Treatment agent for charcot-marie-tooth disease

Abstract

The purpose of this invention is to provide a treatment agent for Charcot-Marie-Tooth disease. The present invention provides an treatment agent for Charcot-Marie-Tooth disease in a subject, the agent containing, as an active ingredient, a drug for editing the PMP22 gene in the genome of the subject.

Description

Treatment for Charcot-Marie-Tooth disease

[0001] The present invention relates to a therapeutic agent for Charcot-Marie-Tooth disease, and more particularly to a therapeutic agent for type 1A Charcot-Marie-Tooth disease.

[0002] Charcot-Marie-Tooth disease (CMT) is a group of familial neurodegenerative disorders that cause hereditary motor and sensory neuropathies (HMSN), with an incidence of 10-80 per 100,000 [Non-Patent Documents 1-5]. More than 30 autosomal dominant genes are thought to cause CMT, while others are autosomal recessive or X-linked. Mutations in these genes result in axonal or demyelinating peripheral neuropathy [Non-Patent Documents 6-11]. Charcot-Marie-Tooth type 1 (CMT1) is the most common form, accounting for approximately 70% of CMT patients and resulting from demyelinating peripheral neuropathy. Six CMT1 subtypes, CMT1A-F, are associated with different causative genes. CMT1A, caused by pathological duplication of the peripheral myelin protein 22 (PMP22) gene and subsequent accumulation of PMP22 protein, is the most common subtype, accounting for 70-80% of CMT1 patients [Non-Patent Documents 6-11]. Characteristic symptoms and findings include distal muscle weakness, paresthesia, and mild impairment of peripheral nerve conduction velocity. The severity of symptoms varies from case to case [6-11].

[0003] Currently, there are no clinically proven therapeutic interventions for CMT or CMT1A [6, 9, 10]. Primary management includes physical therapy and occupational therapy, and in some cases, nonsteroidal anti-inflammatory drugs (NSAIDs) and antidepressants for pain management [6-10, 12]. Downregulation of PMP22 is one of the most promising treatments for CMT1A. Small interfering RNA (siRNA) [13, 14], AAV-mediated short hairpin inhibitory RNA (shRNA)

[15] , and AAV-mediated microRNA (miRNA)

[16] have been developed at the research level to suppress abnormally elevated PMP22 mRNA in CMT1A.

[0004] Numerous mouse models of CMT1A have been developed to test this idea [Non-Patent Documents 9, 10, 14, 17-20]. However, these are transgenic mice or rats overexpressing PMP22, and no knock-in animal models with tandem PMP22 gene duplications with sufficiently long flanking genomic regions exist. A recent report [Non-Patent Document 15] examined the effects of shRNAs knocking down PMP22 in a rat CMT1A model in which PMP mRNA expression was increased by more than fourfold [Non-Patent Document 17]. Another recent study developed AAV-mediated miRNA expression to downregulate PMP22 in heterozygous human PMP22 transgenic C61 mice, resulting in reduced PMP22 mRNA expression [Non-Patent Document 16]. These rodent studies, however, may not accurately reflect the human pathology due to the use of overexpression model animals. Furthermore, excessive knockdown may cause pathologies similar to those of PMP22 deficiency (e.g., hereditary neuropathy with pressure palsy (HNPP)), which causes hereditary neuropathy due to loss of function [Non-patent literature 21, 22].

[0005] Skre, H. Genetic and clinical aspects of Charcot-Marie-Tooth’s disease. Clin Genet 6, 98-118 (1974).Barisic, N. et al. Charcot-Marie-Yooth disease: A clinico-genetic confrontation. Ann Hum Genet 72, 416-441 (2008).Saporta, A. S. D. et al. Charcot-marie-tooth disease subtypes and genetic testing strategies. Ann Neurol 69, 22-33 (2011).Klein, C. J., Duan, X. & Shy, M. E. Inherited neuropathies: Clinical overview and update. Muscle Nerve 48, 604-622 (2013).Gutmann, L. & Shy, M. Update on Charcot-Marie-Tooth disease. Curr Opin Neurol 28, 462-467 (2015).Bolino, A. & D’Antonio, M. Recent advances in the treatment of Charcot Marie Tooth neuropathies. J Peripher Nerv Syst 28, 134-149 (2023).Stavrou, M., Sargiannidou, I., Georgiou, E., Kagiava, A. & Kleopa, K. A. Emerging Therapies for Charcot-Marie-Tooth Inherited Neuropathies. Int J Mol Sci 22, 6048 (2021).Braathen, G. J. Genetic epidemiology of Charcot-Marie-Tooth disease. Acta Neurol Scand Suppl 126, iv-22 (2012).Stavrou, M., Kagiava, A., Sargiannidou, I., Georgiou, E. & Kleopa, K. A. Charcot-Marie-Tooth neuropathies: Current gene therapy advances and the route toward translation. J Peripher Nerv Syst 28, 150-168 (2023). Stavrou, M. & Kleopa, K. CMT1A current gene therapy approaches and promising biomarkers. Neural Regen Res 18, 1434 (2023). Bird, T. D. Charcot-Marie-Tooth Hereditary Neuropathy Overview. Adam MP, Mirzaa GM, Pagon RA, et al., editors. University of Washington, Seattle GeneReviews(registered trademark)[Internet] (1993-2023). Zhao, H. T. et al. PMP22 antisense oligonucleotides reverse Charcot-Marie-Tooth disease type 1A features in rodent models. J Clin Invest 128, 359-368 (2017). Lee, J.-S. et al. Pmp22 mutant allele-specific siRNA alleviates demyelinating neuropathic phenotype in vivo. Neurobiol Dis 100, 99-107 (2017). Boutary, S. et al. Squalenoyl siRNA PMP22 nanoparticles are effective in treating mouse models of Charcot-Marie-Tooth disease type 1 A. Commun Biol 4, 317 (2021). Gautier, B. et al.AAV2 / 9-mediated silencing of PMP22 prevents the development of pathological features in a rat model of Charcot-Marie-Tooth disease 1 A. Nat Commun 12, 984-985 (2021).Stavrou, M. et al. A translatable RNAi-driven gene therapy silences PMP22 / Pmp22 genes and improves neuropathy in CMT1A mice. J Clin Invest 132, e159814 (2022).Sereda, M. et al. A Transgenic Rat Model of Charcot-Marie-Tooth Disease. Neuron 16, 1049-1060 (1996).Magyar, J. P. et al. Impaired Differentiation of Schwann Cells in Transgenic Mice with Increased PMP22 Gene Dosage. J Neurosci 16, 5351-5360 (1996).Huxley, C. Construction of a mouse model of Charcot-Marie-Tooth disease type 1A by pronuclear injection of human YAC DNA. Hum Mol Genet 5, 563-569 (1996).Perea, J. Induced myelination and demyelination in a conditional mouse model of Charcot-Marie-Tooth disease type 1A. Hum Mol Genet 10, 1007- 1018 (2001).Li, J., Parker, B., Martyn, C., Natarajan, C. & Guo, J. The PMP22 gene and its related diseases.Mol Neurobiol 47, 673-698 (2013).van Paassen, B. W. et al. PMP22 related neuropathies: Charcot-Marie-Tooth disease type 1A and Hereditary Neuropathy with liability to Pressure Palsies. Orphanet J Rare Dis 9, 38 (2014).Valentijn, L. J. et al. The peripheral myelin gene PMP-22 / GAS-3 is duplicated in Charcot-Marie-Tooth disease type 1A. Nat Genet 1, 166- 170 (1992).Pentao, L., Wise, C. A., Chinault, A. C., Patel, P. I. & Lupski, J. R. Charcot-Marie-Tooth type 1A duplication appears to arise from recombination at repeat sequences flanking the 1.5 Mb monomer unit. Nat Genet 2, 292-300 (1992).Palau, F. et al. Origin of the de novo duplication in Charcot-Marie-Tooth disease type 1A: unequal nonsister chromatid exchange during spermatogenesis. Hum Mol Genet 2, 2031-2035 (1993).Inoue, K. et al. The 1.4-Mb CMT1A duplication / HNPP deletion genomic region reveals unique genome architectural features and provides insights into the recent evolution of new genes. Genome Res 11, 1018-1033 (2001).Aida, T. et al. Gene cassette knock-in in mammalian cells and zygotes by enhanced MMEJ. BMC Genomics 17, 979 (2016).Storici, F. Gene Correction. Humana Press 1114 (2014).Hoyng, S. A. et al. Gene delivery to rat and human Schwann cells and nerve segments: A comparison of AAV 1-9 and lentiviral vectors. Gene Ther 22, 767-780 (2015).Kim, H. S. et al. Schwann Cell Precursors from Human Pluripotent Stem Cells as a Potential Therapeutic Target for Myelin Repair. Stem Cell Reports 8, 1714-1726 (2017).McLaren, W. et al. The Ensembl Variant Effect Predictor. Genome Biol 17, 122 (2016).Bae, S., Park, J. & Kim, J. S. Cas-OFFinder: A fast and versatile algorithm that searches for potential off-target sites of Cas9 RNA-guided endonucleases. Bioinformatics 30, 1473-1475 (2014).Brinkman, E. K., Chen, T., Amendola, M. & van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res 42, e168-e168 (2014).Naef, R. & Suter, U.Many facets of the peripheral myelin protein PMP22 in myelination and disease. Microsc Res Tech 41, 359-371 (1998).Sancho, S. Regulation of Schwann cell proliferation and apoptosis in PMP22-deficient mice and mouse models of Charcot-Marie-Tooth disease type 1A. Brain 124, 2177-2187 (2001).Tanaka, H. et al. The intellectual disability gene PQBP1 rescues Alzheimer’s disease pathology. Mol Psychiatry 23, 2090-2110 (2018).Fu, Y. et al. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol 31, 822-826 (2013).Leibowitz, M. L. et al. Chromothripsis as an on-target consequence of CRISPR-Cas9 genome editing. Nat Genet 53, 895-905 (2021).Zha, M.-J., Cai, C.-E. & He, P.-M. Outlook on the Security and Potential Improvements of CRISPR-Cas9. Mol Biotechnol (2023).Ran, F. A. et al. Double Nicking by RNA-Guided CRISPR Cas9 for Enhanced Genome Editing Specificity. Cell 154, 1380-1389 (2013).Naeem, M., Majeed, S., Hoque, M. Z. & Ahmad, I.Latest Developed Strategies to Minimize the Off-Target Effects in CRISPR-Cas-Mediated Genome Editing. Cells 9, 1608 (2020).Salzer, J. L. Schwann Cell Myelination. Cold Spring Harb Perspect Biol 7, a020529 (2015).Suresh, S., Wang, C., Nanekar, R., Kursula, P. & Edwardson, J. M. Myelin basic protein and myelin protein 2 act synergistically to cause stacking of lipid bilayers. Biochemistry 49, 3456-3463 (2010).Raasakka, A. et al. Membrane Association Landscape of Myelin Basic Protein Portrays Formation of the Myelin Major Dense Line. Sci Rep 7, 4974 (2017).Raasakka, A. et al. Molecular structure and function of myelin protein P0 in membrane stacking. Sci Rep 9, 642 (2019).Di Gioacchino, M. et al. Myelin basic protein dynamics from out-of-equilibrium functional state to degraded state in myelin. Biochim Biophys Acta Biomembr 1862, 183256 (2020).Mittendorf, K. F. et al. Peripheral myelin protein 22 alters membrane architecture. Sci Adv 3, e1700220 (2017).Tobler, A. R., Liu, N., Mueller, L.& Shooter, E. M. Differential aggregation of the Trembler and Trembler J mutants of peripheral myelin protein 22. Proc Natl Acad Sci U S A 99, 483-488 (2002).Marinko, J. T. et al. Glycosylation limits forward trafficking of the tetraspan membrane protein PMP22. J Biol Chem 296, 100719 (2021).Zoidl, G., Blass-Kampmann, S., D’Urso, D., Schmalenbach, C. & Muller, H. W. Retroviral-mediated gene transfer of the peripheral myelin protein PMP22 in Schwann cells: Modulation of cell growth. EMBO Journal 14, 1122-1128 (1995).Hanemann, C. O. et al. Improved culture methods to expand schwann cells with altered growth behaviour from CMT1a patients. Glia 23, 89-98 (1998).Fabbretti, E., Edomi, P., Brancolini, C. & Schneider, C. Apoptotic phenotype induced by overexpression of wild-type gas3 / PMP22: its relation to the demyelinating peripheral neuropathy CMT1A. Genes Dev 9, 1846-1856 (1995).Brancolini, C., Edomi, P., Marzinotto, S. & Schneider, C.Exposure at the Cell Surface Is Required for Gas3 / PMP22 To Regulate Both Cell Death and Cell Spreading: Implication for the Charcot-Marie-Tooth Type 1A and Dejerine-Sottas Diseases. Mol Biol Cell 11, 2901-2914 (2000).Fledrich, R. et al. Soluble neuregulin-1 modulates disease pathogenesis in rodent models of Charcot-Marie-Tooth disease 1A. Nat Med 20, 1055- 1061 (2014).Martini, R. Neuregulin-1 alleviates Charcot-Marie-Tooth disease in rats. Nat Med 20, 984-985 (2014).Sahenk, Z. et al. AAV1.NT-3 gene therapy for charcot-marie-tooth neuropathy. Molecular Therapy 22, 511-521 (2014).Nobbio, L. et al. P2X7-mediated increased intracellular calcium causes functional derangement in schwann cells from rats with CMT1A neuropathy. Journal of Biological Chemistry 284, 23146-23158 (2009).Pareyson, D. et al. Ascorbic acid in Charcot-Marie-Tooth disease type 1A (CMT-TRIAAL and CMT-TRAUK): a double-blind randomised trial. Lancet Neurol 10, 320-328 (2011).Lewis, R. A. et al.High-dosage ascorbic acid treatment in charcot-marie-tooth disease type 1A results of a randomized, double-masked, controlled trial. JAMA Neurol 70, 981-987 (2011). Thomas, FP et al. Randomized Phase 2 Study of ACE-083 in Patients With Charcot-Marie-Tooth Disease. Neurology 98, e2356 (2022).

