Chlorella microalga and use thereof in wastewater treatment

Abstract

Provided are a Chlorella microalga and the use thereof in wastewater treatment, the microalga being Chlorella sp., and the accession number thereof being CCTCCM 20231952. The wastewater includes municipal wastewater, food processing wastewater, printing and dyeing industrial wastewater and animal husbandry breeding wastewater.

Description

Chlorella microalgae and its application in sewage treatment Technical Field

[0001] The present invention relates to the technical field of microalgae cultivation and sewage treatment, in particular to microalgae of the genus Chlorella and application thereof in sewage treatment. Background Art

[0002] In recent years, global research on algae-based wastewater treatment has primarily focused on treating domestic and livestock wastewater. Relatively little research has been conducted on the treatment of food processing and printing and dyeing wastewater, primarily due to their high oil content and toxicity, respectively. For domestic wastewater, due to its relatively low COD, nitrogen, and phosphorus concentrations, COD degradation rates can reach 60-80%, and total phosphorus removal rates can reach as high as 80-90%. However, total nitrogen degradation rates are only 50-60%. For municipal wastewater, due to its higher nutrient content, total nitrogen removal efficiencies are relatively higher (~80%). In the treatment of industrial wastewater, due to its low organic content, it is often mixed with municipal or domestic sewage, or even directly added with sugars to adjust nutrient concentrations, thereby achieving COD, nitrogen, and phosphorus removal rates exceeding 80%. However, due to the complex nature of the wastewater and the numerous inhibitory factors, COD removal results are often unstable.

[0003] Most research on algae species focuses on species such as Clorella vulgaris, Chlorella sorokiniana, Chlorella protothecoides, and Chlamydomona reinhardtii. Green algae are globally recognized for their ability to degrade organic matter in pig and cattle farm wastewater. However, their drawbacks lie in their slow growth, resulting in low removal rates for COD, ammonia nitrogen, and total phosphorus. It often takes 10-30 days to remove 80-90% of pollutants. Consequently, the longer hydraulic retention time (HRT) cannot compete with traditional biochemical treatments. Furthermore, lacking the advantages of anaerobic digestion and activated sludge biochemical treatments for high COD and ammonia nitrogen concentrations, most green algae experience growth inhibition in environments with high COD and ammonia nitrogen concentrations. This ultimately results in algal cell growth failure or a prolonged lag phase, which ultimately impacts organic matter removal rates in wastewater.

[0004] Therefore, the existing technology needs to be further improved and enhanced.

[0005] Summary of the Invention

[0006] In view of the above-mentioned deficiencies in the prior art, the object of the present invention is to provide microalgae of the genus Chlorella and their application in sewage treatment, aiming to solve the problems of growth inhibition and low removal rate of organic matter in wastewater caused by existing algae treatment of sewage.

[0007] The first aspect is Chlorella sp., whose deposit number is CCTCCM 20231952.

[0008] The Chlorella species in this invention is a wild algae species, and its domestication method is somewhat specific to this species. Therefore, two primers were used to extract the nucleotide sequences of two portions of 18sRNA from this algae species. The BLAST system from the National Center for Biotechnology Information (NCBI) website was used to identify the species as Chlorella sp.

[0009] Optionally, in the Chlorella vulgaris, a first primer is designed, and the 18sRNA sequence corresponding to the first primer is shown as SEQ ID NO.1;

[0010] The first primer consists of a forward primer sequence whose nucleotide sequence is shown as SEQ ID NO.2 and a reverse primer sequence whose nucleotide sequence is shown as SEQ ID NO.3.

[0011] The nucleotide sequence of the first primer (Primers) in the present invention is as follows:

[0012] GGTGATCCTGCCAGTAGTCATATGCTTG(Forward)

[0013] GATCCTTCCGCAGGTTCACCTACGGAAACC(Reverse).

[0014] Optionally, in the Chlorella vulgaris, a second primer is designed, and the 18sRNA sequence corresponding to the second primer is shown as SEQ ID NO.4;

[0015] The second primer consists of a forward primer sequence whose nucleotide sequence is shown as SEQ ID NO.5 and a reverse primer sequence whose nucleotide sequence is shown as SEQ ID NO.6.

