARP expression causes lymphocyte exclusion; and e) High GARP expression correlates with poor prognosis in patients with GBM. Because of these characteristics, we assert that GARP is an important target for immunotherapy in glioma.

[0235] Because of difficulty with crossing the blood-brain barrier (BBB) and paucity of T cell homeostatic cytokines in the brain, CAR-T cells initially had a difficult time taking hold in the brain tumor sphere. Initial clinical experience with many anti-cancer treatments have included ways to break down the BBB, for example with high intensity ultrasound or radiation. However, the optimal delivery route of CAR-T cells for treating brain tumors has remained an outstanding question. Although several ongoing CAR-T clinical trials for the treatment of GBM [e.g. NCT01 109095, NCT01454596, NCT02844062, NCT02209376] are delivering CAR-T cells by intravenous infusion, recent studies indicate that direct intracerebral CAR-T placement has superior efficacy and excellent tolerability w ith very few off-target toxicities noted. This includes a distinct reduction in the incidence of cytokine release syndrome and CAR-T -mediated neurotoxicity when cells are delivered intracerebrally. Additionally, the ease of access via subcutaneous reservoir and lack of requirement for pre-infusion lymphodepletion improve patient quality of life and reduce the additional complications associated w ith very lowrWBC counts. Our data show that implantation of anti-GARP CAR-T cells directly into the brain does not come with reduced effectiveness, indicating further that this route of delivery is applicable in brain tumors.

[0236] Finally, a major concern with targeting GARP via CAR-T cells is the potential for on- target, off-tumor toxicity. How ever, we did not observe ominous unexpected side effects of anti- GARP CAR-T in our preclinical models. In particular, the fear that our anti-GARP CAR-T cells could cause life threatening platelet destruction was unfounded for 2 key reasons: a) platelets are major producers of latent TGFp. As a result, all de novo synthesized GARP molecules in megakary ocytes and platelets are pre-complexed with LTGFp. There is essentially no LTGFp- free GARP on platelets; b) our anti-GARP antibody PIIO-I and the anti-GARP scFv used in the CAR-T construct recognize the LTGFP-binding site of GARP. Therefore, they can only bind to LTGFp-free GARP. Thus, biochemically, our anti-GARP CAR Tcell completely spares megakaryocytes and platelets. Together, our data would suggest that using anti-GARP CAR-T cells will be potentially safe in human patients, a hypothesis that will be definitively addressed in a planned upcoming phase I clinical trial.

[0237] In sum, we have developed a unique anti-GARP CAR-T cell modality that has shown promises against multiple preclinical models of GBM without significant toxicity. c) MATERIALS & METHODS

[0238] (1) TCGA data collection and downstream analysis

[0239] Gene expression matrix values, survival information and subtype annotation of patients with GBM were obtained from The Cancer Genome Atlas (TCGA) via cBioPortal, the Broad Firehose GDAC and GlioVis repositories; for survival analysis the LRRC32 high group was defined as samples with above median relative mRNA expression and LRRC32 low group defined as samples with below median relative transcript expression.

[0240] For the TCGA-GBM-2013 dataset, LRRC32 high group was defined by the top ten percent LRRC32 expression, and LRRC32 low group was defined by the bottom ten percent LRRC32 expression. GSVA enrichment score for each sample was performed for the GARP associated pathway using the GSVA package (v.1.49). The GSEA enrichment analysis for angiogenesis, myeloid compartment, T cell signature, and T cell exhaustion for TCGA-GBM- 2013 dataset was done using desktop GSEA software (v.4.3.2) with default settings.

[0241] (2) GSC ATAC-seq data collection and visualization

[0242] The human GSC ATAC-seq datasets aligned on hgl 9 reference genome with bigwig format were downloaded from GSE163853. Twelve oncological treatment naive samples were selected, including U3005MG-1, U3005MG-2, U3008MG-1, U3008MG-2, U3046MG-1, U3046MG-2, U3056MG-1, U3056MG-2, U3164MG-1, U3164MG-2, U3085MG-1, and U3085MG-2. GSE163853. Integrative Genomics Viewer (IGV, v. 2.4.1) was implemented to visualize the collected bigwig data.

[0243] (3) Cell lines.

[0244] Human glioblastoma U87-MG cell line was obtained from the American Type Culture Collection (ATCC® HTB-14™ Manassas, VA). Mouse glioma cell line GL261 was obtained from NCI Tumor Repository (Frederik, MD). CT-2A mouse cell line w as purchased from EMD Millipore (Cat. No: SCC194, Burlington, MA). All cells w ere cultured in Dulbecco's Modified Eagle Medium supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin (ThermoFisher Scientific, Waltham. MA). For cell lines containing puromycin-resistant gene, puromycin (Gibco, Cat. No: Al 113803, 1 pg / mL) was used for selection.

[0245] (4) Construction of lentiviral vectors.

[0246] The antibody targeting human GARP (PIIO-1) was reported previously38. Synthetic oligonucleotide encoding for the GGGGSGGGGSGGGGS (SEQ ID NO: 15) amino acid linker sequence was used to join the VH and VL DNA sequences to create PIIO-1 scFv. The PIIO-1 scFv is then connected with the CD8a hinge and transmembrane domains, and the intracellular signaling domain contains the co-stimulation domain consisting of 4- IBB and the CD3^ domain. Subsequently, the P1I0-1 scFv CAR coding sequence was synthesized by GeneScript and then cloned into Xmal / PacI sites of the pLenti-EFl alpha vector to generate our anti-GARP CAR lentiviral vector (pLenti-PIIO-l-CAR). The pLenti-EFl alpha vector was modified from pLenti CMV / TO Hygro empty (w214-l) (Addgene, Plasmid #17484), by replacing CMV promoter with the human EF-1 alpha promoter, deletion of hygromycin selection marker and replacing the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) by a 50-mer sequence (GTGACGAACATGGGGCAGATTGCTTCCAGTGCTTGCTGGGCATTGCTGAT) (SEQ ID NO: 14) (synthesized by GeneScript, Piscataway, NJ). To generate GARP overexpressing cell lines, the human GARP cDNA was amplified from a shuttle plasmid and subcloned into Nhel / BstBI sites of Addgenes's pLJMl-EGFP (Plasmid #19319) by replacing the EGFP gene. From Addgene, we also obtained pLenti CMV / TO Hygro empty' (w214-l) (Addgene plasmid #17484) and pLJMl-EGFP (Addgene plasmid # 19319).