[0006] Therefore, optimizing knockdown efficiency for therapeutic benefit is a therapeutic challenge for human CMT1A patients who have three copies of the PMP22 gene, and we believe that a method to delete the extra gene copy, such as the one described in this patent, is most appropriate. A 1.5 Mb tandem repeat at 17p11.2 causes a pathological duplication of the PMP22 gene, resulting in CMT1A [Non-Patent Document 23]. Pentato et al. proposed that the mechanism underlying the low-copy-number repetitive elements may be induced by rearrangement of two homologous sequences, CMT1A-REP, flanking a 1.5 Mb genomic unit during spermatogenesis due to unequal crossover during meiosis [Non-Patent Document 24]. This was supported by the finding that only paternal duplications occurred in nine sporadic CMT1A patients [Non-Patent Document 25]. Thus, the mutant CMT1A genome encodes two copies of the identical genomic sequence of the PMP22 gene.

[0007] One of the most promising therapeutic approaches for CMT1A is genome editing of the PMP22 gene duplication, but this approach has not been attempted before. Challenges to this gene therapy include the need to remove only one copy of the PMP22 gene without editing the second copy, and the efficiency of infection and genome editing in adult Schwann cells, which generate the myelin sheath of peripheral nerves. YAC transgenic mice [19, 20] are attractive for testing genome editing techniques, but a 560 kb YAC is not long enough to contain two copies of the same genomic sequence. Meanwhile, overexpression mice with eight copies of the YAC described above are inappropriate for testing our method. Therefore, we developed an AAV vector that specifically deletes a single copy of the PMP22 gene from the duplicated gene using human iPSCs (iPSCs) derived from CMT1A patients containing two copies of the same genomic sequence. This molecular tool overcomes a major obstacle to the therapeutic use of this modality, leaving the remaining challenge of in vivo delivery to animal models and even humans, which may be overcome with expected technological advances in the field of gene therapy.

[0008] As mentioned above, Charcot-Marie-Tooth disease type 1A (CMT1A) is one of the most common inherited peripheral neuropathy caused by a duplication of a 1.5 Mb genomic region containing the PMP22 gene. We aimed to correct the duplication in human CMT1A patient-derived iPS cells (CMT1A-iPSCs) using genome editing techniques such as CRISPR-Cas, and to analyze the effects on Schwann cells differentiated from CMT1A-iPSCs.

[0009] That is, an object of the present invention is to provide an agent for treating Charcot-Marie-Tooth disease.

[0010] We selected several unique sequences (gRNA1-5) present in two regions flanking only one copy of the duplicated PMP22 gene from the genome sequence, designed gRNAs targeting these sequences, and selected one of them (gRNA3) through efficiency screening using a T7E1 mismatch detection assay. gRNA3 was subcloned into the pX601-AAV-CMV plasmid to generate AAV2-hSaCas9-gRNAedit, and then transfected the genome-editing AAV vector into CMT1A-iPSCs.

[0011] Infection of CMT1A-iPSCs with AAV2-hSaCas9-gRNAedit, which expresses both hSaCas9 and a gRNA targeting the tandem repeat sequence, reduced PMP22 gene duplication by 20-40%. Infection of CMT1A-iPSC-derived Schwann cell precursors with AAV2-hSaCas9-gRNAedit normalized PMP22 mRNA and protein expression levels and also ameliorated increased apoptosis and impaired myelination in CMT1A-iPSC-derived Schwann cells.

[0012] After careful testing for toxicity, including off-target mutations, in vivo transfer of AAV2-hSaCas9-gRNAedit into peripheral nerves may be a potential treatment for patients with CMT1A.

[0013] This is summarized below. Charcot-Marie-Tooth disease type 1A (CMT1A) is one of the most common inherited peripheral neuropathy disorders, yet no cure exists. We developed a method to correct the PMP22 gene duplication that causes CMT1A by genome editing using gRNAs targeting unique sequences present at two sites flanking only one copy of the duplicated PMP22 gene. Infection of iPSCs with an AAV2 vector expressing both hSaCas9 and gRNAs targeting the tandem repeat sequence reduced the PMP22 gene duplication by 20–40% in iPSC-derived Schwann cells and normalized PMP22 mRNA and protein expression levels. CMT1A-iPSC-derived Schwann cell progenitors and Schwann cells exhibited reduced proliferation and increased apoptosis. These characteristics extended to impaired myelination in coculture with normal iPSC-derived neurons. Increased apoptosis and impaired myelination capacity of human CMT1A-iPSC-derived Schwann cell precursors were normalized by infection with a genome-editing vector.

[0014] That is, the present invention provides the following. [Aspect 1] A therapeutic agent for Charcot-Marie-Tooth disease in a subject, comprising as an active ingredient an agent for editing the PMP22 gene in the genome of a subject. [Aspect 2] The therapeutic agent according to Aspect 1, wherein the copy number of the PMP22 gene in the genome of the subject is three or more. [Aspect 3] The therapeutic agent according to Aspect 1, wherein the copy number of the PMP22 gene in the genome of the subject is three. [Aspect 4] The therapeutic agent according to Aspect 1, wherein the agent for editing the PMP22 gene in the genome of a subject is an agent for editing one copy of the PMP22 gene in the genome of the subject. [Aspect 5] The therapeutic agent according to Aspect 1, wherein the agent for editing the PMP22 gene in the genome of a subject is an agent for deleting the PMP22 gene in the genome of the subject. [Aspect 6] The therapeutic agent according to Aspect 5, wherein the agent for deleting the PMP22 gene in the genome of a subject is an agent for deleting one copy of the PMP22 gene in the genome of the subject. [Aspect 7] The agent for treating Charcot-Marie-Tooth disease in a subject according to Aspect 1, wherein the agent for treating Charcot-Marie-Tooth disease in a subject is a therapeutic agent for Charcot-Marie-Tooth disease in a subject. [Aspect 8] The agent for treating Charcot-Marie-Tooth disease in a subject according to Aspect 1, wherein the agent for editing the PMP22 gene in the subject's genome comprises an agent for cleaving a first predetermined position in the subject's genome and an agent for cleaving a second predetermined position in the subject's genome. [Aspect 9] The agent for treating 8, wherein the first predetermined position in the subject's genome is located upstream of the PMP22 gene in the subject's genome and the second predetermined position in the subject's genome is located downstream of the PMP22 gene in the subject's genome. [Aspect 10] The agent for treating 8, wherein the agent for cleaving the first predetermined position in the subject's genome is an agent for cleaving a second predetermined position in the subject's genome. [Aspect 11] The agent for treating Charcot-Marie-Tooth disease in a subject according to Aspect 1, wherein the agent for editing the PMP22 gene in the subject's genome comprises a substance for binding an enzyme that cleaves the predetermined position in the genome to the predetermined position in the genome. [Embodiment 12] The treatment agent according to embodiment 11, wherein the substance for binding an enzyme that cleaves a specific site in the genome to the specific site in the genome is RNA.[Aspect 13] The treatment agent according to Aspect 12, wherein the RNA is a guide RNA of a CRISPR-Cas system. [Aspect 14] The treatment agent according to Aspect 11, wherein the enzyme that cleaves a predetermined position in the genome is Cas9. [Aspect 15] The treatment agent according to Aspect 14, wherein the Cas9 is SaCas9. [Aspect 16] The treatment agent according to Aspect 1, wherein the agent for editing the PMP22 gene in the genome of a subject comprises an enzyme that cleaves a predetermined position in the genome. [Aspect 17] The treatment agent according to Aspect 1, comprising a substance for producing a substance for binding an enzyme that cleaves a predetermined position in the genome to the predetermined position in the genome. [Aspect 18] The treatment agent according to Aspect 17, wherein the substance for producing a substance for binding an enzyme that cleaves a predetermined position in the genome to the predetermined position in the genome is a vector for expressing, in a cell of the subject, a substance for binding an enzyme that cleaves a predetermined position in the genome to the predetermined position in the genome. [Aspect 19] The treatment agent according to Aspect 1, comprising a substance for producing an enzyme that cleaves a predetermined position in the genome. [Aspect 20] The treatment agent according to Aspect 19, wherein the substance for producing an enzyme that cleaves a predetermined position in the genome is a vector for expressing the enzyme that cleaves a predetermined position in the genome in a cell of a subject. [Aspect 21] The treatment agent according to Aspect 19, wherein the substance for producing an enzyme that cleaves a predetermined position in the genome is a substance for producing a substance for binding an enzyme that cleaves a predetermined position in the genome to a predetermined position in the genome. [Aspect 22] The treatment agent according to Aspect 11, wherein the substance for binding an enzyme that cleaves a predetermined position in the genome to a predetermined position in the genome is RNA comprising the sequence set forth in any one of SEQ ID NOS: 1 to 5, RNA comprising the sequence set forth in any one of SEQ ID NOS: 19 to 23, or RNA comprising the sequence set forth in any one of SEQ ID NOS: 25 to 29. [Aspect 23] The treatment agent according to Aspect 11, wherein the substance for binding an enzyme that cleaves a predetermined position in the genome to a predetermined position in the genome is RNA consisting of the sequence set forth in any one of SEQ ID NOS: 1 to 5, RNA consisting of the sequence set forth in any one of SEQ ID NOS: 19 to 23, or RNA consisting of the sequence set forth in any one of SEQ ID NOS: 25 to 29. [Aspect 24] The therapeutic agent according to Aspect 1, wherein the Charcot-Marie-Tooth disease is type 1.[Aspect 25] The therapeutic agent according to Aspect 1, wherein the Charcot-Marie-Tooth disease is type 1A. [Aspect 26] The therapeutic agent according to Aspect 1, wherein the agent for editing the PMP22 gene in the genome of a subject comprises a guide RNA that recognizes both a first predetermined position in the subject's genome and a second predetermined position in the subject's genome, and an enzyme that forms a complex with the guide RNA and cleaves genomic DNA, wherein the guide RNA and the enzyme are expressed from the same AAV vector. [Aspect 27] A method for treating Charcot-Marie-Tooth disease, comprising delivering to a subject in need of treatment an agent for editing the PMP22 gene in the subject's genome, wherein the agent for editing the PMP22 gene in the subject's genome comprises a guide RNA that recognizes both a first predetermined position in the subject's genome and a second predetermined position in the subject's genome, and an enzyme that forms a complex with the guide RNA and cleaves genomic DNA, thereby deleting one copy of the duplicated PMP22 gene in the subject's genome. [Aspect 28] The method of aspect 27, wherein the guide RNA and the enzyme are expressed from the same AAV vector, and delivery is achieved by administering the AAV vector to a subject.

[0015] According to the present invention, Charcot-Marie-Tooth disease can be treated.

