High throughput parallel synthesis of small molecule degraders

Abstract

Disclosed herein are high throughput synthetic methods for the deliberate and prospective discovery of molecular glues which can be used to form composite protein-ligand surfaces that facilitate interfacial binding to other proteins over dispersed surfaces. In particular, this application discloses a high throughput approach using sulfur(VI) fluoride exchange (SuFEx) transformations and N-hydroxysuccinimide (NHS)-ester derived amide couplings to prospectively repurpose known ligands for a prolein-of-interest into degraders and compounds capable of inducing proximity to other proteins. Disclosed herein are methods of developing known ligands of a target protein into degraders of the target proteins. Further disclosed are methods of developing novel small molecule chromatin-competitive inhibitors of the eleven nineteen leukemia (ENL) YEATS domain into effective degraders of ENL.

Description

TSRI 2225.1PC     HIGH THROUGHPUT PARALLEL SYNTHESIS OF SMALL MOLECULE DEGRADERS CROSS REFERENCE TO RELATED APPLICATION

[0001] This application claims priority to U.S. provisional patent application No. 63 / 588,354, which was filed on October 6, 2023, and which is hereby incorporated by reference in its entirety. GOVERNMENT SUPPORT

[0002] This invention was made with government support under DP-5-OD26380 awarded by the National Institutes of Health. The government has certain rights in the invention. FIELD OF THE INVENTION

[0003] Disclosed herein are high throughput synthetic methods for the deliberate and prospective discovery of molecular glues which can be used to form composite protein-ligand surfaces that facilitate interfacial binding to other proteins over dispersed surfaces. In particular, this application discloses a high throughput approach using sulfur(VI) fluoride exchange (SuFEx) transformations and N-hydroxysuccinimide (NHS)-ester derived amide couplings to prospectively repurpose known ligands for a protein-of-interest into degraders and compounds capable of inducing proximity to other proteins. Disclosed herein are methods of developing known ligands of a target protein into degraders of the target proteins. Further disclosed are methods of developing novel small molecule chromatin-competitive inhibitors of the eleven nineteen leukemia (ENL) YEATS domain into effective degraders of ENL. BACKGROUND OF THE INVENTION

[0004] Small molecule drugs typically function by stoichiometrically engaging hydrophobic pockets on a protein surfaces (Fig.1a). These pockets often exist because they are involved in binding natural small-molecule ligands as part of a normal physiological process. Unfortunately, many of the most coveted anti-cancer targets are proteins that lack functional ligand-binding pockets (Fig.1b). To overcome the challenges associated with drugging these proteins, we require new approaches to discovery chemistry. PROTACs, which 1       TSRI 2225.1PC     induce targeted protein degradation by independently binding a target of interest and an E3 substrate adapter, have found widespread use as chemical probes and investigational new drugs (7). However, despite the several examples of advanced PROTAC drug candidates, there are several aspects of PROTAC design that can make clinical translation difficult. Foremost among these is the large size of PROTAC molecules, which can result in poor solubility, cell penetration, and pharmacokinetics. In addition, only two E3s (CRBN and VHL), have found widespread use in PROTAC design, limiting the scope of addressable targets.

[0005] Molecular glues have emerged as a class of molecules that can overcome many of the shortcomings associated with PROTACs (1, 2). Unlike PROTACs, molecular glues do not require an independent ligand-binding pockets on each of the dimerized proteins. Instead, they rely on the ability of a composite protein-ligand surface to facilitate interfacial binding to another protein over a dispersed surface (Fig.1c). This mechanism allows for proteins without a discernable ligand-binding pocket to be pharmacologically manipulated. Pomalidomide, for example, binds to CRBN and creates a composite surface that recruits the undruggable transcription factors IKZF1 / 3 (Fig.1d) (8–11). Since CRBN is an E3 substrate receptor of a cullin-RING ubiquitin ligase complex, pomalidomide-induced proximity leads to the ubiquitination and degradation of IKZF1 / 3. The discovery that CRBN can be used to degrade otherwise undruggable transcription factors has motivated broad efforts to discover molecular glues.

[0006] Several other molecular glue degraders have now been discovered, either serendipitously through mechanism of action studies or prospectively through target-agnostic phenotypic screens. These include (among others): (i) CDK12 / Cyclin K inhibitors that degrade Cyclin K via DDB1, (ii) BTB ligands that degrade BCL6 by forming polymers that are recognized by SIAH1, and (iii) modified bromodomain ligands that induce BRD4 degradation via DCAF16 (Fig.2a) (3, 4, 12–15). The molecular glue degrader in each of these examples is structurally related to non-glue ligands that were previously known for the target – the only differences being subtle modifications that present outward toward the solvent (Fig. 2a). These modifications, discovered retrospectively, create a composite protein-ligand surface that can lead to degradation (Fig.2b). We hypothesize that such modifications can be identified prospectively for a given target of interest using high-throughput medicinal chemistry (Fig 2c). 2       TSRI 2225.1PC

[0007] Our laboratory is unified around efforts to develop chemical probes that can be used as tools to study the regulatory mechanisms governing mRNA transcription. Recently, we have reported the discovery of compounds that can inhibit ENL function in living systems. ENL is a chromatin reader protein that selectively recruits transcription elongation machinery to the promoters of leukemia proto-oncogenes, such as HOXA9 / 10, MYB, ZEB2, and MYC (5). Motivated by our discovery of ENL as a leukemia dependency (16, 17), we sought to drug its YEATS domain (5, 18), which binds acetylated lysines and is required for ENL to localize to chromatin. After screening 275,000 small molecules for chromatin-competitive inhibitors of the ENL YEATS domain, we identified an amido-imidazopyridine scaffold that bound with an affinity of ~5 µM.

[0008] As mentioned above, molecular glue type degraders are highly sought after small molecule degraders of a protein of interest. These molecules are typically discovered serendipitously and retrospectively, usually as anomalies in the medicinal chemical development of inhibitors.

[0009] Thus, a method to prospectively repurpose known ligands for a protein-of-interest into degraders and compounds capable of inducing proximity to other proteins would be of wide utility to the drug discovery and medicinal chemistry fields. BRIEF DESCRIPTION OF THE FIGURES

[0010] Figure 1a-d. (a) Schematic depiction of classically defined druggable targets. (b) “Undruggable” targets. (c) Glue-type interactions. (d) Pomalidomide-induced CRBN-IKZF1 interaction (PDB: 6H0F).

[0011] Figure 1a-c. (a) Slight structural modifications turn inhibitors into degraders. (b) Examples in “a” discovered serendipitously through mechanism of action (MoA) studies. (c) Can we turn ligands into glues prospectively by systematically remodeling protein surfaces through high-throughput chemistry?

[0012] Figure 2. (a) SuFEx high-throughput medicinal chemistry screen to diversify low- affinity ENL ligand. (b) Top hits from screen show up to 100-fold improvement in ENL inhibition (competitive binding assay). (c) Best hit leads to discovery of high-affinity ENL chemical probes SR-0813 and TM-7. 3       TSRI 2225.1PC

[0013] Figure 3a-d. (a) SuFEx screen to turn high-affinity ENL ligand (TM-7) into ENL degraders. TM-7 diversified into library of 3,234 analogs, then screened directly in cell-based assay of ENL abundance using HiBiT luminescence. (b) SuFEx screen identified several clusters of structurally related hits. Dotted line = 3 s.d.. (c) Confirmation that succinimide hit from “c” (in blue) induces ENL degradation through CRBN recruitment. JS8-100 was resynthesized, purified, and tested in HiBiT assays (24 h) with chemical rescues to validate degradation was ENL-, CRBN-, CRL-, and proteasome-dependent. (d) Same as “c” but using immunoblot after 3 h.

[0014] Figure 5a-d. (a) amine reactive NHS esters can be synthesized in one step from the corresponding benzoic acid. (b) TM-7 diversified into library of 3,234 amide analogs, then screened directly in cell-based assay of ENL abundance using HiBiT luminescence. (c) JS8- 115 is a resynthesized hit from our intracellular ENL-engagement assay (d) which is nearly equipotent with TM-7.

[0015] Figure 6. Results of our initial HiBiT screen performed in January 2023. X-axis has the molecular weight of the amine used in each well, Y-axis shows the ENL-HiBiT signal after 24 hours with 5 µM concentrations of compound. Marker colors indicate LogSw, a measure of water solubility of the corresponding amine. The product that we would later name JS8-100 is highlighted in a red circle.

[0016] Figure 7. JS8-100 degradation of ENL can be rescued by ENL ligands, cereblon ligands, NEDDylation inhibitors and proteasome inhibitors.

[0017] Figure 8. Structural analogues of JS8-100 do not degrade ENL, indicating a narrow structure-activity relationship (SAR) by JS8-100.

[0018] Figure 9. JS8-100 is capable of binding to intracellular ENL with higher affinities than our group’s previous ENL degrader, but less so than the corresponding inhibitor.

[0019] Figure 10. JS8-100 decreases MV4;11 and HB11;197-day viability in a dose dependent manner. OCI AML2 cells are less affected by JS8-100 treatment.

[0020] Figure 11. JQ1-spirocycle does not degrade BRD4, which supports our hypothesis that JS8-100 is a molecular glue, as opposed to a bivalent PROTAC.

[0021] Figure 12. JS8-100 does not demonstrate observable binding to CRBN in biochemical assays until high concentrations, indicating that ENL is required to bind JS8-100 to CRBN. The free spirocycle never observably binds CRBN. 4       TSRI 2225.1PC

[0022] Figure 13. Pretreatment with JS8-100 does not rescue CRBN-dependent BRD4 degradation by dBET6.

[0023] Figure 14. JS8-100 shows strong binding to ENL-YEATS in HTRF (IC50278 nM). This value is comparable to TM-7, which is an ENL-inhibitor our group had previously developed and the scaffold from which JS8-100 was built.

[0024] Figure 15A-B. Syntheses and stereochemical assignment of dHTC1 and intermediates. (A) racemic dHTC1 is separated into enantiopure components and their absolute stereochemistry is assigned by VCD. The biologically active component is determined to be of (S)- configuration. (B) 7 is benzyl protected and separated by SFC into enantiopure components, allowing for high confidence stereochemical assignment by VCD. SFC analysis of the coupling product with 6 is used to further confirm the (S) configuration of the active enantiomer.

[0025] Figure 16A-C. SFC is used to separate rac-dHTC1 into enantioenriched components (–)-dHTC1 and (+)-dHTC1, assigned by VCD as (–)-(R)-dHTC1 and (+)-(S)- dHTC1, respectively. The two enantiomers are separated using a Daicel IK-3 column, 4.6 mm I.D x 100 mL, particle size is 3 µm, under isocratic condition (3.3 mL / min, CO2 / 50% MeOH containing 0.5 vol% 7M methanolic NH3). The injection volume is 5 µL. (A) analytical SFC trace of rac-dHTC1. (B) analytical SFC trace of preparatively separated (–)- (R)-dHTC1. This material is inactive in biological assays. (C) analytical SFC trace of preparatively separated (+)-(S)-dHTC1. This material is active in biological assays.

[0026] Figure 17A-B. The active enantiomer of dHTC1 is of (S)-stereochemical configuration. A: IR spectra measured in DMSO of the active component (+)-dHTC1 (black) and its inactive enantiomer (–)-dHTC1 (red) from the chiral-stationary-phase chromatographic separation of racemic dHTC1 (see Figure M2). Calculated IR spectrum of (S)-dHTC1 in DMSO (blue) and alignment (green) with measured IR spectrum of chromatographic fraction 2. Alignment Pearson correlation: 0.82. B: VCD-IR spectra measured in DMSO of (+)-dHTC1 (black) and (–)-dHTC1 (red). Calculated VCD spectrum of (S)-dHTC1 in DMSO (blue) and alignment (green) with the measured VCD spectrum of (+)-dHTC1. Alignment Pearson correlation: 0.41. (+)-dHTC1 is therefore assigned as (+)-(S)-dHTC1.

[0027] Figure 18A-B. Intermediate assigned by VCD is used to synthesize dHTC1 with known stereochemistry, confirming (S) assignment of the active enantiomer. The isomers were separated on a Waters Prep SFC 150 AP using a Daicel IG column (5 µm, 19 x 5       TSRI 2225.1PC     250 mm). The purification was run under isocratic conditions (50% MeOH containing 0.5 vol% (v / v) 7M methanolic NH3 / CO2, 100 mL / min, 1600 psi back pressure) at 40 °C. Fractionation was triggered by mass spec (ESI+ on a Waters QDa, SIR channel m / z = 245.0). (A) analytical SFC trace of (–)-(R)-dHTC1, synthesized using intermediate (+)-Bn-7 of (R)- stereochemical configuration, as assigned by VCD. This retention time matches that of material confirmed to be inactive in biological assays (see Figure 18). (B) analytical SFC trace of (+)-(S)-dHTC1, synthesized using intermediate (–)-Bn-7 of known (S)- stereochemical configuration, as assigned by VCD. This retention time matches that of material confirmed to be active in biological assays (see Figure 18).

[0028] Figure 19A-B. The active enantiomer of dHTC1 is synthesized from a spirocyclic building block of (S)-stereochemical configuration. A: IR spectra measured in chloroform of (+)-Bn-7 (black, leading to the inactive enantiomer of dHTC1) and (–)-Bn-7 (red, leading to the active enantiomer of dHTC1) from the chiral-stationary-phase chromatographic separation of racemic rac-Bn-7 (see Figure 18). Calculated IR spectrum of (S)-Bn-7 in chloroform (blue) and alignment (green) with measured IR spectrum of (–)-Bn-7. Alignment Pearson correlation: 0.99. B: VCD-IR spectra measured in chloroform of (+)-Bn-7 (black) and (–)-Bn-7 (red). Calculated VCD spectrum of (S)-Bn-7 in chloroform (blue) and alignment (green) with the measured VCD spectrum of (–)-Bn-7. Alignment Pearson correlation: 0.90. (–)-Bn-7 is therefore assigned as (–)-(S)-Bn-7, the elaboration of which gives rise to the active enantiomer (+)-dHTC1, in turn assigned as (+)-(S)-dHTC1, consistent with the direct assignment described in Fig.17.

[0029] Figure 20A-H. Prospective discovery of rac-dHTC1 by high-throughput chemical diversification. (A) TM-7 (1) with a iminosulfur oxydifluoride SuFEx handle (2) was used for the parallel synthesis of 3,163 analogs (3). (B) Crude reaction products were screened for ENL degradation (5 µM, 24 h) in MV4;11 cells expressing HiBiT-ENL. HiBiT luminescence normalized to DMSO:PBS vehicle control (n = 1). Molecular weight shown for the free amine building block. (C) Resynthesized hits were rescreened by HiBiT-ENL (n = 3) and counter screened against BRD4-HiBiT (n = 3). HiBiT luminescence normalized to DMSO:PBS vehicle control. (D) Chemical structure of building block 4 and rac-dHTC1 (5). (E) Immunoblot of ENL in AML cell lines treated with purified rac-dHTC1 (10 µM, 24 h) or DMSO vehicle control. (F) Time-dependent and dose-responsive loss of HiBiT-ENL signal in MV4;11 cells treated with rac-dHTC1. Luminescence normalized to DMSO vehicle control (n 6       TSRI 2225.1PC     = 4). (G) Dose-responsive effects of rac-dHTC1 in MV4;11 cells following indicated pretreatments for (1 h). HiBiT-ENL luminescence normalized to DMSO vehicle control (n = 4). (H) Quantitative TMT-based expression proteomics analysis of MV4;11 cells treated with rac-dHTC1 (1µM, 16 h) or DMSO vehicle control (5,512 proteins with >2 peptides, data was filtered using DTAselect 2.0 within IP2). P values were calculated with a two-tailed Student’s t-test, n = 3.

[0030] Figure 21A-I. ENL degradation by rac-dHTC1 proceeds through CRL4CRBNdespite minimal CRBN affinity. (A) FACS-based CRISPR screens for UPS components affecting ENL stability in KBM7 reporter cells (ENL-BFP-P2A-mCherry) treated with DMSO, SR-1114 (10 µM) or rac-dHTC1 (10 µM) for 8 h (6 sgRNAs targeting 1301 UPS- associated genes). Gene-level fold change and P values were determined by one-sided MAGeCK analysis. (B) Immunoblot analysis of wild-type and CRBN-deficient MV4;11 cells treated with rac-dHTC1 (10 µM, 24 h) or DMSO vehicle control. (C) Immunoblot analysis of MV4;11 cells pretreated with DMSO vehicle control, SR-0813 (10 µM), pomalidomide (pom, 25 µM), MLN4924 (1 µM) or carfilzomib (500 nM) for 1 h prior to rac-dHTC1 treatment (10 µM, 6 h) or DMSO vehicle control. (D) MV4;11 HiBiT-ENL cells pretreated with pomalidomide (25 µM, 1 h) or DMSO control prior to rac-dHTC1 treatment (24 h). Luminescence normalized to DMSO vehicle control (n = 4). Data in Fig.1G are taken from the same experiment (DMSO pre-treatment is repeated in both panels). (E) HiBiT-ENL response to rac-dHTC1 treatment (24 h) in wild-type and CRBN-deficient MV4;11 cells. Luminescence normalized to DMSO vehicle control (n = 4). (F) SPR curve of CRBN binding to immobilized ENL-YEATS in the presence of rac-dHTC1 or buffer control. (G) FP assay to measure CRBN engagement through the displacement of a fluorescent pomalidomide analog (n = 1). Data presented in this plot are repeated in Fig.26B. (H) Binding of pomalidomide to CRBNmidimeasured by SPR. (n = 1). (I) rac-dHTC1 (same as H).

[0031] Figure 22A-L. The ENL:(S)-dHTC1 complex binds cooperatively and stereoselectively to CRBN. (A), (B) Structures of dHTC1 enantiomers. (C) Luminescence- based measurement of HiBiT-ENL abundance in MV4;11 cells treated with (S)-dHTC1 (normalized to DMSO control, n = 4) (D) (R)-dHTC1 (same as C). (E) CRBN-DDB1 FP assay measuring (S)-dHTC1 displacement of BODIPY-thalidomide (10 nM) from CRBN-DDB1 (50 nM) in the presence of recombinant ENL YEATS protein (3 µM) or buffer control. (F) (R)- dHTC1 (same as E). (G) SPR curve of CRBN-DDB1 binding to immobilized ENL YEATS in 7       TSRI 2225.1PC     the presence of (S)- or (R)-dHTC1 (1 µM). (H) Viability of MV4;11 cells after 12-d treatment with (S)-dHTC1 or (R)-dHTC1 measured by CellTiterGlo (normalized to DMSO, n = 3). (I) Mean plasma concentration of (S)-dHTC1 in male C57BL / 6 mice dosed with 50 mg / kg via intraperitoneal injection (n = 3). Cellular DC50(MV4;11 at 8 h) is depicted with and without adjustment for percent protein binding (PPB). (J) Immunoblot analysis of tumor lysates from MV4;11 xenotransplantations following treatment with vehicle, (S)-dHTC1 (50 mg / kg), or (R)-dHTC1 (50 mg / kg) via intraperitoneal injection (3 treatments spaced 12 h apart). Sampling occurred 1 h after the final treatment (n = 4 mice). (K) RNA-seq analysis of tumor lysates (same treatment conditions as figure 3J). (L) Quantification via flow cytometry of CD11b-positive cells in indicated tissues (same treatment conditions as figure 3J).

[0032] Figure 23A-G. (S)-dHTC1 mediates extensive protein-protein contacts between ENL and CRBN. (A) Heat map comparing CRBN DMS results for rac-dHTC1 and SR-1114. C-terminal ENL-BFP levels in MV4;11 CRBN- / -ENL-TagBFP-P2A-mCherry cells were measured by flow cytometry following transduction with a CRBN DMS library and drug treatment (dHTC1 or SR-1114, 1 µM for 8h, n = 3). Arrows above indicate residues showing selectivity for dHTC1 (blue), SR-1114 (gray), or mixed (purple) that were selected for follow- up assays. (B) Immunoblot analysis of MV4;11 CRBN- / -ENL-TagBFP-P2A-mCherry cells expressing the indicated CRBN mutation treated with dHTC1 or SR-1114 (1 µM for 6h). Images are re-used from Fig.31F. (C) Crystal structure of (S)-dHTC1 bound to CRBNmidi. (D) View of the thalidomide-binding site bound by (S)-dHTC1. Residues indicated with an arrow in panel A are colored accordingly. (E) EM map of DDB1:CRBN bound to (S)-dHTC1 and ENL colored by protein. (F) Model of DDB1:CRBN bound to (S)-dHTC1 and ENL complex with zoomed images showing the interface of protein-protein interaction. (G) Interaction between CRBN H353 and ENL residues less than 5 Å (R16, D31, M33 and E74).

[0033] Figure 24A-D. TM-7 is a high affinity ligand for the ENL YEATS domain. (A) DMSO-normalized HiBiT signal in ENL-HiBiT expressing MV4;11 cells following 24-h treatments (n = 4). (B) Intracellular engagement of ENL-YEAT by TM-7 and SR-0813 (n = 4). (C) ENL-YEATS affinity determination using SPR (n = 1). (D) Activity of ENL inhibitors against BRD4, as measured by HTRF (n = 3).

[0034] Figure 25A-D. rac-dHTC1 degrades ENL and AF9 in leukemia cell lines. (A) Immunoblot analysis of ENL in a panel of AML cell lines treated with 10 µM rac-dHTC1 or DMSO control for 24 hours. (B) ENL-HiBiT expressing AML cell lines treated with rac- 8       TSRI 2225.1PC     dHTC1 for 24 hours. Signal is normalized to DMSO treated cells (n = 4). (C) Immunoblot analysis of AF9 levels in Jurkat cells treated with rac-dHTC1 or DMSO control. (D) Validation of an ENL reporter construct. KBM7 cells expressing an ENL-tagBFP-P2A- mCherry dual fluorescence stability reporter were treated with 10 µM compound or DMSO control for 8 h (n = 1).

[0035] Figure 26A-I. CRBN target engagement assays. (A) Rescue of dBET6-mediated BRD4 degradation to assess CRBN target engagement. MV4;11 cells expressing BRD4- HiBiT were pretreated with compounds in dose response for 2 h prior to a 1 h treatment with dBET6 (500 nM, n = 3). Data for pomalidomide is repeated below in Fig.28, which originated from a single experiment. (B) Fluorescence polarization (FP) assay to measure CRBN engagement through the displacement of a fluorescent pomalidomide analog in the presence of 3 µM recombinant ENL YEATS domain protein (with ENL) or buffer (without ENL). Unlabeled thalidomide used as a positive control. CRBN binding by, thalidomide, rac-dHTC1, SR-1114, and 4, (n = 1). Curves without ENL are repeated from Fig.2G.

[0036] Figure 27A-F. Closely related analogs of dHTC1 do not induce ENL degradation. (A) Structure of dHTC1 analogs. (B) HiBiT-based intracellular ENL-YEATS target engagement assay (3 h). MLN4924 pre-treatment (1 µM, 1 h) was used to prevent the potential for compound-induced degradation. Signal is normalized to DMSO-treated cells (n = 4). (C) Binding to immobilized ENL-YEATS as measured by SPR (n = 1). (D) HiBiT-based ENL degradation assay (24 h). Signal is normalized to DMSO treated cells (n = 4). (E) CRBN FP assay for 6 in the presence of recombinant ENL YEATS domain (3 µM) or buffer. (F) Urea analog 7 (same as E) (n = 1).

[0037] Figure 28A-G. Characterization of dHTC1 enantiomers. (A) HiBiT-based ENL degradation assay in cells expressing HiBiT-ENL and treated with (S)-dHTC1 (24 h). Signal is normalized to DMSO treated cells (n = 4). (B) The same as D but for (R)-dHTC1. (C) Binding to ENL as measured by SPR (n = 1). (D) HiBiT-based intracellular ENL-YEATS target engagement assay (3 h). Cells were pretreated with MLN4924 (1 µM, 1 h) to prevent the potential for compound-induced degradation. Signal is normalized to DMSO-treated cells (n = 4). (E) Intracellular CRBN target engagement assessed in MV4;11 cells expressing BRD4- HiBiT via rescue of dBET6-induced BRD4 degradation. Cells are pretreated with compounds in dose response for 2 h prior to a 1-h treatment with dBET6 (500 nM, n = 3). Data for the pomalidomide positive control is repeated from Fig.26A (both panels are taken from the same 9       TSRI 2225.1PC     experiment). (F) (S)-dHTC1 binding to ENL measured by SPR, with or without CRBN-DDB1 (500 nM) present (n = 1). Each trace is normalized to its response at saturation. (S)-dHTC1 without CRBN-DDB1 data is repeated from Fig.28C. (G) Binding to ENL as measured by SPR with CRBN-DDB1 (500 nM) and dHTC1 analogs (n = 1). (S)-dHTC1 with CRBN-DDB1 is partially repeated from Fig.28F (data are taken from the same experiment).