[0247] (5) Generation of human and mouse GARP CAR-T cells by using lentiviruses.

[0248] To generate lentiviruses, HEK293FT cells (Thermo Fisher, Waltham, MA) were transfected with Addgene’s pCMV-VSV-G (Plasmid #8454), pCMV-dR8.9 (Plasmid #8455), and pLenti-EFlalpha-scFv (PIIO-l)-CAR using TransIT-293 Transfection Reagent (Mirus Bio, Madison. WI) or Lipofectamine 3000 (Thermo Fisher, Waltham, MA). The media on the HEK293FT cells was replaced with fresh media 24 hr post-transfection. At 72 hr post transfection, the lentiviral media was filtered through a 0.45 pm filter. The supernatant w as then concentrated using amicon viral concentration ultrafiltration 100 kDa tubes (Merck Millipore, Burlington, MA) with centrifugation at 1,200g for 15 min at 4°C. The freshly collected concentrated virus supernatant was used for spin-transduction by centrifugation at 800 g for 90 minutes at 32°C. For the human T cell transduction, T cells w ere enriched with a Pan T Cell Isolation Kit (Miltenyi Biotec, Auburn, CA) from the peripheral blood mononuclear cells (PBMCs. obtained from deidentified healthy donors). The isolated T-cells (5 x io6) were resuspended in 3 ml medium per well of a 6-well plate and stimulated with a 1 : 1 ratio CD3 / CD28 beads (Life Technologies, Carlsbad, CA) and IL-2 (Peprotech, Rocky Hill, NJ, 100 U / ml) for overnight. Next, the media (2 ml / well) was gently removed without disturbing clustering T-cells, and 1 ml pLenti-PIIO-l-CAR fresh concentrated virus particles were added (final 3 ml / well). T-cells were then cultured with the lentiviral virus for 24 hr in a TexMAX cell medium (Miltenyi Biotec) containing 10% fetal bovine serum and IL-2 (100 U / ml). For the mouse CAR-T cell generation, mouse T cells were first isolated from the spleen of C57BL / 6 mice with a mouse T Cell-specific Isolation Kit (Miltenyi Biotec, Cat# 130-095-130). Similar transduction procedures were followed. Mouse CAR-T cells were maintained in TexMAX cell medium (Miltenyi Biotec) containing 5% FBS (Sigma), IL-2 (100 U / ml), IL-7 (lOng / mL), and IL-15 (lOng / mL).

[0249] (6) Flow cytometric analysis.

[0250] To detect CAR expression. 1 * 106CAR-T or control T cells transduced with empty pLenti-EFl alpha vector were stained Protein L-PE conjugate (AcroBioSystems, Newark, DE) at 4°C for 30 minutes, along with fluorochrome-labeled antibodies against CD4 and CD8 (eBiosciences). To detect human GARP surface expression on GBM cell lines, cells were stained with anti-GARP antibody conjugated with phycoerythrin (PE, Biolegend). All samples’ fluorescent data were collected with a Cytek Aurora flow cytometer, and all data were analyzed with FlowJo software.

[0251] (7) In vitro cytotoxicity assay.

[0252] The ability of GARP-specific CAR-T cells to kill targets was tested in a 24-hour luciferase-based killing assay in 96-well flat-bottom plates at various effector: target ratio. All cell lines (U87, GL261 , and CT-2A) were engineered to stably express firefly luciferase (Cellomics Technology7, Hallethorpe, MD, USA). Target cells alone were seeded at the same cell density to determine the maximal luciferase expression (relative light units; RLUmax). After 24h hours, 100 pl of supernatant per well was removed, and 100 pl of luciferase substrate (Bright-Glo, Promega) was added to the remaining supernatant and cells. Emitted light was measured after five minutes of incubation using the Spectra Max ID5 plate reader (Molecular Devices, San Jose, CA). Lysis was determined as [1 - (RLUsample) / (RLUmax)] x 100.

[0253] (8) Cytokine ELISA.

[0254] Quantification of IL-2. IFN-y, and TNF-a were done using commercially available ELISA Kits, according to the manufacturer's instructions (R&D Systems, Minneapolis, MN).

[0255] (9) Multiplex immunofluorescence (mIF)

[0256] Paraffin-embedded slides from patients with known glioblastoma or matched LGG and HGG specimens were obtained from the Ohio State University Department of Pathology under an IRB-approved protocol (OSU IRB# 2020C0062). Deidentified samples were shared with no identifying health information. Commercially available tissue microarrays supplemented primary samples (USBiomax, Inc. [Cat# GL1002, GL803d, BS17016b]). Multiplex immunofluorescence was performed using Vectra Polaris™ Automated Quantitative Pathology Imaging System (Akoya Biosciences) according to manufacturer protocols. (10) Multiplex immunofluorescence image analysis mIF images in qtiff format were uploaded into InForm Tissue Analysis software (Akoya Biosciences). Briefly, this software allows for spectral unmixing, marker identification, phenotyping, and quantification of cells within a sample. First, representative sections from each sample were taken and uploaded into the training set to make an "‘algorithm” for the software to process full images. Regions of tissues were segmented into “high GARP” (defined as >250 GARP-positive cells per mm2) and “low GARP” (defined as <250 GARP-positive cells per mm2) based on input and manual notation from the research team and then via algorithm training until the accuracy calculated by the program was >97%. After tissue segmentation, cell segmentation based on a manual review to machine learning pipeline was performed. Phenotyping was performed in the same way, manually inputting phenotype designations to train the algorithm with machine learning algorithms performing the full collection. After full quantification of each sample image, the data was analyzed using the R4.3.0 plugin phenop tr Reports (Akoya Biosciences).

[0257] (11) In vivo studies.