[0016] AAV-mediated genome editing strategy: (a) Human genome structure surrounding the PMP22 gene in normal cells, CMT1A cells, and edited CMT1A cells containing the genome editing target site. (b) Map of the genome editing VB171205 plasmid used to remove the additional PMP22 gene copy from CMT1A cells. AAV2 vectors were generated in HEK293 cells from this plasmid. Verification of genome editing in human CMT1A iPS cells: (a) Protocol for genome editing verification in human CMT1A iPS cells by quantitative PCR. (b) Method and secondary primers for nested PCR used to detect unedited hybrid CMT1A-REP. (c) Formula for calculating percent genome editing: Ct x: Ct value of sample X; Ct (internal control): Ct value of the internal control in qPCR for sample X. (d) Percent genome editing in iPSCs after 1, 2, 3, 4, or 5 weeks of infection with AAV2 genome editing vectors. The number of samples (AAV-, gRNAcont, gRNAedit) was 1 week (3, 4, 7), 2 weeks (3, 4, 7), 3 weeks (4, 4, 4), 4 weeks (5, 4, 6), and 5 weeks (8, 5, 7). (e) Protocol for verifying genome editing in human CMT1A iPSCs by Southern blot analysis. (f) The scheme on the left shows the genome structure and the proximal, hybrid, and distal CMT1A-REPs. EcoRI-SacI digestion generated bands of 5.1 kb, 6.1 kb, and 3.3 kb from the three REP sequences. The image on the top right shows the Southern blot results detecting the three bands. The image on the bottom right shows an agarose gel stained with ethidium bromide, demonstrating equal amounts of genomic DNA loaded. The asterisk indicates that 1 / 50 of the amount of digoxigenin-labeled DNA molecular weight marker III was not visible in the ethidium bromide stain. (g) Strategy for calculating percent genome editing by Southern blot after correcting for blot efficiency and hybridization efficiency. (h) Quantitative analysis of percent genome editing in uninfected iPSCs, AAV2-hSaCas9-gRNAcont-infected iPSCs, and AAV2-hSaCas9-gRNAedit-infected iPSCs. Schwann cell differentiation from normal or CMT1A iPSCs: (a) Protocol for differentiating Schwann cells from iPSCs. (b) Representative images of cultures at the Schwann cell precursor (day 25) and Schwann cell (day 42) stages. (c) Quantitative analysis of colony number, colony cell proliferation, and number of Schwann cell precursors outside of colonies. Neuron-Schwann cell cocultures of normal or CMT1A-iPSC cells: (a) Protocol for measuring myelination in neuron-Schwann cell cocultures of normal iPSC-derived neurons and normal or CMT1A-iPSC-derived Schwann cells. (b) Co-staining for MBP and MAP2 revealed myelinated neurites (downward arrows) and unmyelinated neurites (other arrows).The myelination rate (area of ​​myelinated fibers / area of ​​MAP2-positive fibers * 100) was calculated for cocultures of normal Schwann cells and normal neurons at high cell density (4,000 neurons + 40,000 Schwann cells / well in a 6-well plate) and for cocultures of CMT1A Schwann cells and normal neurons. (c) Electron microscopy revealed an increased ratio of dead cells to total cells in cocultures of normal neurons and CMT1A Schwann cells. The graph on the right shows quantitative analysis of cell death in eight independent regions. Rescue of cell death in CMT1A-iPSC-derived Schwann cells by genome-editing AAV vectors: (a) Rescue of the coculture phenotype of normal iPSC-derived neurons and CMT1A-iPSC-derived Schwann cells by infection with genome-editing AAV vectors at the Schwann cell stage. (b) Two representative EM images of a co-culture of normal iPSC-derived neurons and CMT1A-iPSC-derived Schwann cells after infection with AAV2-hSaCas9-gRNAcont (AAV-gRNAcont) or AAV2-hSaCas9-gRNAedit (AAV-gRNAedit). The graph on the right shows a quantitative analysis of the cell death rate (number of dead cells / total number of cells) calculated from eight EM images. Rescue of CMT1A-iPSC-derived Schwann cell myelination function by genome-editing AAV vectors: (a) Immunohistochemistry of a co-culture of normal iPSC-derived neurons and CMT1A iPSC-derived Schwann cells after infection with AAV2-hSaCas9-gRNAcont (AAV-gRNAcont) or AAV2-hSaCas9-gRNAedit (AAV-gRNAedit). Quantitative analysis revealed that AAV2-hSaCas9-gRNAedit infection improved the myelination function of CMT1A Schwann cells. (b) Representative image of myelinated fibers. Although no dense myelin sheath was observed up to 50 days after iPSC seeding, loose myelination was observed around neurites.(c) Representative images of cocultures of normal neurons and normal Schwann cells, cocultures of normal neurons and CMT1A Schwann cells, cocultures of AAV2-hSaCas9-gRNAcont-infected CMT1A Schwann cells and normal neurons, and cocultures of AAV2-hSaCas9-gRNAedit-infected CMT1A Schwann cells and normal neurons. (d) Quantitative analysis of myelinated fiber bundles in the four groups shown in (c). The table below shows the statistical analysis results. Effect of genome editing on PMP22 expression levels: (a) Sampling protocol for assessing PMP22 protein and mRNA expression levels. (b) Immunocytochemistry for assessing PMP22 protein levels in a monoculture of CMT1A-iPSC-derived Schwann cells at day 42 and colocalization of PMP22 and MAP2 signals in a coculture of iPSC-derived neurons and CMT1A-iPSC-derived Schwann cells at day 47. PMP22 signals were increased in CMT1A-iPSC-derived Schwann cells compared with normal iPSC-derived Schwann cells. A similar increase in PMP22 signals was observed in coculture, but the MAP2 and PMP22 signals were corrected, and the fused signal was increased by AAV-gRNAedit infection. (c) Quantitative analysis of PMP22 signal intensity, MAP2 signal intensity, the % area of ​​MAP2 colocalized with PMP22, and the % area of ​​PMP22 colocalized with MAP2 in the four coculture groups. (d) Quantitative PCR analysis of PMP22 mRNA in the four coculture groups. (e) Western blot analysis of PMP22 protein in the four coculture groups. (f) Quantitative analysis of the number of PMP22-positive Schwann cells in the four groups. Selection of guide RNA sequences for genome editing of the duplicated PMP22 gene: (a) Schematic diagram of guide RNA design and screening. Five guide RNA sequences were designed and cloned into the pX601 vector. For genome editing, plasmids containing guide RNAs were transfected into 293T cells and normal iPSCs. To determine the genome editing efficiency of CRISPR-SaCas9, a T7 endonuclease 1 assay was performed. Guide RNA 3 showed the highest cleavage efficiency among the five candidates and was selected for cloning into AAV2.(b) T7 endonuclease 1 assay to determine relative gene editing efficiency. Guide RNA sequences were designed in the 2400-bp region proximally adjacent to CMT1A-REP. Three primer pairs were required to perform PCR of the five guide RNAs in the T7E1 assay. In 293T cells, all sequences except gRNA4 showed detectable activity. In normal iPSCs, gRNA2, gRNA3, and gRNA5 showed significant cleavage activity. (c) Schematic diagram of the T7E1 assay. Plasmids containing guide RNA sequences and those without guide RNA were transfected into cells using Lipofectamine 2000 reagent. After 48 hours of incubation, genomic DNA was extracted and PCR was performed using the primers listed above. The PCR products were denatured and reannealed, and DNA from edited cells was reannealed with DNA from unedited cells to generate heteroduplexes. The reannealed heteroduplexes were cleaved by T7E1 endonuclease, which detects mismatches in heteroduplexes and cleaves double-stranded DNA at the mismatched region, while the homoduplexes remained intact. The resulting fragments were of different lengths and were distinguishable in an agarose gel. (d) Gel image of PCR products from normal iPSCs. The expected band sizes on the gel were as follows: sgRNA1: 376 and 255 bp, sgRNA2: 311 and 297 bp, sgRNA3: 255 and 172 bp, sgRNA4: 306 and 325 bp, and sgRNA5: 251 and 176 bp. The genome editing efficiency of CRISPR-SaCas9 was evaluated according to the InDel (insertion / deletion polymorphism) mutation rate measured by PCR band intensity. Intensity values ​​are summarized in the table. No cleavage was detected with gRNA1 or gRNA4. (e) Scheme showing the location of guide RNA sequences within the CMT1A genome. The sequence was drawn in the region outside of the CMT1A-REP. The PAM sequence was generated using Cas-OFFinder software. In the example of 21-bp gRNA1, the arrowhead at the bottom right indicates the SaCas9 cleavage site, and the box at the bottom right indicates the PAM sequence. Assessment of CMT1A-iPSC integrity: (a) Karyotype analysis of CMT1A-iPSCs (CiRA00139) by G-banding.(b) Genome-wide analysis to identify the duplication region. Read counts map to the 17p11.2 genomic region. Workflow for AAV infection of CMT1A iPSCs: iPSCs derived from a CMT1A patient cultured in a feeder-free system were seeded onto 12-well plates coated with Matrigel GFR. After 13 hours, cells were divided into three groups: no AAV infection, AAV infection without guide RNA, and AAV infection with guide RNA sequence 3 (MOI = 10,000). After 72 hours, cells were replaced with fresh medium, and one week later, the cells reached confluence, required for the first passage. Seven days after AAV infection, viral infection of CMT1A iPSCs was confirmed by PCR amplification of the AAV-ITR region, and samples were prepared for nested qPCR of the CMT1A hybrid region. RNase P was used as an internal control for nested qPCR. Evaluation of genome editing efficiency by TIDE: (a) Methods for TIDE, TOPO subcloning, and Sanger sequencing. The region surrounding the gRNA target sequence was PCR amplified, subcloned into TOPO plasmids, and sequenced by Sanger sequencing. (b) Results of a pilot study using four plasmids from uninfected iPSCs (uninfected) and four plasmids from AAV-gRNAedit-infected iPSCs. Representative TOPO plasmid sequences are shown in the right panel. Plasmids 2 and 1 contain unedited genomic sequence surrounding the gRNA target (top panel). Plasmid 5 contains a completely different sequence that maps to clone RP11-203E6 (ID: AC116310.2) on chromosome 5, indicating that this clone was derived from PCR primer hybridization with a non-target genomic sequence. Plasmid 7 contained a point mutation in the gRNA target sequence, which was determined to be the result of genome editing. (c) Summary of the complete study for 1,268 plasmids. The genome editing efficiency was calculated to be 16.77%. hiPSC to Schwann cell differentiation protocol: Feeder-free hiPSC cells were cultured in medium containing SB431542 and CT99021 and differentiated into neural rosettes. Addition of NRG1 further induced Schwann cell precursors.The culture medium was then replaced with SC differentiation medium to differentiate the SCPs into Schwann cells. Schwann cell differentiation stages in CMT1A-iPSC-derived iPSCs and genome editing efficiency at various infection time points: (a) The upper panel shows the protocol. AAV genome editing vectors or AAV control vectors were infected at the iPSC, Schwann cell precursor, and mature Schwann cell stages. The percent genome editing efficiency was evaluated as shown in Figure 2. The sample numbers (AAV-, AAV-gRNAcont, AAV-gRNAedit) were: iPSCs (2, 3, 3), SCPs (4, 4, 4), and Schwann cells (4, 4, 3). (b) S100B immunostaining revealed impaired differentiation of CMT1A-iPSC-derived iPSCs. The lower graph shows a quantitative analysis of S100B signal intensity per field. Confirmation of AAV genome editing vector infection by immunoelectron microscopy: Immunoelectron microscopy using anti-Chrispr-Cas9 antibody revealed nuclear-specific staining (straight arrows), i.e., gold particles within the nucleus, in CMT1A iPSC-derived Schwann cells, whereas only faint nonspecific staining in the cytoplasm (dotted arrows) was detected in uninfected CMT1A Schwann cells. Effect of genome editing on chromosome and genomic sequence: (a) Karyotype analysis of CMT1A-iPSCs after genome editing by G-banding. (b) 1 × 10 6Genome structure analysis by whole-genome sequencing of genomic DNA prepared from cells. Genome structure remained unchanged at the chromosome and CNV levels after genome editing. (c) Whole-genome sequencing to identify off-target effects on CMT1A-iPSCs after genome editing by infection with AAV-gRNAedit. (d) Whole-genome sequencing to identify off-target effects on peripheral nerves and surrounding tissues after genome editing by intraneural injection of AAV-gRNAedit. Regarding "unknown SNPs," "common base SNPs" refer to SNPs whose positions are known but whose changed bases are not recorded in SNP databases, and "common position SNPs" refer to SNPs whose positions are not recorded in SNP databases but whose changed bases are the same before and after genome editing. The final percentage of potential off-target effects for coding and regulatory regions was 3.23 x 10 for human iPSCs. -8 %, and 4.58 x 10 in mouse tissues -6 %.

[0017] The present invention provides a therapeutic agent for treating Charcot-Marie-Tooth disease in a subject, which comprises as an active ingredient an agent for editing the PMP22 gene in the genome of the subject.

[0018] Subjects include humans. Subjects can be of any age, including infants, juveniles, adolescents, adults, and geriatrics.

[0019] In a drug for editing the PMP22 gene in a target genome, editing the PMP22 gene in the genome can include, for example, editing the ORF of the PMP22 gene, as well as editing the transcriptional regulatory region of the PMP22 gene. Examples of the transcriptional regulatory region include promoters, enhancers, silencers, and terminators. In addition, editing the PMP22 gene in the genome can include, for example, editing the ORF of the PMP22 gene and excessive gene copies containing the transcriptional regulatory region, editing the ORF, editing the transcriptional regulatory region, etc.

[0020] For example, editing the PMP22 gene in genome can be modified the function of the PMP22 gene in genome.Modifying the function of the PMP22 gene in genome can be completely lost, partially lost, or acquired a function that the PMP22 gene in genome does not have, and preferably completely lost the function of the PMP22 gene in genome.