[0038] Figure 29A-C. in vitro and in vivo assessment of dHTC1. (A) Viability of HL60 cells after 12-d treatment with (S)-dHTC1 or (R)-dHTC1 measured by CellTiterGlo (normalized to DMSO treated cells, n = 3). (B) Mean plasma concentration of male C57BL / 6 mice dosed with rac-dHTC1 at 10 mg / kg via intraperitoneal (IP) injection, 2 mg / kg via intravenous (IV) injection or 2 mg / kg per os (PO) (n = 3). (C) Mean plasma concentration of male C57BL / 6 mice dosed with 25, 50 or 75 mg / mg via intraperitoneal injection (n = 3).50 mg / kg data is repeated from Fig.22I (all data taken from the same experiment).

[0039] Figure 30A-D. Validation of MV4;11 cell line for CRBN DMS screen. (A) Flow cytometry following drug treatment in MV4;11 CRBN knockout cells expressing a BFP- tagged ENL and P2A-separated mCherry internal control. This cell line is defined as the “parental.” The histograms for SR-1114, rac-dHTC1 and DMSO treated cells overlap because ENL degradation is CRBN-dependent. (B) Control demonstrating that the reintroduction of wild-type CRBN restores ENL degradation to drug-treated cells. (C) Control demonstrating that the reintroduction of CRBN with an inactivating mutation fails to mediate ENL degradation. (D) Cells that were transduced with the CRBN DMS library regained activity, with roughly 70% of the cells showing ENL degradation.

[0040] Figure 31A-D. Validation of CRBN DMS results. (A) MV4;11 CRBN knockout cells expressing ENL-TagBFP-P2A-mCherry were transduced with a DMS library, which reintroduced CRBN with single amino acid mutations within a 10 Å radius of the thalidomide binding site. After these cells were treated with rac-dHTC1 (1 µM, 8 h, n = 3), endpoint ENL levels were quantified by flow cytometry. Results are depicted in a heatmap indicating log2 fold change of ENLhighover the unsorted pools. (B) SR-1114 (same as A). (C) Validation results of individually expressed CRBN mutants assessed by flow cytometry (n = 3). (D) Immunoblot analyses of ENL levels in MV4;11 CRBN knockout cells expressing ENL- TagBFP-P2A-mCherry. Wild-type or mutant CRBN was re-introduced by lentiviral expression to evaluate mutations that selectively impact the ability of dHTC1 or SR-1114 to degrade ENL (1 µM, 6 h). Sections of this figure are also shown in Fig.23B. 10       TSRI 2225.1PC

[0041] Figure 32A-B. Comparison of dHTC1 DMS results to CC-885. (A) Differential activity between CC-885 (500 nM, 7 d) treated RKO cells (44) and dHTC1 (1 µM, 8 h) treated MV4;11 ENL-TagBFP-P2A-mCherry cells. (B) Validation of selected CRBN mutations in MV4;11 CRBN- / - GSPT1-GFP treated with CC-885 versus ENL-BFP treated with (n = 3).

[0042] Figure 33A-B. Certain distal CRBN amino acid residues are essential for dHTC1- mediated degradation of ENL. (A) DMS screening reveals CRBN P54 and G61 are essential for ENL degradation despite their distance from the dHTC1 binding pocket. (B) Crystal structure of dHTC1 bound to CRBN, showing residue H353 as solvent exposed.

[0043] Figure 34A-B. Prioritization of dHTC2 and dHTC3. (A) Hits were rescreened at 2 µM (16 h) in MV4;11 BRD4-HiBiT (n = 3) and counter screened against MV4;11 ENL-HiBiT (n = 3). HiBiT luminescence normalized to DMSO:PBS vehicle control. (B) Same as A, but hits were rescreened and counter-screened at 10 µM (16 h). SUMMARY OF THE INVENTION

[0044] The application provides a method of identifying a degrader of a target protein comprising 1) selecting a known ligand of a target protein; 2) using high throughput parallel synthesis to generate a multitude of analogues of the ligand; 3) identifying analogues with high-affinity for the target protein from the multitude of analogues formed in step 2); and 4) using cell-based HiBiT assays and other high throughput assays to identify high-affinity analogues formed in step 3) that degrade the target protein or induce proximity to a secondary protein target.

[0045] The application further provides the above method, further comprising conducting subsequent cell-based HiBiT assays to determine whether the mechanism of degradation of the target protein by the high-affinity analogues occurs through 1) proximity-driven pharmacology via monovalent interfacial binding as a molecular glue to a second protein; 2) PROTAC-like bivalent binding to both the target protein and an E3 substrate adapter; 3) autophagy pathways; 4) the high-affinity analogues functioning as hydrophobic tags; or 5) another pathway leading to degradation of the protein-of-interest.

[0046] The application provides the above methods of identifying a degrader of a target protein, wherein the high throughput parallel synthesis comprises 1) esterification of an aryl- carboxylic acid derivative of the known ligand of a target protein to form the corresponding 11       TSRI 2225.1PC     aryl-N-Hydroxysuccinimide (NHS) ester; and 2) high throughput addition of a multitude of amines to yield the corresponding amide compounds.

[0047] The application provides the above methods of identifying a degrader of a target protein, wherein the high throughput parallel synthesis comprises 1) the addition of a carboxylic acid derivative to a known ligand of a target protein; 2) esterification of said carboxylic acid, converting it to the corresponding NHS-ester; 3) subjecting the NHS-ester derivatives to high throughput addition of a multitude of aliphatic amines to form via amide- linked amine-functionalized analogues of the known ligand of the target protein.

[0048] The application provides the above method, according to the following reaction scheme:  A is a known ligand of a target protein; R1is (C1-C6)alkyl, (C1-C6)heteroalkyl, (C1-C6)alkyl (C3-C7)cycloalkyl, (C1-C6)alkyl (C3- C7)heterocycloalkyl, (C1-C6)alkyl (C6-C10)aryl, or (C1-C6)alkyl (C5-C6)heteroaryl, optionally substituted with one or more R2; and R2is oxo, OH, NH2, halo, (C1-C6) alkyl, (C1-C6) heteroalkyl, halo (C1-C6) alkyl, NH(C1-C6) alkyl, or N((C1-C6) alkyl)2; including enantiomers, scalemic or racemic mixtures, and pharmaceutically acceptable salts thereof.

[0049] The application further provides a method of identifying a degrader of a target protein wherein the high throughput parallel synthesis comprises 1) addition of an ester functionalized amine to the carboxylic acid derivative of the known ligand of a target protein to form the ester derivative via amide linkage; 2) converting the resultant ester derivative to 12       TSRI 2225.1PC     the corresponding carboxylic acid derivative; and 3) treatment of the said carboxylic acid derivative with a spirocyclic succinimide derivative.

[0050] The application provides the above method, according to the following reaction scheme:A is a known ligand of a target protein; R3is (C1-C6) alkyl; R4is (C1-C6)alkyl, (C1-C6)heteroalkyl, (C1-C6)alkyl (C3-C7)cycloalkyl, (C1-C6)alkyl (C3- C7)heterocycloalkyl, (C1-C6)alkyl (C6-C10)aryl, or (C1-C6)alkyl (C5-C6)heteroaryl, optionally substituted with one or more R5; R5is oxo, OH, NH2, halo, (C1-C6) alkyl, (C1-C6) heteroalkyl, halo (C1-C6) alkyl, NH(C1-C6) alkyl, or N((C1-C6) alkyl)2; and n is 0 or 1; including enantiomers, scalemic or racemic mixtures, and pharmaceutically acceptable salts thereof.

[0051] The application provides the above methods, wherein the high throughput parallel synthesis comprises 1) subjecting an amine derivative of the known ligand of a target protein to sulfur(VI) fluoride exchange (SuFEx) to form an iminosulfur oxydifluoride derivative; and 13       TSRI 2225.1PC     2) subjecting the iminosulfur oxydifluoride derivatives to high throughput addition of a multitude of aliphatic amines to form via sulfamide linkage amine-functionalized analogues of the known ligand of the target protein.

[0052] The application provides the above method, according to the following reaction scheme:  a a R6is (C1-C6)alkyl, (C1-C6)heteroalkyl, (C1-C6)alkyl (C3-C7)cycloalkyl, (C1-C6)alkyl (C3- C7)heterocycloalkyl, (C1-C6)alkyl (C6-C10)aryl, or (C1-C6)alkyl (C5-C6)heteroaryl, optionally substituted with one or more R12; and R7is oxo, OH, NH2, halo, (C1-C6) alkyl, (C1-C6) heteroalkyl, halo (C1-C6) alkyl, NH(C1-C6) alkyl, or N((C1-C6) alkyl)2; including enantiomers, scalemic or racemic mixtures, and pharmaceutically acceptable salts thereof.

[0053] The application provides the above method, according to the following scheme: 14       TSRI 2225.1PC      a a R13is (C1-C6)alkyl, (C1-C6) heteroalkyl, (C1-C6) alkyl (C3-C7) cycloalkyl, or (C1-C6)alkyl (C3- C7) heterocycloalkyl; including enantiomers, scalemic or racemic mixtures, and pharmaceutically acceptable salts thereof.

[0054] The application further provides the above method, according to the following reaction scheme: 15       TSRI 2225.1PC     .reaction scheme: wherein A is a known ligand of a target protein; and n is 0 or 1; including enantiomers, scalemic or racemic mixtures, and pharmaceutically acceptable salts thereof.

[0056] The application further provides the ENL molecular degrader compound JS8-100 having the following structure: .

[0057] The application further provides a pharmaceutical composition comprising the ENL molecular degrader compound JS8-100 and a pharmaceutically acceptable carrier, excipient, or diluent. 16       TSRI 2225.1PC

[0058] The application further provides a method of treating leukemia in a subject, comprising administering a therapeutically effective amount of the ENL molecular degrader compound JS8-100 or a pharmaceutical composition thereof. DETAILED DESCRIPTION OF THE INVENTION

[0059] Needing to improve ligand affinity to support cell-based studies and to find new degraders, either monovalent, bivalent, or those which degrade proteins of interest through different pathways, we innovated a high-throughput medicinal chemistry approach. This uses sulfur(VI) fluoride exchange (SuFEx) transformations to “click” small, amine-functionalized chemical building blocks onto a compound that has been functionalized with an iminosulfur oxydifluoride “SuFEx hub” (Fig.3a) (5, 19). The SuFEx hub reacts quantitatively with aliphatic amines to form a stable sulfamide linkage. Most importantly, the reaction requires no catalyst, forms fluoride as the only byproduct, and proceeds in mild DMSO / PBS mixtures. Because the reactions are quantitative and biocompatible, they can be performed in parallel and the crude products can be assayed directly in living cells without any further purification (5). Using a library of amine building blocks, thousands of analogs can be synthesized and tested in a single day, expediting medicinal chemistry efforts. Using this approach, we were able to diversify an initial high-throughput-screening hit into 288 analogs (synthesized and screened within 2 days), which led to the discovery chemical probes with over 100-fold improvements in activity (Fig.3b) (5). Additional improvements in cell penetration and pharmacokinetics yielded SR-0813 and TM-7 – high-quality chemical probes of the ENL YEATS domain (Fig.3c) (5).

[0060] Having established the compatibility of SuFEx-based high-throughput medicinal chemistry with cell-based assays (5), we have become inspired to use it for the prospective discovery of molecular glues. We are compelled by the serendipitous discoveries that molecular glue degraders of BCL6, Cyclin K, and BRD4 existed among many other structurally related ligands for the same protein that do not function as glues (Fig.2a). It suggests that it might be possible to find molecular glues from within any large collection of structurally similar, high-affinity ligands that target a given protein (Fig.2c). We considered ourselves ideally suited to test this hypothesis, given our ability to generate such a large collection of compounds using SuFEx-based high-throughput chemistry. Therefore, we installed a SuFEx-reactive hub onto our in-vivo-optimized ENL chemical probe, TM-7 (Fig. 17       TSRI 2225.1PC     4a). We then reacted this with a library of 3,234 aliphatic amine building blocks to generate a library of TM-7 analogs, each modified at a position of permissive structure activity relationship (SAR) that presents outward into the solvent (Fig.4a). We screened each compound for potential ENL degraders using a HiBiT-based luminescent readout of ENL abundance in leukemia cells (MV4;11 cells harboring HiBiT knock-ins at the ENL C- terminus) (Fig.4b). We called hits using a statistical cutoff of 3 standard deviations from the mean and counter-screened for false-positives using a BRD4-HiBiT knock-in MV4;11 cell line. Since TM-7 does not bind BRD4, any hits showing loss of BRD4-HiBiT signal would be expected to be false positive (e.g. due to toxicity, luminescence quenching, etc.) (Fig.4b). Top hits from the screen included several classes of structurally related amines (Fig.4b), including 2 adamantanes, which have previously been used to induce targeted degradation through hydrophobic tagging (20), lending confidence to our screen. We also noticed that the hit with the lowest molecular weight, a spirocyclic succinimide, resembled the succinimide present in a cyclic asparagine degron recognized by the E3 ligase, CRBN (21). We therefore re- synthesized and purified the hit, JS8-100, and validated ENL degradation by both HiBiT luminescence and immunoblot (Fig.4c). We showed that degradation could be rescued by proteasome inhibition (carfilzomib), inhibition of cullin-RING ligase activity (MLN4924), saturation with free TM-7, and saturation with the CRBN ligand pomalidomide – confirming that degradation occurs through an induced proximity between ENL and CRBN (Fig.4c). These data provided a mechanistically unambiguous demonstration that SuFEx-based parallel diversification can be used to transform a ligand into a degrader.

[0061] While our research group and others have demonstrated the utility of SuFEx-based high throughput chemistry for drug and molecular glue based discovery, access to SuFEx intermediates remains a challenge. SuFEx handles (Fig.3a, 4a) can be synthesized with thionyl tetrafluoride, a toxic and difficult to generate gas. Due to our limited supply of SuFEx- handled compounds and the goal to generate hit compounds with highly tractable resynthesis, we developed a new high throughput synthesis strategy whose products could be tested directly in cell-based assays without the need for purification. Based on our previous experience with the functional group (22) and recent literature (23), we found that aryl- carboxylic acids could be esterified to generate aryl-N-Hydroxysuccinimide (NHS) esters (Fig.5a) whose reaction with alkyl amines would yield stable amide bonds. While highly synonymous with SuFEx-based parallel synthesis, this NHS-ester based strategy can be 18       TSRI 2225.1PC     employed without procuring increasingly rare reagents, and affords an amide product whose resynthesis will be trivial for someone with any level of synthetic chemistry experience (Fig. 5b). Further, aryl-NHS esters perform well under aqueous workup conditions and can be readily purified by C18 column chromatography which affords high purity starting material for our library syntheses. We employed this chemistry with the same amine library previous used in SuFEx-based libraries to generate a library of 3,234 amide analogs of our initial ENL- ligand. We tested this library for intracellular engagement of ENL and for degradation of endogenously HiBiT tagged ENL. One of our hits from the target engagement assay was JS8- 115 (Fig.5c), which was selected because it bears a new aromatic ring which could be further functionalized and derivatized with NHS-ester chemistry. This compound has nearly identical intracellular engagement to ENL as TM-7, indicating that this is a high affinity scaffold from which we would be able to derive additional ENL-molecular glues. References: 1. Z. Kozicka, N. H. Thomä, Haven’t got a glue: Protein surface variation for the design of molecular glue degraders. Cell Chem Biol (2021), doi:10.1016 / j.chembiol.2021.04.009. 2. S. L. Schreiber, The Rise of Molecular Glues. Cell.184, 3–9 (2021). 3. C. Mayor-Ruiz, S. Bauer, M. Brand, Z. Kozicka, M. Siklos, H. Imrichova, I. H. Kaltheuner, E. Hahn, K. Seiler, A. Koren, G. Petzold, M. Fellner, C. Bock, A. C. Müller, J. Zuber, M. Geyer, N. H. Thomä, S. Kubicek, G. E. Winter, Rational discovery of molecular glue degraders via scalable chemical profiling. Nat Chem Biol.16, 1199–1207 (2020). 4. M. Słabicki, Z. Kozicka, G. Petzold, Y.-D. Li, M. Manojkumar, R. D. Bunker, K. A. Donovan, Q. L. Sievers, J. Koeppel, D. Suchyta, A. S. Sperling, E. C. Fink, J. A. Gasser, L. R. Wang, S. M. Corsello, R. S. Sellar, M. Jan, D. Gillingham, C. Scholl, S. Fröhling, T. R. Golub, E. S. Fischer, N. H. Thomä, B. L. Ebert, The CDK inhibitor CR8 acts as a molecular glue degrader that depletes cyclin K. Nature, 1–5 (2020). 5. L. Garnar-Wortzel, T. R. Bishop, S. Kitamura, N. Milosevich, J. N. Asiaban, X. Zhang, Q. Zheng, E. Chen, A. R. Ramos, C. J. Ackerman, E. N. Hampton, A. K. Chatterjee, T. S. Young, M. V. Hull, K. B. Sharpless, B. F. Cravatt, D. W. Wolan, M. A. Erb, Chemical Inhibition of ENL / AF9 YEATS Domains in Acute Leukemia. Acs Central Sci.7, 815–830 (2021). 19       TSRI 2225.1PC     6. S. Kitamura, Q. Zheng, J. L. Woehl, A. Solania, E. Chen, N. Dillon, M. V. Hull, M. Kotaniguchi, J. R. Cappiello, S. Kitamura, V. Nizet, K. B. Sharpless, D. W. Wolan, Sulfur(VI) Fluoride Exchange (SuFEx)-Enabled High-Throughput Medicinal Chemistry. J Am Chem Soc. 142, 10899–10904 (2020). 7. D. Chirnomas, K. R. Hornberger, C. M. Crews, Protein degraders enter the clinic — a new approach to cancer therapy. Nat. Rev. Clin. Oncol.20, 265–278 (2023). 8. G. Lu, R. E. Middleton, H. Sun, M. Naniong, C. J. Ott, C. S. Mitsiades, K.-K. Wong, J. E. Bradner, W. G. Kaelin, The myeloma drug lenalidomide promotes the cereblon-dependent destruction of Ikaros proteins. Science.343, 305–309 (2014). 9. P. P. Chamberlain, A. Lopez-Girona, K. Miller, G. Carmel, B. Pagarigan, B. Chie- Leon, E. Rychak, L. G. Corral, Y. J. Ren, M. Wang, M. Riley, S. L. Delker, T. Ito, H. Ando, T. Mori, Y. Hirano, H. Handa, T. Hakoshima, T. O. Daniel, B. E. Cathers, Structure of the human Cereblon–DDB1–lenalidomide complex reveals basis for responsiveness to thalidomide analogs. Nat Struct Mol Biol.21, 803–809 (2014). 10. J. Krönke, N. D. Udeshi, A. Narla, P. Grauman, S. N. Hurst, M. McConkey, T. Svinkina, D. Heckl, E. Comer, X. Li, C. Ciarlo, E. Hartman, N. Munshi, M. Schenone, S. L. Schreiber, S. A. Carr, B. L. Ebert, Lenalidomide causes selective degradation of IKZF1 and IKZF3 in multiple myeloma cells. Science.343, 301–305 (2014). 11. E. S. Fischer, K. Böhm, J. R. Lydeard, H. Yang, M. B. Stadler, S. Cavadini, J. Nagel, F. Serluca, V. Acker, G. M. Lingaraju, R. B. Tichkule, M. Schebesta, W. C. Forrester, M. Schirle, U. Hassiepen, J. Ottl, M. Hild, R. E. J. Beckwith, J. W. Harper, J. L. Jenkins, N. H. Thomä, Structure of the DDB1-CRBN E3 ubiquitin ligase in complex with thalidomide. Nature.512, 49–53 (2014). 12. L. Lv, P. Chen, L. Cao, Y. Li, Z. Zeng, Y. Cui, Q. Wu, J. Li, J.-H. Wang, M.-Q. Dong, X. Qi, T. Han, Discovery of a molecular glue promoting CDK12-DDB1 interaction to trigger cyclin K degradation. eLife.9, e59994 (2020). 13. M. Słabicki, H. Yoon, J. Koeppel, L. Nitsch, S. S. R. Burman, C. D. Genua, K. A. Donovan, A. S. Sperling, M. Hunkeler, J. M. Tsai, R. Sharma, A. Guirguis, C. Zou, P. Chudasama, J. A. Gasser, P. G. Miller, C. Scholl, S. Fröhling, R. P. Nowak, E. S. Fischer, B. 20       TSRI 2225.1PC     L. Ebert, Small-molecule-induced polymerization triggers degradation of BCL6. Nature.588, 164–168 (2020). 14. N. Kerres, S. Steurer, S. Schlager, G. Bader, H. Berger, M. Caligiuri, C. Dank, J. R. Engen, P. Ettmayer, B. Fischerauer, G. Flotzinger, D. Gerlach, T. Gerstberger, T. Gmaschitz, P. Greb, B. Han, E. Heyes, R. E. Iacob, D. Kessler, H. Kölle, L. Lamarre, D. R. Lancia, S. Lucas, M. Mayer, K. Mayr, N. Mischerikow, K. Mück, C. Peinsipp, O. Petermann, U. Reiser, D. Rudolph, K. Rumpel, C. Salomon, D. Scharn, R. Schnitzer, A. Schrenk, N. Schweifer, D. Thompson, E. Traxler, R. Varecka, T. Voss, A. Weiss-Puxbaum, S. Winkler, X. Zheng, A. Zoephel, N. Kraut, D. McConnell, M. Pearson, M. Koegl, Chemically Induced Degradation of the Oncogenic Transcription Factor BCL6. Cell Reports.20, 2860–2875 (2017). 15. A. G. Shergalis, V. L. Marin, D. Y. Rhee, S. Senaweera, R. L. McCloud, J. A. Ronau, C. W. Hutchins, S. McLoughlin, K. R. Woller, S. E. Warder, A. Vasudevan, J. M. Reitsma, CRISPR Screen Reveals BRD2 / 4 Molecular Glue-like Degrader via Recruitment of DCAF16. Acs Chem Biol (2023), doi:10.1021 / acschembio.2c00747. 16. M. A. Erb, T. G. Scott, B. E. Li, H. Xie, J. Paulk, H.-S. Seo, A. Souza, J. M. Roberts, S. Dastjerdi, D. L. Buckley, N. E. Sanjana, O. Shalem, B. Nabet, R. Zeid, N. K. Offei-Addo, S. Dhe-Paganon, F. Zhang, S. H. Orkin, G. E. Winter, J. E. Bradner, Transcription control by the ENL YEATS domain in acute leukaemia. Nature.543, 270–274 (2017). 17. L. Wan, H. Wen, Y. Li, J. Lyu, Y. Xi, T. Hoshii, J. K. Joseph, X. Wang, Y.-H. E. Loh, M. A. Erb, A. L. Souza, J. E. Bradner, L. Shen, W. Li, H. Li, C. D. Allis, S. A. Armstrong, X. Shi, ENL links histone acetylation to oncogenic gene expression in acute myeloid leukaemia. Nature.543, 265–269 (2017). 18. J. N. Asiaban, N. Milosevich, E. Chen, T. R. Bishop, J. Wang, Y. Zhang, C. J. Ackerman, E. N. Hampton, T. S. Young, M. V. Hull, B. F. Cravatt, M. A. Erb, Cell-Based Ligand Discovery for the ENL YEATS Domain. Acs Chem Biol.15, 895–903 (2020). 19. Q. Zheng, J. L. Woehl, S. Kitamura, D. Santos-Martins, C. J. Smedley, G. Li, S. Forli, J. E. Moses, D. W. Wolan, K. B. Sharpless, SuFEx-enabled, agnostic discovery of covalent inhibitors of human neutrophil elastase. Proceedings of the National Academy of Sciences of the United States of America.116, 18808–18814 (2019). 21       TSRI 2225.1PC     20. T. K. Neklesa, H. S. Tae, A. R. Schneekloth, M. J. Stulberg, T. W. Corson, T. B. Sundberg, K. Raina, S. A. Holley, C. M. Crews, Small-molecule hydrophobic tagging-induced degradation of HaloTag fusion proteins. Nat Chem Biol.7, 538–543 (2011). 21. S. Ichikawa, H. A. Flaxman, W. Xu, N. Vallavoju, H. C. Lloyd, B. Wang, D. Shen, M. R. Pratt, C. M. Woo, The E3 ligase adapter cereblon targets the C-terminal cyclic imide degron. Nature.610, 775–782 (2022). 22. R. R. Nani, J. B. Shaum, A. P. Gorka, and M. J. Schnermann, Electrophile-Integrating Smiles Rearrangement Provides Previously Inaccessible C4′-O-Alkyl Heptamethine Cyanine Fluorophores. Organic Letters.17, 302-305 (2015) 23. C. E. Hendrick, J. R. Jorgensen, C. Chaudhry, I. I. Strambeanu, J. Brazeau, J. Schiffer, Z. Shi, J. D. Venable, and S. E. Wolkenberg, Direct-to-Biology Accelerates PROTAC Synthesis and the Evaluation of Linker Effects on Permeability and Degradation. ACS Medicinal Chemistry Letters (13), 1182-1190 (2022). Embodiments

[0062] Embodiment 1. A method of identifying a degrader of a target protein comprising 1) selecting a known ligand of a target protein; 2) using high throughput parallel synthesis to generate a multitude of analogues of the ligand; 3) identifying analogues with high-affinity for the target protein from the multitude of analogues formed in step 2); and 4) using cell-based HiBiT assays and other high throughput assays to identify high-affinity analogues formed in step 3) that degrade the target protein or induce proximity to a secondary protein target.