[0258] Immunocompromised NOD-scid IL2Rgnu11(NSG) mice were obtained from Jackson Laboratory (Bar Harbor, ME, USA). Immunocompetent hLRRC32KIC57BL / 6 mice were reported previously. All animal studies were carried out following an approved protocol by the Ohio State University Institutional Animal Care and Use Committee. Murine GBMs were established by intracranial injections (5 x 104cells) of U87-WT, U87-hGARP, GL261-WT, GL261-hGARP, CT2A-WT, or CT2A-hGARP, all of which expressed stable luciferase. Bioluminescent imaging was performed with the Xenogen IVIS Spectrum (Caliper Life Sciences. Waltham, MA). Treatments with CAR-T or control T cells were performed by intra- tumoral injection. CAR-T doses were adjusted based on CAR+percentage determined via flow cytometry7using Protein L-PE (AcroBioSystems). All mice were observed daily and sacrificed when neurological symptoms developed, body score decreased, or at defined time points for the histological analysis. For the survival analysis, mice were observed for up to 100 days or until tumor endpoint criteria were reached.

[0259] (12) Statistical analysis

[0260] Statistical analysis was performed using GraphPad PRISM software, and independent sample t testing, paired sample t testing. Wilcoxon Rank-sum testing, and mixed effect model / ANOVA were used to determine significance for expenments in this study. Survival curves were plotted using the Kaplan-Meier method, and log-rank tests were used to compare curves between groups. Statistical analyses and tests used are indicated in the legend of corresponding figures. P values are represented as *, P < 0.05; **, P < 0.01, ***. P < 0.001 and ****, P < 0.0001.

[0261] 3. Example 3: PIIO-1 GARP CAR-T against a human Erythroleukemia Cell line in vitro

[0262] The cytotoxic activity of the PIIO-1 GARP CAR-T was tested in vitro using the HEL 92.1.7 erythroblast cell line, which endogenously expresses GARP. For this experiment, 3 different versions of the HEL cells were used: (i) HEL cells that were transduced with Empty Vector (EV), and therefore express the physiological levels of GARP, similarly to the wild t pe cells, (ii) HEL cells that were transduced to overexpress hGARP (GARP-OE), and (iii) HEL cells that GARP was deleted with CRISPR (GARP-KO)(Fig. 21). The cells were plated in various ratios with either the CAR-Ts or the mock T-cells for 24h, and an LDH based cytotoxicity7assay was performed to assess the HEL cell killing under the different conditions. In low EffectorTarget (E:T) ratios, the GARP CAR-T was active only against the GARP-OE cell line, while in higher E:T ratios, the GARP CAR-T was equally efficient between the artificially GARP overexpressing and the wild type HEL cells.

[0263] 4. Example 4: Mouse PIIO-1 GARP CAR-T cells eliminate Treg cells in vitro

[0264] To test if the PIIO-1 GARP CAR-T cells can eliminate activated Treg cells in vitro, we performed a direct Treg cytotoxicity assay (Fig. 22). Briefly, CD4+CD25+Tregs were immunomagnetically sorted from splenocytes of hLrrc32KI mice (hGARP Tregs). As controls, Treg cells yvere also extracted from Treg specific Lrrc32KO mice (GARPKO Tregs). After 48h of in vitro activation with aCD3 / aCD28. Treg cells were co-incubated yvith increasing ratios of either P11O CAR-Ts or mock-T cells, both generated in a CD45. 1 background, for 20h. At the end of the incubation time, the percentage of Foxp3+CD4+Tregs within the total CD45.2+target Treg cells yvas assessed yvith Floyv Cytometry7. We observed that after the 20h co-incubation of the CD45. 1 GARP CAR-T cells with the CD45.2 Tregs, there is a 50% reduction of the Treg within the CD45.2+ target cells. This effect was lost when GARPKO Tregs were used. (Fig. 23 and Fig. 24)

[0265] 5. Example 5: Human PIIO-1 GARP CAR-T cells targets converted Treg cells in vitro

[0266] To test if human PIIO-1 GARP CAR-T cells can target peripherally converted Treg cells, we isolated naive CD4+CD25- cells from splenocytes of either hLrrc32KI or Lrrc32KO mice, and yve cultured them in vitro under Treg ske ving conditions for 4 days, when we confirmed their conversion to CD4+Foxp3+ Treg cells with Flow Cytometry7. The in vitro converted Tregs were then co-incubated with increasing ratios of either human P11O CAR-Ts or mock-T cells for 18h. At the end of the incubation time, the percentage of Foxp3+CD4+ Tregs within the total CD4+ target T cells was assessed with Flow Cytometry. There was a reduction in the proportion of the hGARP Treg cells when they after the co-culture with PIIO-1 GARP CAR-Ts (Figure 25).

[0267] 6. Example 6: Human PIIO-1 GARP CAR-T cells eliminate Treg cells from Tumor Infiltrating Lymphocytes derived from a patient with Bladder Cancer

[0268] To test if PIIO-1 GARP CAR-T cells can target tumor infiltrating Tregs from patients, we expanded in vitro for 4 weeks the tumor infiltrating lymphocytes (TILs) from a fragment of tumor excised from a patient with bladder cancer. We then stained the TILs with Cell Trace Violet and co-incubated them with human PIIO-1 CAR-T cells for 20h. At the end of the incubation time, we assessed the CTV+:CTV- ratio as well as the proportion of CD4+Foxp3+ Tregs within the CTV+ target cells (Figure 26).

[0269] 7. Example 7: PIIO-1 GARP CAR-T infusion in GARP(-) PyMT tumor bearing mice decreases the numbers of the tumor infiltrating Tregs and prevents exhaustion of CD8+ T cells.

[0270] GARP CAR-T cells were administered intratumorally in hLrrc32KI mice (n=7) that had been implanted orthotopically with PyVT breast cancer cells. As controls, mock T cells were injected into another group of tumor bearing mice (n=6)(Figure 27). Tumor growth was measured for both groups post inoculation showing a significant reduction in tumor growth in the GARP CAR-T cell recipient mice compared to the mock treated group (Figure 27). Two days later, we assessed the tumor infiltrating lymphocytes with multi-dimensional flow cytometry (Figure 28 and 29). We found that there were significantly lower proportions of Tregs in the tumors of the GARP CAR-T treated mice compared to the controls (Figure 28). This was associated with improved T cell function, as there were significantly lower exhausted CD8 T cells in the tumors of the GARP CAR-T treated mice (Figure 29).