[0016] The nucleotide sequences of the second primers (Primers) in the present invention are as follows:

[0017] ACCTGGTTGATCCTGCCAG(Forward)

[0018] TGATCCTTCYGCAGGTTCAC(Reverse).

[0019] Optionally, the Chlorella is used in sewage treatment.

[0020] Optionally, the Chlorella is used in sewage treatment, wherein the sewage includes municipal wastewater, food processing wastewater, printing and dyeing industry wastewater and animal husbandry wastewater.

[0021] A second aspect provides a sewage treatment method, comprising:

[0022] transporting the sewage to a reaction tank containing the aforementioned Chlorella vulgaris, subjecting the sewage to algae biochemical treatment to obtain purified effluent;

[0023] The sewage is selected from: municipal wastewater, food processing wastewater, printing and dyeing industrial wastewater;

[0024] The algae biochemical treatment includes: firstly performing light treatment on the sewage in the reaction tank, and then performing light-proof treatment on the sewage after light treatment.

[0025] A third aspect is a sewage treatment method, comprising:

[0026] The pretreated wastewater is subjected to anaerobic digestion and aerobic treatment in sequence to obtain biochemical effluent. The wastewater is livestock breeding wastewater. The pretreatment refers to the solid-liquid separation of the wastewater to remove solid waste. It should be noted that the pretreatment mentioned below also has this meaning.

[0027] Performing solid-liquid separation on the biochemical effluent, transporting the obtained liquid to a reaction pool containing the aforementioned Chlorella vulgaris, and performing algae biochemical treatment on the liquid to obtain purified effluent;

[0028] The algae biochemical treatment includes: firstly performing light treatment on the sewage in the reaction tank, and then performing light-proof treatment on the sewage after light treatment.

[0029] Since livestock wastewater often leaves a certain amount of COD residue (>300 mg / L) after being treated by the traditional activated sludge biochemical end, these organic substances are difficult to be further degraded by biochemical methods. Therefore, in order to further remove such refractory organic substances, the process often includes a third-level treatment process, namely the deep treatment end. The deep treatment end often oxidizes and degrades refractory organic substances by adding strong oxidants (such as hypochlorous acid, hydrogen peroxide, etc.), so the amount of drug added is often high, which ultimately leads to very high treatment costs. The present invention utilizes algae to further degrade refractory organic substances, thereby reducing the effluent COD and reducing the cost of drug addition. At the same time, the recovered algae can be used for subsequent processing to become high-value products such as green energy, high-quality protein, and animal feed.

[0030] A fourth aspect is a sewage treatment method, comprising:

[0031] Anaerobic digestion is performed on the pretreated sewage to obtain anaerobic effluent, wherein the sewage is livestock breeding wastewater;

[0032] Performing solid-liquid separation on the anaerobic effluent, transporting the obtained liquid to a reaction tank containing the aforementioned Chlorella vulgaris, and performing algae biochemical treatment on the liquid to obtain purified effluent;

[0033] The algae biochemical treatment includes: firstly performing light treatment on the liquid in the reaction tank, and then performing light-proof treatment on the liquid after the light treatment.

[0034] Because the COD of raw livestock wastewater is generally >4000 mg / L, anaerobic digestion is typically used to reduce the COD to >1000 mg / L before the activated sludge (A / O) process is used for nitrogen and phosphorus removal. This invention utilizes a Chlorella process to replace the traditional activated sludge biochemical process to remove COD, total nitrogen, and total phosphorus from the anaerobic digestion effluent, thereby reducing sludge production and degrading organic matter that is difficult to degrade in traditional A / O processes. The recovered algae can then be processed into high-value products such as green energy, high-quality protein, and animal feed.

[0035] A fifth aspect is a sewage treatment method, comprising:

[0036] The pretreated sewage is transported to a reaction tank containing the above-mentioned Chlorella vulgaris, and the livestock wastewater is subjected to algae biochemical treatment to obtain first-stage purified effluent; the sewage is livestock breeding wastewater;

[0037] The first-stage purified water is transported to another reaction tank containing the above-mentioned Chlorella vulgaris, and the first-stage purified water is again subjected to algae biochemical treatment to obtain purified water;

[0038] The algae biochemical treatment includes: firstly performing light treatment on the sewage in the reaction tank, and then performing light-proof treatment on the sewage after light treatment.