[0063] Embodiment 2. The method of Embodiment 1, further comprising conducting subsequent cell-based HiBiT assays to determine whether the mechanism of degradation of the target protein by the high-affinity analogues occurs through 1) proximity-driven pharmacology via monovalent interfacial binding as a molecular glue to a second protein; 2) PROTAC-like bivalent binding to both the target protein and an E3 substrate adapter; 3) autophagy pathways; 4) the high-affinity analogues functioning as hydrophobic tags; or 5) another pathway leading to degradation of the protein-of-interest.

[0064] Embodiment 3. The method of Embodiment 1 or Embodiment 2, wherein the mechanism of degradation of the target protein occurs through proximity-driven pharmacology via monovalent interfacial binding as a molecular glue to a second protein. 22       TSRI 2225.1PC

[0065] Embodiment 4. The method of Embodiment 1 or Embodiment 2, wherein the mechanism of degradation of the target protein occurs through PROTAC-like bivalent binding to both the target protein and an E3 substrate adapter.

[0066] Embodiment 5. The method of Embodiment 1 or Embodiment 2, wherein the mechanism of degradation of the target protein occurs through autophagy pathways.

[0067] Embodiment 6. The method of Embodiment 1 or Embodiment 2, wherein the mechanism of degradation of the target protein occurs through the high-affinity analogues functioning as hydrophobic tags.

[0068] Embodiment 7. The method of any one of Embodiments 1-6, wherein the high throughput parallel synthesis comprises 1) the addition of a carboxylic acid derivative to a known ligand of a target protein; 2) esterification of said carboxylic acid, converting it to the corresponding NHS-ester; 3) subjecting the NHS-ester derivatives to high throughput addition of a multitude of aliphatic amines to form via amide-linked amine-functionalized analogues of the known ligand of the target protein.

[0069] Embodiment 8. The method of Embodiment 7, according to the following reaction scheme:  A is a known ligand of a target protein; R1is (C1-C6)alkyl, (C1-C6)heteroalkyl, (C1-C6)alkyl (C3-C7)cycloalkyl, (C1-C6)alkyl (C3- C7)heterocycloalkyl, (C1-C6)alkyl (C6-C10)aryl, or (C1-C6)alkyl (C5-C6)heteroaryl, optionally substituted with one or more R2; and R2is oxo, OH, NH2, halo, (C1-C6) alkyl, (C1-C6) heteroalkyl, halo (C1-C6) alkyl, NH(C1-C6) alkyl, or N((C1-C6) alkyl)2; including enantiomers, scalemic or racemic mixtures, and pharmaceutically acceptable salts thereof. 23       TSRI 2225.1PC

[0070] Embodiment 9. The method of any one of Embodiments 1-6, wherein the high throughput parallel synthesis comprises 1) addition of an ester functionalized amine to the carboxylic acid derivative of the known ligand of a target protein to form the ester derivative via amide linkage; 2) converting the resultant ester derivative to the corresponding carboxylic acid derivative; and 3) treatment of the said carboxylic acid derivative with a spirocyclic succinimide derivative.

[0071] Embodiment 10. The method of Embodiment 9, according to the following reaction scheme:  A is a a R3is (C1-C6) alkyl; R4is (C1-C6)alkyl, (C1-C6)heteroalkyl, (C1-C6)alkyl (C3-C7)cycloalkyl, (C1-C6)alkyl (C3- C7)heterocycloalkyl, (C1-C6)alkyl (C6-C10)aryl, or (C1-C6)alkyl (C5-C6)heteroaryl, optionally substituted with one or more R5; R5is oxo, OH, NH2, halo, (C1-C6) alkyl, (C1-C6) heteroalkyl, halo (C1-C6) alkyl, NH(C1-C6) alkyl, or N((C1-C6) alkyl)2; and n is 0 or 1; including enantiomers, scalemic or racemic mixtures, and pharmaceutically acceptable salts thereof. 24       TSRI 2225.1PC

[0072] Embodiment 11. The method of Embodiment 10, according to the following reaction scheme:  A is a known ligand of a target protein; and n is 0 or 1; including enantiomers, scalemic or racemic mixtures, and pharmaceutically acceptable salts thereof.

[0073] Embodiment 12. The method of Embodiment 10 or Embodiment 11, wherein n is 0.

[0074] Embodiment 13. The method of Embodiment 10 or Embodiment 11, wherein n is 1.

[0075] Embodiment 14. The method of any one of Embodiments 1-6, wherein the high throughput parallel synthesis comprises 1) subjecting an amine derivative of the known ligand of a target protein to sulfur(VI) fluoride exchange (SuFEx) to form an iminosulfur oxydifluoride derivative; and 2) subjecting the iminosulfur oxydifluoride derivatives to high throughput addition of a multitude of aliphatic amines to form via sulfamide linkage amine- functionalized analogues of the known ligand of the target protein. 25       TSRI 2225.1PC

[0076] Embodiment 15. The method of Embodiment 14, according to the following reaction scheme:  R6is (C1-C6)alkyl, (C1-C6)heteroalkyl, (C1-C6)alkyl (C3-C7)cycloalkyl, (C1-C6)alkyl (C3- C7)heterocycloalkyl, (C1-C6)alkyl (C6-C10)aryl, or (C1-C6)alkyl (C5-C6)heteroaryl, optionally substituted with one or more R12; and R7is oxo, OH, NH2, halo, (C1-C6) alkyl, (C1-C6) heteroalkyl, halo (C1-C6) alkyl, NH(C1-C6) alkyl, or N((C1-C6) alkyl)2; including enantiomers, scalemic or racemic mixtures, and pharmaceutically acceptable salts thereof.

[0077] Embodiment 16. The method of any one of Embodiments 1-6, wherein the high throughput parallel synthesis comprises 1) treating an aryl carboxylic acid derivative of a known ligand of a target protein with an amine functionalized group to form an amide derivative of the known ligand; 2) subjecting the amide derivative to sulfur(VI) fluoride exchange (SuFEx) to form an iminosulfur oxydifluoride derivative; and 3) further addition of an aliphatic amine to form a sulfamide linked amine-functionalized derivative of the known ligand.

[0078] Embodiment 17. The method of Embodiment 16, according to the following reaction scheme: 26       TSRI 2225.1PC      a a R13is (C1-C6)alkyl, (C1-C6) heteroalkyl, (C1-C6) alkyl (C3-C7) cycloalkyl, or (C1-C6)alkyl (C3- C7) heterocycloalkyl; including enantiomers, scalemic or racemic mixtures, and pharmaceutically acceptable salts thereof.

[0079] Embodiment 18. The method of any one of Claims 1-6, wherein the high throughput parallel synthesis methods include, but are not limited to: 1) Sulfur(VI) Fluoride Exchange (SuFEx) ; 2); 3)27       TSRI 2225.1PC     ; 4); 5); 6) Alder; 7); 8); 9) Amide Couplings with in-situ Activated Esters 28       TSRI 2225.1PC     ; 10); 11); 12) Urea Couplings; 13)29       TSRI 2225.1PC    ;  14) Radical Nitrone Couplings from Carboxylic Acids ; and 15) Transition Metal Catalyzed Cross Couplings;  wherein: R1, R2, R3, and R4 are each independently H, (C1-C6)alkyl, (C3-C7)cycloalkyl, (C3-C7) heterocycloalkyl, (C6-C10)aryl, or (C5-C8) heteroaryl.

[0080] Embodiment 19. The method of any one of Embodiments 1-18, wherein the second protein is a substrate receptor of an E3 ubiquitin ligase. Embodiment 20. The method of any one of Embodiments 1-19, wherein the second protein is CRBN.

[0081] Embodiment 21. The method of any one of Embodiments 1-20, wherein the target protein is a transcriptional coregulator.

[0082] Embodiment 22. The method of Embodiment 21, wherein the target protein is the chromatin reader YEATS domain of the transcriptional coregulator ENL. 30       TSRI 2225.1PC

[0083] Embodiment 23. The method of any one of Embodiments 1-22, wherein the known ligand of a target protein is an ENL inhibitor with the amido-imidazopyridine scaffold of Formula (I):C6) heteroalkyl, halo (C1-C6) alkyl, (C3-C7) cycloalkyl, or (C1-C6) alkyl (C3-C7) cycloalkyl.

[0084] Embodiment 24. The method of Embodiment 23, wherein R is cyclobutane.

[0085] Embodiment 25. The method of Embodiment 17, according to the following reaction scheme: .    TSRI 2225.1PC

[0087] Embodiment 27. The method of Embodiment 8, according to the following reaction scheme: .

[0088] Embodiment 28. The method of Embodiment 26, wherein .

[0089] Embodiment 29. The method of Embodiment 28, according to the following reaction scheme:.

[0090] Embodiment 30. A compound having the following structure:.

[0091] Embodiment 31. The method of Embodiment 12, according to the following reaction scheme: 32       TSRI 2225.1PC     .

[0092] Embodiment 32. A compound having the following structure: O O NH N N O .

[0093] Embodiment 33. The method of Embodiment 13, according to the following reaction scheme: .

[0094] Embodiment 34. A compound having the following structure:

[0095] Embodiment 35. A pharmaceutical composition comprising the compound of Embodiment 26 and a pharmaceutically acceptable carrier, excipient, or diluent. 33       TSRI 2225.1PC

[0096] Embodiment 36. A method of treating leukemia in a subject, comprising administering a therapeutically effective amount of the compound of Embodiment 26 or the pharmaceutical composition of Embodiment 35.

[0097] Embodiment 37. The method of Embodiment 356 wherein the leukemia is acute myeloid leukemia (AML).

[0098] Embodiment 38. The method of Embodiment 36, wherein the leukemia is acute lymphoblastic leukemia (ALL).

[0099] Embodiment 39. Any compound, composition, or method as described herein. Definitions

[0100] As used herein, the compound referred to as “JS8-100” is also referred to as “dHTC1” in this application as both represent the compound of formula N-cyclobutyl-2-(3- ((2-(4-((6,8-dioxo-2,7-diazaspiro[4.4]nonane)-2-sulfonamido)piperidin-1- yl)ethyl)carbamoyl)phenyl)imidazo[1,2-a]pyridine-6-carboxamide.

[0101] The phrase “a” or “an” entity as used herein refers to one or more of that entity; for example, a compound refers to one or more compounds or at least one compound. As such, the terms “a” (or “an”), “one or more”, and “at least one” can be used interchangeably herein.

[0102] The phrase "as defined herein above" refers to the broadest definition for each group as provided in the Summary of the Invention, the Detailed Description of the Invention, the Experimentals, or the broadest claim. In all other embodiments provided below, substituents which can be present in each embodiment and which are not explicitly defined retain the broadest definition provided in the Summary of the Invention.

[0103] As used in this specification, whether in a transitional phrase or in the body of the claim, the terms "comprise(s)" and "comprising" are to be interpreted as having an open-ended meaning. That is, the terms are to be interpreted synonymously with the phrases "having at least" or "including at least". When used in the context of a process, the term "comprising" means that the process includes at least the recited steps, but may include additional steps. When used in the context of a compound or composition, the term "comprising" means that the compound or composition includes at least the recited features or components, but may also include additional features or components. 34       TSRI 2225.1PC

[0104] As used herein, unless specifically indicated otherwise, the word "or" is used in the "inclusive" sense of "and / or" and not the "exclusive" sense of "either / or".

[0105] The term "independently" is used herein to indicate that a variable is applied in any one instance without regard to the presence or absence of a variable having that same or a different definition within the same compound. Thus, in a compound in which “R” appears twice and is defined as "independently selected from” means that each instance of that R group is separately identified as one member of the set which follows in the definition of that R group. For example, “each R1and R2is independently selected from carbon and nitrogen" means that both R1and R2can be carbon, both R1and R2can be nitrogen, or R1or R2can be carbon and the other nitrogen or vice versa.

[0106] When any variable occurs more than one time in any moiety or formula depicting and describing compounds employed or claimed in the present invention, its definition on each occurrence is independent of its definition at every other occurrence. Also, combinations of substituents and / or variables are permissible only if such compounds result in stable compounds.

[0107] The symbols "*" at the end of a bond or a line drawn through a bond or “~~~~” drawn through a bond each refer to the point of attachment of a functional group or other chemical moiety to the rest of the molecule of which it is a part.

[0108] A bond drawn into ring system (as opposed to connected at a distinct vertex) indicates that the bond may be attached to any of the suitable ring atoms.

[0109] The term “optional” or “optionally” as used herein means that a subsequently described event or circumstance may, but need not, occur, and that the description includes instances where the event or circumstance occurs and instances in which it does not. For example, “optionally substituted” means that the “optionally substituted” moiety may incorporate a hydrogen or a substituent.

[0110] The phrase “optional bond” means that the bond may or may not be present, and that the description includes single, double, or triple bonds. If a substituent is designated to be a "bond" or "absent", the atoms linked to the substituents are then directly connected.

[0111] The term "about" is used herein to mean approximately, in the region of, roughly, or around. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In 35       TSRI 2225.1PC     general, the term "about" is used herein to modify a numerical value above and below the stated value by a variance of 20%.

[0112] Certain compounds disclosed herein may exhibit tautomerism. Tautomeric compounds can exist as two or more interconvertable species. Prototropic tautomers result from the migration of a covalently bonded hydrogen atom between two atoms. Tautomers generally exist in equilibrium and attempts to isolate an individual tautomers usually produce a mixture whose chemical and physical properties are consistent with a mixture of compounds. The position of the equilibrium is dependent on chemical features within the molecule. For example, in many aliphatic aldehydes and ketones, such as acetaldehyde, the keto form predominates while; in phenols, the enol form predominates. Common prototropic tautomers include keto / enol (-C(=O)-CH- ^ -C(-OH)=CH-), amide / imidic acid (-C(=O)-NH- ^ -C(-OH)=N-) and amidine (-C(=NR)-NH- ^ -C(-NHR)=N-) tautomers. The latter two are common in heteroaryl and heterocyclic rings and the present invention encompasses all tautomeric forms of the compounds.

[0113] In this disclosure, a “pharmaceutically acceptable salt” is a pharmaceutically acceptable, organic or inorganic acid or base salt of a compound described herein. Representative pharmaceutically acceptable salts include, e.g., alkali metal salts, alkali earth salts, ammonium salts, water-soluble and water-insoluble salts, such as the acetate, amsonate (4,4-diaminostilbene-2,2-disulfonate), benzenesulfonate, benzoate, bicarbonate, bisulfate, bitartrate, borate, bromide, butyrate, calcium, calcium edetate, camsylate, carbonate, chloride, citrate, clavulariate, dihydrochloride, edetate, edisylate, estolate, esylate, fumarate, gluceptate, gluconate, glutamate, glycollylarsanilate, hexafluorophosphate, hexylresorcinate, hydrabamine, hydrobromide, hydrochloride, hydroxynaphthoate, iodide, isothionate, lactate, lactobionate, laurate, malate, maleate, mandelate, mesylate, methylbromide, methylnitrate, methylsulfate, mucate, napsylate, nitrate, N-methylglucamine ammonium salt, 3-hydroxy-2-naphthoate, oleate, oxalate, palmitate, pamoate (1,1-methene-bis-2-hydroxy-3- naphthoate, einbonate), pantothenate, phosphate / diphosphate, picrate, polygalacturonate, propionate, p-toluenesulfonate, salicylate, stearate, subacetate, succinate, sulfate, sulfosaliculate, suramate, tannate, tartrate, teoclate, tosylate, triethiodide, and valerate salts. A pharmaceutically acceptable salt can have more than one charged atom in its structure. In this instance the pharmaceutically acceptable salt can have multiple counterions. Thus, a 36       TSRI 2225.1PC     pharmaceutically acceptable salt can have one or more charged atoms and / or one or more counterions.

[0114] Technical and scientific terms used herein have the meaning commonly understood by one of skill in the art to which the present invention pertains, unless otherwise defined. Reference is made herein to various methodologies and materials known to those of skill in the art. Standard reference works setting forth the general principles of pharmacology include Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10thEd., McGraw Hill Companies Inc., New York (2001). Any suitable materials and / or methods known to those of skill can be utilized in carrying out the present invention. However, preferred materials and methods are described. Materials, reagents and the like to which reference are made in the following description and examples are obtainable from commercial sources, unless otherwise noted.

[0115] The definitions described herein may be appended to form chemically-relevant combinations, such as “heteroalkylaryl,” “haloalkylheteroaryl,” “arylalkylheterocyclyl,” “alkylcarbonyl,” “alkoxyalkyl,” and the like. When the term “alkyl” is used as a suffix following another term, as in “phenylalkyl,” or “hydroxyalkyl,” this is intended to refer to an alkyl group, as defined above, being substituted with one to two substituents selected from the other specifically-named group. Thus, for example, “phenylalkyl” refers to an alkyl group having one to two phenyl substituents, and thus includes benzyl, phenylethyl, and biphenyl. An “alkylaminoalkyl” is an alkyl group having one to two alkylamino substituents. “Hydroxyalkyl" includes 2-hydroxyethyl, 2-hydroxypropyl, 1-(hydroxymethyl)-2- methylpropyl, 2-hydroxybutyl, 2,3-dihydroxybutyl, 2-(hydroxymethyl), 3-hydroxypropyl, and so forth. Accordingly, as used herein, the term “hydroxyalkyl” is used to define a subset of heteroalkyl groups defined below. The term -(ar)alkyl refers to either an unsubstituted alkyl or an aralkyl group. The term (hetero)aryl or (het)aryl refers to either an aryl or a heteroaryl group.

[0116] The term “acyl” as used herein denotes a group of formula -C(=O)R wherein R is hydrogen or lower alkyl as defined herein. The term or "alkylcarbonyl" as used herein denotes a group of formula C(=O)R wherein R is alkyl as defined herein. The term C1-6acyl refers to a group -C(=O)R contain 6 carbon atoms. The term "arylcarbonyl" as used herein means a group of formula C(=O)R wherein R is an aryl group; the term "benzoyl" as used herein an "arylcarbonyl" group wherein R is phenyl. 37       TSRI 2225.1PC

[0117] The term “alkyl” as used herein denotes an unbranched or branched chain, saturated, monovalent hydrocarbon residue containing 1 to 12 carbon atoms. The term “lower alkyl” or “C1-C6 alkyl” as used herein denotes a straight or branched chain hydrocarbon residue containing 1 to 6 carbon atoms. "C1-12alkyl" as used herein refers to an alkyl composed of 1 to 12 carbons. Examples of alkyl groups include, but are not limited to, lower alkyl groups include methyl, ethyl, propyl, i-propyl, n-butyl, i-butyl, t-butyl or pentyl, isopentyl, neopentyl, hexyl, heptyl, and octyl.

[0118] When the term “alkyl” is used as a suffix following another term, as in “phenylalkyl,” or “hydroxyalkyl,” this is intended to refer to an alkyl group, as defined above, being substituted with one to two substituents selected from the other specifically-named group. Thus, for example, “phenylalkyl” denotes the radical R'R"-, wherein R' is a phenyl radical, and R" is an alkylene radical as defined herein with the understanding that the attachment point of the phenylalkyl moiety will be on the alkylene radical. Examples of arylalkyl radicals include, but are not limited to, benzyl, phenylethyl, 3-phenylpropyl. The terms “arylalkyl” or "aralkyl" are interpreted similarly except R' is an aryl radical. The terms "(het)arylalkyl" or "(het)aralkyl" are interpreted similarly except R' is optionally an aryl or a heteroaryl radical.

[0119] When a range of values is listed, it is intended to encompass each value and sub– range within the range. For example, “C1–6alkyl” is intended to encompass, C1, C2, C3, C4, C5, C6, C1–6, C1–5, C1–4, C1–3, C1–2, C2–6, C2–5, C2–4, C2–3, C3–6, C3–5, C3–4, C4–6, C4–5, and C5–6 alkyl.

[0120] “Alkyl” refers to a radical of a straight–chain or branched saturated hydrocarbon group having from 1 to 20 carbon atoms (“C1–20alkyl”). In some embodiments, an alkyl group has 1 to 15 carbon atoms (“C1–15 alkyl”). In some embodiments, an alkyl group has 1 to 14 carbon atoms (“C1–14alkyl”). In some embodiments, an alkyl group has 1 to 13 carbon atoms (“C1–13 alkyl”). In some embodiments, an alkyl group has 1 to 12 carbon atoms (“C1–12 alkyl”). In some embodiments, an alkyl group has 1 to 11 carbon atoms (“C1–11alkyl”). In some embodiments, an alkyl group has 1 to 10 carbon atoms (“C1–10 alkyl”). In some embodiments, an alkyl group has 1 to 9 carbon atoms (“C1–9alkyl”). In some embodiments, an alkyl group has 1 to 8 carbon atoms (“C1–8 alkyl”). In some embodiments, an alkyl group has 1 to 7 carbon atoms (“C1–7 alkyl”). In some embodiments, an alkyl group has 1 to 6 carbon atoms (“C1–6 alkyl”). In some embodiments, an alkyl group has 1 to 5 carbon atoms 38       TSRI 2225.1PC     (“C1–5 alkyl”). In some embodiments, an alkyl group has 1 to 4 carbon atoms (“C1–4 alkyl”). In some embodiments, an alkyl group has 1 to 3 carbon atoms (“C1–3alkyl”). In some embodiments, an alkyl group has 1 to 2 carbon atoms (“C1–2 alkyl”). In some embodiments, an alkyl group has 1 carbon atom (“C1alkyl”). In some embodiments, an alkyl group has 2 to 6 carbon atoms (“C2–6 alkyl”). Examples of C1–6 alkyl groups include methyl (C1), ethyl (C2), n–propyl (C3), isopropyl (C3), n–butyl (C4), tert–butyl (C4), sec–butyl (C4), iso–butyl (C4), n– pentyl (C5), 3–pentanyl (C5), amyl (C5), neopentyl (C5), 3–methyl–2–butanyl (C5), tertiary amyl (C5), and n–hexyl (C6). Additional examples of alkyl groups include n–heptyl (C7), n– octyl (C8) and the like.

[0121] “Alkenyl” or “olefin” refers to a radical of a straight–chain or branched hydrocarbon group having from 2 to 10 carbon atoms and 1, 2, 3, or 4 carbon-carbon double bonds (“C2–10 alkenyl”). In some embodiments, an alkenyl group has 2 to 9 carbon atoms (“C2–9alkenyl”). In some embodiments, an alkenyl group has 2 to 8 carbon atoms (“C2–8alkenyl”). In some embodiments, an alkenyl group has 2 to 7 carbon atoms (“C2–7 alkenyl”). In some embodiments, an alkenyl group has 2 to 6 carbon atoms (“C2–6alkenyl”). In some embodiments, an alkenyl group has 2 to 5 carbon atoms (“C2–5 alkenyl”). In some embodiments, an alkenyl group has 2 to 4 carbon atoms (“C2–4alkenyl”). In some embodiments, an alkenyl group has 2 to 3 carbon atoms (“C2–3 alkenyl”). In some embodiments, an alkenyl group has 2 carbon atoms (“C2alkenyl”). The one or more carbon– carbon double bonds can be internal (such as in 2–butenyl) or terminal (such as in 1–butenyl). Examples of C2–4alkenyl groups include ethenyl (C2), 1–propenyl (C3), 2–propenyl (C3), 1– butenyl (C4), 2–butenyl (C4), butadienyl (C4), and the like. Examples of C2–6 alkenyl groups include the aforementioned C2–4alkenyl groups as well as pentenyl (C5), pentadienyl (C5), hexenyl (C6), and the like. Additional examples of alkenyl include heptenyl (C7), octenyl (C8), octatrienyl (C8), and the like.

[0122] “Alkynyl” refers to a radical of a straight–chain or branched hydrocarbon group having from 2 to 10 carbon atoms and one or more carbon-carbon triple bonds (e.g., 1, 2, 3, or 4 triple bonds) (“C2–10 alkynyl”). In some embodiments, an alkynyl group has 2 to 9 carbon atoms (“C2–9alkynyl”). In some embodiments, an alkynyl group has 2 to 8 carbon atoms (“C2–8 alkynyl”). In some embodiments, an alkynyl group has 2 to 7 carbon atoms (“C2–7 alkynyl”). In some embodiments, an alkynyl group has 2 to 6 carbon atoms (“C2–6 alkynyl”). In some embodiments, an alkynyl group has 2 to 5 carbon atoms (“C2–5 alkynyl”). In some 39       TSRI 2225.1PC     embodiments, an alkynyl group has 2 to 4 carbon atoms (“C2–4 alkynyl”). In some embodiments, an alkynyl group has 2 to 3 carbon atoms (“C2–3alkynyl”). In some embodiments, an alkynyl group has 2 carbon atoms (“C2 alkynyl”). The one or more carbon– carbon triple bonds can be internal (such as in 2–butynyl) or terminal (such as in 1–butynyl). Examples of C2–4 alkynyl groups include, without limitation, ethynyl (C2), 1–propynyl (C3), 2–propynyl (C3), 1–butynyl (C4), 2–butynyl (C4), and the like. Examples of C2–6alkenyl groups include the aforementioned C2–4 alkynyl groups as well as pentynyl (C5), hexynyl (C6), and the like. Additional examples of alkynyl include heptynyl (C7), octynyl (C8), and the like.