[0021] Editing the PMP22 gene in the genome includes preventing the expression of an expression product from the PMP22 gene in the genome, reducing the expression level of the expression product from the PMP22 gene in the genome, and modifying the size of the expression product from the PMP22 gene in the genome. Here, examples of expression products include mRNA, protein, and the like. Examples of preventing the expression of an expression product from the PMP22 gene in the genome include deleting the PMP22 gene in the genome. Examples of deleting the PMP22 gene in the genome include deleting all or part of the PMP22 gene in the genome. Examples of deleting all or part of the PMP22 gene in the genome include deleting all or part of the ORF of the PMP22 gene, deleting all or part of the transcriptional regulatory region of the PMP22 gene, and deleting all or part of the ORF of the PMP22 gene and then deleting all or part of the transcriptional regulatory region of the PMP22 gene, preferably deleting the entire ORF of the PMP22 gene. Examples of modifying the size of the expression product from the PMP22 gene in the genome include reducing the size of the expression product from the PMP22 gene in the genome. Examples of reducing the size of the expression product from the PMP22 gene in the genome include introducing a nonsense mutation into the PMP22 gene in the genome.

[0022] Examples of editing the PMP22 gene in the target genome include editing one copy of the PMP22 gene in the target genome, editing two copies of the PMP22 gene in the target genome, or editing three copies of the PMP22 gene in the target genome, preferably editing one copy of the PMP22 gene in the target genome. Examples of editing the PMP22 gene in the target genome include deleting one copy of the PMP22 gene in the target genome, deleting two copies of the PMP22 gene in the target genome, or deleting three copies of the PMP22 gene in the target genome, preferably deleting one copy of the PMP22 gene in the target genome.

[0023] The agent for editing the PMP22 gene in the genome of a subject preferably includes an agent for cleaving a first predetermined position in the genome of a subject and an agent for cleaving a second predetermined position in the genome of a subject. Here, the first predetermined position in the genome of a subject is different from the second predetermined position in the genome of a subject. The first predetermined position in the genome of a subject and the second predetermined position in the genome of a subject are preferably present on the same chromosome. The first predetermined location in the subject's genome is located, for example, at least 10 bases, at least 100 bases, at least 1,000 bases, at least 10,000 bases, at least 100,000 bases, at least 200,000 bases, at least 300,000 bases, at least 400,000 bases, at least 500,000 bases, at least 600,000 bases, at least 700,000 bases, at least 800,000 bases, at least 900,000 bases, at least 1,000,000 bases, at least 1,100,000 bases, at least 1,200,000 bases, at least 1,300,000 bases, or at least 1,400,000 bases from the second predetermined location in the subject's genome. The first predetermined location in the subject's genome is located, for example, 100,000,000 bases or less, 10,000,000 bases or less, 9,000,000 bases or less, 8,000,000 bases or less, 7,000,000 bases or less, 6,000,000 bases or less, 5,000,000 bases or less, 4,000,000 bases or less, 3,000,000 bases or less, 2,000,000 bases or less, 1,900,000 bases or less, 1,800,000 bases or less, 1,700,000 bases or less, or 1,600,000 bases or less from the second predetermined location in the subject's genome.

[0024] For example, the first predetermined position in the subject's genome is located upstream of the PMP22 gene in the subject's genome, and the second predetermined position in the subject's genome is located downstream of the PMP22 gene in the subject's genome. Examples of the first predetermined position in the subject's genome being located upstream of the PMP22 gene in the subject's genome and the second predetermined position in the subject's genome being located downstream of the PMP22 gene in the subject's genome include the first predetermined position in the subject's genome being located upstream of the ORF of the PMP22 gene in the subject's genome and the second predetermined position in the subject's genome being located downstream of the ORF of the PMP22 gene in the subject's genome, as well as the first predetermined position in the subject's genome being located upstream of the transcriptional regulatory region of the PMP22 gene in the subject's genome and the second predetermined position in the subject's genome being located downstream of the transcriptional regulatory region of the PMP22 gene in the subject's genome. Here, examples of the first predetermined position in the target genome being located upstream of the transcriptional regulatory region of the PMP22 gene in the target genome include, for example, the first predetermined position in the target genome being located upstream of all transcriptional regulatory regions of the PMP22 gene in the target genome, as well as upstream of a portion of the transcriptional regulatory region of the PMP22 gene in the target genome. Examples of the second predetermined position in the target genome being located downstream of the transcriptional regulatory region of the PMP22 gene in the target genome include, for example, the second predetermined position in the target genome being located downstream of all transcriptional regulatory regions of the PMP22 gene in the target genome, as well as downstream of a portion of the transcriptional regulatory region of the PMP22 gene in the target genome. After cleaving the genomic DNA at the upstream first predetermined position and the downstream second predetermined position, the DNA ends of the first and second predetermined positions are ligated, resulting in the deletion of the region between the first and second predetermined positions.

[0025] The agent for cleaving a first predetermined position in the genome of a subject may also be an agent for cleaving a second predetermined position in the genome of a subject. That is, the predetermined agent may be an agent for cleaving a first predetermined position in the genome of a subject, and also an agent for cleaving a second predetermined position in the genome of a subject. In this case, treatment of the subject of the present invention with the agent for treating Charcot-Marie-Tooth disease can be easily performed.

[0026] The agent for editing the PMP22 gene in a target genome preferably includes a substance for binding an enzyme that cleaves a specific location in the genome to that specific location. Examples of substances for binding an enzyme that cleaves a specific location in the genome include nucleic acids such as RNA (e.g., RNA commonly referred to as guide RNA or gRNA), as well as proteins with DNA-binding domains. The RNA used to bind an enzyme that cleaves a specific location in the genome to that specific location is preferably a guide RNA in a CRISPR-Cas system. For example, in a type II CRISPR-Cas system, the Cas9 nuclease responsible for double-strand cleavage is guided to the target sequence by a guide RNA (a complex of crRNA and tracrRNA or a single-stranded version of these, called sgRNA), and the Cas9-RNA complex cleaves the DNA sequence complementary to the guide RNA. In a type V CRISPR-Cas system, the RNA-dependent DNA nuclease Cpf1 is used. The guide RNA in a type V CRISPR-Cas system consists solely of crRNA. Proteins having a DNA-binding domain that serve as substances for binding an enzyme that cleaves a specific location in the genome to that specific location in the genome include zinc fingers and TALEs.

[0027] Examples of enzymes that cleave a specific site in the genome include Cas9 of the CRISPR-Cas system, as well as nucleases containing a DNA cleavage domain such as FokI. Examples of Cas9 include SaCas9.

[0028] The agent for editing the PMP22 gene in the genome of a subject preferably comprises an enzyme that cleaves a predetermined position in the genome. The agent for editing the PMP22 gene in the genome of a subject preferably comprises an enzyme that cleaves a predetermined position in the genome, as well as a substance for binding the enzyme that cleaves a predetermined position in the genome to the predetermined position in the genome.

[0029] The therapeutic agent for Charcot-Marie-Tooth disease of the present invention preferably contains a substance for producing a substance for binding an enzyme that cleaves a specific site in the genome to a specific site in the genome. The substance for producing a substance for binding an enzyme that cleaves a specific site in the genome to a specific site in the genome is, for example, a vector for expressing a substance for binding an enzyme that cleaves a specific site in the genome to a specific site in the genome in a target cell. Examples of the vector include viral vectors such as adeno-associated virus vectors (AAV vectors).

[0030] The therapeutic agent for Charcot-Marie-Tooth disease of the present invention preferably contains a substance for producing an enzyme that cleaves a specific site in the genome. The substance for producing the enzyme that cleaves a specific site in the genome is, for example, a vector for expressing the enzyme that cleaves a specific site in the genome in the target cells. Examples of the vector include viral vectors such as adeno-associated virus vectors (AAV vectors).

[0031] The substance for producing an enzyme that cleaves a predetermined position in the genome is preferably a substance for producing a substance for binding an enzyme that cleaves a predetermined position in the genome to a predetermined position in the genome. That is, the predetermined substance may be both a substance for producing an enzyme that cleaves a predetermined position in the genome and a substance for producing a substance for binding an enzyme that cleaves a predetermined position in the genome to a predetermined position in the genome. For example, the predetermined vector may be a vector for expressing in a subject's cells a substance for binding an enzyme that cleaves a predetermined position in the genome to a predetermined position in the genome, and a vector for expressing in a subject's cells the enzyme that cleaves a predetermined position in the genome. In this case, treatment with the agent for treating Charcot-Marie-Tooth disease, which is the subject of the present invention, can be easily performed.

[0032] The substance for binding an enzyme that cleaves a predetermined site in the genome to a predetermined site in the genome is preferably RNA comprising the sequence set forth in any one of SEQ ID NOs: 1 to 5, or RNA comprising a sequence having 10 or fewer deletions, substitutions, or insertions from the sequence set forth in any one of SEQ ID NOs: 1 to 5, RNA comprising the sequence set forth in any one of SEQ ID NOs: 19 to 23, or RNA comprising a sequence having 20 or fewer deletions, substitutions, or insertions from the sequence set forth in any one of SEQ ID NOs: 19 to 23, or RNA comprising a sequence set forth in any one of SEQ ID NOs: 25 to 29, or RNA comprising a sequence having 5 or fewer deletions, substitutions, or insertions from the sequence set forth in any one of SEQ ID NOs: 25 to 29. These sequences may also include the sequence set forth in SEQ ID NO: 24, or a sequence having 10 or fewer deletions, substitutions, or insertions from the sequence set forth in SEQ ID NO: 24. Examples of sequences having 10 or fewer deletions, substitutions, or insertions from the sequence set forth in SEQ ID NO:24 include sequences having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 deletions, substitutions, or insertions from the sequence set forth in SEQ ID NO:24.

[0033] The substance for binding an enzyme that cleaves a predetermined site in the genome to a predetermined site in the genome is preferably RNA consisting of the sequence set forth in any one of SEQ ID NOs: 1 to 5, or RNA consisting of a sequence set forth in any one of SEQ ID NOs: 1 to 5 with 10 or fewer deletions, substitutions, or insertions; RNA consisting of the sequence set forth in any one of SEQ ID NOs: 19 to 23, or RNA consisting of a sequence set forth in any one of SEQ ID NOs: 19 to 23 with 20 or fewer deletions, substitutions, or insertions; or RNA consisting of the sequence set forth in any one of SEQ ID NOs: 25 to 29, or RNA consisting of a sequence set forth in any one of SEQ ID NOs: 25 to 29 with 5 or fewer deletions, substitutions, or insertions. RNA consisting of these sequences may be part of another RNA. These sequences may be part of RNA comprising the sequence set forth in SEQ ID NO: 24, or a sequence set forth in SEQ ID NO: 24 with 10 or fewer deletions, substitutions, or insertions. Examples of sequences having 10 or fewer deletions, substitutions, or insertions from the sequence set forth in SEQ ID NO:24 include sequences having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 deletions, substitutions, or insertions from the sequence set forth in SEQ ID NO:24.

[0034] Examples of sequences having 10 or fewer deletions, substitutions, or insertions from the sequence set forth in any one of SEQ ID NOs: 1 to 5 include sequences having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 deletions, substitutions, or insertions from the sequence set forth in any one of SEQ ID NOs: 1 to 5. Examples of sequences having 20 or fewer deletions, substitutions, or insertions from the sequence set forth in any one of SEQ ID NOs: 19 to 23 include sequences having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 deletions, substitutions, or insertions from the sequence set forth in any one of SEQ ID NOs: 19 to 23. Examples of RNAs containing a sequence having five or fewer deletions, substitutions, or insertions from the sequence set forth in any one of SEQ ID NOs: 25 to 29 include sequences having one, two, three, four, or five deletions, substitutions, or insertions from the sequence set forth in any one of SEQ ID NOs: 25 to 29.

