Novel terminal deoxynucleotidyl transferase (TDT) variants and uses thereof

Abstract

The invention relates to novel DNA polymerases of the polX family, and in particular Terminal deoxynucleotidyl Transferase (TdT) variants comprising specific mutations or substitutions, and to their uses.

Description

[0001] Novel Terminal deoxynucleotidyl Transferase (TdT) variants and uses thereof

[0002] Technical field

[0003] The invention relates to novel DNA polymerases of the polX family, and in particular Terminal deoxynucleotidyl Transferase (TdT) variants comprising at least one specific mutation or substitution, and their uses.

[0004] Background

[0005] Synthetic biology has been a rapidly growing field of research in recent years. It opens the possibility to synthesize biological material that does not exist in nature, such as ingredients for therapeutics or diagnostics solutions, for example genomic and diagnostic sequencing, multiplex nucleic acid amplification, therapeutic antibody development, nucleic acid-based therapeutics, DNA origami, DNA-based data storage, and the like.

[0006] Gene synthesis is usually done by relying on chemistry-based synthesis methods. Those methods, however, present a number of drawbacks, such as the fact that for each added nucleotide, the probability of genetic error is about 0.5% and therefore with increasing sequences length, the percentage of errors rapidly becomes unsustainable.

[0007] Recently, interest has arisen in supplementing or replacing chemistry-based synthesis methods by enzymebased methods using template-free polymerases, such as, terminal deoxynucleotidyl transferase (TdT), because of the proven efficiency of such enzymes, their high synthesis rate, the limited error rate they provide and the benefit of mild non- toxic reaction conditions, e.g. WO2015 / 159023; US5763594; Jensen et al, Biochemistry, 57: 1821-1832 (2018); and the like.

[0008] Most methods using enzyme-based synthesis require the use of reversibly blocked nucleoside triphosphates in order to obtain the desired sequence for the polynucleotide product. Unfortunately, template-free polymerases incorporate such modified nucleoside triphosphates with reduced efficiency as compared to unmodified nucleoside triphosphates. Thus, new template-free polymerases variants with better incorporation efficiencies for modified nucleoside triphosphates have been developed, e.g. US2019 / 0211315, WO2021 / 116270; WO2017 / 216472, and the like .

[0009] Despite the development of new template-free polymerases variants, the DNA quality generated by enzymatic DNA synthesis is still in need of improvement, for example, via reducing the risk of lack of incorporation of the desired nucleotide, ultimately leading to substitutions, deletions, or insertions during DNA synthesis. In some instances, these misincorporations are caused by the inability of template-free polymerases to incorporate the desired nucleotide, for example when the growing oligonucleotide chain presents a hairpin secondary structure. There is thus a need for new template-free polymerases variants that limit, or even eliminate, substitutions, deletions or insertions during DNA synthesis and therefore achieve the delivery of synthetic DNA with improved quality.

[0010] To address this need, the inventors have developed new TdT variants and surprisingly discovered more active TdT variants that produce DNA strands or RNA strands with less misincorporations such as deletions, insertions or substitutions, particularly during DNA synthesis.

[0011] Summary of the invention

[0012] The invention relates to novel terminal deoxynucleotidyl transferase (TdT) variants, with or without a tag moiety, which may have a sequence set forth in SEQ ID NO: 4 as an example.

[0013] Exemplary variants comprise the amino acid sequence as set forth in SEQ ID NO:5 or SEQ ID NO: 15.

[0014] The novel terminal deoxynucleotidyl transferase (TdT) variant comprises an amino acid sequence at least 70% identical to SEQ ID NO: 1, preferably at least 75%, 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 1 and optionally less than 100% identical to SEQ ID NO: 1, wherein said amino acid sequence comprises at least one amino acid substitution with a substitute amino acid at position selected from a first group consisting of positions 32, 35, 52, 58, 61, 74, 103, 107, 137, 145, 155, 168, 170, 172, 188, 206, 208, 216, 230, 246, 248, 262, 264, 298, 304, 305, 307, 308 and 309, or at functionally equivalent position of each position of said first group, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO: 1 or an amino acid sequence at least 70% identical to SEQ ID NO:39, preferably at least 75%, 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:39 and optionally less than 100% identical to SEQ ID NO:39, wherein said amino acid sequence comprises at least one amino acid replacement with a replacing amino acid at position selected from a second group consisting of positions 17, 20, 37, 43, 46, 59, 88, 92, 122, 130, 140, 153, 155, 157, 173, 191, 193, 201, 215, 231, 233, 247, 249, 283, 289, 290, 292, 293 and 294, or at functionally equivalent position of each position of said second group, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO: 39.

[0015] In some embodiments, the novel TdT variant comprises the amino acid sequence as set forth in SEQ ID NO: 1, wherein said amino acid sequence comprises at least one amino acid substitution with an amino acid at position selected from the group consisting of positions 32, 35, 52, 58, 61, 74, 103, 107, 137, 145, 155, 168, 170, 172, 188, 206, 208, 216, 230, 246, 248, 262, 264, 298, 304, 305, 307, 308 and 309, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO: 1.