[0271] E. References

[0272] Ahmed, N. el al. HER2-specific T cells target primary glioblastoma stem cells and induce regression of autologous experimental tumors. Clin Cancer Res 16. 474-485. doi: 10. 1158 / 1078- 0432.CCR-09-1322 (2010).

[0273] Akhurst, R. J. Targeting TGF-beta Signaling for Therapeutic Gain. Cold Spring Harb Perspect Biol 9, doi: 10.1101 / cshperspect.a022301 (2017). Antonios, J. P. et al. Immunosuppressive tumor-infiltrating myeloid cells mediate adaptive immune resistance via a PD-1 / PD-L1 mechanism in glioblastoma. Neuro-Oncology, now287, doi: 10. 1093 / neuonc / now287 (2017).

[0274] Azam, Z., To, S. T. & Tannous, B. A. Mesenchymal Transformation: The Rosetta Stone of Glioblastoma Pathogenesis and Therapy Resistance. Adv Set (Weinh) 7, 2002015, doi: 10. 1002 / advs.202002015 (2020).

[0275] Bagley, S. J.. Desai, A. S.. Linette, G. P., June, C. H. & O’Rourke, D. M. CAR T-cell therapy for glioblastoma: recent clinical advances and future challenges. Neuro-Oncology 20, 1429- 1438, doi: 10.1093 / neuonc / noy032 (2018).

[0276] Bao, S. et al. Glioma stem cells promote radioresistance by preferential activation of the DNA damage response. Nature 444, 756-760, doi: 10.1038 / nature05236 (2006).

[0277] Brennan, W.. Cameron et al. The Somatic Genomic Landscape of Glioblastoma. Cell 155, 462- 477, doi: 10. 1016 / j.cell.2013.09.034 (2013).

[0278] Brown, C. E. et al. Bioactivity and Safety of IL 13Ralpha2 -Redirected Chimeric Antigen Receptor CD8+ T Cells in Patients with Recurrent Glioblastoma. Clin Cancer Res 21, 4062- 4072, doi: 10.1158 / 1078-0432.CCR-15-0428 (2015).

[0279] Brown, C. E. et al. Regression of Glioblastoma after Chimeric Antigen Receptor T-Cell Therapy. New England Journal of Medicine 375, 2561-2569, doi:10.1056 / nejmoal610497 (2016).

[0280] Brown, C. E. et al. Stem-like tumor-initiating cells isolated from IL13Ralpha2 expressing gliomas are targeted and killed by IL13-zetakine-redirected T Cells. Clin Cancer Res 18. 2199- 2209, doi : 10. 1158 / 1078-0432. CCR- 11 - 1669 (2012).

[0281] Campbell, M. G. et al. Cryo-EM Reveals Integrin-Mediated TGF-beta Activation without Release from Latent TGF-beta. Cell 180, 490-501 e416, doi: 10.1016 / j.cell.2019.12.030 (2020).

[0282] Carrillo-Galvez, A. B. et al. Mesenchymal stromal cells express GARP / LRRC32 on their Surface: Effects on their biology and immunomodulatory capacity. Stem cells, doi: 10.1002 / stem, 1821 (2014). Cheng. L. et al. Glioblastoma Stem Cells Generate Vascular Pericytes to Support Vessel Function and Tumor Growth. Cell 153, 139-152, doi: 10. 1016 / j. cell.2013.02.021 (2013).

[0283] Choi. B. D. et al. Intraventricular CARv3-TEAM-E T Cells in Recurrent Glioblastoma. N Engl J Met / 390. 1290-1298, doi : 10.1056 / NEJMoa2314390 (2024).

[0284] Chow, K. H. et al. S100A4 Is a Biomarker and Regulator of Glioma Stem Cells That Is Critical for Mesenchymal Transition in Glioblastoma. Cancer Res 77. 5360-5373, doi: 10. 1158 / 0008- 5472.CAN-17-1294 (2017).

[0285] Cuende, J. et al. Monoclonal antibodies against GARP / TGF-betal complexes inhibit the immunosuppressive activity of human regulatory T cells in vivo. Sci Transl Med 7, 284ra256, doi: 10. 1126 / scitranslmed.aaal983 (2015).

[0286] De Streel, G. et al. Selective inhibition of TGF-pi produced by GARP-expressing Tregs overcomes resistance to PD-1 / PD-L1 blockade in cancer. Nature Communications 11 (2020).

[0287] Delgado-Lopez, P. D. & Corrales-Garcia, E. M. Survival in glioblastoma: a review on the impact of treatment modalities. Clinical and Translational Oncology 18, 1062-1071, doi: 10.1007 / sl2094-016-1497-x (2016).

[0288] Derynck, R., Turley, S. J. & Akhurst, R. J. TGFbeta biology in cancer progression and immunotherapy. Nat Rev Clin Oncol 18, 9-34, doi: 10.1038 / s41571-020-0403-l (2021).

[0289] Doucette, T. et al. Immune Heterogeneity of Glioblastoma Subtypes: Extrapolation from the Cancer Genome Atlas. Cancer Immunology Research 1, 112-122, doi: 10.1158 / 2326-6066. cir- 13-0028 (2013).

[0290] Gaignage, M. et al. Blocking GARP -mediated activation of TGF-pi did not alter innate or adaptive immune responses to bacterial infection or protein immunization in mice. Cancer Immunology, Immunotherapy 71, 1851-1862 (2022).

[0291] Gangoso, E. et al. Glioblastomas acquire myeloid-affiliated transcriptional programs via epigenetic immunoediting to elicit immune evasion. Cell 184, 2454-2470. e2426 (2021).

[0292] Gasca-Salas, C. et al. Blood-brain barrier opening with focused ultrasound in Parkinson's disease dementia. Nature Communications 12, doi: 10.1038 / s41467-021-21022-9 (2021). Hahn, S. A. et al. Soluble GARP has potent antiinflammatory and immunomodulatory impact on human CD4(+) T cells. Blood 122, 1182-1191, doi:10.1182 / blood-2012- 12-474478 (2013).

[0293] Han, Y. el al. TISCH2: expanded datasets and new tools for single-cell transcriptome analyses of the tumor microenvironment. Nucleic Acids Res 51, D1425-D1431, doi: 10.1093 / nar / gkac959 (2023).