[0035] When the substance for binding an enzyme that cleaves a predetermined position in the genome to the predetermined position in the genome is RNA, the RNA may be, for example, 15 or more bases, 16 or more bases, 17 or more bases, 18 or more bases, 19 or more bases, 20 or more bases, 21 or more bases, 22 or more bases, 23 or more bases, 24 or more bases, 25 or more bases, 26 or more bases, 27 or more bases, 28 or more bases, 29 or more bases, 30 or more bases, 31 or more bases, 32 or more bases, 33 or more bases, 34 or more bases, 35 or more bases, 36 or more bases, 37 or more bases, 38 or more bases, 39 or more bases, 40 or more bases, 41 or more bases, 42 or more bases, 43 or more bases, 44 or more bases, 45 or more bases, 46 or more bases, 47 or more bases, 48 ​​or more bases, 49 or more bases, 50 or more bases, 51 or more bases, 52 or more bases, 53 or more bases, 54 or more bases, 55 or more bases, 56 or more bases, 57 or more bases, 58 or more bases, 59 or more bases, 60 or more bases, 61 or more bases, 62 or more bases, 63 or more bases, 64 or more bases, 65 or more bases, 66 or more bases, 67 or more bases, 68 or more bases, 69 or more bases, 70 or more bases, 71 or more bases, 72 or more bases, 73 or more bases, 74 or more bases, 75 or more bases, 76 or more bases, 77 or more bases or more, 78 bases or more, 79 bases or more, 80 bases or more, 81 bases or more, 82 bases or more, 83 bases or more, 84 bases or more, 85 bases or more, 86 bases or more, 87 bases or more, 88 bases or more, 89 bases or more, 90 bases or more, 91 bases or more, 92 bases or more, 93 bases or more, 94 bases or more, 95 bases or more, 96 bases or more, 97 bases or more, 98 bases or more, 99 bases or more, or 100 bases or more, for example, 130 bases or less, 129 bases or less, 128 bases or less, 127 bases or less, 126 bases or less, 125 bases or less, 124 bases or less, 123 bases or less, 122 bases or less, 121 bases or more, bases or less, 120 bases or less, 119 bases or less, 118 bases or less, 117 bases or less, 116 bases or less, 115 bases or less, 114 bases or less, 113 bases or less, 112 bases or less, 111 bases or less, 110 bases or less, 109 bases or less, 108 bases or less, 107 bases or less, 106 bases or less, 105 bases or less, 104 bases or less, 103 bases or less, 102 bases or less, 101 bases or less, 100 bases or less, 99 bases or less, 98 bases or less, 97 bases or less, 96 bases or less, 95 bases or less, 94 bases or less, 93 bases or less, 92 bases or less, 91 bases or less, 90 bases or less, 89 bases or less,88 bases or less, 87 bases or less, 86 bases or less, 85 bases or less, 84 bases or less, 83 bases or less, 82 bases or less, 81 bases or less, 80 bases or less, 79 bases or less, 78 bases or less, 77 bases or less, 76 bases or less, 75 bases or less, 74 bases or less, 73 bases or less, 72 bases or less, 71 bases or less, 70 bases or less, 69 bases or less, 68 bases or less, 67 bases or less, 66 bases or less, 65 bases or less, 64 bases or less, 63 bases or less, 62 bases or less, 61 bases or less, 60 bases or less, 59 bases or less, 58 bases or less, 57 bases or less, 56 bases 5 bases or less, 55 bases or less, 54 bases or less, 53 bases or less, 52 bases or less, 51 bases or less, 50 bases or less, 49 bases or less, 48 ​​bases or less, 47 bases or less, 46 bases or less, 45 bases or less, 44 bases or less, 43 bases or less, 42 bases or less, 41 bases or less, 40 bases or less, 39 bases or less, 38 bases or less, 37 bases or less, 36 bases or less, 35 bases or less, 34 bases or less, 33 bases or less, 32 bases or less, 31 bases or less, 30 bases or less, 29 bases or less, 28 bases or less, 27 bases or less, 26 bases or less, or 25 bases or less.

[0036] The agent for editing the PMP22 gene in a subject's genome preferably comprises a guide RNA that recognizes both a first predetermined location in the subject's genome and a second predetermined location in the subject's genome, and an enzyme that forms a complex with the guide RNA and cleaves genomic DNA, wherein the guide RNA and the enzyme are preferably expressed from the same AAV vector.

[0037] As shown in the Examples below, a therapeutic agent for Charcot-Marie-Tooth disease in a subject, containing as an active ingredient a drug for editing the PMP22 gene in the genome of the subject, can be administered to the subject to treat the subject's Charcot-Marie-Tooth disease. Examples of Charcot-Marie-Tooth disease include type 1 Charcot-Marie-Tooth disease, and examples of type 1 Charcot-Marie-Tooth disease include type 1A Charcot-Marie-Tooth disease. Examples of treating Charcot-Marie-Tooth disease in a subject include treating Charcot-Marie-Tooth disease in a subject and preventing Charcot-Marie-Tooth disease in a subject. Examples of treating Charcot-Marie-Tooth disease in a subject include completely curing Charcot-Marie-Tooth disease in a subject and alleviating the symptoms of Charcot-Marie-Tooth disease in a subject.

[0038] The therapeutic agent for Charcot-Marie-Tooth disease provided by the present invention may contain, for example, a pharmaceutically acceptable carrier and additive. The pharmaceutically acceptable carrier or additive is not particularly limited and can be appropriately selected depending on the dosage form, etc., and may include any carrier, diluent, excipient, suspending agent, lubricant, adjuvant, vehicle, delivery system, emulsifier, disintegrant, absorbent, preservative, surfactant, colorant, flavoring, or sweetener. The dosage form of the therapeutic agent for Charcot-Marie-Tooth disease provided by the present invention is not particularly limited and can be appropriately selected depending on the desired administration method, and examples include injections (solutions, suspensions, solid preparations for dissolution before use, etc.), solid preparations (tablets, capsules, suppositories, powders, etc.), etc. Injectable preparations can be prepared by adding, for example, a pH adjuster, buffer, stabilizer, isotonicity agent, local anesthetic, etc. to the composition, and then administering them subcutaneously, intraarticularly, intramuscularly, intravenously, etc., according to standard methods. Examples of pH adjusters and buffers include sodium citrate, sodium acetate, and sodium phosphate. Examples of stabilizers include sodium pyrosulfite, EDTA, thioglycolic acid, and thiolactic acid. Examples of isotonicity agents include sodium chloride and glucose. Examples of local anesthetics include procaine hydrochloride and lidocaine hydrochloride. Solid preparations may be enteric-coated. The agent for treating Charcot-Marie-Tooth disease provided by the present invention may be prepared as a liquid or solid preparation and may be formulated into various dosage forms, such as injections, jellies, sprays, tablets, and granules. When prepared as a liquid preparation, sterile water, physiological saline, aqueous glucose solution, and the like may be used as a carrier, and, if desired, a bactericide, an isotonicity agent, a stabilizer, and the like may be further added. When prepared as a solid preparation, additives such as starch, lactose, mannitol, and inorganic salts may be added, and, if desired, binders, disintegrants, lubricants, and the like may be further added.

[0039] The therapeutic agent for Charcot-Marie-Tooth disease provided by the present invention may be administered by any administration method appropriate for the dosage form, for example, oral administration, intravenous administration, subcutaneous administration, transdermal administration, intramuscular administration, intra-articular administration, nasal administration, intraperitoneal administration, direct injection into target tissue, inhalation administration, enteral administration, enema administration, tube feeding, etc. The dosage of the therapeutic agent for Charcot-Marie-Tooth disease provided by the present invention may vary depending on the age, weight, health condition, etc. of the subject. The therapeutic agent for Charcot-Marie-Tooth disease provided by the present invention may be administered once per day or multiple times per day, and the administration frequency can be, for example, 1 to 100 times per month.

[0040] The present invention provides a method for treating Charcot-Marie-Tooth disease in a subject, comprising administering to the subject as an active ingredient an agent for editing the PMP22 gene in the subject's genome. Examples of administering to the subject as an active ingredient an agent for editing the PMP22 gene in the subject's genome include administering to the subject a substance for producing an agent for editing the PMP22 gene in the subject's genome. For example, if the agent for editing the PMP22 gene in the subject's genome includes a substance for binding an enzyme that cleaves a specific site in the genome to the specific site in the genome, the substance for producing the agent for editing the PMP22 gene in the subject's genome includes a substance for producing a substance for binding an enzyme that cleaves a specific site in the genome to the specific site in the genome, such as a vector for expressing in the subject's cells a substance for binding the enzyme that cleaves a specific site in the genome to the specific site in the genome. Furthermore, for example, when a drug for editing the PMP22 gene in the genome of a subject contains an enzyme that cleaves a specific position in the genome, substances for producing the drug for editing the PMP22 gene in the genome of a subject include substances for producing an enzyme that cleaves a specific position in the genome, such as a vector for expressing the enzyme that cleaves a specific position in the genome in the cells of the subject.

[0041] The present invention further provides a method for treating Charcot-Marie-Tooth disease, comprising delivering to a subject in need thereof an agent for editing the PMP22 gene in the subject's genome, wherein the agent for editing the PMP22 gene in the subject's genome comprises a guide RNA that recognizes both a first predetermined position in the subject's genome and a second predetermined position in the subject's genome, and an enzyme that forms a complex with the guide RNA and cleaves genomic DNA, thereby deleting one copy of the duplicated PMP22 gene in the subject's genome. The guide RNA and the enzyme may be expressed from the same AAV vector, and delivery may be achieved by administering the AAV vector to the subject.

[0042] The present invention provides a pharmaceutical composition for use in treating Charcot-Marie-Tooth disease in a subject, the composition comprising an agent for editing the PMP22 gene in the genome of the subject as an active ingredient.

[0043] The present invention provides the use of an agent for editing the PMP22 gene in a subject's genome, and the use of a material for producing an agent for editing the PMP22 gene in a subject's genome, in the manufacture of a pharmaceutical composition for use in treating Charcot-Marie-Tooth disease in a subject.Here, for example, when the agent for editing the PMP22 gene in a subject's genome comprises a material for binding an enzyme that cleaves a predetermined position in the genome to a predetermined position in the genome, the material for producing an agent for editing the PMP22 gene in a subject's genome includes a material for binding an enzyme that cleaves a predetermined position in the genome to a predetermined position in the genome, such as a vector for expressing in a subject's cells a material for binding an enzyme that cleaves a predetermined position in the genome to a predetermined position in the genome.Furthermore, for example, when the agent for editing the PMP22 gene in a subject's genome comprises an enzyme that cleaves a predetermined position in the genome, the material for producing an agent for editing the PMP22 gene in a subject's genome includes a material for producing an enzyme that cleaves a predetermined position in the genome, such as a vector for expressing in a subject's cells an enzyme that cleaves a predetermined position in the genome.

[0044] Methods: sgRNA design and selection: To target the PMP22 genomic region, we designed a series of sgRNAs by inserting the region between STR polymorphism genetic markers D17S261 and D17S122 (sgRNA region: 15360587–15398063)

[26] into Cas-OFFinder (www.rgenome.net / cas-offinder). This region is located outside the proximal CMT1A-REP (15575936–15587412), distal CMT1A-REP (14179212–14190596), and PMP22 genes (15229777–15265357). The following five sequences were selected and subcloned into the BsaI site of the pX601 vector (Addgene Plasmid #61591) after appending the specific SaCas9 protospacer adjacent motif (PAM) sequence: CMT1AsgRNA1-f: CACCGATATCACTCTCATGACTAGTT (SEQ ID NO: 1) CMT1AsgRNA2-f: CACCGGGCCCAAGGTCTAATTTACAT (SEQ ID NO: 2) CMT1AsgRNA3-f: CACCGCTGAAAGCATAGTTAGGAAGA (SEQ ID NO: 3) CMT1AsgRNA4-f: CACCGAACAGGGAAACAAACAGTGGG (SEQ ID NO: 4) CMT1AsgRNA5-f: CACCGAGAACTGAAAGCATAGTTAGG (SEQ ID NO: 5) Plasmid sequences were verified by sequencing primers. pX601-sequencing: GAGGTACCTGAGGGCCTATT (SEQ ID NO: 6) The full-length sequence including the spacer (21 nt) and scaffold (76 nt) is shown below.CMT1AsgRNA1-f: CACCGATATCACTCTCATGACTAGTTGTTTTAGTACTCTGGAAACAGAATCTACTAAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGA (SEQ ID NO: 19) CMT1AsgRNA2-f: CACCGGGCCCAAGGTCTAATTTACATGTTTTAGTACTCTGGAAACAGAATCTACTAAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGA (SEQ ID NO: 20) CMT1AsgRNA3-f: CACCGCTGAAAGCATAGTTAGGAAGAGTTTTAGTACTCTGGAAACAGAATCTACTAAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGA (SEQ ID NO: 21) CMT1AsgRNA4-f: CACCGAACAGGGAAACAAACAGTGGGGTTTTAGTACTCTGGAAACAGAATCTACTAAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGA (SEQ ID NO: 22) CMT1AsgRNA5-f: CACCGAGAACTGAAAGCATAGTTAGGGTTTTAGTACTCTGGAAACAGAATCTACTAAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGA (SEQ ID NO: 23) Of these, the sequence of the scaffold (76 nt) is shown below: GTTTTAGTACTCTGGAAACAGAATCTACTAAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGA (SEQ ID NO: 24) Of these, the sequence of the spacer (21 nt) is shown below.CMT1AsgRNA1-f: ATATCACTCTCATGACTAGTT (SEQ ID NO: 25) CMT1AsgRNA2-f: GGCCCAAGGTCTAATTTACAT (SEQ ID NO: 26) CMT1AsgRNA3-f: CTGAAAGCATAGTTAGGAAGA (SEQ ID NO: 27) CMT1AsgRNA4-f: AACAGGGAAACAAACAGTGGG (SEQ ID NO: 28) CMT1AsgRNA5-f: AGAACTGAAAGCATAGTTAGG (SEQ ID NO: 29) The first sequence of the full-length sequence is CACCG (SEQ ID NO: 30).