[0039] Because high COD (>4000mg / L) and high ammonia nitrogen (>1000mg / L) levels in raw livestock wastewater can inhibit algae growth, a two-stage algae treatment process is being adopted to completely replace the anaerobic digestion, activated sludge biochemical, and advanced treatment steps in traditional livestock wastewater treatment. This process reduces sludge discharge and chemical dosage, while the recovered algae can be subsequently processed into high-value products such as green energy, high-quality protein, and animal feed.

[0040] Optionally, in the sewage treatment method, the Chlorella seed liquid culture method comprises:

[0041] Using the sewage as a culture medium, inoculating Chlorella into the culture medium for cultivation to obtain the Chlorella seed liquid;

[0042] The inoculation ratio of the chlorella in the culture medium is 5-90% v / v, such as 5% to 10% v / v, 10% to 20% v / v, 20% to 30% v / v, 30% to 40% v / v, 40% to 50% v / v, 50% to 60% v / v, 60% to 70% v / v, 70% to 80% v / v, 80% to 90% v / v; the culture temperature is 15-30°C, such as 15 to 20°C, 20°C to 25°C, 25°C to 30°C; the light intensity is 1000 to 10000 lux, such as 1000 lux to 2000 lux, 2000 lux to 3000 lux, 30 12 hours to 24 hours; the dark period is 2-12 hours, such as 2 hours to 5 hours, 5 hours to 8 hours, 8 hours to 12 hours.

[0043] Optionally, in the sewage treatment method, the algae biochemical treatment comprises:

[0044] Setting a first biochemical pool and a second biochemical pool, wherein the first biochemical pool and the second biochemical pool contain the above-mentioned Chlorella vulgaris;

[0045] The sewage is flowed into the first biochemical pool, and the first biochemical pool is subjected to light treatment; the light intensity is 1000-10000 lux, such as 1000 lux to 2000 lux, 2000 lux to 3000 lux, 3000 lux to 4000 lux, 4000 lux to 5000 lux, 5000 lux to 6000 lux, 6000 lux to 7000 lux, 7000 lux to 8000 lux, 8000 lux to 9000 lux, 9000 lux to 10000 lux; the residence time of the sewage in the first biochemical pool is 2-96 hours, such as 2 hours to 10 hours, 10 hours to 20 hours, 20 hours to 30 hours, 30 hours to 40 hours, 40 hours to 50 hours, 50 hours to 60 hours, 60 hours to 70 hours, 70 hours to 80 hours, 80 hours to 90 hours, 90 hours to 96 hours;

[0046] The sewage after light treatment flows into the second biochemical pool, and the second biochemical pool is subjected to light shielding treatment, wherein the residence time of the sewage in the second biochemical pool is 2-96 hours, such as 2 hours to 10 hours, 10 hours to 20 hours, 20 hours to 30 hours, 30 hours to 40 hours, 40 hours to 50 hours, 50 hours to 60 hours, 60 hours to 70 hours, 70 hours to 80 hours, 80 hours to 90 hours, and 90 hours to 96 hours;

[0047] The OD680 value of the Chlorella cells in the first biochemical pond and the second biochemical pond is 1.0-10.0, such as 1.0 to 2.0, 2.0 to 3.0, 3.0 to 4.0, 4.0 to 5.0, 5.0 to 6.0, 6.0 to 7.0, 7.0 to 8.0, 8.0 to 9.0, and 9.0 to 10.0; the aeration volume is 0.0-2.0 VVM, such as 0.0 VVM to 0.5 VVM, 0.5 VVM to 1.0 VVM, 1.0 VVM to 1.5 VVM, and 1.5 VVM to 2.0 VVM.

[0048] Optionally, in the sewage treatment method, the algae sludge return rate of the second biochemical pool is 5-90%, such as 5% to 10%, 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 60%, 60% to 70%, 70% to 80%, 80% to 90%.