[0294] Hay, K. A. et al. Kinetics and biomarkers of severe cytokine release syndrome after CD 19 chimeric antigen receptor-modified T-cell therapy. Blood 130, 2295-2306 (2017).

[0295] Hodges, T. R. et al. Mutational burden, immune checkpoint expression, and mismatch repair in glioma: implications for immune checkpoint immunotherapy. Neuro-Oncology 19, 1047-1057, doi: 10. 1093 / neuonc / nox026 (2017).

[0296] Huang, Y. et al. A proangiogenic signaling axis in myeloid cells promotes malignant progression of glioma. Journal of Clinical Investigation 127, 1826-1838 (2017).

[0297] June, C. H., O'Connor, R. S., Kawalekar, O. U., Ghassemi, S. & Milone, M. C. CAR T cell immunotherapy for human cancer. Science 359, 1361-1365, doi: 10.1126 / science.aar6711 (2018).

[0298] Kaffes, 1. et al. Human Mesenchymal glioblastomas are characterized by an increased immune cell presence compared to Proneural and Classical tumors. Oncoimmunology 8, el 655360, doi: 10.1080 / 2162402X.2019. 1655360 (2019).

[0299] Kreatsoulas, D. et al. Translational landscape of glioblastoma immunotherapy for physicians: guiding clinical practice with basic scientific evidence. J Hematol Oncol 15, 80, doi: 10.1186 / s 13045-022-01298-0 (2022).

[0300] Krenciute, G. et al. Transgenic Expression of IL 15 Improves Antiglioma Activity of IL13Ralpha2-CAR T Cells but Results in Antigen Loss Variants. Cancer Immunol Res 5, 571 - 581, doi: 10.1158 / 2326-6066.CIR-16-0376 (2017).

[0301] Lee-Chang, C. et al. Myeloid-Derived Suppressive Cells Promote B cell-Mediated Immunosuppression via Transfer of PD-L1 in Glioblastoma. Cancer Immunology Research 7, 1928-1943, doi: 10.1158 / 2326-6066. cir- 19-0240 (2019). Li, A. et al. Selective targeting of GARP-LTGFbeta axis in the tumor microenvironment augments PD-1 blockade via enhancing CD8(+) T cell antitumor immunity. J Immunother Cancer 10, doi: 10.1136 / jitc-2022-005433 (2022).

[0302] Li, A. et al. Selective targeting of GARP-LTGFP axis in the tumor microenvironment augments PD-1 blockade via enhancing CD8. J Immunother Cancer 10, doi: 10.1 136 / jitc-2022-005433 (2022).

[0303] Lienart, S. et al. Structural basis of latent TGF-betal presentation and activation by GARP on human regulatory T cells. Science 362, 952-956, doi: 10.1 126 / science.aau2909 (2018).

[0304] Liu, S., Ren, J. & Ten Dijke. P. Targeting TGFbeta signal transduction for cancer therapy.

[0305] Signal Transduct Target Ther 6. 8, doi: 10.1038 / s41392-020-00436-9 (2021).

[0306] Louis, D. N. et al. The 2021 WHO Classification of Tumors of the Central Nervous System: a summary. Neuro-Oncology 23, 1231-1251, doi:doi: 10.1093 / neuonc / noabl06 (2021).

[0307] Lu, X. et al. Cell-lineage controlled epigenetic regulation in glioblastoma stem cells determines functionally distinct subgroups and predicts patient survival. Nat Commun 13, 2236, doi : 10.1038 / s41467-022-29912-2 (2022).

[0308] Macaulay, I. C. et al. Comparative gene expression profiling of in vitro differentiated megakaryocytes and erythroblasts identifies novel activatory and inhibitory platelet membrane proteins. Blood 109, 3260-3269, doi: 10.1182 / blood-2006-07-036269 (2007).

[0309] Majzner, R. G. et al. GD2-CAR T cell therapy for H3K27M-mutated diffuse midline gliomas. Nature 603, 934-941 (2022).

[0310] Majzner, R. G. et al. GD2-CAR T cell therapy for H3K27M-mutated diffuse midline gliomas. Nature 603, 934-941, doi: 10.1038 / s41586-022-04489-4 (2022).

[0311] Marenco-Hillembrand, L. et al. Trends in glioblastoma: outcomes over time and type of intervention: a systematic evidence based analysis. Journal of Neuro-Oncology 147, 297-307 (2020).

[0312] Marenco-Hillembrand, L. et al. Trends in glioblastoma: outcomes over time and type of intervention: a systematic evidence based analysis. Journal of Neuro-Oncology 147, 297-307, doi : 10. 1007 / s 11060-020-03451 -6 (2020). Martinez-Lage, M. et al. Immune landscapes associated with different glioblastoma molecular subtypes. Acta Neuropathologica Communications 7 (2019).

[0313] Martinez-Lage, M. et al. Immune landscapes associated with different glioblastoma molecular subtypes. Acta Neuropathologica Communications 7. doi: 10.1186 / s40478-019-0803-6 (2019).

[0314] Metelli, A. et al. Immunoregulatory functions and the therapeutic implications of GARP-TGF-P in inflammation and cancer. Journal of Hematology & Oncology 11 (2018).

[0315] Metelli, A. et al. Immunoregulatory functions and the therapeutic implications of GARP-TGF- beta in inflammation and cancer . J Hematol Oncol 11, 24, doi: 10.1186 / sl3045-018-0570-z (2018).

[0316] Metelli, A. et al. Immunoregulatory functions and the therapeutic implications of GARP-TGF-P in inflammation and cancer. Journal of Hematology & Oncology 11, doi:10.1186 / sl3045-018- 0570-z (2018).

[0317] Metelli, A. et al. Surface Expression of TGFbeta Docking Receptor GARP Promotes Oncogenesis and Immune Tolerance in Breast Cancer. Cancer Res 76, 7106-7117, doi: 10.1158 / 0008-5472. CAN-16-1456 (2016).

[0318] Metelli, A. et al. Surface Expression of TGFp Docking Receptor GARP Promotes Oncogenesis and Immune Tolerance in Breast Cancer. Cancer Research 76, 7106-7117 (2016).

[0319] Metelli, A. et al. Thrombin contributes to cancer immune evasion via proteolysis of plateletbound GARP to activate LTGF-p. Science Translational Medicine 12, eaay4860 (2020).