[0045] For the final selection from five gRNA candidates, the genome editing efficiency of CRISPR-SaCas9, expressed as the InDel mutation rate, was determined using the T7E1 mismatch detection assay

[27] . To calculate the percent cleavage efficiency of the CRISPR locus, the intensities of the PCR amplicon band and the digested band were measured using Image J (http: / / imagej.nih.gov / ij / , National Institutes of Health), and the % InDel was calculated using the following formula

[28] :

[0046] AAV Construction: AAV2 was used in this study because it is considered one of the most efficient serotypes for transducing human Schwann cells

[29] . AAV particles were generated using the AAV helper-free system (Agilent Technologies, Santa Clara, CA, USA, Cat. No. 240071). Recombinant AAV vectors were generated by transient transfection of HEK293 cells with vector plasmids AAV2 Rep and AAV2 Cap expression plasmids and the adenovirus helper plasmid pHelper. To verify AAV infection efficiency in Schwann cells, the S16 rat Schwann cell line was transfected at 4 x 10 3 Cells were seeded in an 8-well glass chamber at 2.2 x 10 cells / well. AAV1 virus containing the CAG promoter and EGF (AAV1-CAG-EGF, 2.2 x 10 cells / well) was used. 11Cells were infected with 1000 μg / mL of HIV-1 at an MOI of 5,000, 10,000, 20,000, 50,000, 100,000, or 200,000 and incubated for 24, 48, 72, 96, 120, and 144 hours.

[0047] iPSC Schwann Cell Differentiation: 201B7 iPSCs and HPS0426 PMP22 overlap iPSCs were differentiated as previously described

[30] . Briefly, 6-well plates were coated with Matrigel GFR diluted 1:20 in DMEM / F12 for 1 hour at room temperature. On day 0, iPSCs were cultured at 2 x 10 in Stemfit medium containing the ROCK inhibitor Y-27632. 5Cells were seeded at 1000 cells / well. The next day, the medium was changed to neural differentiation medium containing 1:1 DMEM / F12:Neurobasal medium containing 1xN2, 1xB27, 0.005% BSA, 2 mM GlutaMAX, 0.11 mM β-mercaptoethanol, 3 μM CHIR, and 20 μM SB. After 6 days, cells reached 80–90% confluence and were cultured in equal volumes of DMEM / F12 medium (#11320033 Gibco) and Neurobasal medium (#21103049 Thermo Fisher Scientific), neuroblastoma growth and expression supplement (N2, #17502-048 Thermo Fisher Scientific), neuronal cell culture supplement (B27 #17504044 Thermo Fisher Scientific), 0.005% BSA (bovine serum albumin), 2 mM GlutaMAX (#35050061 Thermo Fisher Scientific), 0.11 mM β-mercaptoethanol (#21985023 Gibco), 3 μM GSK3 inhibitor (CHIR99021, #252917-06-9 Tocris Bioscience), 20 μM TGF-β inhibitor (SB431542, #13031 Cayman), and 50 ng / mL The cells were then ready for the first passage into Schwann cell precursor differentiation medium containing neuregulin 1 (NRG1, #396-HB-050 R&D Systems). After 18 days, the medium was changed to Schwann cell differentiation medium containing low-glucose DMEM, 1% FBS, 200 ng / mL NRG1, 4 μM forskolin (#F6886-10MG Sigma), 100 nM RA, and 10 ng / mL PDGF-BB. The medium was changed daily for 4 days.

[0048] The cells were then incubated in Schwann cell differentiation medium without FK or RA for 2 days. PDGF-BB was then removed, and the cells were incubated in low-glucose DMEM (1 mg / mL), 1% FBS, and 200 ng / mL NRG1 (Neuregulin #396-HB-050 R&D Systems). Immunohistochemistry was performed to verify the expression of Schwann cell markers in the differentiated cells.

[0049] Cells were infected with AAV at day 1 after iPSC culture initiation (day 1), day 26 after initiation of differentiation into Schwann cell precursors (day 26), and day 43 after differentiation into Schwann cells. Each AAV was used at an MOI of 10,000. DNA from infected cells was collected on day 50, and genome editing efficiency was measured using qPCR.

[0050] CMT1A editing: AAV infection of CMT1A-iPSCs was performed as follows: 12-well plates were coated with Matrigel and CMT1A iPSCs (7.5 x 10 4 Four wells contained cells without virus, four wells were infected with AAV encoding a control gRNA (AAV2-hSaCas9-gRNAcont, MOI 10,000), and four wells were infected with AAV2-hSaCas9-gRNAedit at MOI 10,000. One week later, PCR and nested qPCR of the AAV-ITR were performed, respectively, to determine the efficiency of AAV infection and genome editing.

[0051] Primers from Riken and Addgene were used for AAV-ITR PCR. Riken: 5'-GAGTGGCCAACTCCATCACTAGGGGTTCCT-3' (SEQ ID NO: 7). Addgene: fwd ITR primer 5'-GGAACCCCTAGTGATGGAGTT (SEQ ID NO: 8) / rev ITR primer 5'-CGGCCTCAGTGAGCGA (SEQ ID NO: 9). AAV-ITR PCR was performed using LA Taq at 94°C for 1 minute, 35 cycles of 94°C for 1 minute, 64°C for 30 seconds, and 72°C for 3 minutes, with a final cycle of 72°C for 7 minutes.

[0052] Nested qPCR was performed according to the human Taqman copy number assay (ThermoFisher). The probe sequences are as follows: CMT1A Tqm: 6FAM-AAGAAGAATCGTGGGCACACCACCA-TAMRA (SEQ ID NO: 10). Primers for primary PCR of CMT1A recombination sites are as follows: CMT1A PR1: TGATATTTAAAGATTTCATGTC (SEQ ID NO: 11). CMT1A DF1: GGATTCAGAGACATTAGTGTTCC (SEQ ID NO: 12). The product from the first PCR was digested with ExoI (NEB). Primers designed for secondary PCR of CMT1A recombination sites are as follows: CMT1A PR2: CATGTCATTAGACCAAAGAaC (SEQ ID NO: 13). CMT1A DF2: AGAAACATACTAGTTGATATCTTCTaT (SEQ ID NO: 14). RNase P (VIC-TAMRA) was used as an internal control. Both PCR assays were performed using Platinum Taq (TAKARA).

[0053] The signal intensity of the bands on the agar gel was measured using Image J software (http: / / imagej.nih.gov / ij / , National Institutes of Health, USA). Quantification of the hybrid area was performed according to the following formula: Hybrid relative quantification = (2 - [hybrid - internal control] AAV-treated) / (2 - [hybrid - internal control] untreated).

[0054] Southern blot analysis: For probe labeling, genomic DNA prepared from normal iPSCs was used in PCR (KOD Fx Neo) using the following primers: CMT1a_Probe-Fw1: AAGAAGAAATCGTGGGCACAC (SEQ ID NO: 15) CMT1a_Probe-Rv1: AGTGCAAACCATGATCACCC (SEQ ID NO: 16). The PCR product was purified using a Favorgen kit and labeled with DIG-DNA labeling (Roche DIG labeling). Southern blots were performed using 5 μg of iPSC genomic DNA digested with EcoRI and SacI, electrophoresed on a 0.8% agarose gel, treated with 0.25 N HCl for depurination, and cleaved by alkali treatment. DNA was transferred from the agarose gel to a membrane (Hybond-N, RPN303 N, GE Healthcare, Chicago, IL, USA) at room temperature for 20 hours. Prehybridization of the blotted membrane was performed using DIG Easy Hyb, and hybridization was carried out at 42°C for 20 h by adding DIG-labeled DNA probe (35 ng / mL).

[0055] Immunocytochemistry: Cells were fixed with 4% formaldehyde for 10 min at 25°C and permeabilized with 0.1% Triton X-100 in PBS for 5 min at 25°C. After blocking with 10% fetal bovine serum (#10270106, Gibco, MA, USA) for 30 min at 25°C, cells were incubated with primary antibodies for 16 h at 4°C and secondary antibodies for 1 h at 25°C. The antibodies were as follows: rabbit anti-S100B antibody (1:500, ab52642, abcam, Cambridge, UK), goat anti-Sox10 antibody (1:100, sc-17342, Santa Cruz Biotechnology, Dallas, TX, USA), mouse anti-myelin basic protein antibody (1:200, ab62631, abcam, Cambridge, UK), rabbit anti-MAP2 (1:100, sc-32791, Santa Cruz Biotechnology, Dallas, TX, USA), rabbit anti-PMP22 (1:500, abcam, Cambridge, UK), Alexa Fluor 647 anti-MAP2 antibody (1:500, ab225315, abcam, Cambridge, UK), Alexa Fluor 488-conjugated anti-rabbit IgG (1:1000, #A21206, Molecular Probes, Eugene, OR, USA), and Alexa Fluor 568-conjugated anti-mouse IgG (1:1000, #A10037, Molecular Probes, Eugene, OR, USA) and Cy3-conjugated anti-mouse IgG (1:500, 705-165-003, Jackson Laboratory, Bar Harbor, ME, USA). Images were taken using a confocal microscope (Olympus FV1200IX83, Tokyo, Japan).

[0056] Western blot analysis: Cells were scraped and collected in PBS. After centrifugation (1500 rpm, 5 min), the cell pellet was dissolved in sample buffer (25 mM Tris-HCl pH 6.5, 5% glycerol, 1% SDS, 1% mercaptoethanol, and 0.05% BPB) and heated at 100°C for 5 min. Samples were electrophoresed by SDS-PAGE, and the gel was transferred to an Immobileon-P polyvinylidene difluoride membrane (Millipore, Burlington, MA, USA) using semi-dry transfer and blocked with 7.5% milk in TBST (10 mM Tris-HCl pH 8.0, 150 mM NaCl, 0.05% Tween-20). The membrane was then incubated with mouse anti-PMP22 antibody (1:200, sc-515199, Santa Cruz Biotechnology, Dallas, TX, USA) for 3 hours, followed by mouse anti-GAPDH antibody (1:3000, MAB374, Sigma-Aldrich, St. Louis, MO, USA) for 1 hour at 25°C. It was then incubated with HRP-conjugated anti-mouse IgG (1:5000, NA931, GE Healthcare, Buckinghamshire, UK) for 1 hour at 25°C. Proteins were detected using ECL Select Western Blotting Detection Reagent (RPN2235, GE Healthcare, Chicago, IL, USA) and a luminescence image analyzer (ImageQuant LAS 500, GE Healthcare, Chicago, IL, USA).

[0057] Electron microscopy: Cocultures of iPSC-derived neurons and iPSC-derived Schwann cells were prefixed with 2.5% glutaraldehyde in 0.1 M phosphate buffer at 4°C for 2 hours and postfixed with 1% osmium tetroxide at 4°C for 2 hours. After fixation, cells were dehydrated through a graded series of ethanol and embedded in Epon at 60°C for 48 hours and 120°C for 24 hours. Ultrathin sections (80 nm) were cut with an ultramicrotome (US6, Leica, Wetzlar, Germany) and incubated with uranyl acetate and lead citrate. Sections for immunoelectron microscopy were incubated in blocking buffer (1% BSA in PBS) at 25°C for 1 hour and stained with rabbit anti-Crispr-Cas9 antibody (1:25, ab203933, Abcam, Cambridge, UK) for 16 hours. They were incubated with anti-IgG (H + L), rabbit, goat poly, gold 10 nm, EM (1:200, EMGAR10, BBI Solutions, Wales, UK), and anti-IgG (H + L) at 4°C for 2 hours at 25°C. Ultrathin sections were observed by electron microscopy (JEM-1400, JEOL, Tokyo, Japan).

[0058] Whole genome sequencing: To assess the off-target effects of genome-editing vectors in vitro, genomic DNA was extracted from control and genome-edited iPS cells according to the protocol described above. To assess the off-target effects of intraneuronal injection of genome-editing vectors in vivo, 6 x 1010 vg of AAV2-hSaCas9-gRNAedit was injected into the sciatic nerve of three 3-month-old C57 / BL6 mice, and the injected tissues were dissected 4 weeks later. Genomic DNA was extracted from iPS cells and tissues from AAV-injected or uninjected control mice using the FavorPrep Tissue Genomic DNA Extraction Mini Kit (FATGK001, FAVORGEN, Pingtung City, Taiwan). Whole genome sequencing (WGS) was performed on an Illumina NovaSeq 6000 equipped with Truseq DNA Nano from Rhelixa (Tokyo, Japan) using 150 bp × 2 paired-end (PE150), 90 Gb / sample, and 600 M reads per sample (300 M pairs).

[0059] The acquired data were analyzed using the HaplotypeCaller function in the Genome Analysis Toolkit (GATK, v4.2.3.0). The results were annotated using the Ensembl Variant Effect Predictor (VEP) (https: / / asia.ensembl.org / info / docs / tools / vep / index.html)

[31] to identify known and unknown SNPs that differed from databases (human iPS cells: dbSNP, C57 / BL6 mice: Ensembl variation). The original SNPs found in uninfected controls were further excluded to identify candidate SNPs for novel mutations induced by genome editing. Genomic regions duplicated in human CMT1A iPS cells were identified from the increased WGS reads. To visualize the increased reads, read depth was calculated from the WGS data using IGVTools (Broad Institute, v2.5.3).