[0049] Beneficial effects: Compared with the prior art, the Chlorella sp. provided by the present invention has no growth inhibition on high-oil wastewater from oily food processing plants, compared with activated sludge. For printing and dyeing wastewater that cannot be treated by activated sludge, Chlorella can directly treat it. In the treatment of livestock wastewater, it is shown that Chlorella can further degrade the difficult-to-degrade organic matter in the wastewater (COD is reduced to below 200 mg / L), which can replace the deep treatment end, that is, reduce the dosage of chemical agents, avoid secondary pollution, and save costs. At the same time, the treatment of anaerobic effluent and raw wastewater shows that, compared with the activated sludge method and anaerobic digestion method, Chlorella can remove organic matter in sewage more quickly and efficiently. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 is a flow chart of traditional livestock wastewater treatment process;

[0051] Figure 2 is a schematic diagram of the livestock wastewater treatment process in which the algae deep biochemical treatment end replaces the traditional deep treatment end;

[0052] FIG3 is a schematic diagram of the livestock wastewater treatment process in which the algae biochemical treatment end replaces the traditional activated sludge biochemical and deep treatment end;

[0053] Figure 4 is a two-stage Chlorella livestock wastewater treatment process diagram. DETAILED DESCRIPTION

[0054] The present invention provides microalgae of the genus Chlorella and their use in sewage treatment. To clarify the objectives, technical solutions, and effects of the present invention, the present invention is described in further detail below. It should be understood that the specific embodiments described herein are merely illustrative of the present invention and are not intended to limit the present invention.

[0055] The reagents and materials used in the present invention are all common commercial products and can be purchased in the market.

[0056] The present invention will be further described below with reference to the embodiments.

[0057] Example 1

[0058] Chlorella sp. for treating municipal wastewater

[0059] Chlorella seed liquid culture method:

[0060] During seed culture, Chlorella was grown in Erlenmeyer flasks at a 5% v / v inoculum ratio using 100% municipal wastewater. The culture temperature was maintained at 20°C, and the light intensity was controlled at 1000 lux with a 2-hour light-2-hour dark cycle. The rotation speed was set at 100 rpm. The total incubation time was 2 hours. When the OD680 value of the Chlorella cells reached 0.5, the continuous reaction mode was entered. The amplification ratio was maintained at 1:5.

[0061] Chlorella municipal sewage biochemical end design:

[0062] For continuous municipal wastewater treatment, the Chlorella biochemical end should be designed as two reaction tanks: a light reaction tank and a dark (no light) reaction tank. The hydraulic retention time of the light reaction tank is set to 2 hours, while the hydraulic retention time of the Chlorella in the dark reaction tank is set to 2 hours. The Chlorella concentration (OD680) in both biochemical tanks (light and dark reaction tanks) should be maintained at 1.0; the aeration rate should be set to 0.0VVM; the light intensity can be set between 1000 lux; and the algae sludge return rate in the dark reaction tank can be set to 5%. The treated water quality was tested and met the national Class 2 effluent standard.

[0063] Example 2

[0064] Treatment of food processing plant wastewater by Chlorella sp.

[0065] Chlorella food processing plant wastewater seed solution culture method:

[0066] During seed culture, the inoculum ratio of Chlorella in Erlenmeyer flasks is 20% v / v, and the culture medium is 100% food factory wastewater. The culture temperature is controlled at 20°C, and the light intensity is controlled at 3000 lux, maintaining a growth environment of 12 hours of light and 12 hours of darkness. The rotation speed can be set to 150 rpm. The total culture time is 20 hours. When the OD680 value of the Chlorella cells reaches 3.0, the culture can be scaled up or enter the continuous reaction mode. The scale-up ratio should be maintained at 1:10 each time.

[0067] Design of biochemical end of wastewater from Chlorella food processing plant:

[0068] For the continuous treatment of food processing plant wastewater, the biochemical end of Chlorella should be designed as two reaction tanks: a light reaction tank and a dark (no light) reaction tank. The hydraulic retention time of the light reaction tank is set to 12 hours, while the hydraulic retention time of Chlorella in the dark reaction tank can be set to 8 hours. The Chlorella concentration (OD680) in both biochemical tanks (light and dark reaction tanks) should be maintained at 3.0; the aeration volume needs to be set to 1.0VVM; the light intensity can be set to 2000lux; and the algae mud return flow in the dark reaction tank is set to 10%. The treated water quality was tested and met the national Class 2 effluent standard.

[0069] Example 3

[0070] Treatment of printing and dyeing industrial wastewater by Chlorella sp.