[0320] Metelli, A. et al. Thrombin contributes to cancer immune evasion via proteolysis of plateletbound GARP to activate LTGF-beta. Sci TranslMed 12, doi: 10.1126 / scitranslmed.aay4860 (2020).

[0321] Miao, H. et al. EphA2 promotes infiltrative invasion of glioma stem cells in vivo through crosstalk with Akt and regulates stem cell properties. Oncogene 34, 558-567, doi: 10.1038 / onc.2013.590 (2015).

[0322] Moreau, J. M., Velegraki, M., Bolyard, C., Rosenblum, M. D. & Li, Z. Transforming growth factor-betal in regulatory T cell biology. Sci Immunol 7, eabi4613, doi : 10. 1126 / sciimmunol . abi4613 (2022). Morgan, R. A. et al. Recognition of glioma stem cells by genetically modified T cells targeting EGFRvIII and development of adoptive cell therapy for glioma. Hum Gene Ther 23, 1043-1053, doi: 10.1089 / hum.2012.041 (2012).

[0323] O’Rourke, D. M. et al. A single dose of peripherally infused EGFRvIII-directed CAR T cells mediates antigen loss and induces adaptive resistance in patients with recurrent glioblastoma. Science Translational Medicine 9, eaaa0984, doi: 10. 1126 / scitranslmed.aaa0984 (2017).

[0324] Obstfeld. A. E. et al. Cytokine release syndrome associated with chimeric-antigen receptor T- cell therapy: clinicopathological insights. Blood 130, 2569-2572 (2017).

[0325] Oh. T. et al. Immunocompetent murine models for the study of glioblastoma immunotherapy. Journal of Translational Medicine 12. 107, doi: 10. 1186 / 1479-5876-12-107 (2014).

[0326] O'Leary. M. C. et al. FDA Approval Summary' : Tisagenlecleucel for Treatment of Patients with Relapsed or Refractory B-cell Precursor Acute Lymphoblastic Leukemia. Clin Cancer Res 25, 1142-1146, doi: 10.1158 / 1078-0432.CCR-18-2035 (2019).

[0327] Ollendorff, V., Noguchi, T., deLapeyriere, O. & Birnbaum, D. The GARP gene encodes a new member of the family of leucine-rich repeat-containing proteins. Cell Growth Differ 5, 213-219 (1994).

[0328] Rachidi, S. et al. Platelets subvert T cell immunity against cancer via GARP-TGFbeta axis. Sci Immunol 2. doi: 10.1126 / sciimmunol.aai7911 (2017).

[0329] Rajendran, S. et al. Single-cell RNA sequencing reveals immunosuppressive myeloid cell diversity during malignant progression in a murine model of glioma. Cell Rep 42, 112197, doi : 10. 1016 / j . celrep.2023. 112197 (2023).

[0330] Raychaudhuri, B. et al. Myeloid-derived suppressor cell accumulation and function in patients with newly diagnosed glioblastoma. Neuro-Oncology 13, 591-599, doi:10.1093 / neuonc / nor042 (2011).

[0331] Sadelain, M. CAR therapy: the CD19 paradigm. J Clin Invest 125, 3392-3400, doi: 10.1172 / JCI80010 (2015). Salem. M. et al. GARP Dampens Cancer Immunity by Sustaining Function and Accumulation of Regulatory T Cells in the Colon. Cancer Res 79, 1178-1190, doi: 10.1158 / 0008-5472.CAN-18- 2623 (2019).

[0332] San-Miguel, J. et al. Cilta-cel or Standard Care in Lenalidomide-Refractory Multiple Myeloma. N Engl J Med f 335-347, doi:10. 1056 / NEJMoa2303379 (2023).

[0333] Stock, S., Schmitt, M. & Sellner, L. Optimizing Manufacturing Protocols of Chimeric Antigen Receptor T Cells for Improved Anticancer Immunotherapy. International Journal of Molecular Sciences 20, 6223, doi:10.3390 / ijms20246223 (2019).

[0334] Stupp, R. et al. Effect of Tumor-Treating Fields Plus Maintenance Temozolomide vs Maintenance Temozolomide Alone on Survival in Patients With Glioblastoma: A Randomized Clinical Trial. JAMA 318, 2306-2316, doi: 10.1001 / jama.2017.18718 (2017).

[0335] Stupp, R. et al. Effects of radiotherapy with concomitant and adjuvant temozolomide versus radiotherapy alone on survival in glioblastoma in a randomised phase III study: 5-year analysis of the EORTC-NCIC trial. Lancet Oncol 10, 459-466, doi: 10.1016 / S 1470-2045(09)70025-7 (2009).

[0336] Stupp, R. et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N Engl J Med 352, 987-996, doi: 10.1056 / NEJMoa043330 (2005).

[0337] Suva, M. L. & Tirosh, I. The Glioma Stem Cell Model in the Era of Single-Cell Genomics. Cancer Cell 37, 630-636, doi: 10.1016 / j.ccell.2020.04.001 (2020).

[0338] Thakkar, J. P. et cd. Epidemiologic and Molecular Prognostic Review of Glioblastoma. Cancer Epidemiology, Biomarkers & Prevention 23, 1985-1996, doi: 10. 1158 / 1055-9965. epi-14-0275 (2014).

[0339] Tran, D. Q. et al. GARP (LRRC32) is essential for the surface expression of latent TGF-beta on platelets and activated FOXP3+ regulatory T cells. Proc Natl Acad Sci U SA 106, 13445-13450, doi: 10.1073 / pnas.0901944106 (2009).

[0340] Umemura, N. et al. Tumor-infiltrating myeloid-derived suppressor cells are pleiotropic-inflamed monocytes / macrophages that bear Ml - and M2-type characteristics. Journal of Leukocyte Biology 83, 1136-1144, doi: 10. 1189 / jlb.0907611 (2008). Verhaak. R. G. et al. Integrated genomic analysis identifies clinically relevant subtypes of glioblastoma characterized by abnormalities in PDGFRA, IDH1, EGFR, and NF1. Cancer Cell 17, 98-110, doi: 10.1016 / j.ccr.2009.12.020 (2010).