[0123] The terms “haloalkyl” or “halo-lower alkyl” or “lower haloalkyl” refers to a straight or branched chain hydrocarbon residue containing 1 to 6 carbon atoms wherein one or more carbon atoms are substituted with one or more halogen atoms.

[0124] The term "alkylene" or "alkylenyl" as used herein denotes a divalent saturated linear hydrocarbon radical of 1 to 10 carbon atoms (e.g., (CH2)n)or a branched saturated divalent hydrocarbon radical of 2 to 10 carbon atoms (e.g., -CHMe- or -CH2CH(i-Pr)CH2-), unless otherwise indicated. Except in the case of methylene, the open valences of an alkylene group are not attached to the same atom. Examples of alkylene radicals include, but are not limited to, methylene, ethylene, propylene, 2-methyl-propylene, 1,1-dimethyl-ethylene, butylene, 2-ethylbutylene.

[0125] The term "alkoxy" as used herein means an -O-alkyl group, wherein alkyl is as defined above such as methoxy, ethoxy, n-propyloxy, i-propyloxy, n-butyloxy, i-butyloxy, t- butyloxy, pentyloxy, hexyloxy, including their isomers. "Lower alkoxy" as used herein denotes an alkoxy group with a "lower alkyl" group as previously defined. "C1-10 alkoxy" as used herein refers to an-O-alkyl wherein alkyl is C1-10.

[0126] The term "hydroxyalkyl" as used herein denotes an alkyl radical as herein defined wherein one to three hydrogen atoms on different carbon atoms is / are replaced by hydroxyl groups.

[0127] The terms "alkylsulfonyl" and "arylsulfonyl" as used herein refers to a group of formula -S(=O)2R wherein R is alkyl or aryl respectively and alkyl and aryl are as defined herein. The term “heteroalkylsulfonyl” as used herein refers herein denotes a group of formula -S(=O)2R wherein R is “heteroalkyl” as defined herein. 40       TSRI 2225.1PC

[0128] The terms "alkylsulfonylamino" and "arylsulfonylamino"as used herein refers to a group of formula -NR'S(=O)2R wherein R is alkyl or aryl respectively, R' is hydrogen or C1-3alkyl, and alkyl and aryl are as defined herein.

[0129] The term “cycloalkyl” as used herein refers to a saturated carbocyclic ring containing 3 to 8 carbon atoms, i.e. cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl or cyclooctyl. "C3-7cycloalkyl" as used herein refers to an cycloalkyl composed of 3 to 7 carbons in the carbocyclic ring.

[0130] The term carboxy-alkyl as used herein refers to an alkyl moiety wherein one, hydrogen atom has been replaced with a carboxyl with the understanding that the point of attachment of the heteroalkyl radical is through a carbon atom. The term “carboxy” or “carboxyl” refers to a –CO2H moiety.

[0131] The term "heteroaryl” or "heteroaromatic" as used herein means a monocyclic or bicyclic radical of 5 to 12 ring atoms having at least one aromatic ring containing four to eight atoms per ring, incorporating one or more N, O, or S heteroatoms, the remaining ring atoms being carbon, with the understanding that the attachment point of the heteroaryl radical will be on an aromatic ring. As well known to those skilled in the art, heteroaryl rings have less aromatic character than their all-carbon counter parts. Thus, for the purposes of the invention, a heteroaryl group need only have some degree of aromatic character. Examples of heteroaryl moieties include monocyclic aromatic heterocycles having 5 to 6 ring atoms and 1 to 3 heteroatoms include, but is not limited to, pyridinyl, pyrimidinyl, pyrazinyl, pyrrolyl, pyrazolyl, imidazolyl, oxazol, isoxazole, thiazole, isothiazole, triazoline, thiadiazole and oxadiaxoline which can optionally be substituted with one or more, preferably one or two substituents selected from hydroxy, cyano, alkyl, alkoxy, thio, lower haloalkoxy, alkylthio, halo, lower haloalkyl, alkylsulfinyl, alkylsulfonyl, halogen, amino, alkylamino,dialkylamino, aminoalkyl, alkylaminoalkyl, and dialkylaminoalkyl, nitro, alkoxycarbonyl and carbamoyl, alkylcarbamoyl, dialkylcarbamoyl, arylcarbamoyl, alkylcarbonylamino and arylcarbonylamino. Examples of bicyclic moieties include, but are not limited to, quinolinyl, isoquinolinyl, benzofuryl, benzothiophenyl, benzoxazole, benzisoxazole, benzothiazole and benzisothiazole. Bicyclic moieties can be optionally substituted on either ring; however the point of attachment is on a ring containing a heteroatom.

[0132] The term "heterocyclyl", “heterocycloalkyl” or "heterocycle" as used herein denotes a monovalent saturated cyclic radical, consisting of one or more rings, preferably one 41       TSRI 2225.1PC     to two rings, including spirocyclic ring systems, of three to eight atoms per ring, incorporating one or more ring heteroatoms (chosen from N,O or S(O)0-2), and which can optionally be independently substituted with one or more, preferably one or two substituents selected from hydroxy, oxo, cyano, lower alkyl, lower alkoxy, lower haloalkoxy, alkylthio, halo, lower haloalkyl, hydroxyalkyl, nitro, alkoxycarbonyl, amino, alkylamino, alkylsulfonyl, arylsulfonyl, alkylaminosulfonyl, arylaminosulfonyl, alkylsulfonylamino, arylsulfonylamino, alkylaminocarbonyl, arylaminocarbonyl, alkylcarbonylamino, arylcarbonylamino, unless otherwise indicated. Examples of heterocyclic radicals include, but are not limited to, azetidinyl, pyrrolidinyl, hexahydroazepinyl, oxetanyl, tetrahydrofuranyl, tetrahydrothiophenyl, oxazolidinyl, thiazolidinyl, isoxazolidinyl, morpholinyl, piperazinyl, piperidinyl, tetrahydropyranyl, thiomorpholinyl, quinuclidinyl and imidazolinyl.

[0133] “Heterocyclyl” or “heterocyclic” refers to a group or radical of a 3– to 14– membered non–aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“3–14 membered heterocyclyl”). In heterocyclyl groups that contain one or more nitrogen atoms, the point of attachment can be a carbon or nitrogen atom, as valency permits. A heterocyclyl group can either be monocyclic (“monocyclic heterocyclyl”) or polycyclic (e.g., a fused, bridged or spiro ring system such as a bicyclic system (“bicyclic heterocyclyl”) or tricyclic system (“tricyclic heterocyclyl”)), and can be saturated or can contain one or more carbon– carbon double or triple bonds. Heterocyclyl polycyclic ring systems can include one or more heteroatoms in one or both rings. “Heterocyclyl” also includes ring systems wherein the heterocyclyl ring, as defined above, is fused with one or more carbocyclyl groups wherein the point of attachment is either on the carbocyclyl or heterocyclyl ring, or ring systems wherein the heterocyclyl ring, as defined above, is fused with one or more aryl or heteroaryl groups, wherein the point of attachment is on the heterocyclyl ring, and in such instances, the number of ring members continue to designate the number of ring members in the heterocyclyl ring system.

[0134] In some embodiments, a heterocyclyl group is a 5–10 membered non–aromatic ring system having ring carbon atoms and 1–4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5–10 membered heterocyclyl”). In some embodiments, a heterocyclyl group is a 5–8 membered non–aromatic ring system having ring carbon atoms and 1–4 ring heteroatoms, wherein each heteroatom is independently 42       TSRI 2225.1PC     selected from nitrogen, oxygen, and sulfur (“5–8 membered heterocyclyl”). In some embodiments, a heterocyclyl group is a 5–6 membered non–aromatic ring system having ring carbon atoms and 1–4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5–6 membered heterocyclyl”). In some embodiments, the 5–6 membered heterocyclyl has 1–3 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments, the 5–6 membered heterocyclyl has 1–2 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments, the 5–6 membered heterocyclyl has 1 ring heteroatom selected from nitrogen, oxygen, and sulfur.

[0135] Exemplary 3–membered heterocyclyl groups containing 1 heteroatom include, without limitation, azirdinyl, oxiranyl, and thiiranyl. Exemplary 4–membered heterocyclyl groups containing 1 heteroatom include, without limitation, azetidinyl, oxetanyl and thietanyl. Exemplary 5–membered heterocyclyl groups containing 1 heteroatom include, without limitation, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothiophenyl, dihydrothiophenyl, pyrrolidinyl, dihydropyrrolyl, and pyrrolyl–2,5–dione. Exemplary 5–membered heterocyclyl groups containing 2 heteroatoms include, without limitation, dioxolanyl, oxathiolanyl and dithiolanyl. Exemplary 5–membered heterocyclyl groups containing 3 heteroatoms include, without limitation, triazolinyl, oxadiazolinyl, and thiadiazolinyl. Exemplary 6–membered heterocyclyl groups containing 1 heteroatom include, without limitation, piperidinyl, tetrahydropyranyl, dihydropyridinyl, and thianyl. Exemplary 6–membered heterocyclyl groups containing 2 heteroatoms include, without limitation, piperazinyl, morpholinyl, dithianyl, and dioxanyl. Exemplary 6–membered heterocyclyl groups containing 3 heteroatoms include, without limitation, triazinanyl. Exemplary 7–membered heterocyclyl groups containing 1 heteroatom include, without limitation, azepanyl, oxepanyl and thiepanyl. Exemplary 8–membered heterocyclyl groups containing 1 heteroatom include, without limitation, azocanyl, oxecanyl and thiocanyl. Exemplary bicyclic heterocyclyl groups include, without limitation, indolinyl, isoindolinyl, dihydrobenzofuranyl, dihydrobenzothienyl, tetra- hydrobenzothienyl, tetrahydrobenzofuranyl, tetrahydroindolyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, decahydroisoquinolinyl, octahydrochromenyl, octahydroisochromenyl, decahydronaphthyridinyl, decahydro–1,8–naphthyridinyl, octahydropyrrolo[3,2–b]pyrrole, indolinyl, phthalimidyl, naphthalimidyl, chromanyl, chromenyl, 1H–benzo[e][1,4]diazepinyl, 1,4,5,7–tetrahydropyrano[3,4–b]pyrrolyl, 5,6– dihydro–4H–furo[3,2–b]pyrrolyl, 6,7–dihydro–5H–furo[3,2–b]pyranyl, 5,7–dihydro–4H– 43       TSRI 2225.1PC     thieno[2,3–c]pyranyl, 2,3–dihydro–1H–pyrrolo[2,3–b]pyridinyl, 2,3–dihydrofuro[2,3– b]pyridinyl, 4,5,6,7–tetrahydro–1H–pyrrolo[2,3–b]pyridinyl, 4,5,6,7–tetrahydrofuro[3,2– c]pyridinyl, 4,5,6,7–tetrahydrothieno[3,2–b]pyridinyl, 1,2,3,4–tetrahydro–1,6–naphthyridinyl, and the like.

[0136] “Aryl” refers to a radical of a monocyclic or polycyclic (e.g., bicyclic or tricyclic) 4n+2 aromatic ring system (e.g., having 6, 10, or 14 pi electrons shared in a cyclic array) having 6–14 ring carbon atoms and zero heteroatoms provided in the aromatic ring system (“C6–14aryl”). In some embodiments, an aryl group has 6 ring carbon atoms (“C6aryl”; e.g., phenyl). In some embodiments, an aryl group has 10 ring carbon atoms (“C10 aryl”; e.g., naphthyl such as 1–naphthyl (α-naphthyl) and 2–naphthyl (β-naphthyl)). In some embodiments, an aryl group has 14 ring carbon atoms (“C14 aryl”; e.g., anthracyl). “Aryl” also includes ring systems wherein the aryl ring, as defined above, is fused with one or more carbocyclyl or heterocyclyl groups wherein the radical or point of attachment is on the aryl ring, and in such instances, the number of carbon atoms continue to designate the number of carbon atoms in the aryl ring system.

[0137] “Heteroaryl” refers to a radical of a 5–14 membered monocyclic or polycyclic (e.g., bicyclic, tricyclic) 4n+2 aromatic ring system (e.g., having 6, 10, or 14 pi electrons shared in a cyclic array) having ring carbon atoms and 1–4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5–14 membered heteroaryl”). In heteroaryl groups that contain one or more nitrogen atoms, the point of attachment can be a carbon or nitrogen atom, as valency permits. Heteroaryl polycyclic ring systems can include one or more heteroatoms in one or both rings. “Heteroaryl” includes ring systems wherein the heteroaryl ring, as defined above, is fused with one or more carbocyclyl or heterocyclyl groups wherein the point of attachment is on the heteroaryl ring, and in such instances, the number of ring members continue to designate the number of ring members in the heteroaryl ring system. “Heteroaryl” also includes ring systems wherein the heteroaryl ring, as defined above, is fused with one or more aryl groups wherein the point of attachment is either on the aryl or heteroaryl ring, and in such instances, the number of ring members designates the number of ring members in the fused polycyclic (aryl / heteroaryl) ring system. Polycyclic heteroaryl groups wherein one ring does not contain a heteroatom (e.g., indolyl, quinolinyl, carbazolyl, and the like) the point of 44       TSRI 2225.1PC     attachment can be on either ring, i.e., either the ring bearing a heteroatom (e.g., 2–indolyl) or the ring that does not contain a heteroatom (e.g., 5–indolyl).

[0138] In some embodiments, a heteroaryl group is a 5–10 membered aromatic ring system having ring carbon atoms and 1–4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5–10 membered heteroaryl”). In some embodiments, a heteroaryl group is a 5–8 membered aromatic ring system having ring carbon atoms and 1–4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5–8 membered heteroaryl”). In some embodiments, a heteroaryl group is a 5–6 membered aromatic ring system having ring carbon atoms and 1–4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5–6 membered heteroaryl”). In some embodiments, the 5–6 membered heteroaryl has 1–3 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments, the 5–6 membered heteroaryl has 1–2 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments, the 5–6 membered heteroaryl has 1 ring heteroatom selected from nitrogen, oxygen, and sulfur.

[0139] Exemplary 5–membered heteroaryl groups containing 1 heteroatom include, without limitation, pyrrolyl, furanyl and thiophenyl. Exemplary 5–membered heteroaryl groups containing 2 heteroatoms include, without limitation, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, and isothiazolyl. Exemplary 5–membered heteroaryl groups containing 3 heteroatoms include, without limitation, triazolyl, oxadiazolyl, and thiadiazolyl. Exemplary 5–membered heteroaryl groups containing 4 heteroatoms include, without limitation, tetrazolyl. Exemplary 6–membered heteroaryl groups containing 1 heteroatom include, without limitation, pyridinyl. Exemplary 6–membered heteroaryl groups containing 2 heteroatoms include, without limitation, pyridazinyl, pyrimidinyl, and pyrazinyl. Exemplary 6–membered heteroaryl groups containing 3 or 4 heteroatoms include, without limitation, triazinyl and tetrazinyl, respectively. Exemplary 7–membered heteroaryl groups containing 1 heteroatom include, without limitation, azepinyl, oxepinyl, and thiepinyl. Exemplary 5,6– bicyclic heteroaryl groups include, without limitation, indolyl, isoindolyl, indazolyl, benzotriazolyl, benzothiophenyl, isobenzothiophenyl, benzofuranyl, benzoisofuranyl, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzoxadiazolyl, benzthiazolyl, benzisothiazolyl, benzthiadiazolyl, indolizinyl, and purinyl. Exemplary 6,6–bicyclic 45       TSRI 2225.1PC     heteroaryl groups include, without limitation, naphthyridinyl, pteridinyl, quinolinyl, isoquinolinyl, cinnolinyl, quinoxalinyl, phthalazinyl, and quinazolinyl. Exemplary tricyclic heteroaryl groups include, without limitation, phenanthridinyl, dibenzofuranyl, carbazolyl, acridinyl, phenothiazinyl, phenoxazinyl and phenazinyl.

[0140] “Saturated” refers to a ring moiety that does not contain a double or triple bond, i.e., the ring contains all single bonds.

[0141] Alkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl groups may be optionally substituted. Optionally substituted refers to a group which may be substituted or unsubstituted. In general, the term “substituted” means that at least one hydrogen present on a group is replaced with a non-hydrogen substituent, and which upon substitution results in a stable compound, e.g., a compound which does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, or other reaction. Heteroatoms such as nitrogen, oxygen, and sulfur may have hydrogen substituents and / or non-hydrogen substituents which satisfy the valencies of the heteroatoms and results in the formation of a stable compound.

[0142] Exemplary non-hydrogen substituents wherein a moiety is “optionally substituted” as used herein means the moiety may be substituted with any additional moiety selected from, but not limited to, the group consisting of halogen, –CN, –NO2, –N3, –SO2H, –SO3H, –OH, – ORaa, –N(Rbb)2, –N(ORcc)Rbb, –SH, –SRaa, –C(=O)Raa, –CO2H, –CHO, –CO2Raa, – OC(=O)Raa, –OCO2Raa, –C(=O)N(Rbb)2, –OC(=O)N(Rbb)2, –NRbbC(=O)Raa, –NRbbCO2Raa, – NRbbC(=O)N(Rbb)2, –C(=NRbb)Raa, –C(=NRbb)ORaa, –OC(=NRbb)Raa, –OC(=NRbb)ORaa, – C(=NRbb)N(Rbb)2, –OC(=NRbb)N(Rbb)2, –NRbbC(=NRbb)N(Rbb)2, –C(=O)NRbbSO2Raa, – NRbbSO2Raa, –SO2N(Rbb)2, –SO2Raa, –S(=O)Raa, –OS(=O)Raa, -B(ORcc)2, C1–10 alkyl, C2–10 alkenyl, C2–10alkynyl, C3–14carbocyclyl, 3– to 14- membered heterocyclyl, C6–14aryl, and 5– to 14- membered heteroaryl, wherein each alkyl, alkenyl, alkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is independently substituted with 0, 1, 2, 3, 4, or 5 Rddgroups, or two geminal hydrogens on a carbon atom are replaced with the group =O; each instance of Raais, independently, selected from the group consisting of C1–10alkyl, C1–10perhaloalkyl, C2–10alkenyl, C2–10 alkynyl, C3–14 carbocyclyl, 3– to 14- membered heterocyclyl, C6–14 aryl, and 5– to 14- membered heteroaryl, or two Raagroups are joined to form a 3– to 14- membered heterocyclyl or 5– to 14- membered heteroaryl ring, wherein each alkyl, alkenyl, alkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is independently substituted with 0, 1, 2, 3, 4, or 5 Rddgroups; each instance of Rbbis, independently, selected from the group consisting of 46       TSRI 2225.1PC     hydrogen, –OH, –ORaa, –N(Rcc)2, –CN, –C(=O)Raa, –C(=O)N(Rcc)2, –CO2Raa, –SO2Raa, – SO2N(Rcc)2, –SORaa, C1–10alkyl, C1–10perhaloalkyl, C2–10alkenyl, C2–10alkynyl, C3–14carbocyclyl, 3– to 14- membered heterocyclyl, C6–14 aryl, and 5– to 14- membered heteroaryl, or two Rbbgroups are joined to form a 3– to 14- membered heterocyclyl or 5– to 14- membered heteroaryl ring, wherein each alkyl, alkenyl, alkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is independently substituted with 0, 1, 2, 3, 4, or 5 Rddgroups; each instance of Rccis, independently, selected from the group consisting of hydrogen, C1–10 alkyl, C1–10perhaloalkyl, C2–10alkenyl, C2–10alkynyl, C3–14carbocyclyl, 3– to 14- membered heterocyclyl, C6–14 aryl, and 5– to 14- membered heteroaryl, or two Rccgroups are joined to form a 3– to 14- membered heterocyclyl or 5– to 14- membered heteroaryl ring, wherein each alkyl, alkenyl, alkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is independently substituted with 0, 1, 2, 3, 4, or 5 Rddgroups; and each instance of Rddis, independently, selected from the group consisting of halogen, –CN, –NO2, –N3, –SO2H, –SO3H, –OH, –OC1–6 alkyl, –ON(C1–6 alkyl)2, –N(C1–6 alkyl)2, –N(OC1–6 alkyl)(C1–6 alkyl), –N(OH)(C1–6 alkyl), – NH(OH), –SH, –SC1–6alkyl, –C(=O)(C1–6alkyl), –CO2H, –CO2(C1–6alkyl), –OC(=O)(C1–6alkyl), –OCO2(C1–6 alkyl), –C(=O)NH2, –C(=O)N(C1–6 alkyl)2, –OC(=O)NH(C1–6 alkyl), – NHC(=O)( C1–6alkyl), –N(C1–6alkyl)C(=O)( C1–6alkyl), –NHCO2(C1–6alkyl), – NHC(=O)N(C1–6 alkyl)2, –NHC(=O)NH(C1–6 alkyl), –NHC(=O)NH2, –C(=NH)O(C1–6 alkyl),–OC(=NH)(C1–6alkyl), –OC(=NH)OC1–6alkyl, –C(=NH)N(C1–6alkyl)2, – C(=NH)NH(C1–6 alkyl), –C(=NH)NH2, –OC(=NH)N(C1–6 alkyl)2, –OC(NH)NH(C1–6 alkyl), – OC(NH)NH2, –NHC(NH)N(C1–6alkyl)2, –NHC(=NH)NH2, –NHSO2(C1–6alkyl), –SO2N(C1–6alkyl)2, –SO2NH(C1–6 alkyl), –SO2NH2,–SO2C1–6 alkyl, -B(OH)2, -B(OC1–6 alkyl)2,C1–6 alkyl, C1–6perhaloalkyl, C2–6alkenyl, C2–6alkynyl, C3–10carbocyclyl, C6–10aryl, 3–to 10- membered heterocyclyl, and 5- to 10- membered heteroaryl; or two geminal Rddsubstituents on a carbon atom may be joined to form =O.

[0143] “Halo” or “halogen” refers to fluorine (fluoro, –F), chlorine (chloro, –Cl), bromine (bromo, –Br), or iodine (iodo, –I).

[0144] As used herein, the term “composition” is intended to encompass a product comprising the specified ingredients, as well as any product which results, directly or indirectly, from combination of the specified ingredients.

[0145] “Salt” includes any and all salts. “Pharmaceutically acceptable salt” refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with 47       TSRI 2225.1PC     the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, Berge et al., describes pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences (1977) 66:1–19. Pharmaceutically acceptable salts include those derived from inorganic and organic acids and bases. Examples of pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2–hydroxy–ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2– naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3–phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p–toluenesulfonate, undecanoate, valerate salts, and the like. Pharmaceutically acceptable salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium and N+(C1–4alkyl)4 salts. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, lower alkyl sulfonate, and aryl sulfonate.

[0146] Unless otherwise indicated, compounds described herein can comprise one or more asymmetric centers, and thus can exist in various stereoisomeric forms, e.g., enantiomers and / or diastereomers. For example, the compounds described herein can be in the form of an individual enantiomer, diastereomer or geometric isomer, or can be in the form of a mixture of stereoisomers, including racemic mixtures and mixtures enriched in one or more stereoisomer. Isomers can be isolated from mixtures by methods known to those skilled in the art, including chiral high pressure liquid chromatography (HPLC). Compounds described herein can be in 48       TSRI 2225.1PC     the form of individual isomers substantially free of other isomers, and alternatively, as mixtures of various isomers.

[0147] Unless otherwise stated, structures depicted herein are also meant to include compounds that differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the present structures except for the replacement of hydrogen by deuterium or tritium, replacement of19F with18F, replacement of a carbon by a13C- or14C- enriched carbon, and / or replacement of an oxygen atom with18O, are within the scope of the disclosure. Other examples of isotopes include15N,18O,17O,31P,32P,35S,18F,36Cl and123I. Compounds with such isotopically enriched atoms are useful, for example, as analytical tools or probes in biological assays.

[0148] Certain isotopically-labelled compounds (e.g., those labeled with3H and14C) are useful in compound and / or substrate tissue distribution assays. Tritiated (i.e.,3H) and carbon- 14 (i.e.,14C) isotopes are particularly preferred for their ease of preparation and detectability.