[0071] Cultivation method of pellet printing and dyeing industrial wastewater seed liquid:

[0072] During seed culture, Chlorella vulgaris is grown in a conical flask at a 50% v / v inoculum ratio, using 100% printing and dyeing industrial wastewater as the culture medium. The culture temperature is controlled at 25°C, and the light intensity is controlled at 5000 lux for 20 hours. The rotation speed can be set to 150 rpm. The total culture time is 60 hours. When the OD680 value of the Chlorella cells reaches 4.5, the continuous reaction mode is entered. The amplification ratio should be maintained at 1:30 each time.

[0073] Chlorella printing and dyeing industrial wastewater biochemical design:

[0074] For the continuous treatment of printing and dyeing industrial wastewater, the biochemical end of Chlorella should be designed as two reaction tanks, namely a light reaction tank and a dark (no light) reaction tank. The hydraulic retention time of the light reaction tank is set to 24 hours, while the hydraulic retention time of Chlorella in the dark reaction tank can be set to 12 hours. The Chlorella concentration (OD680) in both biochemical tanks (light and dark reaction tanks) should be maintained at 5.0; the aeration volume needs to be set to 2.0VVM; the light intensity can be set to 8000lux; and the algae sludge return flow in the dark reaction tank is set to 50%. The treated water quality was tested and met the national Class 2 effluent standard.

[0075] Example 4

[0076] Treatment of livestock wastewater by Chlorella sp.

[0077] Figure 1 shows a process flow chart for treating traditional livestock farming wastewater. The evolved Chlorella algae can be used to treat three different types of livestock wastewater: duck, pig, and cattle farm wastewater. It can also degrade wastewater from three different outlets of traditional livestock wastewater treatment plants: raw wastewater, anaerobic effluent, and biochemical effluent.

[0078] Design of deep biochemical treatment process for biochemical effluent using Chlorella:

[0079] During the seed culture period, Chlorella vulgaris was grown in a conical flask at an inoculum ratio of 80% v / v, using 100% duck farm biochemical effluent as the culture medium. The total incubation time was 86 hours. When the OD680 value of the Chlorella cells reached 5.0, the continuous reaction mode was entered. The culture temperature was controlled at 30°C, and the light intensity was controlled at 9000 lux with a 24-hour light growth environment. The rotation speed could be set to 200 rpm. The scale-up ratio was maintained at 1:40.

[0080] In continuous deep biochemical treatment, the traditional deep treatment stage, namely tertiary treatment processes such as advanced oxidation, is replaced by a Chlorella-based algae deep biochemical treatment stage, as shown in Figure 2. A fully illuminated reaction tank is designed. The hydraulic retention time of the illumination reaction tank is set to 24 hours. The Chlorella concentration (OD680) in the algae deep biochemical reaction tank is maintained at 10.0; the aeration rate is set to 2.0 VVM; the light intensity can be set to 10,000 lux; and the algae sludge return rate is set to 90%. The final effluent meets the national Class 1 effluent standard. It should be noted that the two alternative methods in this process flow are: 1) The algae biochemical treatment end can be combined with the activated sludge biochemical end into a single reaction tank. The activated sludge volume in the reaction tank is 1000-5000 mg / L, the Chlorella concentration (OD680) is between 1.0-5.0, and the hydraulic retention time is 24-72 hours. 2) The anaerobic effluent end is first connected to the algae biochemical treatment end and then to the activated sludge biochemical end. The Chlorella concentration (OD680) at the algae biochemical treatment end and the sludge concentration at the sludge biochemical end are respectively between 3.0-5.0 and 1000-5000 mg / L, and the hydraulic retention time is between 24-72 and 24-48 hours. Other reaction conditions are based on the main process flow above.

[0081] Example 5

[0082] Treatment of anaerobic effluent by Chlorella:

[0083] During the seed culture period, Chlorella vulgaris was grown in a conical flask with an inoculum ratio of 0% v / v and a culture medium consisting of 100% anaerobic porcine effluent. The total culture time was 96 hours. When the OD680 value of the Chlorella cells reached 5.0, the continuous reaction mode was entered. The culture temperature was controlled at 30°C, the light intensity was controlled at 10,000 lux, and a 24-hour light growth environment was maintained. The rotation speed was set to 00 rpm. The scale-up ratio was maintained at 1:50.