[0341] Verhaak. R. G. W. et al. Integrated Genomic Analysis Identifies Clinically Relevant Subtypes of Glioblastoma Characterized by Abnormalities in PDGFRA, IDH1 , EGFR, and NF1. Cancer Cell 17, 98-110, doi: 10.1016 / j.ccr.2009.12.020 (2010).

[0342] Vermeersch, E. et al. The role of platelet and endothelial GARP in thrombosis and hemostasis. PLoSOne 12, e0173329, doi: 10.1371 / joumal.pone.0173329 (2017).

[0343] Wang, H. et al. S100A11 Promotes Glioma Cell Proliferation and Predicts Grade-Correlated Unfavorable Prognosis. Technol Cancer Res Treat 20, 15330338211011961 (2021).

[0344] Wang, Q. et al. Tumor Evolution of Glioma-Intrinsic Gene Expression Subtypes Associates with Immunological Changes in the Microenvironment. Cancer Cell 32, 42-56.e46 (2017).

[0345] Wang, Q. et al. Tumor Evolution of Glioma-Intrinsic Gene Expression Subty pes Associates with Immunological Changes in the Microenvironment. Cancer Cell 32, 42-56.e46, doi: 10.1016 / j.ccell.2017.06.003 (2017).

[0346] Wang, R., Wan, Q., Kozhaya, L., Fujii, H. & Unutmaz, D. Identification of a regulatory T cell specific cell surface molecule that mediates suppressive signals and induces Foxp3 expression. PLoS One 3, e2705, doi: 10.1371 / joumal.pone.0002705 (2008).

[0347] Xu, H. et al. ITGB2 as a prognostic indicator and a predictive marker for immunotherapy in gliomas. Cancer Immunology, Immunotherapy 71, 645-660 (2022).

[0348] Yang, X. J. et al. TGF-pi enhances tumor-induced angiogenesis via JNK pathway and macrophage infiltration in an improved zebrafish embryo / xenograft glioma model. Ini Immunopharmacol 15, 191-198 (2013).

[0349] Zhang, C. et al. TGF-02 initiates autophagy via Smad and non-Smad pathway to promote glioma cells’ invasion. Journal of Experimental & Clinical Cancer Research 36, doi: 10.1186 / sl3046-017-0628-8 (2017). Zhang. P., Xia. Q.. Liu, L., Li. S. & Dong. L. Current Opinion on Molecular Characterization for GBM Classification in Guiding Clinical Diagnosis, Prognosis, and Therapy. Front Mol Biosci 7, 562798, doi: 10.3389 / fmolb.2020.562798 (2020).

[0350] Zhang. X. et al. Increased Expression of GARP in Papillary Thyroid Carcinoma. Endocrine Pathology 30, 1 -7 (2019).

[0351] Zhang, Y. et al. Comprehensive trans criptomic characterization reveals core genes and module associated with immunological changes via 1619 samples of brain glioma. Cell Death Dis 12, 1 140 (2021).

[0352] Zimmer, N. et al. GARP as an Immune Regulatory Molecule in the Tumor Microenvironment of Glioblastoma Multiforme. IntJMol Sei 20, doi: 10.3390 / ijms20153676 (2019).

Claims

VII. CLAIMSWhat is claimed is:

1. A chimeric antigen receptor (CAR) immune cell comprising an anti -glycoprotein A repetitions predominant (GARP) binding molecule.

2. The CAR immune cell of claim 1 , wherein the anti-GARP binding molecule comprises i) a variable heavy chain (VH) complementarity determining region 1 (CDR1), CDR2, and CDR3 as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively and ii) a variable light chain (VL) complementarity determining region 1 (CDR1), CDR2, and CDR3 as set forth in SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, respectively.

3. The CAR immune cell of claim 1 or 2. wherein the anti-GARP binding molecule comprises a Vn domain at least about 80%, 90%, 95%, 98% or 99% identical to the Vn domain of the humanized PIIO-1 (huPIIO-1) antibodies as set forth in SEQ ID NO: 7, 8, 9 or 10 and / or a VL domain at least about 80% 90%, 95%, 98% or 99% identical to the VL domain of the huPIIO- 1 antibodies as set forth in SEQ ID NO:

11.

12. or 13.

4. The CAR immune cell of claim 3, wherein the anti-GARP binding molecule comprises a VH domain as set forth in SEQ ID NO: 7, 8, 9, or 10 and / or a VL domain as set forth in SEQ ID NO: 11, 12 or 13.

5. The CAR immune cell of any one of claims 1-4. wherein the anti-GARP binding molecule comprises a Vn domain as set forth in SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 12 (VH1 VL1), a VH domain as set forth in SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 13 (VH1VL2), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 12 (VH2VL1), SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 11 (VH1 VL3), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 13 (VH2VL2), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 11 (VH2VL3), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 12 (VH3VL1), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 13 (VH3VL2), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 11 (VH3VL3), a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 12 (VH4VL1), a VH domain as set forth inSEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 13 (VH4VL2), or a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 11 (VH4VL3).

6. The CAR immune cell of any one of claims 1-5. wherein the immune cell comprises a T cell, B cell, NK cell, NK. T cell, or macrophage.

7. The CAR immune cell of claim 6, wherein the immune cell is a T cell.

8. The CAR immune cell of any one of claims 1-7. wherein the CAR further comprises a CD28, 41BB, 0X40, Myd88, ICOS, CD2, CD226, BAFF-R, TACI, or IL2RB signaling domain.

9. A method for treating a cancer in a subject comprising administering to the subject a therapeutically effective amount of the CAR immune cell of any one of claims 1-8.

10. A method of treating a cancer in a subject comprising administering to the subject a therapeutically effective amount of a chimeric antigen receptor (CAR) immune cell comprising an anti-glycoprotein A repetitions predominant (GARP) binding molecule.

11. The method of treating a cancer of claim 10, wherein the anti-GARP binding molecule comprises i) a variable heavy chain (VH) complementarity determining region 1 (CDR1), CDR2, and CDR3 as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively and ii) a variable light chain (VL) complementarity determining region 1 (CDR1), CDR2, and CDR3 as set forth in SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, respectively.