[0149] Certain isotopically-labelled compounds of Formula (I) can be useful for medical imaging purposes, for example, those labeled with positron-emitting isotopes like11C or18F can be useful for application in Positron Emission Tomography (PET) and those labeled with gamma ray emitting isotopes like123I can be useful for application in Single Photon Emission Computed Tomography (SPECT). Further, substitution with heavier isotopes such as deuterium (i.e.,2H) may afford certain therapeutic advantages resulting from greater metabolic stability (e.g., increased in vivo half-life or reduced dosage requirements) and hence may be preferred in some circumstances. Further, substitution with heavier isotopes such as deuterium (i.e.,2H) may afford certain therapeutic advantages resulting from greater metabolic stability (e.g., increased in vivo half-life or reduced dosage requirements), and hence, may be preferred in some circumstances. Additionally, isotopic substitution at a site where epimerization occurs may slow or reduce the epimerization process and thereby retain the more active or efficacious form of the compound for a longer period of time. Isotopically labeled compounds of Formula (I), in particular those containing isotopes with longer half-lives (t1 / 2>1 day), can generally be prepared by following procedures analogous to those disclosed in the Schemes and / or in the Examples herein below, by substituting an appropriate isotopically labeled reagent for a non-isotopically labeled reagent.

[0150] If there is a discrepancy between a depicted structure and a name given to that structure, then the depicted structure controls. Additionally, if the stereochemistry of a 49       TSRI 2225.1PC     structure or a portion of a structure is not indicated with, for example, bold or dashed lines, the structure or portion of the structure is to be interpreted as encompassing all stereoisomers of it. In some cases, however, where more than one chiral center exists, the structures and names may be represented as single enantiomers to help describe the relative stereochemistry. Those skilled in the art of organic synthesis will know if the compounds are prepared as single enantiomers from the methods used to prepare them. EXAMPLES Abbreviations

[0151] Commonly used abbreviations include: acetyl (Ac), azo-bis-isobutyrylnitrile (AIBN), atmospheres (Atm), 9-borabicyclo[3.3.1]nonane (9-BBN or BBN), tert- butoxycarbonyl (Boc), di-tert-butyl pyrocarbonate or boc anhydride (BOC2O), benzyl (Bn), butyl (Bu), Chemical Abstracts Registration Number (CASRN), benzyloxycarbonyl (CBZ or Z), carbonyl diimidazole (CDI), 1,4-diazabicyclo[2.2.2]octane (DABCO), diethylaminosulfur trifluoride (DAST), dibenzylideneacetone (dba), 1,5-diazabicyclo[4.3.0]non-5-ene (DBN), 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU), N,N'-dicyclohexylcarbodiimide (DCC), 1,2- dichloroethane (DCE), dichloromethane (DCM), diethyl azodicarboxylate (DEAD), di-iso- propylazodicarboxylate (DIAD), di-iso-butylaluminumhydride (DIBAL or DIBAL-H), 1,3- Diisopropylcarbodiimide (DIC), di-iso-propylethylamine (DIPEA), N,N-dimethyl acetamide (DMA), 4-N,N-dimethylaminopyridine (DMAP), N,N-dimethylformamide (DMF), dimethyl sulfoxide (DMSO), 1,1'-bis-(diphenylphosphino)ethane (dppe), 1,1'-bis- (diphenylphosphino)ferrocene (dppf), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDCI), ethyl (Et), ethyl acetate (EtOAc), ethanol (EtOH), 2-ethoxy-2H- quinoline-1-carboxylic acid ethyl ester (EEDQ), diethyl ether (Et2O), O-(7-azabenzotriazole- 1-yl)-N, N,N’N’-tetramethyluronium hexafluorophosphate acetic acid (HATU), acetic acid (HOAc), 1-N-hydroxybenzotriazole (HOBt), high pressure liquid chromatography (HPLC), iso-propanol (IPA), lithium hexamethyl disilazane (LiHMDS), methanol (MeOH), melting point (mp), MeSO2- (mesyl or Ms), , methyl (Me), acetonitrile (MeCN), m-chloroperbenzoic acid (MCPBA), mass spectrum (ms), methyl t-butyl ether (MTBE), N-bromosuccinimide (NBS), N-carboxyanhydride (NCA), N-chlorosuccinimide (NCS), N-methylmorpholine (NMM), N-methylpyrrolidone (NMP), pyridinium chlorochromate (PCC), pyridinium dichromate (PDC), phenyl (Ph), propyl (Pr), iso-propyl (i-Pr), pounds per square inch (psi), 50       TSRI 2225.1PC     pyridine (pyr), room temperature (rt or RT), tert-butyldimethylsilyl or t-BuMe2Si (TBDMS), triethylamine (TEA or Et3N), 2,2,6,6-tetramethylpiperidine 1-oxyl (TEMPO), triflate or CF3SO2- (Tf), trifluoroacetic acid (TFA), 1,1'-bis-2,2,6,6-tetramethylheptane-2,6-dione (TMHD), O-benzotriazol-1-yl-N,N,N',N'-tetramethyluronium tetrafluoroborate (TBTU), thin layer chromatography (TLC), tetrahydrofuran (THF), trimethylsilyl or Me3Si (TMS), p- toluenesulfonic acid monohydrate (TsOH or pTsOH), 4-Me-C6H4SO2- or tosyl (Ts), N- urethane-N-carboxyanhydride (UNCA),. Conventional nomenclature including the prefixes normal (n), iso (i-), secondary (sec-), tertiary (tert-) and neo have their customary meaning when used with an alkyl moiety. (J. Rigaudy and D. P. Klesney, Nomenclature in Organic Chemistry, IUPAC 1979 Pergamon Press, Oxford.). Biological Protocols Cell Lines and Culture

[0152] The following cell lines were used in this work: HL-60, OCI-AML-2, OCI-AML- 3, HB11;19, MV4-11, MOLM-13, Kasumi-1, EOL1, KBM7 iCas9, K562, KBM7, Lenti-X 293 T and HEK293T. All cell lines were cultured in RPMI-1640, IMDM or DMEM media containing 10% or 20% heat-inactivated fetal bovine serum (FBS) and were supplemented with streptomycin and penicillin and stored at 37 ^C at 5% CO2. HB11;19, MV4;11, MOLM13 and EOL1 cell lines were cultured in 10% FBS in RPMI-1640. OCI-AML-2, OCI-AML-3, Kasumi-1, and CMK cell lines were cultured in 20% FBS in RPMI-1640. HEK293T and Lenti-X 293 T cell lines were cultured in 10% FBS in DMEM. HL-60 and KBM7 cells were cultured in IMDM supplemented with 10% FBS Commercial cell lines were obtained from ATCC or DSMZ and underwent authentication using short tandem repeat (STR) DNA profiling to confirm their identity prior to use. HB11;19 cell lines were generously provided by Akihiko Yokoyama. KBM7 iCas9 cells were a gift from J. Zuber. All cell lines were confirmed mycoplasma negative at 1-month intervals.

[0153] For lentiviral production, Lenti-X 293 T cells were seeded in 6-well plates or 10cm dishes and transfected at approximately 80% confluency with 0.6 / 3.4ug target plasmid, 1.7 / 0.3ug psPAX2 (Addgene 12260) and 0.85 / 0.15ug pMD2.G (Addgene 12259) using PEI (PolySciences). Virus supernatant was collected after 60h, filtrated using 0.45μm filter and stored in aliquots for transduction. 51       TSRI 2225.1PC     Viability Studies

[0154] To assess drug response, 20 x 105MV4;11 or HL-60 cells were seeeded per well in a non-tissue culture treated 96-well plate (VWR) and treated with 0.1% DMSO or increasing concentrations of (R)- or (S)-dHTC1 (39.07nM, 78.13nM, 156nM, 312nM, 625nM, 1.25µM, 2.5µM, 5µM and 10µM). Cells were split 1:10 and fresh drug was added every 3 days. Cell proliferation was measured on day 12 using the CellTiterGlo® Luminescent Cell Viability Assay (Promega). Drug response was calculated based on luminescence relative to the DMSO treated samples. The experiment was independently repeated 3 times in technical replicates and for each, the average luminescence was calculated. Diagrams show the mean of the 3 experiments and error bars represent the standard error of means (SEM). ENL-HiBiT cell lines

[0155] The following cell lines were generated bearing an endogenously tagged N- terminal ENL HiBiT via homology directed repair: OCI-AML2, OCI-AML3, MV4;11 (WT and CRBN KO (31)), MOLM-13, EOL1, and HL60. All components necessary were ordered from Integrated DNA Technologies. A Neon Transfection System (ThermoFisher) was used to electroporate cells. Briefly, sgRNA complexes are synthesized by mixing equal volumes of crRNA (2 µL, 160 µM in nuclease free water, ggcgccagccatggacaatc) and tracrRNA (2 µL, 160 µM) and are incubated at 37 °C for 30 min before Cas9 (2.7 µL, 10 µg / µL, Alt-R™ S.p. Cas9 Nuclease V3, catalog number 1081058) and duplex buffer (1.3 µL, 30 mM HEPES, pH 7.5; 100 mM potassium acetate in nuclease free water) are added. This suspension is incubated at 37 °C for an additional 15 min to form the active RNP complex. The RNP solution (1 µL) is added to ssODN (2 µM in nuclease free water, gcggcggcggcgagcgacgcggggcccgggggcggggcggggcgccagccatggtgagcggctggcggctgttcaagaagatt agcggaagcggagacaatcaagtgaggagcggccgcgccgcccctgcgcagcccgcccggccccct). The resulting mixture is electroporated with 200,000 cells in electroporation buffer and the cells are deposited into antibiotic free media (see Cell Lines and Culture for conditions) and allowed to rest in a 37 °C incubator for 24 h before additional antibiotic containing media is added. Replicates with the highest overall signal are selected and expanded.

[0156] The electroporation conditions for each cell lines were as follows: 52       TSRI 2225.1PC     MV4;11, OCI-AML2, OCI-AML3, MV4;11, MOLM-13, EOL1: 1600 pulse voltage, 10 millisecond pulse width, 3 pulses.HL-60: 1350 pulse voltage, 35 millisecond pulse width, 1 pulse. MV4;11 BRD4-HiBiT cell lines

[0157] All components necessary were ordered from Integrated DNA Technologies. A Neon Transfection System (ThermoFisher) was used to electroporate cells. Briefly, sgRNA complexes are synthesized by mixing equal volumes of crRNA (2 µL, 160 µM in nuclease free water, aatcttttctgagcgcacct) and tracrRNA (2 µL, 160 µM) and are incubated at 37 °C for 30 min before Cas9 (2.7 µL, 10 µg / µL, Alt-R™ S.p. Cas9 Nuclease V3, catalog number 1081058) and duplex buffer (1.3 µL, 30 mM HEPES, pH 7.5; 100 mM potassium acetate in nuclease free water) are added. This suspension is incubated at 37 °C for an additional 15 min to form the active RNP complex. The RNP solution (1 µL) is added to ssODN (2 µM in nuclease free water, catgaatttccagagtgatctattgtcaatatttgaagaaaatcttttcggtggcggtggctcgggcggtggtgggtcgggtggcggcgga tctgtgagcggctggcggctgttcaagaagattagctgacctaggtggcttctgactttgattttctggcaaaacattgactttccata). The resulting mixture is electroporated (1600 pulse voltage, 10 millisecond pulse width, 3 pulses) with 200,000 cells in electroporation buffer and the cells are deposited into antibiotic free media (see Cell Lines and Culture for conditions) and allowed to rest in a 37 °C incubator for 24 h before additional antibiotic containing media is added. Replicates with the highest overall signal are selected and expanded. Endpoint HiBiT protein degradation

[0158] MV4;11 cells were engineered using CRISPR knock-in of the HiBiT tag at the n- terminus of ENL and the c-terminus of BRD4 with a protocol adapted from the Neon ^ Transfection System Quick Reference. Cells were seeded into 384-well plates at 20,000 cells / well and treated with the indicated compounds and equivalent concentrations of DMSO for the time indicated in the experiment, usually 3, 24 or 72 hours. Levels of HiBiT-tagged proteins were detected via luminescence using the Nano-Glo® HiBiT Lytic Detection System (Promega, catalog number N3050). Dose response curves were fitted using non-linear regression and the data shown are from n = 3 or n = 4 independent repeats, mean plus or minus standard error of the mean. 53       TSRI 2225.1PC     ENL Intracellular engagement assay

[0159] Intracellular ENL engagement assays were carried out as described previously (80). Briefly, an Echo acoustic liquid handler (Labcyte) was used to transfer drug in 10-point dose response (100 nL transfers) to empty wells on a white, tissue culture treated 384 well plate. To these wells were added OCI / AML-2 cells stably expressing ENL(YEATS)-HiBiT at concentrations of 20,000 cells in 20 µL of media. The plate was placed on an orbital shaker for 15 seconds and was then placed in a 37 °C incubator for 3 h, or a time otherwise indicated, after which each well was treated with 20 µL of Nano-Glo® HiBiT Lytic Detection (Promega, N3050). After this treatment, the plate is mixed with an orbital shaker for 15 seconds and allowed to rest in the dark for 20 min before luminescence is measured with a Clariostar microplate reader (BMG Labtech). Luminescence values are normalized to DMSO treated wells and dose response curves were fitted using non-linear regression. CRBN Intracellular engagement assay

[0160] An Echo acoustic liquid handler (Labcyte) was used to transfer drug in 10-point dose response (100 nL transfers) to empty wells on a white, tissue culture treated 384 well plate. MV4;11 cells stably expressing an endogenous BRD4 with a C-terminal HiBiT (31) were added at concentrations of 20,000 cells in 18 µL of media, and the plate was mixed on an orbital shaker for 15 seconds. The plate was placed into a 37 °C incubator for 2 hours before 2 µL of a 5 µM dBET6 solution in RPMI with 10% FBS was added to each well, and the plate was again placed on an orbital shaker for 15 seconds (final concentration of dBET6 is 500 nM, control wells are treated with an equal volume of DMSO in RPMI with 10% FBS). After 1 h incubation at 37 °C, each well was treated with 20 µL of Nano-Glo® HiBiT Lytic Detection (Promega, N3050). After this treatment, the plate is mixed with an orbital shaker for 15 seconds and allowed to rest in the dark for 20 min before luminescence is measured with a Clariostar microplate reader (BMG Labtech). Luminescence values are normalized to DMSO treated wells and dose response curves were fitted using non-linear regression. Cell viability assay

[0161] An Echo acoustic liquid handler (Labcyte) was used to transfer drug in 10-point dose response (100 nL transfers) to empty wells on a white, tissue culture treated 384 well plate. The indicated cells were added at concentrations of 1,000 cells in 50 µL of media, and the plate was mixed on an orbital shaker for 15 seconds. After 72 h, or the indicated amount of 54       TSRI 2225.1PC     time, 25 µL of ATPlite ^ 1step Luminescence Assay System (Perkin Elmer / Revvity) was added to each well and the plate was mixed on an orbital shaker for 15 seconds. After 20 minutes of incubation in the dark, luminescence is measured with a Clariostar microplate reader (BMG Labtech). Luminescence values are normalized to DMSO treated wells and dose response curves were fitted using non-linear regression. Western blotting

[0162] For adherent cell lines, cells were plated in 6 or 12-well plates at approximately 1x106cells per well and allowed to adhere overnight. For suspension lines, cells were plated at 1x106cells per well and used shortly thereafter. Wells were treated with the indicated compounds for the times indicated in each experiment. Cells were then washed with ice cold PBS and lysed with 1X RIPA buffer supplemented with protease inhibitor and phosphatase inhibitor (Life Technologies). Lysates were sonicated and centrifuged, and the supernatants were collected. Protein concentration in cell lysates was measured using BCA assay.25 μg of denatured total protein from each sample was separated by sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE) using 4-12% Bis-Tris gels and transferred to nitrocellulose membranes. Membranes were blocked with 5% milk in TBST and then incubated with primary antibodies overnight at 4 °C (all antibodies were 1:1000 in 5% milk in TBST, while GAPDH primary antibody is diluted 1:5000 in 5% milk in TBST). Bound primary antibodies were incubated in the appropriate secondary antibody (IRDye680 goat- anti-mouse: 925-68070, IRDye800 goat-anti-rabbit: 926-32211, diluted 1:5000 in 5% milk in TBST). Secondary antibodies are incubated at room temperature for 90 minutes before being washed with additional TBST and are visualized on an Odyssey CLx (Li-Cor Biosciences).

[0163] Alternatively, MV4;11 CRBN- / -ENL-TagBFP-P2A-mCherry cells rescued with CRBN wild-type or mutant were seeded in 12-well plates at 1x106cells per mL and treated with DMSO, 1μM dHTC1 or 1μM SR-1114 for 6h. Cells were washed twice in ice-cold PBS and lysed for 15min on ice with RIPA buffer (50mM Tris-HCl pH 8.0, 150mM NaCl, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS) supplemented with benzonase protease (25U / mL) and 1x Halt protease inhibitor cocktail. Following clearance via centrifugation, protein concentration of lysates was determined using Pierce BCA Protein Assay (23225, Fisher Scientific) and 30μg of lysate was prepared using 4x LDS sample buffer (Thermo Fisher) and 10% 2-mercaptoethanol and run on NuPAGE 4-15% bis-tris gels (Thermo Fisher). Proteins were transferred to nitrocellulose membranes, blocked for 30min in 5% milk TBS-T 55       TSRI 2225.1PC     at room temperature before incubating with primary antibodies for 1h at room temperature. The following primary antibodies were used: ENL (1:1,000, D9M4B, Cell Signaling Technology) CRBN (1:2,000, gift of R. Eichner and F. Bassermann) and GAPDH (1:2,000, FL-335, Santa Cruz Biotechnology). Membranes were then washed in TBS-T and incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies for 45 min at room temperature before further washes and developing with chemiluminescence films. Secondary antibodies used: peroxidase-conjugated AffiniPure Goat Anti-Rabbit IgG (1:10,000, Jackson ImmunoResearch, 111-035-003) and peroxidase-conjugated AffiniPure Goat Anti-Mouse IgG (1:10,000, Jackson ImmunoResearch, 115-035-003).

[0164] For western blots of xenografted MV4;11 cells, mouse cell depletion was performed on whole bone marrow cells using the Mouse Cell Depletion Kit and LS columns (Miltenyi Biotec). RIPA lysis was performed with purified human cells and 25µg of protein were loaded on 10% Bis-Tris-Gel NuPAGE gels with MOPS SDS running buffer (Life Technologies). Samples were transferred on nitrocellulose iBlot 3 transfer stacks (Life Technologies) using the iBlot 3 Gel Transfer Device (Thermo Fisher). Membranes were blocked in 5% milk in TBS-Tween buffer (TBST) for one hour at room temperature and incubated overnight at 4°C with antibodies directed against ENL (Millipore, 1:1000 in 5% milk in TBST) or GAPDH (Cell Signaling Technologies, 1:1000 in 5% milk in TBST). Membranes were washed followed by incubation with the secondary IrDye® 800CW donkey anti-rabbit antibody (Thermo Fisher Scientific, 1:7000 in 5% milk in TBST) for one hour at room temperature and subsequent washes were performed. Membranes were imaged on a LI- COR imager. Primary Antibodies Used: ENL: D9M4B (Cell Signaling Technologies) or ABE2596-100UG (Millipore) AF9: E5Z7U (Cell Signaling Technologies) GAPDH: sc-32233 (Santa Cruz Biotechnology) Secondary Antibodies Used: Goat anti-Mouse IgG with IRDye 680RD: 925-68070 (Li-Cor) Goat anti-Rabbit IgG with IRDye 800CW: 926-32211 (Li-Cor) 56       TSRI 2225.1PC     Goat anti-Rabbit IgG with HRP: 111-035-003 (Jackson ImmunoResearch) Goat anti-Mouse IgG with HRP: 115-035-003 (Jackson ImmunoResearch) Donkey anti-Rabbit with IRDye800CW: 926-32213 (Li-Cor) Expression Proteomics Sample Preparation

[0165] Treated cells were resuspended in 200 µL of cold DPBS containing protease inhibitor (cOmplete ULTRA tablets mini EDTA-free, Roche, Cat # 05892791001, 1 tablet was dissolved in 10 mL DPBS before use). Cells were lysed by probe sonication using a Branson Sonifer 250 ultrasonic cell disruptor (2 x 12 pulses, 10% power output). Protein content of whole cell lysates was determined using the DC protein Assay (Bio-Rad, Cat # 5000113 and 5000114) with absorbance at 750 nm measured on a CLARIOstar plate reader. A volume corresponding to 200 µg of protein was transferred to a new low-bind Eppendorf tube containing 48 mg of urea and brought to a total volume of 100 µL. Samples were reduced with DTT by the addition of 5 µL of a 200 mM solution (10 mM final concentration) and were incubated at 65 ^C for 15 minutes. Samples were next alkylated with iodoacetamide by the addition of 5 µL of a 400 mM solution (20 mM final concentration) and incubated at 37 ^C for 30 minutes in the dark. Proteins in each sample were precipitated by the addition of cold MeOH (500 µL), CHCl3 (100 µL) and H2O (400 µL). Samples were vortexed and centrifuged (16000 g, 10 minutes, 4 ^C). The supernatant was aspirated leaving behind the protein disc and an additional 1 mL of cold MeOH was added. The samples were vortexed again and centrifuged (16000 g, 10 minutes, 4 ^C). The supernatant was aspirated and the protein pellet was briefly allowed to air dry. The protein pellet was then resuspended in 160 µL of EPPS buffer (200 mM, pH 8.0) by probe sonication (10 pulses, 10% power output). Proteomes were digested with Lys-C by the addition of 4 µL of a 0.5 µg / µL Lys-C solution in HPLC-grade water and the samples were incubated for 2 hours at 37 ^C. Proteomes were then digested with trypsin by the addition of 8 µL of a 0.5 µg / µL trypsin solution in trypsin resuspension buffer with 20 mM CaCl2 and the samples were incubated at 37 ^C overnight. Peptide concentrations were determined using a Micro BCATMassay (Thermo Scientific, Cat # 23235) and a volume that corresponded to 25 µg was transferred to a new low-bind Eppendorf tube and brought to a total volume of 25 µL with EPPS buffer. To each sample, 9 µL of HPLC-grade acetonitrile 57       TSRI 2225.1PC     was added followed by 3 µL (20 µg / µL in dry acetonitrile) of the respective TMT6plextag and the reaction was vortexed and incubated at room temperature for 1 hour with additional vortexing every 20 minutes. The reaction was quenched by the addition of 6 µL of 5% hydroxylamine in H2O, vortexed, and incubated at room temperature for 15 minutes. Each sample was acidified by the addition of 2.5 µL of LCMS-grade formic acid. Samples were combined by taking 25 µL of each sample (~12.5 µg of labeled peptide per channel) and vacuum-centrifuged. The combined samples were desalted with a Sep-Pak C18 cartridge and offline-fractionated by HPLC. Sample de-salting and offline fractionation

[0166] Samples were resuspended in 500 µL of buffer A (95% H2O, 5% acetonitrile, 0.1% formic acid), vortexed and water bath sonicated for 5 minutes at room temperature. Before loading the sample onto a Sep-Pak C18 cartridge (Waters, Cat # WAT054955), the column was conditioned with acetonitrile (3 x 1 mL) and equilibrated with buffer A (3 x 1 mL). The sample was then loaded onto the column and the flow through of the sample was added onto the column again. The sample was de-salted by adding buffer A (3 x 1 mL) and passing it through and the sample was then eluted by the addition of 1 mL of buffer B (80% acetonitrile, 20% H2O, 0.1% formic acid). The eluted sample was collected into a new low-bind Eppendorf tube and was evaporated to dryness using a SpeedVac vacuum concentrator.