[0060] TOPO subcloning and Sanger sequencing were performed according to the protocol (https: / / www.thermofisher.com / jp / ja / home / life-science / genome-editing / genomeediting-learning-center / genome-editing-resource-library / genome-editing-application-notes / sanger-sequencing-facilitate-crispr-talen-mediated-genome-editing-workflows.html). Genomic DNA prepared from CMT1A-iPSCs 2 weeks after AAV2-hSaCas9-gRNAedit infection was amplified with junction 4F (TGGATGGTGGTAGGTATCATTCA) (SEQ ID NO: 17) and junction 4R (TGGGGCACATGAGATATTTTGG) (SEQ ID NO: 18) primers. The amplified DNA fragment was subcloned into pCR®4-Blunt TOPO®, and 1,000 clones were sequenced by the Sanger method at Eurofins Genomics (Tokyo, Japan). The sequence data were analyzed using BLAST on the supercomputer SHIROKANE (Institute of Medical Science, The University of Tokyo).

[0061] Karyotype analysis: G-banding was performed to determine the karyotype of the iPSC lines. Twenty metaphase plates were analyzed.

[0062] Statistics: Statistical analysis of biological experiments was performed using Graphpad Prism 8. Biological data that follow a normal distribution are presented as mean ± SEM using Tukey's HSD test for comparisons of multiple groups or Welch's t-test for comparisons of two groups. The distribution of observed data is presented in box plots, with data also plotted as points. The box plots display the median, quartiles, and whiskers to represent data outside the 25th to 75th percentile range. Data that do not follow a normal distribution are examined by Wilcoxon rank sum test with post-hoc Bonferroni correction.

[0063] Results: Example 1 Development of a genome-editing AAV vector targeting the PMP22 gene duplication: A 1.5 Mb tandem repeat at 17p11.2 containing two copies of the PMP22 gene causes CMT1A [Non-Patent Document 23] (Figure 1a). To excise the PMP22 copy by genome editing, we designed a series of sgRNAs targeting sequences within the 1.5 Mb genome unit other than the PMP22 gene or the CMT1A-REP using Cas-OFFinder (www.rgenome.net / cas-offinder) software [Non-Patent Document 32]. Five candidate sequences were further selected from up to 20 sequences based on identity at two positions (Figure 8a). The five candidate sequences were supplemented with the specific protospacer adjacent motif (PAM) sequence of SaCas9 and subcloned into the BsaI site of the pX601 vector (Addgene plasmid #61591) (Figure 8a). The plasmids were transfected into normal iPSCs (RIKEN Cell Bank 201B7) to confirm whether the 5' genomic sequence of the PMP22 gene could be cleaved by genome editing (Figure 8b, c). SaCas9-mediated cleavage efficiency (InDel fraction) was calculated using the T7E1 assay based on the percentage of cleaved DNA, as determined by the integrated intensity of the gel band (Figure 8d). The relative amount of cleaved DNA fragments detectable on the gel was considered an indicator of mutation frequency within the cell population. The SaCas9-mediated cleavage efficiency (InDel fraction), calculated based on the percentage of cleaved DNA, as determined by the integrated intensity of the gel band, was highest for pX601-sgRNA3 (20.18%), followed by pX601-sgRNA5 (18.63%) and pX601-gRNA2 (12.36%). The other vectors (pX601-sgRNA1 and pX601-sgRNA4) did not induce cleavage in 201B7 iPSCs. In 293T cells, pX601-sgRNA5 cleaved DNA most efficiently (33.50%), followed by pX601-sgRNA3 (33.21%), pX601-sgRNA1 (27.55%), and pX601-sgRNA2 (16.73%). pX601-sgRNA4 showed no detectable activity in 293T cells.Based on these findings, we selected CMT1A-sgRNA3 to generate an AAV2 vector (AAV2-hSaCas9-gRNAedit) for subsequent experiments (Fig. 1b, Fig. S8e).

[0064] Example 2: Correction of PMP22 Gene Duplication in CMT1A-iPSCs: Next, we used human CMT1A iPSCs to confirm whether AAV vectors could correct the human PMP22 gene duplication (Figures 2 and 3). Human iPSCs or iPSC-differentiated cells are considered to be the optimal model for the genetic events underlying CMT1A. This is because a humanized disease genome model that retains the duplicated human PMP22 genome and the long flanking region of the human genome surrounding the PMP22 gene is not currently available, making human iPSCs or iPSC-differentiated cells the optimal model for the genetic events underlying CMT1A. iPSC-differentiated cells are considered a simple system for testing the genetic events underlying CMT1A. Furthermore, this was the most direct means of testing the vector's ability to edit the human genome, rather than an animal model. Therefore, we obtained an iPSC line (HPS0426) from the RIKEN Cell Bank, generated from a female patient (aged 40-49 years) with a PMP22 gene duplication at CiRA, Kyoto University (CiRA00139). The karyotype of the CMT1A-iPSCs (CiRA00139 is referred to as CMT1A-iPSCs) was normal (Fig. 9a). Whole-genome sequencing mapped the duplication to Chr17:14,173,927-15,588,542 (Fig. 9b). This indicates that the CiRA00139 cell line harbors a common CMT1A mutation. The PMP22 gene duplication was heterozygous, based on the patient's family history and a 1.5-fold increase in whole-genome sequencing reads (Fig. 9b).

[0065] Subsequently, CMT1A-iPSCs were infected with AAV2-hSaCas9-gRNAedit or AAV2-hSaCas9-gRNAcont (Fig. 2a). The disease allele-specific unedited distal-proximal fusion CMT1A-REP was detected by quantitative PCR (Fig. 2b), and genome editing efficiency was expressed as percent genome editing (Fig. 2c). CMT1A-iPSCs were infected with AAV vectors for 3 days, then incubated in normal medium for 3 days and passaged. After AAV infection, DNA from CMT1A-iPSCs was sampled weekly (Fig. 2a). This approach achieved genome editing efficiencies of approximately 40%, but these values ​​became unstable after 4 weeks of infection due to reduced iPSC viability (Fig. 2d, Fig. 10).

[0066] To confirm genome editing by the AAV2-hSaCas9-gRNAedit vector, we performed Southern blot analysis of genomic DNA prepared from CMT1A-iPSCs 2 weeks after AAV infection (Fig. 2e). EcoRI-SacI co-digestion of genomic DNA generated from proximal, hybrid, or distal CMT1A-REP-infected cells generated DNA fragments of different lengths (Figs. 1 and 2f). The signal intensity of the 3.3-kb DNA fragment (band c) corrected for the signal intensities of the 6.1-kb fragment (band a) and the 5.1-kb fragment (band b) was used as a quantitative indicator of the unedited genome (Fig. 2g). The percentage of genome editing could be calculated by subtracting the intensity of the 3.3-kb DNA fragment (band c') from the corrected intensity of band c in CMT1A-iPSCs after AAV2-hSaCas9-gRNAedit infection (Fig. 2g). This Southern blot-based assay confirmed nearly 20% genome editing after AAV2-hSaCas9-gRNAedit infection (Figure 2h). Southern blot analysis is affected by many factors, including DNA digestion efficiency, blotting efficiency, and hybridization uniformity. Therefore, discrepancies between the two methods are acceptable, and genome editing rates are likely to exceed approximately 20%.

[0067] To further investigate the efficiency of genome editing, we employed a third method, Tracking Indels by Degradation (TIDE)

[33] , TOPO subcloning, and Sanger sequencing, using genomic DNA prepared from CMT1A-iPSCs 2 weeks after AAV2-hSaCas9-gRNAedit infection (Fig. 11a). A pilot study of four plasmids revealed that two plasmids from AAV-infected CMT1A-iPSCs contained amplified genomes from different chromosomes. Meanwhile, the other two plasmids contained the exact target region of the PMP22 gene, both indicating genome editing (Fig. 11b). Therefore, we expanded the analysis to 1,268 plasmids (Fig. 11c). The genome editing efficiency was found to be 16.77%, lower than the previous two methods. However, TIDE failed to count mutations when Cas9-mediated cleavage recombined without generating point mutations during the deletion of the 1.5 Mb genomic region. Therefore, the genome editing efficiencies assessed by the three methods appear to be broadly consistent.

[0068] Example 3: Abnormal proliferation and differentiation of Schwann cell precursors from CMT1A-iPSCs: Using a previously published protocol [Non-Patent Document 30], normal and CMT1A iPSCs were differentiated into Schwann cell precursors (SCPs) and then into Schwann cells (Figure 12). Compared with normal iPSCs, CMT1A iPSCs showed delayed proliferation of Sox10-positive SCPs, and the morphology of S100B-positive Schwann cells was abnormal, as evidenced by the larger gemistocyte shape (Figures 3a and 3b). Quantitative analysis confirmed these Schwann cell characteristics during differentiation of human CMT1A iPSCs, including reduced proliferation (cell counting) and delayed differentiation (reduced expression of the Schwann cell marker S100B and the SCP marker Sox10) from iPSCs to SCPs (Figure 3c). In contrast, normal iPSCs differentiated into Schwann cells with a thin, fibrous morphology. These findings support the notion that CMT1A pathology begins early in development, as suggested by previous reports [34, 35].

[0069] Example 4: Abnormal Myelination and Cell Death in Cocultures of CMT1A-iPSC-Derived Schwann Cells and Normal iPSC-Derived Pan-Neurons: We next investigated how aberrant Schwann cell differentiation of CMT1A-iPSCs affects the functional outcome of neurite myelination. iPSC-derived neurons and iPSC-derived Schwann cells were cocultured according to a unique protocol developed in this study (Fig. 4a). This protocol combined a protocol for differentiating iPSCs into pan-neurons

[36] with a protocol for coculture of rat dorsal root ganglion (DRG) neurons with human iPSC-derived Schwann cells

[30] . While neurons were differentiated only from normal iPSCs, Schwann cells were differentiated from both normal and CMT1A iPSCs to determine the disease-related myelination function of Schwann cells (Fig. 4a).

[0070] Co-immunostaining for myelin basic protein (MBP), a marker of mature myelin, and microtubule-associated protein (MAP), a neuronal marker, revealed myelinated and hypomyelinated neurites (downward and upward arrows, Fig. 4b, upper panel) in cultures of normal iPSC-derived neurons and normal iPSC-derived Schwann cells (Fig. 4b, upper panel). To compare the degree of myelination, the percentage of MBP-MAP binding length relative to the total neurite length was quantified in images of a fixed area (Fig. 4b, lower panel). The percentage of MBP-MAP binding neurite length differed significantly between the co-cultures of normal iPSC-derived Schwann cells and CMT1A-iPSC-derived Schwann cells (Fig. 4b, graph).

[0071] To investigate the detailed morphology of the cocultures, including the myelination status at the coculture endpoint, we used transmission electron microscopy (EM) (Fig. 4c). In the coculture of CMT1A-iPSC-derived Schwann cells, the number of dead cells with apoptotic indicators, such as chromatin condensation and apoptotic bodies, was statistically increased (Fig. 4c). On the other hand, neurons with larger nuclei remained viable, suggesting that the dying cells were primarily CMT1A-iPSC-derived Schwann cells (Fig. 4c).

[0072] Example 5: Rescue of abnormal co-culture phenotypes by AAV-mediated genome editing: Finally, we determined whether genome editing using AAV2-hSaCas9-gRNAedit to normalize the overlap of a 1.5 Mb genomic fragment ameliorated the abnormal phenotype of co-cultures of normal iPSC-derived neurons and CMT1A-iPSC-derived Schwann cells (Figure 5). Prior to analysis, we examined genome editing with this platform by infection at various time points during differentiation and found that the level of genome editing was highest in Schwann cell precursors (average 75%), but not in Schwann cells (average 75%). However, the levels of Schwann cells (42%) and iPSCs (50%) remained comparable (Figure 13a). Therefore, we decided to infect cells after Schwann cell differentiation, which are most likely to be applicable to future human therapeutics. At the same time, we observed that using the same protocol, the efficiency of differentiation of CMT1A-iPSCs into S100B-positive Schwann cells decreased, which may impact future therapeutic applications (Figure 13b). Infection of differentiated CMT1A-iPSC-derived Schwann cells with AAV2-hSaCas9-gRNAedit (Fig. 5a), but not AAV2-hSaCas9-gRNAcont, reduced cell death in neuron-Schwann cell cocultures (Fig. 5b).