12. The method of treating a cancer of claim 10 or 11 , wherein the anti-GARP binding molecule comprises a VII domain at least about 80%, 90%, 95%, 98% or 99% identical to the VII domain of the humanized PIIO-1 (huPIIO-1) antibodies as set forth in SEQ ID NO: 7, 8, 9 or 10 and / or a VL domain at least about 80% 90%, 95%, 98% or 99% identical to the VL domain of the huPIIO-1 antibodies as set forth in SEQ ID NO: 11, 12, or 13.

13. The method of treating a cancer of claim 12. wherein the anti-GARP binding molecule comprises a VH domain as set forth in SEQ ID NO: 7, 8, 9, or 10 and / or a VL domain as set forth in SEQ ID NO: 11, 12 or 13.

14. The method of treating a cancer of any one of claims 10-13, wherein the anti-GARP binding molecule comprises a VH domain as set forth in SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 12 (VH1VL1). a VH domain as set forth in SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 13 (VH1VL2), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 12 (VH2VL1), SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 11 (VH1 VL3), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 13 (VH2VL2), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 11 (VH2VL3), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 12 (VH3VL1), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 13 (VH3VL2), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 11 (VH3VL3), a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 12 (VH4VL1), a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 13 (VH4VL2), or a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 11 (VH4VL3).

15. The method of treating a cancer of any one of claims 10-14, wherein the immune cell comprises a T cell, B cell, NK cell, NK T cell, or macrophage.

16. The method of treating a cancer of claim 15, wherein the immune cell is a T cell.

17. The method of treating a cancer of any one of claims 9-16, wherein the CAR further comprises a CD28, 4 IBB, 0X40, Myd88, ICOS, CD2, CD226, BAFF-R, TACI, or IL2RB signaling domain.

18. The method of treating a cancer of any one of claims 9-17, wherein the cancer and / or the T regulator cells (Treg) in the tumor microenvironment (TME) are GARP positive.

19. The method of treating a cancer of any one of claims 9-18, wherein the cancer is glioblastoma, bladder cancer, breast cancer, or leukemia.

20. The method of treating a cancer of any one of claims 9-19, wherein the CAR immune cell is administered systemically.

21. The method of treating a cancer of any one of claims 9-20, wherein the CAR immune cell is administered intravenously, intradermally, intratumorally, intramuscularly, intraperitoneally, subcutaneously, or locally.

22. The method of treating a cancer of any one of claims 9-21, wherein the CAR immune cell is administered intratumorally.

23. The method of treating a cancer of any one of claims 9-22, further comprising administering to the subject at an anticancer therapy and / or an anticancer agent to the subject.

24. A method of modulating immunosuppressive T regulatory' (Treg) cells in a tumor microenvironment (TME) of a cancer in a subject, comprising administering to the subject a therapeutically effective amount of the CAR immune cell of any one of claims 1-8.

25. A method of modulating immunosuppressive T regulatory' (Treg) cells in a tumor microenvironment (TME) of a cancer in a subject, comprising administering to the subject a therapeutically effective amount of a chimeric antigen receptor (CAR) immune cell comprising an anti-glycoprotein A repetitions predominant (GARP) binding molecule.

26. The method of modulating immunosuppressive Treg cells in a TME of a cancer of claim 25, wherein the anti-GARP binding molecule comprises i) a variable heavy chain (VH) complementarity determining region 1 (CDR1), CDR2, and CDR3 as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively and ii) a variable light chain (VL) complementarity determining region 1 (CDR1), CDR2, and CDR3 as set forth in SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, respectively.

27. The method of modulating immunosuppressive Treg cells in a TME of a cancer of claim 25 or 26, wherein the anti-GARP binding molecule comprises a VH domain at least about 80%, 90%, 95%, 98% or 99% identical to the VH domain of the humanized PIIO-1 (huPIIO-1) antibodies as set forth in SEQ ID NO: 7, 8, 9 or 10 and / or a VL domain at least about 80% 90%,95%. 98% or 99% identical to the VL domain of the huPHO-1 antibodies as set forth in SEQ ID NO: 11, 12, or 13.

28. The method of modulating immunosuppressive Treg cells in a TME of a cancer of claim 27, wherein the anti-GARP binding molecule comprises a VH domain as set forth in SEQ ID NO: 7, 8, 9, or 10 and / or a VL domain as set forth in SEQ ID NO: 11, 12 or 13.

29. The method of modulating immunosuppressive Treg cells in a TME of a cancer of any one of claims 25-28, wherein the anti-GARP binding molecule comprises a VH domain as set forth in SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 12 (VH1VL1), a VH domain as set forth in SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 13 (VH1VL2), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 12 (VH2VL1), SEQ ID NO: 9 and VL domain as set forth in SEQ ID NO: 11 (VH1 VL3), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 13 (VH2VL2), a VH domain as set forth in SEQ ID NO: 10 and VL domain as set forth in SEQ ID NO: 11 (VH2VL3), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 12 (VH3VL1), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 13 (VH3VL2), a VH domain as set forth in SEQ ID NO: 8 and VL domain as set forth in SEQ ID NO: 11 (VH3VL3), a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 12 (VH4VL1), a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 13 (VH4VL2), or a VH domain as set forth in SEQ ID NO: 7 and VL domain as set forth in SEQ ID NO: 11 (VH4VL3).

30. The method of modulating immunosuppressive Treg cells in a TME of a cancer of any one of claims 25-29, wherein the immune cell comprises a T cell, B cell, NK. cell, NK T cell, or macrophage.

31. The method of modulating immunosuppressive Treg cells in a TME of a cancer of claim 30, wherein the immune cell is a T cell.

32. The method of modulating immunosuppressive Treg cells in a TME of a cancer of anyone of claims 25-31, wherein the CAR further comprises a CD28, 41BB, 0X40, Myd88. ICOS, CD2, CD226, BAFF-R, TACI, or IL2RB signaling domain.

33. The method of modulating immunosuppressive Treg cells in a TME of a cancer of any one of claims 24-32, wherein the T regulator cells (Treg) in the tumor microenvironment (TME) are GARP positive.

34. The method of modulating immunosuppressive Treg cells in a TME of a cancer of any one of claims 24-33, wherein the cancer is glioblastoma, bladder cancer, breast cancer, or leukemia.

35. The method of modulating immunosuppressive Treg cells in a TME of a cancer of anyone of claims 24-34, wherein the CAR immune cell is administered intratumorally.

Images