[0167] The sample was then resuspended in 500 µL of buffer A and fractionated using an Agilent HPLC (Agilent Infinity 1260 II system) into a 96 deep-well plate containing 20 µL of 20% formic acid as previously reported (81, 82). The peptides were eluted onto a capillary column (ZORBAX Extend-C18, 80 Å, 4.6 x 250 mm, 5 µM) and separated at a flow rate of 0.5 mL / min using the following gradient with buffer A (10 mM aqueous NH4HCO3) and buffer B (100% Acetonitrile): 100% buffer A from 0–2 min, 0–13% buffer B from 2–3 min, 13–42% buffer B from 3–60 min, 42–100% buffer B from 60–61 min, 100% buffer B from 61–65 min, 100–0% buffer b from 65–66 min, 100% buffer A from 66–75 min, 0–13% buffer B from 75–78 min, 13–80% buffer B from 78–80 min, 80% buffer B from 80–85 min, 100% buffer A from 86–91 min, 0–13% buffer B from 91–94 min, 13–80% buffer B from 94–96 min, 80% buffer B from 96–101 min, and 80–0% buffer B from 101–102 min. The eluent collected in the 96 deep-well plate was evaporated to dryness using a SpeedVac vacuum concentrator. The peptides were resuspended in 80% acetonitrile with 0.1% formic acid buffer and combined into 12 fractions (fractions were combined down a column of the plate) by 58       TSRI 2225.1PC     addition 200 µL of buffer, resuspending by pipetting, and combining into the next row. This process was repeated with another 200 µL. Each of the fractions had a final volume of 400 µL and were evaporated to dryness using a SpeedVac vacuum concentrator. TMT liquid chromatography-mass-spectrometry (LC-MS) analysis

[0168] Dried fractions were solubilized in 50mL of 0.1% trifluoroacetic acid and desalted using 2μg capacity ZipTips (Millipore, Billeric, MA) according to manufacturer instructions. Peptides were then on-line eluted into a Fusion Tribrid mass spectrometer (Thermo Scientific, San Jose, CA) from an EASY PepMapTMRSLC C18 column (2μm, 100Å, 75μm x 50cm, Thermo Scientific, San Jose, CA), using a hold of 6% solvent B (80 / 20 acetonitrile / water, 0.1% formic acid) for 15 minutes, followed by a gradient of 6-28% solvent B in 105 minutes, then 28-49% solvent B in 15 minutes, 40-100% solvent B in 10 minutes, a 10 minute hold of 100% solvent B, a return to 5% solvent B in 3 minutes, and finally a 3 minute hold of 5% solvent B. The gradient was then extended for the purpose of cleaning the column by increasing solvent B to 100% in 3 min, a 100% solvent B hold for 10 min, a return to 5% solvent B in 3 min, a 5% solvent B hold for 3 min, an increase of solvent B again to 100% in 3 min, then a 100% solvent B hold for 10min, a return to 5% solvent B in 3 minutes, a 5% solvent B hold for 3 min and finally one last increase to 100% solvent B in 3 minutes and a hold of 100% solvent B for 10min. All flow rates were 250 nL / minute delivered using an nEasy-LC1000 nano liquid chromatography system (Thermo Scientific, San Jose, CA). Solvent A consisted of water and 0.1% formic acid. Ions were created at 2.0 or 1.9kV using an EASY Spray source (Thermo Scientific, San Jose, CA) held at 50 °C. A synchronous precursor selection (SPS)-MS3 mass spectrometry method was selected based on the work of Ting et al (83). Scans were conducted between 380-2000 m / z at a resolution of 120,000 for MS1 in the Orbitrap mass analyzer at a standard AGC target (as defined in Thermo Scientific Xcalibur v 4.6.67.17) and a maximum injection of 50 msec. Collision induced dissociation (CID) was then performed in the linear ion trap of peptide monoisotopic ions with charge 2-8 above an intensity threshold of 5E3, using a quadrupole isolation of 0.7 m / z and a CID energy of 35%. The ion trap AGC target was also set to standard with a maximum injection time of 50 msec. Dynamic exclusion duration was set at 60 seconds and ions were excluded after one time within the + / - 10ppm mass tolerance window. The top 10 MS2 ions in the ion trap between 400-1200 m / z were then chosen for Higher-energy C-trap dissociation (HCD) at 65% energy. Detection occurred in the Orbitrap at a resolution of 50,000 and an AGC target of 1E5 59       TSRI 2225.1PC     (or 200% custom setting as defined in Thermo Scientific Xcalibur v 4.6.67.17), and an injection time of 120msec (MS3). All scan events occurred within a 3-second specified cycle time. The analysis was performed at The Herbert Wertheim UF Scripps Institute for Biomedical Innovation & Technology, Mass Spectrometry and Proteomics Core Facility (RRID:SCR_023576). Peptide and protein identification and quantification

[0169] The raw spectra files were uploaded to the Integrated Proteomics Pipeline (IP2) (http: / / ip2.scripps.edu / ip2 / mainMenu.html) and MS2 and MS3 files were extracted from the raw files using RAW converter and searched using the ProLuCID algorithm against a reverse- concatenated and nonredundant variant of the human UniProt database (2016-07). The precursor ion mass tolerance for a minimum envelop of three isotopic peaks was set to 50 ppm. Cysteine residues were searched with a static modification for carbamidomethylation (+57.02146 Da) and up to two differential modifications were allowed per peptide for methionine oxidation (+15.994915 Da). Lysine and N-termini residues were also searched with a static modification corresponding to the TMT tag (+229.1629 Da). Peptides were required to be a minimum of 6 amino acids long. ProLuCID data was filtered using DTAselect 2.0 within IP2 to allow for a false-positive rate less than 1% at the spectrum level. MS3-based peptide quantification was performed with a reporter ion mass tolerance set to 20 ppm with IP2. Proteins were required to have at least two unique peptides. Peptide-spectra matches were grouped based on protein ID and peptides were excluded if a) the sum of the reporter ion intensities were less than 10000, b) the coefficient of variance was greater than 0.5, or c) if they were non-unique or non-tryptic peptide sequences. Proteins were quantified by summing the reporter ion intensities across all matching peptide-spectra matches and normalizing to the highest signal channel per protein. Plots were generated with the log2 fold change of the quotient of DMSO treated cells with drug treated cells and the inverse log10of a two-tailed Student’s T-Test. In vivo experiments

[0170] Studies were conducted in 6-8 week-old female NOD.Cg- PrkdcscidIl2rgtm1Wjl / SzJ (NSG) mice under the Institutional Animal Care and Use Committee (IACUC) protocol number 16-021 at Dana-Farber Cancer Institute. 1 x 106MV4;11 cells were intravenously injected per mouse and engraftment was confirmed in the 60       TSRI 2225.1PC     peripheral blood by flow cytometry-based detection of human CD45+ cells using an LSR Fortessa, BD Biosciences (human CD45-PE, clone HI30, 1:200, mouse CD45-APC-Cy7, clone 30-F11, 1:100, BioLegend). Upon confirmation of engraftment, mice were randomly assigned to treatment groups and received 3 doses of (R)-, (S)- dHTC1 (50 mg / kg i.p. BID, i.e. every 12 hours) or vehicle. The compounds were dissolved in 5% DMAC and 95% PEG-300 (40%) + NaCl (0.9%) (60%).

[0171] Mice were euthanized one hour after the last dosing using CO2 inhalation followed by cervical dislocation. Bone marrow cells were isolated from tibias, femurs, iliac crest and spine by crushing the bones with mortar and pestle in PBS (Life Technologies) + 2% FBS (Life Technologies) and passing the cell suspension through a 40µM cell strainer (Falcon). Spleens were smashed using a syringe plunger and passed through a 40µM cell strainer (Falcon). Blood was collected by cardiac puncture and red blood cell lysis was performed using RBC lysis buffer (BioLegend). The differentiation status of bone marrow, spleen and blood cells was assessed by flow cytometry (LSR Fortessa, BD Biosciences) using the following antibodies: human CD45-PE, clone HI30, 1:200, mouse CD45-APC-Cy7, clone 30- F11, 1:100, and human CD11b-FITC, clone ICRF44, 1:100, BioLegend). Ubiquitin Proteosome System Screen Plasmids and oligonucleotides

[0172] The design and construction of the human UPS-focused sgRNA library used for ENL stability screens and the human CRBN deep mutational scanning (DMS) library have been described previously (44, 74). The engineering of the fluorescent protein stability reporter of ENL for the FACS-based CRISPR-Cas9 and DMS screens and the CRBN point mutants for the validation of the DMS screen were done as described previously (33, 44). The fluorescent protein stability reporter of GSPT1 was generated by inserting GSPT1 coding sequence into pArtichoke plasmid (Addgene 73320) by Gibson assembly. FACS-based CRISPR-Cas9 ENL stability screen

[0173] The UPS-focused library packaged lentivirus containing supernatant was used to transduce KBM7 ENL-TagBFP-P2A-mCherry cells harboring a doxycycline-inducible Cas9 allele (iCas9) at a multiplicity of infection of 0.19 and 1,000x-fold library representation using 8μg / mL polybrene (Szabo Scandic, SACSC-134220). Library-transduced KBM7 cells were selected with 1mg / mL G418 (Gibco) for 14 days, expanded and Cas9 expression was induced 61       TSRI 2225.1PC     with doxycycline at 0.4 μg / mL (PanReac AppliChem). Three days after doxycycline induction, 50 million cells per condition were treated with DMSO, dHTC1 (10μM) or SR- 1114 (10μM) for 8h in two biological replicates. Cells were washed with PBS, stained with APC anti-mouse Thy1.1 antibody (1:400, 202526, BioLegend) and Zombie NIR Fixable Viability Dye (1:1000, BioLegend) in the presence of Human TruStain FcX Fc Receptor Blocking Solution (1:400, 422302, BioLegend) for 10min at 4°C in the dark, and fixed with 1mL BD CytoFix Fixation Buffer (BD Biosciences, 554655) for 30min at 4°C in the dark. Cells were washed with and stored in FACS buffer (PBS with 5% FCS and 1mM EDTA) at 4°C overnight. The next day, cells were strained through a 35μm nylon mesh and sorted on a BD FACSAria Fusion (BD Biosciences) iperated on BD FACSDiva software (v.8.0.2) using a 70μm nozzle excluding aggregates, dead (Zombie NIR positive), Cas9-negative (GFP negative) and sgRNA library-negative (Thy1.1-APC negative) cells. The remaining cells were sorted based on their ENL-BFP and mCherry levels into ENLhi(5-10% of cells), ENLmid(25- 50%) and ENLlow(5-10%) fractions. Cells corresponding to at least 750-fold library representation were sorted per each sample replicate. DNA libraries of sorted fractions for Next-generation sequencing (NGS) were prepared as done previously (84). In short, genomic DNA was extracted by cell lysis (10mM Tris-HCl, 10mM EDTA, 150mM NaCl, 0.1% SDS), proteinase K treatment (New England Biolabs) and DNAse-free RNAse digest (Thermo Fisher), followed by two rounds of phenol extraction and isopropanol precipitation. Barcoded NGS libraries for each sorted fraction were prepared using a two-step PCR protocol using AmpliTaq Gold polymerase (Invitrogen). Barcodes for each sample were introduced in a first PCR, the product of which were purified using Mag-Bind TotalPure NGS beads (Omega Bio- tek) and amplified in a second PCR introducing the standard Illumina adapters. The final Illumina libraries were bead-purified, pooled and sequenced on NovaSeq 6000 instrument (Illumina) following a 100-base-pair, paired-end recipe. Screen analysis was performed as previously described (84). In short, sequencing reads were trimmed using fastx-toolkit (v0.0.14), aligned using Bowtie2 (v2.4.2) and quantified using featureCounts (v2.0.1). The crispr-process-nf Nextflow workflow is available at https: / / github.com / ZuberLab / crispr- process-nf / tree / 566f6d46bbcc2a3f49f51bbc96b9820f408ec4a3. For statistical analysis, we used the crispr-mageck-nf Nextflow workflow, available at https: / / github.com / ZuberLab / crispr-mageck- nf / tree / c75a90f670698bfa78bfd8be786d6e5d6d4fc455. To calculate gene-level enrichment, 62       TSRI 2225.1PC     the sorted populations (ENLhighor ENLlow) were compared to the ENLmidpopulations in MAGeCK (0.5.9)(85), using median-normalized read counts. FACS-based deep mutational scanning screens

[0174] 18 million MV4;11 CRBN- / -ENL-TagBFP-P2A-mCherry cells were transduced with the CRBN DMS library virus supernatant at a multiplicity of infection of 0.17 yielding a calculated library representation of 1,760 cells per variant. For the transduction, 1 million cells were seeded in a 24-well plate with 8μg / mL polybrene (Szabo Scandic, SACSC-134220) and filled to 1mL with the titrated amount of virus and culture medium. The plate was centrifuged at 760g for 45min at 37°C and then cells were pooled and expanded.3 days after transduction, library-transduced cells were selected with 1μg / mL Blasticidin (Gibco, R21001) for 7 days and selected cells were expanded.50 million cells per condition were treated with dHTC1 (1μM) or SR-1114 (1μM) for 8h in three biological replicates. Cells were washed with PBS, stained with Zombie NIR Fixable Viability Dye (1:1000, BioLegend) for 10min at 4°C in the dark, and fixed with 1mL BD CytoFix Fixation Buffer (BD Biosciences, 554655) for 30min at 4°C in the dark. Cells were washed with and stored in FACS buffer (PBS with 5% FCS and 1mM EDTA) at 4°C overnight. Two sets of 50 million unsorted cells were also harvested as control, and directly washed and frozen. The next day, cells were strained through a 35μm nylon mesh and sorted on a BD FACSAria Fusion (BD Biosciences) operated on BD FACSDiva software (v.8.0.2) using a 70μm nozzle excluding aggregates, dead (Zombie NIR positive) and reporter negative (BFP and mCherry negative) cells. The remaining cells were sorted based on their ENL-BFP and mCherry levels into an ENLhifraction (30-35% of cells). Cells corresponding to at least 3,000-fold library representation were sorted per each sample replicate. DNA libraries of sorted and unsorted cell pools for Next-generation sequencing (NGS) were prepared as done previously (44, 84). In short, genomic DNA (gDNA) was extracted by cell lysis (10mM Tris-HCl, 10mM EDTA, 150mM NaCl, 0.1% SDS), proteinase K treatment (New England Biolabs) and DNAse-free RNAse digest (Thermo Fisher), followed by two rounds of phenol extraction and isopropanol precipitation. CRBN variant cDNAs were amplified via PCR from gDNA using AmpliTaq Gold polymerase (Invitrogen) and primers CRBN_GA_fwd (AGGTGTCGTGACGTACGGGATCCCAGGACCATGGCCGGCGAAGGAG) and CRBN_GA_rev (GGGGGGGGGGCGGAATTAATTCCTACTACTTACAAGCAAAGTATTACTTTGTCTG 63       TSRI 2225.1PC     GAC). The cycle number for specific amplification of 1.4kb CRBN target was confirmed by agarose gel electrophoresis. PCR reactions for each sample were pooled and purified using Mag-Bind TotalPure NGS beads (Omega Bio-tek). The library preparation from the amplified DNA was performed using the Tagment DNA TDE1 Enzyme and IDT for Illumina Unique Dual Indexes (Illumina). Library concentrations were quantified with the Qubit 2.0 Fluorometric Quantitation system (Life Technologies) and the size distribution was assessed using the 2100 Bioanalyzer instrument (Agilent). For sequencing, samples were diluted and pooled into NGS libraries and sequenced on NovaSeq 6000 instrument (Illumina) following a 100-base-pair, paired-end recipe. Raw sequencing reads were converted to fastq format with samtools (v1.15.1) and bedtools (v.2.30.0) using bamtofastq function. Sequencing reads were trimmed using Trim Galore (v0.6.6) using nextera and pair modes. Short reads were aligned to the CRBN cassette and SAM files were generated using mem algorithm from the bwa software package (v0.7.17). SAM file was converted to BAM using samtools and mutation calling was performed using the AnalyzeSaturationMutagenesis tool from GATK (v4.1.8.1). Given our sequencing strategy, >98% of reads corresponded to wild-type sequences and were filtered out during this step. Next, relative frequencies of variants were calculated for each position and variants that were covered by less than 1 in 30,000 reads were excluded from further analysis. Read counts for each variant were then normalized to total read count of each sample and log2fold changes of ENLhighover unsorted pools were calculated. To correct for differential drug potency, each variant was then normalized to the maximum log2 fold change. For drug comparisons, log2fold changes of ENLhighover unsorted pools of each drug were subtracted. Heatmaps were generated using pheatmap (v.1.0.12) package in R (v.4.1.0) or with Prism version 10. Flow-cytometric ENL reporter assay

[0175] MV4;11 CRBN- / -ENL-TagBFP-P2A-mCherry or GSPT1-GFP-P2A-mCherry cells were transduced with lentivirus expressing wild-type or mutated CRBN in pRRL-EF1a-CRBN- IRES-BlastR plasmid to generate stable cell lines. For evaluation of reporter degradation on the different CRBN backgrounds, cells were treated with DMSO or dHTC1, SR-1114 (both 1μM, 6h, ENL reporter) or CC885 (1μM, 5h, GSPT1 reporter) before flow cytometry analysis on an LSR Fortessa (BD Biosciences) operated on BD FACSDiva software (v9.0). 64       TSRI 2225.1PC     Crystallization of CRBNmidibound to dHTC1

[0176] CBRNmidiat 3.4 mg / mL in a buffer containing 20 mM HEPES pH 7.5, 500 mM NaCl and 0.5 mM TCEP was mixed with a 4-molar excess of dHTC1 (364 µM, 1.8% (v / v) DMSO final). The complex was subjected to co-crystallization using the sitting drop vapor diffusion method across several sparse matrix screens at 20°C by mixing equal volumes of protein solution and reservoir solution. Crystal hits from Morpheus H10 (0.1 M Buffer System 3 pH 8.5, 0.12 M Alcohols, 30 % Precipitant Mix 2) (Molecular Dimensions) were harvested directly from the drop and flash cooled in liquid nitrogen.

[0177] Diffraction data were collected at Diamond Light Source beamline I24 using the Eiger CdTe 9M detector at a wavelength of 0.6199 Å. The 2.2 Å dataset was processed using Dials (86), indexed in P31space group and the structure was solved by molecular replacement in phenix.phaser (87) using the coordinates of 8RQA as a search model. Phenix.refine (88) and coot (89) were used for refinement and model building. Surface plasmon resonance

[0178] Surface plasmon resonance experiments were performed on a Biacore S200 (Cytiva). A series S streptavidin sensor chip was used for ligand immobilization (Cytiva). Biotinylated ENL and biotinylated CRBNmidiwere prepared in HBS-EP+ buffer (10 mM HEPES, 150 mM NaCl, 3 mM EDTA, 0.05% P20, pH 7.4). Ligand immobilization was carried out in flow cell 2 and 4 with a series of ligand injections at a flow rate of 5 mL / min, until the desired density was achieved (700 RU for ENL, and 4432 RU for CRBNmidi). Flow cells 1 and 3 were left blank as a reference. HBS-EP+ buffer with 2% DMSO was used as running buffer and for the preparation of all analyte samples. For samples with CRBN-DDB1 in the eluent, CRBN-DDB1 was serially diluted in either HBS-EP+ and 1% DMSO buffer or HBS-EP+ and 1% DMSO buffer with 1 µM compound. Analytes were serially diluted in polystyrene 96 well plates immediately prior to injection. Before analyte injection, 3 startup cycles were run with injections of running buffer over all flow cells. Binding data was collected by injecting the analyte at a flow rate of 30 mL / min over two flow cells (reference and immobilized ligand) at a temperature of 25 °C. The association to biotin-ENL or biotin- YEATS4 was measured over 60 seconds, and the dissociation over 180 seconds. The flow cell surfaces were regenerated with 30 second injections of running buffer over each flow cell. Duplicate injections were carried out for each sample, including the blank. Affinity curves, 65       TSRI 2225.1PC     association and dissociation constants, and sensograms were determined using Biacore S200 evaluation software. Synthetic Protocols General Experimental Notes

[0179] All reagents were purchased from Sigma Aldrich, Fischer Scientific, CombiBlocks, Oakwood Chemical or ChemImpex and used as received without further purification unless otherwise noted.1H and13C NMR spectra were recorded on Bruker AVIII HD 600 NMR equipped with either with a 5 mm CPQCI (H-C-N-P) CryoProbes or a 5 mm CPDCH (C-H) CryoProbe, or a Bruker AV NEO 399 NMR equipped with a BBFO Smart Probe.19F NMR was recorded on Bruker AV NEO 399 NMR spectrometer equipped with a 5 mm BBFO Smart Probe. Data for1H NMR spectra are reported as follows: chemical shift (δ ppm), multiplicity, coupling constant (Hz) and integration. Data for13C and19F NMR spectra are reported in terms of chemical shift. Unless otherwise indicated, all NMR spectra are recorded at 295 K. Reactions were monitored by TLC, LC / MS or UPLC / MS. Purifications were carried out with a Teledyne ISCO CombiFlash NextGen 300+ using running Teledyne silica or C18 cartridges. Optical rotation data was recorded on an Anton Paar 100 Modular Circular Polarimeter. Synthesis of SuFEx libraries

[0180] SuFEx libraries were synthesized in Echo qualified 384-well low dead volume plates and with an Echo acoustic liquid handler (Beckman Coulter).1 µL of an amine stock (50 mM in DMSO) was transferred to wells of the plate, followed by 1.5 µL of the SuFEx enabled difluoride (6.67 mM in DMSO). Finally, 2.5 µL of phosphate buffered saline (freshly prepared at pH 8) was added to each well via matrix pipette. Each plate has fitted with a heat seal and incubated in a 37 °C oven for 24 h before HPLC analysis of a diverse set of wells was run to confirm conversion prior to biological assays. High-throughput Methods

[0181] High throughput methods include, but are not limited to the following, wherein: R1, R2, R3, and R4 are each independently H, (C1-C6)alkyl, (C3-C7)cycloalkyl, (C3-C7) heterocycloalkyl, (C6-C10)aryl, or (C5-C8)heteroaryl: 66       TSRI 2225.1PC     1) Sulfur(VI) Fluoride Exchange (SuFEx) 2)3)    TSRI 2225.1PC     8) Amide Couplings with Activated Esters 9) Amide Couplings with in-situ Activated Esters 10)11)12)68       TSRI 2225.1PC     13)  14) Radical Nitrone Couplings from Carboxylic Acids  15) Transition Metal Catalyzed Cross Couplings  General procedure for miniaturized syntheses of NHS-derived amides:

[0182] An Echo 650 Series Acoustic Liquid Handler (Labcyte) was used to transfer 1 µL of an amine stock (50 mM in anhydrous DMSO) from wells in a source plate to those of a reaction plate. Next, 1 µL of an NHS-ester solution (20 mM in anhydrous DMSO) is transferred by E1 ClipTip micropipetter (ThermoFisher) to each well containing amine. Finally, 8 µL of a DIPEA solution (12.5 mM in anhydrous DMSO) is added each well, and the 69       TSRI 2225.1PC     plate is sealed with an adhesive foil and placed into a 60 °C oven for 16 hours. Individual reactions can be analyzed by HPLC. Experimental Procedures

[0183] Adapted from literature conditions (i), a 250 mL round bottom flask is charged with methyl 2-bromoimidazo[1,2-a]pyridine-6-carboxylate (commercially available from Sigma Aldrich, Astatech, Combi Blocks or Chemscene, 10 grams, 39.2 mmol, 1 eq) and 4:1 methanol:water (156 mL, 250 mM relative to the limiting reagent). To this suspension is added LiOH (1.88 grams, 78.4 mmol, 2 eq). The resulting solution is stirred for 16 hours at 35 °C before being cooled to room temperature. The solution is acidified to pH 1 with 6N HCl and the resulting white precipitate is filtered and dried with the sequential washing of cold ethanol (40 mL) and diethyl ether (80 mL), affording the product (9.36 g, >95%). 1H NMR (600 MHz, DMSO) δ 9.22 (s, 1H), 8.23 (s, 1H), 7.70 (d, J = 9.4 Hz, 1H), 7.60 (d, J = 9.4 Hz, 1H), 3.96 (s, 1H); 13C NMR (150 MHz, DMSO) δ 166.1, 145.2, 130.8, 125.5, 123.1, 117.4, 115.9, 114.1; HRMS (ESI), calculated for C8H6BrN2O2: (M+H+) 240.9613, observed 240.9611. (i) C. A. Schulte et al., A knowledge-based, structural-aided discovery of a novel class of 2-phenylimidazo[1,2-a]pyridine-6-carboxamide H-PGDS inhibitors. Bioorg Med Chem Lett 47, 128113 (2021).carboxamide

[0184] To a 250 mL round bottom flask is sequentially added 2-bromoimidazo[1,2- a]pyridine-6-carboxylic acid (9.36 grams, 38.8 mmol, 1 eq), anhydrous DMF (155 mL, 250 mM relative to the limiting reagent), HATU (18.5 grams, 48.5 mmol, 1.25 eq), DIPEA (16.9 mL, 97.1 mmol, 2.5 eq) and cyclobutylamine (3.65 mL, 42.7 mmol, 1.1 eq). The flask is 70       TSRI 2225.1PC     sealed with a rubber septum, placed under an atmosphere of nitrogen and the reaction is stirred 35 °C until LCMS analysis indicates the reaction is complete after three hours. The reaction is concentrated under vacuum to dryness, reconstituted in 1:1 DCM:MeOH and adsorbed onto silica and purified by silica flash column chromatography with an increasing gradient of methanol in DCM (0 ––> 20%, product elutes around 10% MeOH) to afford the product as an off-white powder. This material was further purified by recrystallization out of methanol to afford pure product (7.53 g, 66%).1H NMR (500 MHz, DMSO) δ 9.04 (s, 1H), 8.78 (d, J = 7.4 Hz, 1H), 8.21 (s, 1H), 7.74 (d, J = 9.1 Hz, 1H), 7.59 (d, J = 9.4 Hz, 1H), 4.43 (h, J = 8.1 Hz, 1H), 2.28 – 2.19 (m, 2H), 2.13 – 2.01 (m, 2H), 1.76 – 1.62 (m, 2H);13C NMR (125 MHz, DMSO) δ 163.3, 144.8, 128.1, 124.6, 122.8, 120.9, 115.7, 113.7, 45.11, 30.5, 15.2; HRMS (ESI) calculated for C12H13BrN3O: (M+H+) 294.0242, observed 294.0242.