[0084] In continuous algae biochemical treatment, both the traditional activated sludge biochemical stage and the advanced treatment stage, namely tertiary treatment processes such as advanced oxidation, will be replaced by a Chlorella-based algae biochemical treatment stage, as shown in Figure 3. The design consists of a fully illuminated reactor. The hydraulic retention time (HRT) of the illuminated reactor is set to 96 hours. The Chlorella concentration (OD680) in the deep algae biochemical reactor is maintained at 10.0; the aeration rate is set to 2.0 VVM; the light intensity is set at 10,000 lux; and the algae sludge return rate can be set to 90%. The final effluent meets the national Class 1 effluent standard.

[0085] Example 6

[0086] Treatment of livestock wastewater by Chlorella:

[0087] During the seed liquid culture period, the inoculation ratio of the first stage of Chlorella grown in the conical flask was 50% v / v, and the culture medium was 100% raw wastewater from the cattle farm. The total culture time was 96 hours. When the OD680 value of the Chlorella cells reached 5.0, algae-water separation was carried out, and the wastewater treated in the first stage was transferred to the second conical flask (second stage) for culture. The new algae species were inoculated at an inoculation ratio of 80% v / v, and the culture time was continued for 96 hours. The two stages need to be expanded and cultured separately or converted to continuous culture mode respectively. The culture temperature is controlled at 30°C, the light intensity is controlled at 10,000 lux, and a 24-hour light growth environment is maintained. The rotation speed is set to 200rpm. The amplification ratio should be maintained at 1:40 each time.

[0088] In the continuous algae biochemical treatment, traditional anaerobic digestion, activated sludge biochemical treatment, and advanced treatment stages are replaced by a two-stage algae biochemical treatment stage based on Chlorella vulgaris, as shown in Figure 4. The design consists of two fully illuminated reactors. The hydraulic retention time (HRT) in the first-stage illumination reactor is set at 96 hours. The Chlorella concentration (OD680) in the advanced algae biochemical reactor is maintained at 2.5. The effluent from the first stage passes through a sedimentation tank for algae-water separation before entering the second-stage algae biochemical treatment tank. Because the first-stage treatment can remove less than 80% of the COD, total nitrogen, and total phosphorus in the raw wastewater, the HRT in the second stage can be set at 24 hours, the Chlorella concentration (OD680) at 10.0, the aeration rate at 2.0 vvm, the light intensity at 70,000 lux, and the algae sludge return rate at 70%. The final effluent meets the national Class 1 effluent standard. Using the wastewater treatment method provided by the present invention, degradation tests were conducted on the aforementioned wastewater types, with COD, ammonia nitrogen, total nitrogen, total phosphorus, and treatment time recorded (Table 1). The experiments demonstrated that the treatment speed and effectiveness of domesticated Chlorella on municipal wastewater were comparable to those achieved by the activated sludge method. For oily food processing plant wastewater, Chlorella showed no growth inhibition compared to activated sludge. Furthermore, Chlorella was able to directly treat printing and dyeing wastewater that activated sludge could not treat.

[0089] In the treatment of livestock wastewater, Chlorella has demonstrated that its ability to further degrade recalcitrant organic matter (COD reduction below 200 mg / L) can replace advanced treatment, thereby reducing the amount of chemical agents added. Furthermore, the treatment of anaerobic effluent and raw wastewater (Table 2) demonstrates that Chlorella can remove organic matter from wastewater more rapidly and efficiently than activated sludge and anaerobic digestion methods.

[0090] Table 1. Changes in water quality indicators before and after treatment of various wastewaters with Chlorella

[0091] Table 2. Changes in water quality indicators of various livestock wastewaters before and after treatment using traditional sewage treatment methods

[0092] It should be understood that the application of the present invention is not limited to the above examples. For those skilled in the art, improvements or changes can be made based on the above description. All these improvements and changes should fall within the scope of protection of the claims attached to the present invention.

Claims

1. Chlorella sp., whose deposit number is: CCTCCM 20231952.

2. The Chlorella according to claim 1, characterized in that Designing a first primer, wherein the 18sRNA sequence corresponding to the first primer is shown as SEQ ID NO.1; The first primer consists of a forward primer sequence whose nucleotide sequence is shown as SEQ ID NO.2 and a reverse primer sequence whose nucleotide sequence is shown as SEQ ID NO.