[0073] Furthermore, co-immunostaining for MBP and MAP revealed that the gene-editing vector increased the percentage of neurite length bound by MBP-MAP, indicating enhanced myelination (Fig. 6a). Furthermore, EM revealed immature myelination of neurites in the coculture (Fig. 6b). As shown in the bottom panel of Fig. 7a, multiple layers of immature myelin sheaths surrounded neurites (Fig. 6b). This complex of neurites and immature myelin was reduced in the coculture of normal iPSC-derived neurons and CMT1A-iPSC-derived Schwann cells (Fig. 6c), but was restored in the coculture of AAV2-hSaCas9-gRNAedit-infected CMT1A-iPSC-derived Schwann cells and normal iPSC-derived neurons (Fig. 6c, d).

[0074] Furthermore, immunoelectron microscopy using anti-Crispr-Cas9 antibodies confirmed that the AAV genome editing vector successfully infected the Schwann cells used in the above experiments (Figure 14).

[0075] Example 6: Effects of genome editing on chromosomes, genome sequence, and PMP22 expression: Finally, we investigated the possible side effects of our genome editing method. First, karyotype analysis revealed that the chromosomes were normal after AAV-mediated genome editing (Fig. 15a). Second, 1 × 10 6 Whole-genome sequencing of genomic DNA prepared from iPSC cells revealed that the genome structure remained unchanged at the chromosomal or copy number variation (CNV) level after AAV-mediated genome editing (Figure 15b). Third, whole-genome sequencing was also used to evaluate off-target effects after AAV-mediated genome editing (Figure 15b). In CMT1A-iPSCs after in vitro AAV2-hSaCas9-gRNAedit infection, we found 66 potential off-target mutations among the 3,099,734,149 bp of the human whole genome. In mouse tissues after AAV2-hSaCas9-gRNAedit injection into the sciatic nerve, we found 797 potential off-target mutations among the 2,728,206,152 bp of the mouse whole genome (Figure 15b). Of the 66 potential point mutations, 65 mapped to intronic / non-coding regions, and only one mapped to a protein-coding exon of the FCGBP gene, but the encoded amino acid was not altered. Given that they were all point mutations and no consecutive or clustered mutations were found, we could not exclude the possibility that they were novel SNPs unrelated to genome editing. However, although the rate of possible off-target mutations was very low in both cases, off-target effects are a significant problem in the clinical application of genome editing technology [Non-Patent Documents 37-39] and should be further reduced by the development of genome editing technology [Non-Patent Documents 39-41].

[0076] We also examined PMP22 mRNA and protein levels in iPSC-derived Schwann cells before AAV infection (day 42) and after coculture with normal iPSC-derived neurons (day 47) (Fig. 7a). Immunohistochemistry revealed increased PMP22 protein levels in CMT1A-iPSC-derived Schwann cells at day 42 (Fig. 7b). The spherical shape of MAP2-positive / PMP22-positive cells was observed in cocultures of normal iPSC-derived Schwann cells but was reduced in cocultures of CMT1A-iPSC-derived Schwann cells (Fig. 7b). Instead, abnormally reduced shapes of MAP2 / PMP22-double-positive cells were detected in cocultures of CMT1A-iPSC-derived Schwann cells (Fig. 7b). The number of spherical cells increased with AAV2-hSaCas9-gRNAedit but not with AAV2-hSaCas9-gRNAcont (Fig. 7b). Consistently, quantitative analysis revealed restoration of PMP22 signaling and the PMP22-MAP2 binding domain (Fig. 7c). Quantitative PCR and Western blot analysis revealed that both PMP22 mRNA and protein levels were increased in CMT1A-iPSC-derived Schwann cells, whereas AAV-mediated genome editing nearly normalized PMP22 levels (Fig. 7d, e). The restoration of PMP22 levels was not due to a decrease in Schwann cell numbers after AAV2-hSaCas9-gRNAedit infection (Fig. 7f).

[0077] Discussion: PMP22 is a compact myelin protein, similar to myelin protein 0 (P0), myelin protein 2 (P2), and myelin basic protein (MBP) [Non-Patent Documents 42-45], and these molecules each form a distinct layer of the myelin structural unit [Non-Patent Document 46]. Abnormal duplication of the PMP22 gene leads to hypomyelination and subsequent axonal degeneration, while PMP22 deletion occasionally leads to pressure-sensitive neuropathy accompanied by hypermyelination, suggesting that PMP22 gene dosage is associated with the myelinating phenotype [Non-Patent Document 21]. CMT1A is the most common CMT subtype, accounting for more than 50% of familial peripheral neuropathies [Non-Patent Document 1]. PMP22 alters membrane structure, and its effect depends on the ratio of lipids to PMP22 protein [Non-Patent Document 47]. However, the specific molecular mechanism by which CMT1A gene duplication leads to hypomyelination and axon loss is not fully understood. Several point mutations in the PMP22 gene disrupt intracellular PMP22 protein trafficking [48, 49].

[0078] However, it is unclear whether the 1.5-fold increase in PMP22 protein levels in human CMT1A causes protein misfolding or induces endoplasmic reticulum-associated degradation (ERAD), which leads to a decrease in PMP22 protein.

[0079] Impaired proliferation and apoptotic cell death of differentiating Schwann cells are potential hallmarks of CMT1A pathology

[34] , supported by previous studies such as retroviral vector-mediated PMP22 gene transfer in cultured Schwann cells

[50] , Schwann cells isolated from nerve biopsies of CMT1A patients

[51] , and PMP22 overexpression in Schwann cells and NIH-3T3 cells [52, 53]. The results of this study, which evaluated the phenotype of human CMT1A-iPSC-derived Schwann cells in monoculture and coculture with normal human iPSC-derived pan-neurons, demonstrated suppressed proliferation and apoptotic cell death during differentiation into mature Schwann cells. This further suggests that these processes are characteristic of Schwann cells derived from CMT1A patients.

[0080] No therapies directly targeting CMT1A have proven clinically effective in CMT1A. As summarized in recent reviews [9, 10], various treatments currently under development include indirect methods that increase Schwann cell and / or neuron survival and direct approaches that reduce PMP22 protein expression. Preclinical studies in rodent models have suggested that soluble neuregulin 1 [54, 55], AAV1-mediated delivery of neurotrophin 3 (NT3)

[56] , P2X7 receptor inhibition

[57] , shRNA

[15] , AAV-mediated miRNA expression

[16] , and antisense oligonucleotides targeting PMP227 may ameliorate CMT1A pathology. However, these findings have not been confirmed in clinical trials. On the other hand, clinical trials involving ascorbic acid [58,59] (NCT00484510), myostatin inhibitors

[60] and progesterone receptor antagonists (NCT02600286) failed to demonstrate clinical benefit for patients with CMT1A.

[0081] These findings demonstrate the development of a novel gene therapy technique that uses genome editing in iPSC-derived Schwann cells from CMT1A patients to remove the abnormal PMP22 gene copy that causes CMT1A. Because the cutting sites in this genome editing technique are located in non-coding and non-functional genomic regions, a single cut in the genome is nontoxic. Deletion of the PMP22 gene copy by the editing vector only occurs when two sites are cut in the abnormal allele with a duplicated PMP22 gene, demonstrating the safety of this approach. The genome editing efficiency of the vector in CMT1A-iPSC-derived Schwann cells is approximately 20–40%. This may pose a barrier to clinical application of this tool, but further optimization may improve efficiency. However, vectors with excessive efficacy may cause unexpected side effects and are therefore inappropriate for early clinical trials.

[0082] The method of infection (intravenous or intraneural injection) should be considered. Previous studies have shown that intravenous injection of siRNA targeting PMP22 conjugated to squalenoyl nanoparticles has a short duration of action and requires multiple injections

[14] . Another previous study demonstrated that direct injection of AAV2 vectors into the peripheral nerves of adult mice results in high infection efficiency of mature Schwann cells

[15] , suggesting that this may be the optimal delivery approach in adults.

[0083] The timing of injection into human CMT1A patients also needs to be considered. The genome editing efficiency of the developed vector did not change significantly when injected into primary iPS cells or mature Schwann cells. Considering the developmental pathology that occurs during Schwann cell differentiation and the relatively high genome editing efficiency of the vector in SCPs, intervention at an earlier age may enhance clinical efficacy.

[0084] However, this protocol requires careful consideration of ethical issues.

[0085] Because there are no animal models with PMP2 gene duplications in which we can test the genome editing of our vector, we may need to carefully rule out the toxicity of our vector in animals and confirm its safety before proceeding to human clinical trials to examine its therapeutic efficacy.Our study revealed the targeted effect of the expressed gRNA, even though the frequency of off-target mutations was very low both in vitro and in vivo.

Claims

1. A method for treating Charcot-Marie-Tooth disease in a subject, the method comprising the step of: (a) administering to the subject a therapeutically effective amount of a therapeutic agent for editing the PMP22 gene in the subject's genome; 2. The treatment according to claim 1, wherein the copy number of the PMP22 gene in the subject's genome is 3 or more.

3. The treatment of claim 1, wherein the copy number of the PMP22 gene in the subject's genome is 3.

4. The treatment method of claim 1, wherein the agent for editing the PMP22 gene in the subject's genome is an agent for editing one copy of the PMP22 gene in the subject's genome.

5. The treatment agent described in claim 1, wherein the agent for editing the PMP22 gene in the subject's genome is an agent for deleting the PMP22 gene in the subject's genome.

6. The treatment method according to claim 5, wherein the agent for deleting the PMP22 gene in the subject's genome is an agent for deleting one copy of the PMP22 gene in the subject's genome.

7. The treatment of claim 1, wherein the treatment for Charcot-Marie-Tooth disease in a subject is a therapeutic agent for Charcot-Marie-Tooth disease in a subject.

8. The treatment of claim 1, wherein the agent for editing the PMP22 gene in the subject's genome comprises an agent for cleaving a first predetermined location in the subject's genome and an agent for cleaving a second predetermined location in the subject's genome.

9. The treatment agent described in claim 8, wherein the first predetermined location in the subject's genome is located upstream of the PMP22 gene in the subject's genome, and the second predetermined location in the subject's genome is located downstream of the PMP22 gene in the subject's genome.

10. The treatment of claim 8, wherein the agent for cleaving a first predetermined location in the subject's genome is an agent for cleaving a second predetermined location in the subject's genome.

11. The treatment agent of claim 1, wherein the agent for editing the PMP22 gene in the subject's genome comprises a substance for binding an enzyme that cleaves a specific position in the genome to a specific position in the genome.

12. The treatment agent according to claim 11, wherein the substance for binding an enzyme that cleaves a specific site in the genome to a specific site in the genome is RNA.

13. The treatment according to claim 12, wherein the RNA is a guide RNA of a CRISPR-Cas system.

14. The treatment agent described in claim 11, wherein the enzyme that cleaves a specific site in the genome is Cas9.

15. The therapeutic agent of claim 14, wherein Cas9 is SaCas9.

16. The treatment of claim 1, wherein the agent for editing the PMP22 gene in the subject's genome comprises an enzyme that cuts a specific location in the genome.

17. The treatment agent according to claim 1, comprising a substance for producing a substance for binding an enzyme that cleaves a specific site in the genome to a specific site in the genome.

18. The treatment agent described in claim 17, wherein the substance for producing a substance for binding an enzyme that cleaves a predetermined position in the genome to a predetermined position in the genome is a vector for expressing in a subject's cell a substance for binding an enzyme that cleaves a predetermined position in the genome to a predetermined position in the genome.

19. The treatment of claim 1, comprising a substance for producing an enzyme that cleaves a specific location in the genome.

20. The treatment agent according to claim 19, wherein the substance for producing an enzyme that cleaves a specific site in the genome is a vector for expressing the enzyme that cleaves a specific site in the genome in the subject's cells.

21. The treatment agent according to claim 19, wherein the substance for producing an enzyme that cleaves a specific position in the genome is a substance for producing a substance for binding an enzyme that cleaves a specific position in the genome to a specific position in the genome.

22. The treatment agent according to claim 11, wherein the substance for binding an enzyme that cleaves a specific position in the genome to a specific position in the genome is RNA comprising a sequence set forth in any one of SEQ ID NOs: 1 to 5, RNA comprising a sequence set forth in any one of SEQ ID NOs: 19 to 23, or RNA comprising a sequence set forth in any one of SEQ ID NOs: 25 to 29.

23. The treatment agent described in claim 11, wherein the substance for binding an enzyme that cleaves a specific position in the genome to a specific position in the genome is RNA having a sequence set forth in any one of SEQ ID NOs: 1 to 5, RNA having a sequence set forth in any one of SEQ ID NOs: 19 to 23, or RNA having a sequence set forth in any one of SEQ ID NOs: 25 to 29.

24. The treatment of claim 1, wherein the Charcot-Marie-Tooth disease is type 1.

25. The treatment of claim 1, wherein the Charcot-Marie-Tooth disease is type 1A.

26. The treatment of claim 1, wherein the agent for editing the PMP22 gene in the subject's genome comprises a guide RNA that recognizes both a first predetermined location in the subject's genome and a second predetermined location in the subject's genome, and an enzyme that forms a complex with the guide RNA and cleaves genomic DNA, and the guide RNA and the enzyme are expressed from the same AAV vector.

Images