[0185] To a 500 mL two neck round bottom flask is added 2-bromoimidazopyridine (7.53 g, 25.6 mmol, 1 eq), 3-carboxyphenylboronic acid pinacol ester (9.53 mg, 38.4 mmol, 1.5 eq), potassium carbonate (8.84 g, 64.0 mmol, 2.5 eq), and a 5:1 solution of dioxane:water (256 mL, 100 mM relative to the starting bromide). This flask is fitted with a reflux condenser, and both the second outlet and the condenser are sealed with rubber stoppers. The resulting suspension is vigorously sparged with nitrogen gas for 30 minutes, before one rubber stopper is removed and PdCl2(dppf)•DCM (2.09 g, 2.56 mmol, 10 mol%) is added. The resulting suspension is further sparged for an additional 20 minutes before the reaction flask is heated via oil bath to 90 °C. The reaction is stirred under nitrogen for 16 hours before LCMS indicates complete consumption of starting material. The reaction is cooled to room temperature and diluted with saturated aqueous sodium bicarbonate (50 mL) and DCM (2x75 mL). The aqueous layer is filtered through a pad of celite and acidified to pH 1 with 6M HCl. 71       TSRI 2225.1PC     The resulting precipitate is isolated by vacuum filtration through a Buchner funnel to afford the product as an off white solid (4.91 g, 57%). This material is used without further purification in subsequent steps; this material can also be purified via C18 column chromatography with an increasing gradient of MeCN in H2O (10 ––> 60% with 0.1% by volume TFA, product elutes around 35%). 1H NMR (600 MHz, DMSO) δ 9.12 (s, 1H), 8.84 (d, J = 7.4 Hz, 1H), 8.69 (s, 1H), 8.57 (s, 1H), 8.22 (d, J = 1.5 Hz, 1H), 7.96 (d, J = 1.4 Hz, 1H), 7.84 (d, J = 1.8 Hz, 1H), 7.72 (d, J = 9.4 Hz, 1H), 7.63 (t, J = 7.7 Hz, 1H), 4.45 (h, J = 8.1 Hz, 1H), 2.30 – 2.21 (m, 2H), 2.15 – 2.05 (m, 2H), 1.75 – 1.65 (m, 2H); 13C NMR (150 MHz, DMSO) δ 167.6, 163.1, 158.5, 144.5, 142.9, 132.6, 132.0, 130.5, 129.8, 129.0, 127.0126.0, 121.6, 115.3, 111.6, 45.2, 30.5, 15.3; HRMS (ESI) calculated for C19H18N3O3: (M+H+) 336.1348, observed 336.1348.a]pyridine-6-carboxamide

[0186] Tert-butyl (1-(2-aminoethyl)piperidin-4-yl)carbamate was prepared according to the literature (ii). A 20 mL scintillation vial is charged sequentially with acid (352 mg, 1.05 mmol, 1 eq), DMF (4.62 mL, 250 mM relative to the starting acid), DIPEA (457 µL, 2.62 mmol, 2.5 eq), HATU (499 mg, 1.31 mmol, 1.25 eq) and tert-butyl (1-(2- aminoethyl)piperidin-4-yl)carbamate (281 mg, 1.15 mmol, 1.1 eq). The vial was sealed under an ambient atmosphere and allowed to stir at 35 °C for 3 hours before consumption of starting material was observed by UPLC-MS. The reaction was diluted with EtOAC (25 mL) and washed with brine (25 mL). The aqueous layer was further extracted with EtOAC (2 x 25 mL) and the organic layers were combined and concentrated to dryness via rotary evaporation and high vacuum. This material was used in the next step without further purification. 72       TSRI 2225.1PC     (ii) I. HIROAKI et al., E. P. Office, Ed. (DAIICHI SANKYO CO LTD (JP), Taiwan, 2009), vol. TW-200946528-A, chap. WO2009125809A1.

[0187] The intermediate Boc-protected amine was transferred to a 20 mL scintillation vial which was further charged with 1,4-dioxane (3 mL) and HCl in 1,4-dioxane (4N, 3 mL). UPLC-MS analysis at 18 hours indicated consumption of starting material. The resulting suspension is filtered with a Hirsch funnel, washed with toluene (5 mL) and manually transferred to a 50 mL round bottom flask. The suspension is dissolved in 2:1 MeOH:DCM and adsorbed onto celite. The celite is packed into a solid load cartridge and purified by C18 column chromatography with an increasing gradient of acetonitrile in water (2.5 ––> 30% with 0.1% by volume TFA). The pure fractions are combined and dried by lyophilization to afford the product as a white flocculent solid (229 mg, 47%).1H NMR (600 MHz, DMSO) δ 9.65 (s, 1H), 9.14 (s, 1H), 8.94 (t, J = 5.5 Hz, 1H), 8.84 (d, J = 7.4 Hz, 1H), 8.62 (s, 1H), 8.51 (s, 1H), 8.20 (s, 3H), 8.16 (d, J = 7.8 Hz, 1H), 7.87 (d, J = 7.7 Hz, 1H), 7.80 (d, J = 9.7 Hz, 1H), 7.69 (d, J = 9.4 Hz, 1H), 7.61 (t, J = 7.7 Hz, 1H), 4.45 (h, J = 8.2 Hz, 1H), 3.70 – 3.66 (m, 2H), 3.29 (t, J = 6.6 Hz, 3H), 3.11 (t, J = 13.0 Hz, 2H), 2.30 – 2.21 (m, 2H), 2.17 – 2.05 (m, 4H), 1.84 – 1.66 (m, 4H);13C NMR (150 MHz, DMSO) δ 167.2, 163.3, 145.0, 144.2, 134.9, 133.3, 129.5, 129.3, 129.0, 127.6, 125.4, 125.1, 121.1, 115.7, 111.3, 55.7, 50.7, 45.5, 45.1, 34.8, 30.5, 27.7, 15.2; HRMS (ESI) calculated for C26H33N6O2: (M+H+) 461.2660, observed 461.2654.4-yl)sulfurimidoyl difluoride

[0188] A 25 mL round-bottom flask equipped with a magnetic stir bar was charged with the amine (126.1 mg, 0.254 mmol). The compound was dissolved in dry DMF (3 mL), and DIPEA was added (133 uL, 0.761 mmol, 3.0 eq). Topped with a rubber septum, the flask was evacuated (solvent gently bubbling) and backfilled with thionyl tetrafluoride. The mixture was 73       TSRI 2225.1PC     stirred vigorously at room temperature for 1 h until complete conversion of the starting material was verified by LC-MS analysis. The solution was then purified by reverse-phase preparative high-performance liquid chromatography (HPLC) using a water / MeCN elution containing a 0.1% formic acid. Product was isolated after lyophilization (81.6 mg, 59% yield).1H NMR (600 MHz, DMSO) δ 9.09 (s, 1H), 8.77 (d, J = 7.5 Hz, 1H), 8.58 – 8.53 (m, 2H), 8.44 (t, J = 1.9 Hz, 1H), 8.25 (s, 1H), 8.12 (d, J = 7.8 Hz, 1H), 7.79 (d, J = 7.7 Hz, 1H), 7.70 (d, J = 9.7 Hz, 1H), 7.64 (d, J = 9.5 Hz, 1H), 7.55 (t, J = 7.7 Hz, 1H), 6.63 (s, 1H), 4.45 (h, J = 8.1 Hz, 1H), 3.75 (s, 1H), 3.44 – 3.38 (m, 2H), 2.80 (s, 2H), 2.30 – 2.16 (m, 4H), 2.14 – 2.05 (m, 2H), 1.89 (q, J = 4.7 Hz, 2H), 1.74 – 1.66 (m, 2H), 1.62 (dtd, J = 13.2, 9.9, 3.6 Hz, 2H);13C NMR (150 MHz, DMSO) δ 166.5, 163.5, 145.5, 145.5, 135.7, 134.1, 129.3, 128.7, 128.7, 127.2, 125.0, 124.3, 120.5, 116.2, 111.0, 57.3, 55.0, 51.2, 45.1, 37.6, 33.5, 30.6, 15.2;19F NMR (375 MHz, DMSO) δ 52.49, -74.19 (TFA); HRMS (ESI) calculated for C26H31F2N6O3S: (M+H+) 545.2141, observed 545.21401-yl)ethyl)carbamoyl)phenyl)imidazo[1,2-a]pyridine-6-carboxamide

[0189] A 1-dram vial equipped with a magnetic stir bar is charged with (1-(2-(3-(6- (cyclobutylcarbamoyl)imidazo[1,2-a]pyridin-2-yl)benzamido)ethyl)piperidin-4- yl)sulfurimidoyl difluoride (9.8 mg, 0.018 mmol, 1 eq), MeCN (0.5 mL, 40 mM relative to the limiting reagent), triethylamine (6.8 µL, 0.049 mmol, 2.7 eq) and 2,7-diazaspiro[4.4]nonane- 1,3-dione (7) (4.2 mg, 0.027 mmol, 1.5 eq). The vial is sealed under ambient atmosphere and allowed to stir for 4 h. The reaction solution was loaded directly onto a C18 column for column chromatography and purified with an increasing gradient of MeCN in water (10 ––> 60% with 0.1% by volume TFA). The pure fractions are combined and dried by lyophilization to afford the product as a white flocculent solid (1.6 mg, 13%).1H NMR (600 MHz, DMSO) δ 11.31 (s, 1H), 9.09 (t, J = 1.4 Hz, 1H), 8.79 (d, J = 7.5 Hz, 1H), 8.57 (s, 2H), 8.45 (t, J = 1.8 Hz, 1H), 8.12 (d, J = 7.7 Hz, 1H), 7.79 (d, J = 7.6 Hz, 1H), 7.71 (d, J = 9.4 Hz, 1H), 7.65 (d, J = 9.4 Hz, 1H), 7.55 (t, J = 7.7 Hz, 1H), 7.27 (d, J = 7.7 Hz, 74       TSRI 2225.1PC     1H), 4.45 (h, J = 8.2 Hz, 1H), 3.39 (d, J = 15.5 Hz, 3H), 3.36 – 3.33 (m, 2H), 3.22 (td, J = 9.3, 6.9 Hz, 1H), 3.05 (s, 1H), 2.88 (d, J = 10.7 Hz, 2H), 2.77 – 2.66 (m, 2H), 2.48 (s, 2H), 2.25 (tdt, J = 9.8, 4.8, 2.5 Hz, 2H), 2.18 – 1.99 (m, 6H), 1.86 – 1.80 (m, 2H), 1.74 – 1.65 (m, 2H), 1.46 (q, J = 12.0 Hz, 2H);13C (150 MHz, DMSO) δ 181.5, 177.4, 166.5, 163.5, 145.5, 135.7, 134.1, 129.3, 128.7, 128.7, 127.2, 125.0, 124.3, 120.5, 116.2, 111.0, 57.4, 56.7, 52.6, 51.4, 50.6, 47.6, 45.1, 42.4, 37.6, 36.5, 33.2, 30.6, 15.2; HRMS (ESI) calculated for C33H41N8O6S: (M+H+) 677.2864, observed 677.2862; [α]D25= -9.300 (c 1.00, MeOH): inactive enantiomer, (R); [α]D25= +8.600 (c 1.00, MeOH): active enantiomer, (S).4-carboxylic acid

[0190] a A 20 mL scintillation vial is charged sequentially with 3-(6- (cyclobutylcarbamoyl)imidazo[1,2-a]pyridin-2-yl)benzoic acid (100 mg, 0.298 mmol, 1 eq), DMF (3 mL, 100 mM relative to the starting acid), DIPEA (130 µL, 0.745 mmol, 2.5 eq), HATU (140 mg, 0.373 mmol, 1.25 eq) and methyl 1-(2-aminoethyl)piperidine-4-carboxylate (61mg, 0.328 mmol, 1.1 eq). The vial is sealed under an ambient atmosphere and allowed to stir at 35 °C for 3 hours before consumption of starting material was observed by UPLC-MS. The reaction is diluted with EtOAc (20 mL) and washed with saturated aqueous sodium chloride (2 x 20 mL), dried with sodium sulfate and concentrated to dryness. This material is used in the next step without further purification.

[0191] A 20 mL scintillation vial equipped with a magnetic stir bar was charged with the crude methyl ester intermediate from above, methanol : water (4:1, 2.4 mL methanol, 600 µL H2O 100 mM relative to the methyl ester) and lithium hydroxide (28.5 mg, 1.19 mmol, 2 eq). The vial was sealed under an ambient atmosphere and allowed to stir for 2 hours before 75       TSRI 2225.1PC     consumption of starting material was observed by UPLC-MS. The material is acidified to pH 2 with the addition of minimal aqueous 1 M HCl, solubilized with the addition of 500 mL of DMF and loaded directly onto a prep-HPLC for purification with an increasing gradient of (2.5 ––> 60% with 0.1% by volume TFA). The pure fractions are combined and dried by lyophilization to afford the product as a white flocculent solid (99 mg, 68%).1H NMR (600 MHz, DMSO) δ 9.12 (s, 1H), 9.07 (s, 1H), 8.88 (t, J = 5.7 Hz, 1H), 8.80 (d, J = 7.5 Hz, 1H), 8.59 (s, 1H), 8.51 (s, 1H), 8.16 (d, J = 7.8 Hz, 1H), 7.85 (d, J = 7.8 Hz, 1H), 7.76 (d, J = 9.4 Hz, 1H), 7.67 (d, J = 9.2 Hz, 1H), 7.61 (t, J = 7.7 Hz, 1H), 4.45 (h, J = 8.2 Hz, 1H), 3.67 (d, J = 5.6 Hz, 2H), 3.32 – 3.26 (m, 3H), 3.15 – 2.91 (m, 4H), 2.29 – 2.22 (m, 2H), 2.14 – 2.05 (m, 4H), 1.99 – 1.89 (m, 1H), 1.79 – 1.66 (m, 4H);13C NMR (150 MHz, DMSO) δ 175.1, 167.2, 163.3, 145.0, 144.3, 135.0, 133.4, 129.5, 129.2, 129.0, 127.6, 125.1, 121.0, 117.8, 115.7, 111.2, 55.8, 51.8, 45.1, 38.3, 34.8, 30.5, 25.88, 15.2; HRMS (ESI) calculated for C27H32N5O4: (M+H+) 490.2454, observed 490.2451.(cyclobutylcarbamoyl)imidazo[1,2-a]pyridin-2-yl)benzoic acid (100 mg, 0.298 mmol, 1 eq), DMF (3 mL, 100 mM relative to the starting acid), DIPEA (130 µL, 0.745 mmol, 2.5 eq), HATU (140 mg, 0.373 mmol, 1.25 eq) and methyl 1-(2-aminoethyl)piperidine-4-carboxylate (61mg, 0.328 mmol, 1.1 eq). The vial is sealed under an ambient atmosphere and allowed to stir at 35 °C for 3 hours before consumption of starting material was observed by UPLC-MS. The reaction is diluted with EtOAc (20 mL) and washed with saturated aqueous sodium chloride (2 x 20 mL), dried with sodium sulfate and concentrated to dryness. This material is used in the next step without further purification.

[0193] A 20 mL scintillation vial equipped with a magnetic stir bar was charged with the crude methyl ester intermediate from above, methanol : water (4:1, 2.4 mL methanol, 600 µL H2O 100 mM relative to the methyl ester) and lithium hydroxide (28.5 mg, 1.19 mmol, 2 eq). The vial was sealed under an ambient atmosphere and allowed to stir for 2 hours before consumption of starting material was observed by UPLC-MS. The material is acidified to pH 76       TSRI 2225.1PC     2 with the addition of minimal aqueous 1 M HCl, solubilized with the addition of 500 mL of DMF and loaded directly onto a prep-HPLC for purification with an increasing gradient of (2.5 ––> 60% with 0.1% by volume TFA). The pure fractions are combined and dried by lyophilization to afford the product as a white flocculent solid (99 mg, 68%).1H NMR (600 MHz, DMSO) δ 9.12 (s, 1H), 9.07 (s, 1H), 8.88 (t, J = 5.7 Hz, 1H), 8.80 (d, J = 7.5 Hz, 1H), 8.59 (s, 1H), 8.51 (s, 1H), 8.16 (d, J = 7.8 Hz, 1H), 7.85 (d, J = 7.8 Hz, 1H), 7.76 (d, J = 9.4 Hz, 1H), 7.67 (d, J = 9.2 Hz, 1H), 7.61 (t, J = 7.7 Hz, 1H), 4.45 (h, J = 8.2 Hz, 1H), 3.67 (d, J = 5.6 Hz, 2H), 3.32 – 3.26 (m, 3H), 3.15 – 2.91 (m, 4H), 2.29 – 2.22 (m, 2H), 2.14 – 2.05 (m, 4H), 1.99 – 1.89 (m, 1H), 1.79 – 1.66 (m, 4H);13C NMR (150 MHz, DMSO) δ 175.1, 167.2, 163.3, 145.0, 144.3, 135.0, 133.4, 129.5, 129.2, 129.0, 127.6, 125.1, 121.0, 117.8, 115.7, 111.2, 55.8, 51.8, 45.1, 38.3, 34.8, 30.5, 25.88, 15.2; HRMS (ESI) calculated for C27H32N5O4: (M+H+) 490.2454, observed 490.2451.4-carboxylic acid

[0194] A 20 mL scintillation vial is charged sequentially with 3-(6- (cyclobutylcarbamoyl)imidazo[1,2-a]pyridin-2-yl)benzoic acid (100 mg, 0.298 mmol, 1 eq), DMF (3 mL, 100 mM relative to the starting acid), DIPEA (130 µL, 0.745 mmol, 2.5 eq), HATU (140 mg, 0.373 mmol, 1.25 eq) and methyl 1-(2-aminoethyl)piperidine-4-carboxylate (61mg, 0.328 mmol, 1.1 eq). The vial is sealed under an ambient atmosphere and allowed to stir at 35 °C for 3 hours before consumption of starting material was observed by UPLC-MS. The reaction is diluted with EtOAc (20 mL) and washed with saturated aqueous sodium chloride (2 x 20 mL), dried with sodium sulfate and concentrated to dryness. This material is used in the next step without further purification.

[0195] A 20 mL scintillation vial equipped with a magnetic stir bar was charged with the crude methyl ester intermediate from above, methanol : water (4:1, 2.4 mL methanol, 600 µL H2O 100 mM relative to the methyl ester) and lithium hydroxide (28.5 mg, 1.19 mmol, 2 eq). The vial was sealed under an ambient atmosphere and allowed to stir for 2 hours before 77       TSRI 2225.1PC     consumption of starting material was observed by UPLC-MS. The material is acidified to pH 2 with the addition of minimal aqueous 1 M HCl, solubilized with the addition of 500 mL of DMF and loaded directly onto a prep-HPLC for purification with an increasing gradient of (2.5 ––> 60% with 0.1% by volume TFA). The pure fractions are combined and dried by lyophilization to afford the product as a white flocculent solid (99 mg, 68%).1H NMR (600 MHz, DMSO, 25 °C) δ 9.12 (s, 1H), 9.07 (s, 1H), 8.88 (t, J = 5.7 Hz, 1H), 8.80 (d, J = 7.5 Hz, 1H), 8.59 (s, 1H), 8.51 (s, 1H), 8.16 (d, J = 7.8 Hz, 1H), 7.85 (d, J = 7.8 Hz, 1H), 7.76 (d, J = 9.4 Hz, 1H), 7.67 (d, J = 9.2 Hz, 1H), 7.61 (t, J = 7.7 Hz, 1H), 4.45 (h, J = 8.2 Hz, 1H), 3.67 (d, J = 5.6 Hz, 2H), 3.32 – 3.26 (m, 3H), 3.15 – 2.91 (m, 4H), 2.29 – 2.22 (m, 2H), 2.14 – 2.05 (m, 4H), 1.99 – 1.89 (m, 1H), 1.79 – 1.66 (m, 4H);13C {1H} NMR (150 MHz, DMSO, 25 °C) δ 175.10, 167.21, 163.31, 145.04, 144.33, 134.98, 133.41, 129.47, 129.24, 128.96, 127.59, 125.10, 121.02, 117.82, 115.73, 111.23, 55.83, 51.80, 45.12, 38.28, 34.75, 30.54, 25.88, 15.24. HRMS (ESI), calculated for C27H31N5O4: (M+H+) 490.2454, observed 490.2451 (∆ppm - 0.611938).yl)ethyl)carbamoyl)phenyl)imidazo[1,2-a]pyridine-6-carboxamide

[0196] To a scintillation vial equipped with a magnetic stir bar was added 1-(2-(3-(6- (cyclobutylcarbamoyl)imidazo[1,2-a]pyridin-2-yl)benzamido)ethyl)piperidine-4-carboxylic acid (4.7 mg, 9.6 mmol, 1 eq), DMF (272 µL, 35 mM relative to the carboxylic acid), HATU (9.1 mg, 0.024 mmol, 2.50 eq) and DIPEA (2.1 µL, 0.0119 mmol, 1.25 eq). The vial was sealed under an ambient atmosphere and allowed to stir at 35 °C until consumption of the starting material was observed by UPLC-MS at 16 hours. The reaction was loaded directly onto a C18 column for column chromatography with an increasing gradient of acetonitrile in water (10 ––> 60% with 0.1% by volume TFA). The pure fractions are combined and dried by lyophilization to afford the product as a white flocculent solid (2.3 mg, 38%). 78       TSRI 2225.1PC     1H NMR (600 MHz, DMSO) δ 11.26 (s, 0.45H), 11.18 (s, 0.47H), 9.31 – 9.01 (m, 2H), 8.78 (s, 1H), 8.68 (d, J = 7.4 Hz, 1H), 8.55 (s, 1H), 8.50 (s, 1H), 8.15 (d, J = 7.7 Hz, 1H), 7.85 (d, J = 7.7 Hz, 1H), 7.73 (d, J = 9.5 Hz, 1H), 7.63 (d, J = 9.4 Hz, 1H), 7.59 (t, J = 7.7 Hz, 1H), 4.44 (h, J = 8.2 Hz, 1H), 3.83 – 3.76 (m, 1H), 3.74 – 3.65 (m, 4H), 3.63 – 3.53 (m, 2H), 3.08 – 3.05 (m, 4H), 2.79 – 2.64 (m, 3H), 2.31 – 2.21 (m, 3H), 2.11 (ddt, J = 18.1, 11.7, 9.0 Hz, 3H), 2.05 – 1.78 (m, 5H), 1.78 – 1.66 (m, 2H). 13C NMR (150 MHz, DMSO, 320K) δ 181.8, 181.1, 177.1, 171.5, 167.4, 163.5, 145.4, 145.1, 135.0, 134.1, 129.4, 128.8, 127.4, 125.1, 124.6, 120.9, 116.0, 111.0, 56.2, 54.7, 54.4, 52.1, 50.8, 48.9, 45.6, 45.3, 41.5, 37.4, 37.1, 36.3, 34.8, 34.3, 30.5, 25.9, 15.3; HRMS (ESI) calculated for C34H40N7O5: (M+H+) 626.3091, observed 626.3091.yl)benzamido)ethyl)piperidin-4-yl)-6,8-dioxo-2,7-diazaspiro[4.4]nonane-2-carboxamide

[0197] To To a 1-dram vial equipped with a magnetic stir bar was added 1-(2-(3-(6- (cyclobutylcarbamoyl)imidazo[1,2-a]pyridin-2-yl)benzamido)ethyl)piperidine-4-carboxylic acid (17.5 mg, 0.035 mmol, 1 eq), DMF (350 µL, 100 mM relative to the carboxylic acid), diphenylphosphoryl azide (12µL, 0.054 mmol, 1.5 eq) and triethylamine (12.5 µL, 0.089 mmol, 2.5 eq). The vial is sealed and allowed to stir at 65 °C for 20 minutes before UPLC analysis indicates complete conversion to the intermediate isocyanate at which point 2,7- diazaspiro[4.4]nonane-1,3-dione (4, 14 mg, 0.089 mmol, 2.5 eq) is added to the vial which is stirred at room temperature for 30 minutes. After UPLC analysis confirms the complete formation of starting material, the crude product is loaded directly onto a prep HPLC for purification with an increasing gradient of acetonitrile in water (10 ––> 60% with 0.1% by volume TFA). The pure fractions are combined and dried by lyophilization to afford the product as a white flocculent solid (6.1 mg, 27%). 1H NMR (600 MHz, DMSO) δ 11.28 (s, 1H), 9.14 (d, J = 21.5 Hz, 2H), 8.92 (t, J = 5.7 Hz, 1H), 8.81 (d, J = 7.5 Hz, 1H), 8.60 (s, 1H), 8.50 (d, J = 2.2 Hz, 1H), 8.15 (d, J = 7.7 Hz, 1H), 79       TSRI 2225.1PC     7.85 (d, J = 7.7 Hz, 1H), 7.77 (d, J = 1.8 Hz, 1H), 7.67 (d, J = 9.4 Hz, 1H), 7.60 (t, J = 7.7 Hz, 1H), 6.19 (d, J = 7.4 Hz, 1H), 4.45 (h, J = 8.2 Hz, 1H), 3.54 – 3.44 (m, 4H), 3.37 (d, J = 10.5 Hz, 2H), 3.31 – 3.23 (m, 4H), 3.09 (q, J = 11.6 Hz, 2H), 2.68 (d, J = 3.0 Hz, 2H), 2.28 – 2.20 (m, 2H), 2.16 – 2.04 (m, 3H), 2.02 – 1.93 (m, 3H), 1.92 – 1.83 (m, 1H), 1.75 – 1.63 (m, 4H);13C NMR (150 MHz, DMSO) δ 181.9, 177.4, 167.3, 163.4, 156.2, 145.2, 135.0, 133.6, 129.5, 129.2, 128.9, 127.5, 125.1, 120.9, 117.9, 116.0, 115.8, 111.2, 55.8, 54.7, 52.0, 50.0, 45.7, 45.3, 45.1, 41.8, 35.8, 34.9, 30.5, 30.0, 15.2; HRMS (ESI) calculated for C34H41N8O5: (M+H+) 641.3200, observed 641.3181.