3.

3. The Chlorella according to claim 1, characterized in that Designing a second primer, wherein the 18sRNA sequence corresponding to the second primer is shown in SEQ ID NO.4; The second primer consists of a forward primer sequence whose nucleotide sequence is shown as SEQ ID NO.5 and a reverse primer sequence whose nucleotide sequence is shown as SEQ ID NO.

6.

4. Use of the Chlorella described in claim 1 in sewage treatment.

5. The use of Chlorella in sewage treatment according to claim 4, characterized in that: The sewage includes: municipal wastewater, food processing wastewater, printing and dyeing industry wastewater and animal husbandry wastewater.

6. A method for treating sewage, characterized in that: include: transporting the sewage to a reaction pool containing the Chlorella vulgaris according to claim 1, subjecting the sewage to algae biochemical treatment to obtain purified effluent; The sewage is selected from: municipal wastewater, food processing wastewater, printing and dyeing industrial wastewater; The algae biochemical treatment comprises: firstly subjecting the sewage in the reaction pool to light treatment, and then subjecting the sewage after light treatment to light-shielding treatment.

7. A sewage treatment method, characterized in that: include: The pretreated sewage is subjected to anaerobic digestion treatment and aerobic treatment in sequence to obtain biochemical effluent, wherein the sewage is livestock breeding wastewater; Performing solid-liquid separation on the biochemical effluent, conveying the obtained liquid to a reaction pool containing the Chlorella described in claim 1, performing algae biochemical treatment on the liquid to obtain purified effluent; The algae biochemical treatment comprises: firstly subjecting the sewage in the reaction pool to light treatment, and then subjecting the sewage after light treatment to light-shielding treatment.

8. A method for treating sewage, characterized in that: include: Anaerobic digestion is performed on the pretreated sewage to obtain anaerobic effluent, wherein the sewage is livestock breeding wastewater; The anaerobic effluent is subjected to solid-liquid separation, and the obtained liquid is transported to a chlorella containing the chlorella according to claim 1. In the reaction tank, the liquid is subjected to algae biochemical treatment to obtain purified water; The algae biochemical treatment comprises: firstly subjecting the liquid in the reaction pool to light treatment, and then subjecting the liquid after light treatment to light-shielding treatment.

9. A method for treating sewage, characterized in that: include: The pretreated sewage is transported to a reaction pool containing the Chlorella described in claim 1, and the livestock wastewater is subjected to algae biochemical treatment to obtain first-stage purified effluent; the sewage is livestock breeding wastewater; The first-stage purified water is transported to another reaction tank containing the Chlorella vulgaris according to claim 1, and the first-stage purified water is again subjected to algae biochemical treatment to obtain purified water; The algae biochemical treatment comprises: firstly subjecting the sewage in the reaction pool to light treatment, and then subjecting the sewage after light treatment to light-shielding treatment.

10. The sewage treatment method according to any one of claims 6 to 9, characterized in that: The method for culturing Chlorella seed solution includes: Using the sewage as a culture medium, inoculating Chlorella into the culture medium for cultivation, and obtaining the Chlorella seed liquid; The inoculation ratio of the Chlorella in the culture medium is 5-90% v / v; the culture temperature is 15-30° C.; the light intensity is 1000-10000 lux, the light duration is 2-24 hours, and the dark duration is 2-12 hours.

11. The sewage treatment method according to any one of claims 6 to 9, characterized in that: The algae biochemical treatment comprises: Setting a first biochemical pool and a second biochemical pool, wherein the first biochemical pool and the second biochemical pool contain the Chlorella described in claim 1; The sewage flows into the first biochemical pool, and the first biochemical pool is subjected to light treatment; the light intensity is 1000-10000 lux, and the residence time of the sewage in the first biochemical pool is 2-96 hours; The sewage after light treatment flows into the second biochemical pool, and the second biochemical pool is subjected to light shielding treatment, and the residence time of the sewage in the second biochemical pool is 2-96 hours; The OD680 value of the Chlorella cells in the first biochemical pool and the second biochemical pool is 1.0-10.0; and the aeration volume is 0.0-2.0 VVM.

12. The sewage treatment method according to claim 11, characterized in that: The algae mud return rate of the second biochemical pool is 5-90%.

Images