[0198] A A 20 mL scintillation vial is sequentially charged with 2,7- diazaspiro[4.4]nonane-1,3-dione hydrochloride, MeCN (6.5 mL, 100 mM relative to the starting material), benzyl bromide (81 µL, 0.681 mmol, 1.05 eq) and DIPEA (136 µL, 0.778 mmol, 1.2 eq). The vial is capped and placed on a heating block set to 35 °C. UPLC analysis at 16 hours indicates consumption of starting material, significant amounts of the single alkylation product, as well as noticeable amounts of the double and triple alkylation product. The reaction suspension is concentrated to dryness, reconstituted in a minimal amount of dichloromethane and loaded directly onto a silica column for purification by normal phase column chromatography with an increasing gradient of ethyl acetate to methanol in DCM. Product elutes in a broad peak at near 100% EtOAc in DCM.1H NMR (400 MHz, CDCl3) δ 7.35 – 7.18 (m, 5H), 3.72 (d, J = 12.9 Hz, 1H), 3.61 (d, J = 12.9 Hz, 1H), 3.00 (ddd, J = 9.2, 7.7, 4.2 Hz, 1H), 2.87 – 2.67 (m, 4H), 2.60 (td, J = 8.8, 7.4 Hz, 1H), 2.42 (ddd, J = 12.8, 8.5, 4.2 Hz, 1H), 1.88 (dt, J = 12.8, 7.6 Hz, 1H);13C NMR (150 MHz, CDCl3) δ 182.8, 177.0, 138.1, 128.8, 128.4, 127.3, 59.5, 53.7, 50.5, 45.9, 37.1; HRMS (ESI) calculated for C14H17N2O2: (M+H+) 245.1290, observed 245.1288; [α]D25= +13.696 (c 0.5, DCM): peak 1, assigned R [α]D25= – 13.600 (c 1.00, DCM): peak 2, assigned S. 80       TSRI 2225.1PC    eq), DMF (0.5 mL, 300 mM relative to the starting acid), DIPEA (65 µL, 0.37 mmol, 2.5 eq), HATU (71 mg, 0.19 mmol, 1.25 eq) and (4,6-dimethylpyridin-3-yl)methanamine (22 mg, 0.16 mmol, 1.1 eq). The vial was sealed under an ambient atmosphere and allowed to stir at 35 °C for 16 hours before consumption of starting material was observed by UPLC-MS. The reaction was drawn into syringe and loaded directly onto a C18 column for purification with an increasing gradient of acetonitrile in water (2.5 ––> 60% with 0.1% by volume TFA). The pure fractions are combined and dried by lyophilization to afford the product JS8-115 as a white flocculent solid (59.5 mg, 88%).(cyclobutylcarbamoyl)imidazo[1,2-a]pyridin-2-yl)benzoic acid (500 mg, 1.49 mmol, 1 eq), DMF (3.0 mL, 500 mM relative to the starting acid), DIPEA (650 µL, 3.73 mmol, 2.5 eq), HATU (706 mg, 1.86 mmol, 1.25 eq) and 2-(piperidin-1-yl)ethan-1-amine (230 µL, 1.64 mmol, 1.1 eq). The vial was sealed under an ambient atmosphere and allowed to stir at 35 °C for 5 hours before consumption of starting material was observed by UPLC-MS. The reaction was diluted with IPA:CHCl3 (1:1, 50 mL) and washed with saturated aqueous potassium carbonate (50 mL). The organic layer was dried with sodium sulfate, adsorbed onto Celite and loaded into a solid load cartridge for purification by C18 column chromatography with an increasing gradient of acetonitrile in water (10 ––> 80% with 0.1% TFA by volume). The pure fractions are combined and dried by lyophilization to afford the product TM-7 as a pink flocculent solid. The resulting solid is further washed with warm ethyl acetate to yield pure product as a white solid (350 mg, 52%). 81       TSRI 2225.1PC    (6- (cyclobutylcarbamoyl)imidazo[1,2-a]pyridin-2-yl)benzoic acid (100 mg, 0.298 mmol, 1 eq), DMF (anhydrous, stored over sieves and in a desiccator, 1.19 mL, 250 mM relative to the starting acid), DIPEA (130 µL, 0.745 mmol, 2.5 eq), EDC•HCl (71.5 mg, 0.373 mmol, 1.25 eq), 4-dimethylaminopyridine (3.6 mg, 0.0298 mmol, 10 mol%) and N-hydroxysuccinimide (37.7 mg, 0.328 mmol, 1.1 eq). The vial is stirred under an atmosphere of anhydrous nitrogen gas at 45 °C for six hour before consumption of starting material is observed by UPLC-MS. The material is purified via an abbreviated aqueous workup in the reaction container; to the vial is added ethyl acetate (5 mL) and saturated aqueous sodium bicarbonate (5 mL). The vial is capped and quickly shaken and after the layers resolved, the aqueous layer is removed by syringe. The organic layer is quickly filtered through sodium sulfate and concentrated to dryness on a rotary evaporator. The crude material is reconstituted in minimal anhydrous DMSO and loaded directly onto a C18 column for C18 column chromatography with an increasing gradient of acetonitrile in water (10 ––> 60% with 0.1% TFA by volume). The pure fractions are combined and dried by lyophilization to afford the product as a white flocculent solid (53 mg, 41%) which is stored under high vacuum until use.(piperidin-1-yl)ethyl)carbamoyl)phenyl)imidazo[1,2-a]pyridine-6-carboxylic acid (148 mg, 0.377 mmol, 1 eq), DMF (anhydrous, stored over sieves and in a desiccator, 1.5 mL, 250 mM relative to the starting acid), DIPEA (164 µL, 0.943 mmol, 2.5 eq), EDC•HCl (90.3 mg, 0.471 mmol, 1.25 eq), 4-dimethylaminopyridine (4.6 mg, 0.0377 mmol, 10 mol%) and N- hydroxysuccinimide (47.8 mg, 0.415 mmol, 1.1 eq). The vial is stirred under an atmosphere of anhydrous nitrogen gas at 45 °C for six hour before consumption of starting material is 82       TSRI 2225.1PC     observed by UPLC-MS. The material is purified via an abbreviated aqueous workup in the reaction container; to the vial is added ethyl acetate (5 mL) and saturated aqueous sodium bicarbonate (5 mL). The vial is capped and quickly shaken and after the layers resolved, the aqueous layer is removed by syringe. The organic layer is quickly filtered through sodium sulfate and concentrated to dryness on a rotary evaporator. The crude material is reconstituted in minimal anhydrous DMSO and loaded directly onto a C18 column for C18 column chromatography with an increasing gradient of acetonitrile in water (10 ––> 60% with 0.1% TFA by volume). The pure fractions are combined and dried by lyophilization to afford the product as a white flocculent solid (113 mg, 61%) which is stored under high vacuum until use. Stereochemical assignment of the active dHTC1 enantiomer

[0203] The stereochemical configuration of the active enantiomer of dHTC1 was assigned by VCD-IR spectroscopy and DFT calculations as schematically described in Figure 17. Briefly, racemic dHTC1 was separated via chiral-stationary-phase chromatography, and VCD- IR spectra were acquired on the two main chromatographic fractions (1: (S)-dHTC1, 2:(R)- dHTC1) and compared to DFT-calculated spectra. For increased confidence in the stereochemical assignment, an early synthetic intermediate (Bn-7) was subjected to the same analysis, and the resulting optically enriched materials were used to independently synthesize each enantiomer of dHTC1. In both cases, the comparison of measured and calculated VCD- IR spectra supports the conclusion that the active enantiomer of dHTC1 is of (S)- stereochemical configuration. Methods

[0204] dHTC1 and Bn-7 were separated into enantiopure samples using a Waters Prep SFC 150 AP. For dHTC1, the two enantiomers are separated using a Daicel IK-3 column, 4.6 mm I.D x 100 mL, particle size is 3 µm, under isocratic condition (3.3 mL / min, CO2 / 50% MeOH containing 0.5 vol% 7M methanolic NH3). The injection volume is 5 µL.

[0205] For Bn-7, the isomers were separated on a Waters Prep SFC 150 AP using a Daicel IG column (5 µm, 19 x 250 mm). The purification was run under isocratic conditions (50% MeOH containing 0.5 vol% (v / v) 7M methanolic NH3 / CO2, 100 mL / min, 1600 psi back pressure) at 40 °C. Fractionation was triggered by mass spec (ESI+ on a Waters QDa, SIR channel m / z = 245.0). 83       TSRI 2225.1PC

[0206] The enantiomeric excess for dHTC1 products synthesized from stereochemically assigned Bn-7 was determined by heart-cutting 2D LC-SFC (4). The LC dimension consisted of a Waters I-Class LC with a Waters BEH C18 column (1.7 µm, 2.1x105 mm) using a 0.1% aqueous NH4OH:acetonitrile gradient (0.6 mL / min, 15-99% acetonitrile over 2.1 minutes) at 55 °C. The heart cut was performed at 0.97 minutes using a 6-port 2-position valve equipped with a 10 µL transfer loop. The SFC dimension consisted of a Waters UPC2 SFC with a Daicel IH column (3 µm, 4.6x250 mm) using isocratic conditions (3.3 mL / min, 35% MeOH containing 0.5% (v / v) 7M methanolic NH3 / CO2, 1600 psi backpressure) at 30 °C. The enantiomers were detected by UV light (256 nm). (iii) C. J. Venkatramani et al., Simultaneous achiral-chiral analysis of pharmaceutical compounds using two-dimensional reversed phase liquid chromatography- supercritical fluid chromatography. Talanta 148, 548-555 (2016).

[0207] VCD-IR spectra were acquired were obtained in the following manner. The CDCl3 solvent (Cambridge Isotope Labs with Silver Foil) was run through a small plug of activated basic alumina immediately before use. To a small vial containing 7.5 mg of Bn-7 (Enant.1 or Enant.2) was added 200 µL of CDCl3. The resulting solution was transferred to a liquid IR cell (BaF2, 100 µm cell path) and placed in the measurement chamber. The instrumentation was a BioTools, Inc. (Jupiter, FL) ChiralIR 2X Dual PEM FT-VCD spectrometer, set to 4 cm-1resolution, with PEM (both 1 and 2) maximum frequency set to 1400 cm-1. The sample was then measured for 8 hours in one hour blocks. The IR data from the first block was solvent and water vapor subtracted, then offset to zero at 2000 cm-1. The VCD data blocks were averaged and subtracted to produce a half difference spectrum ((E1 – E2) / 2). Finally, the VCD spectrum was offset to zero at 2000 cm-1. The VCD noise data was block averaged and used without further processing.

[0208] The above procedure was reproduced for dHTC1 samples using DMSO-d6(Cambridge Isotope Labs) without further purification.

[0209] Theoretical VCD-IR spectra were predicted and aligned to experimental spectra using Jaguar Spectroscopy (Schrödinger Maestro version 13.9.138, MMshare version 6.5.138, Release 2024-1, Platforms Linux-x64_64 and Darwin-x86_64). For spectral prediction, a conformational search was first performed using the OPLS4 force field, with mixed torsional / low-mode sampling (200 steps, MM energy window 5.0 kcal / mol). A maximum of 24 conformers were retained exhibiting up to 0.50 Å atomic deviation within a 5.0 kcal / mol 84       TSRI 2225.1PC     QM energy window. DFT calculations were subsequently performed at the B3LYP-D3 level of theory using the LACVP** basis set (solvent: chloroform [(S)-Bn-7] or DMSO [(S)- dHTC1]). The predicted spectra shown are Boltzmann-weighted averages of the lowest-energy conformers. The alignment of measured and averaged predicted VCD-IR spectra was performed (Needleman-Wunsch algorithm) in the 950 cm-1– 2000 cm-1wavenumber region. References 1. T. R. Carter et al., SuFEx-based chemical diversification for the systematic discovery of CRBN molecular glues. Bioorg Med Chem 104, 117699 (2024). 2. J. N. Asiaban et al., Cell-Based Ligand Discovery for the ENL YEATS Domain. ACS Chem Biol 15, 895-903 (2020). 3. M. R. Lazear et al., Proteomic discovery of chemical probes that perturb protein complexes in human cells. Mol Cell 83, 1725-1742.e1712 (2023). 4. E. V. Vinogradova et al., An Activity-Guided Map of Electrophile-Cysteine Interactions in Primary Human T Cells. Cell 182, 1009-1026.e1029 (2020). 5. L. Ting, R. Rad, S. P. Gygi, W. Haas, MS3 eliminates ratio distortion in isobaric multiplexed quantitative proteomics. Nat Methods 8, 937-940 (2011). 6. C. Kagiou et al., Alkylamine-tethered molecules recruit FBXO22 for targeted protein degradation. Nat Commun 15, 5409 (2024). 7. A. Hanzl et al., Functional E3 ligase hotspots and resistance mechanisms to small- molecule degraders. Nat Chem Biol 19, 323-333 (2023). 8. O. Hsia et al., Targeted protein degradation via intramolecular bivalent glues. Nature 627, 204-211 (2024). 9. M. de Almeida et al., AKIRIN2 controls the nuclear import of proteasomes in vertebrates. Nature 599, 491-496 (2021). 10. W. Li et al., MAGeCK enables robust identification of essential genes from genome-scale CRISPR / Cas9 knockout screens. Genome Biol 15, 554 (2014). 11. G. Winter et al., DIALS: implementation and evaluation of a new integration package. Acta Crystallogr D Struct Biol 74, 85-97 (2018). 12. A. J. McCoy et al., Phaser crystallographic software. J Appl Crystallogr 40, 658- 674 (2007). 85       TSRI 2225.1PC     13. P. V. Afonine et al., Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallogr D Biol Crystallogr 68, 352-367 (2012). 14. P. Emsley, B. Lohkamp, W. G. Scott, K. Cowtan, Features and development of Coot. Acta Crystallogr D Biol Crystallogr 66, 486-501 (2010). 15. C. A. Schulte et al., A knowledge-based, structural-aided discovery of a novel class of 2-phenylimidazo[1,2-a]pyridine-6-carboxamide H-PGDS inhibitors. Bioorg Med Chem Lett 47, 128113 (2021). 16. I. HIROAKI et al., E. P. Office, Ed. (DAIICHI SANKYO CO LTD (JP), Taiwan, 2009), vol. TW-200946528-A, chap. WO2009125809A1. 17. C. J. Venkatramani et al., Simultaneous achiral-chiral analysis of pharmaceutical compounds using two-dimensional reversed phase liquid chromatography-supercritical fluid chromatography. Talanta 148, 548-555 (2016).

[0210] The foregoing disclosure has been described in some detail by way of illustration and example, for purposes of clarity and understanding. It will be obvious to one of skill in the art that changes and modifications may be practiced within the scope of the appended claims. Therefore, it is to be understood that the above description is intended to be illustrative and not restrictive. The scope of the disclosure should, therefore, be determined not with reference to the above description, but should instead be determined with reference to the following appended claims, along with the full scope of equivalents to which such claims are entitled.

[0211] This application refers to various issued patents, published patent applications, journal articles, and other publications, each of which are incorporated herein by reference. 86

Claims

TSRI 2225.1PC     WHAT IS CLAIMED IS:

1. A method of identifying a degrader of a target protein comprising 1) selecting a known ligand of a target protein; 2) using high throughput parallel synthesis to generate a multitude of analogues of the ligand; 3) identifying analogues with high-affinity for the target protein from the multitude of analogues formed in step 2); and 4) using cell-based HiBiT or other high throughput assays to identify high-affinity analogues formed in step 3) that degrade the target protein, or to identify hits that can induce proximity between the protein-of-interest to a second protein target.

2. The method of Claim 1, further comprising conducting subsequent cell-based HiBiT assays to determine whether the mechanism of degradation of the target protein by the high- affinity analogues occurs through 1) proximity-driven pharmacology via monovalent interfacial binding as a molecular glue to a second protein; 2) PROTAC-like bivalent binding to both the target protein and an E3 substrate adapter; 3) autophagy pathways; 4) the high- affinity analogues functioning as hydrophobic tags; or 5) another pathway leading to degradation of the protein-of-interest.

3. The method of Claim 1 or Claim 2, wherein the mechanism of degradation of the target protein occurs through proximity-driven pharmacology via monovalent interfacial binding as a molecular glue to a second protein.

4. The method of Claim 1 or Claim 2, wherein the mechanism of degradation of the target protein occurs through PROTAC-like bivalent binding to both the target protein and an E3 substrate adapter.

5. The method of Claim 1 or Claim 2, wherein the mechanism of degradation of the target protein occurs through autophagy pathways.

6. The method of Claim 1 or Claim 2, wherein the mechanism of degradation of the target protein occurs through the high-affinity analogues functioning as hydrophobic tags.

7. The method of any one of Claims 1-6, wherein the high throughput parallel synthesis comprises 1) the addition of a carboxylic acid derivative to a known ligand of a target protein; 2) esterification of said carboxylic acid, converting it to the corresponding NHS-ester; 3) subjecting the NHS-ester derivatives to high throughput addition of a multitude of aliphatic amines to form via amide-linked amine-functionalized analogues of the known ligand of the target protein. 87       TSRI 2225.1PC     8. The method of Claim 7, according to the following reaction scheme:  R1is (C1-C6)alkyl, (C1-C6)heteroalkyl, (C1-C6)alkyl (C3-C7)cycloalkyl, (C1-C6)alkyl (C3- C7)heterocycloalkyl, (C1-C6)alkyl (C6-C10)aryl, or (C1-C6)alkyl (C5-C6)heteroaryl, optionally substituted with one or more R2; and R2is oxo, OH, NH2, halo, (C1-C6) alkyl, (C1-C6) heteroalkyl, halo (C1-C6) alkyl, NH(C1-C6) alkyl, or N((C1-C6) alkyl)2; including enantiomers, scalemic or racemic mixtures, and pharmaceutically acceptable salts thereof.

9. The method of any one of Claims 1-6, wherein the high throughput parallel synthesis comprises 1) addition of an ester functionalized amine to the carboxylic acid derivative of the known ligand of a target protein to form the ester derivative via amide linkage; 2) converting the resultant ester derivative to the corresponding carboxylic acid derivative; and 3) treatment of said carboxylic acid derivative with a spirocyclic succinimide derivative.

10. The method of Claim 9, according to the following reaction scheme: 88       TSRI 2225.1PC       A is aR3is (C1-C6) alkyl; R4is (C1-C6)alkyl, (C1-C6)heteroalkyl, (C1-C6)alkyl (C3-C7)cycloalkyl, (C1-C6)alkyl (C3- C7)heterocycloalkyl, (C1-C6)alkyl (C6-C10)aryl, or (C1-C6)alkyl (C5-C6)heteroaryl, optionally substituted with one or more R5; R5is oxo, OH, NH2, halo, (C1-C6) alkyl, (C1-C6) heteroalkyl, halo (C1-C6) alkyl, NH(C1-C6) alkyl, or N((C1-C6) alkyl)2; and n is 0 or 1; including enantiomers, scalemic or racemic mixtures, and pharmaceutically acceptable salts thereof.

11. The method of Claim 10, according to the following reaction scheme: 89       TSRI 2225.1PC      A is a known ligand of a target protein; and n is 0 or 1; including enantiomers, scalemic or racemic mixtures, and pharmaceutically acceptable salts thereof.

12. The method of Claim 10 or Claim 11, wherein n is 0.

13. The method of Claim 10 or Claim 11, wherein n is 1.

14. The method of any one of Claims 1-6, wherein the high throughput parallel synthesis comprises 1) subjecting the known ligand of a target protein to sulfur(VI) fluoride exchange (SuFEx) to form an iminosulfur oxydifluoride derivative; and 2) subjecting the iminosulfur oxydifluoride derivatives to high throughput addition of a multitude of aliphatic amines to form via sulfamide linkage amine-functionalized analogues of the known ligand of the target protein.

15. The method of Claim 14, according to the following reaction scheme: 90       TSRI 2225.1PC      R6is (C1-C6)alkyl, (C1-C6)heteroalkyl, (C1-C6)alkyl (C3-C7)cycloalkyl, (C1-C6)alkyl (C3- C7)heterocycloalkyl, (C1-C6)alkyl (C6-C10)aryl, or (C1-C6)alkyl (C5-C6)heteroaryl, optionally substituted with one or more R12; and R7is oxo, OH, NH2, halo, (C1-C6) alkyl, (C1-C6) heteroalkyl, halo (C1-C6) alkyl, NH(C1-C6) alkyl, or N((C1-C6) alkyl)2; including enantiomers, scalemic or racemic mixtures, and pharmaceutically acceptable salts thereof.

16. The method of any one of Claims 1-6, wherein the high throughput parallel synthesis comprises 1) treating an aryl carboxylic acid derivative of a known ligand of a target protein with an amine functionalized group to form an amide derivative of the known ligand; 2) subjecting the amide derivative to sulfur(VI) fluoride exchange (SuFEx) to form an iminosulfur oxydifluoride derivative; and 3) further addition of an aliphatic amine to form a sulfamide linked amine-functionalized derivative of the known ligand.

17. The method of Claim 16, according to the following reaction scheme: 91       TSRI 2225.1PC      a a R13is (C1-C6)alkyl, (C1-C6) heteroalkyl, (C1-C6) alkyl (C3-C7) cycloalkyl, or (C1-C6)alkyl (C3- C7) heterocycloalkyl; including enantiomers, scalemic or racemic mixtures, and pharmaceutically acceptable salts thereof.

18. The method of any one of Claims 1-6, wherein the high throughput parallel synthesis methods include, but are not limited to: 1) Sulfur(VI) Fluoride Exchange (SuFEx) ; 2);     TSRI 2225.1PC     3) Ruthenium Catalyzed Azide-Alkyne Cycloadditions ; 4); 5); 6) Alder;;  9) Amide Couplings with in-situ Activated Esters 93       TSRI 2225.1PC     ; 10); 11); 12) Urea Couplings; 13)94       TSRI 2225.1PC    ;  14) Radical Nitrone Couplings from Carboxylic Acids ; and 15) Transition Metal Catalyzed Cross Couplings;  wherein: R1, R2, R3, and R4 are each independently H, (C1-C6)alkyl, (C3-C7)cycloalkyl, (C3-C7) heterocycloalkyl, (C6-C10)aryl, or (C5-C8) heteroaryl.

19. The method of any one of Claims 1-18, wherein the second protein is a substrate receptor of an E3 ubiquitin ligase.

20. The method of any one of Claims 1-19, wherein the second protein is CRBN.

21. The method of any one of Claims 1-20, wherein the target protein is a transcriptional coregulator.

22. The method of Claim 21, wherein the target protein is the chromatin reader YEATS domain of the transcriptional coregulator ENL.

23. The method of any one of Claims 1-22, wherein the known ligand of a target protein (A) is an ENL inhibitor with an amido-imidazopyridine scaffold of Formula (I): 95       TSRI 2225.1PC    heteroalkyl, halo (C1-C6) alkyl, (C3-C7) cycloalkyl, or (C1-C6) alkyl (C3-C7) cycloalkyl.

24. The method of Claim 23, wherein R is cyclobutane.

25. The method of Claim 17, according to the following reaction scheme: . .

27. The method of Claim 8, according to the following reaction scheme: 96       TSRI 2225.1PC     .

28. The method of Claim 27, wherein R1.

29. The method of Claim 28, according to scheme: .

30. A compound having the following structure: .

31. The method of Claim 12, according to the following reaction scheme:.

32. A compound having the following structure: 97       TSRI 2225.1PC     O O NH N N H N H O . to the following reaction scheme: .

35. A pharmaceutical composition comprising the compound of Claim 26 and a pharmaceutically acceptable carrier, excipient, or diluent.

36. A method of treating leukemia in a subject, comprising administering a therapeutically effective amount of the compound of Claim 26 or the pharmaceutical composition of Claim 35.

37. The method of Claim 36, wherein the leukemia is acute myeloid leukemia (AML).

38. The method of Claim 36, wherein the leukemia is acute lymphoblastic leukemia (ALL). 98

Images