[0016] In some embodiments, the novel TdT variant comprises the amino acid sequence as set forth in SEQ ID NO:39, wherein said amino acid sequence comprises at least one amino acid replacement with an amino acid at position selected from the group consisting of positions 17, 20, 37, 43, 46, 59, 88, 92, 122, 130, 140, 153, 155, 157, 173, 191, 193, 201, 215, 231, 233, 247, 249, 283, 289, 290, 292, 293 and 294, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO:39.

[0017] In a particular embodiment the terminal deoxynucleotidyl transferase (TdT) variant comprises more than one amino acid substitution in the amino acid sequence as set forth in SEQ ID NO: 1, preferably at least two amino acid substitutions, more preferably at least three amino acid substitutions.

[0018] In a particular embodiment the terminal deoxynucleotidyl transferase (TdT) variant comprises more than one amino acid replacement in the amino acid sequence as set forth in SEQ ID NO:39, preferably at least two amino acid replacements, more preferably at least three amino acid replacements.

[0019] In some embodiments, the amino acid substituted in the amino acid sequence as set forth in SEQ ID NO: 1 is selected from the group consisting of Cysteine (C), Aspartic Acid (D), Glutamic Acid (E), Isoleucine (I), Methionine (M), Asparagine (N), Proline (P), Serine (S), Tryptophan (W), Tyrosine (Y), Arginine (R), Valine (V), Alanine (A), Leucine (L), Lysine (K), Glutamine (Q), Threonine (T) and Glycine (G).

[0020] In some embodiments, the amino acid replaced in the amino acid sequence as set forth in SEQ ID NO:39 is selected from the group consisting of Cysteine (C), Aspartic Acid (D), Glutamic Acid (E), Isoleucine (I), Methionine (M), Asparagine (N), Proline (P), Serine (S), Tryptophan (W), Tyrosine (Y), Arginine (R), Valine (V), Alanine (A), Leucine (L), Lysine (K), Glutamine (Q), Threonine (T) and Glycine (G).

[0021] In a particular embodiment, the TdT variant comprises an amino acid sequence selected from SEQ ID NO:5 to SEQ ID NO:38.

[0022] In a particular embodiment, the TdT variant comprises an amino acid sequence selected from SEQ ID NO:40 to SEQ ID NO:73.

[0023] The invention also relates to kits for performing template-free polynucleotide elongations of any predetermine sequence, wherein the kits include at least one TdT variant of the invention, at least one 3’- O-modified nucleoside triphosphates, and optionally at least one initiator. Such kit may further comprise a deoxyribonucleoside triphosphates (dNTPs) for A, C, G and T for DNA elongation, or ribonucleoside triphosphates (rNTPs) for rA, rC, rG and U for RNA elongation.

[0024] Thus, the kit comprises at least one TdT variant according to the invention. In this context, one understands that the kit can comprise one TdT variant or many TdT variants, for example two different TdT variants.

[0025] In a particular embodiment, the kit comprises more than one TdT variant, in particular the kit comprises two TdT variants according to the invention, more preferably the kit comprises three TdT variants according to the invention.

[0026] In some embodiments, the kit comprises at least one TdT variant comprising an amino acid sequence selected from SEQ ID NO:5 to SEQ ID NO:38. In a particular embodiment the kit comprises two TdT variants, the first TdT variant comprising an amino acid sequence selected from SEQ ID NO: 5 to SEQ ID NO:38 and the second TdT variant comprising an amino acid sequence also selected from SEQ ID NO:5 to SEQ ID NO:38, said second TdT variant being different from the first TdT variant. In another particular embodiment, the kit comprises three TdT variants according to the invention, more preferably the kit comprises three different TdT variants each comprising amino acid sequences independently selected from the amino acid sequences set forth in SEQ ID NO:5 to SEQ ID NO:38.

[0027] In some embodiments, the kit comprises at least one TdT variant comprising an amino acid sequence selected from SEQ ID NO:40 to SEQ ID NO:73. In a particular embodiment the kit comprises two TdT variants, the first TdT variant comprising an amino acid sequence selected from SEQ ID NO:40 to SEQ ID NO:73 and the second TdT variant comprising an amino acid sequence also selected from SEQ ID NO:40 to SEQ ID NO:73, said second TdT variant being different from the first TdT variant. In another particular embodiment, the kit comprises three TdT variants according to the invention, more preferably the kit comprises three different TdT variants each comprising amino acid sequences independently selected from the amino acid sequences set forth in SEQ ID NO:40 to SEQ ID NO:73.

[0028] In some embodiments, the kit comprises at least one TdT variant comprising an amino acid sequence at least 70% identical to an amino acid sequence selected from SEQ ID NO: 5 to SEQ ID NO: 38. In a particular embodiment the kit comprises two TdT variants, the first TdT variant comprising an amino acid sequence at least 70% identical to an amino acid sequence elected from SEQ ID NO:5 to SEQ ID NO:38 and the second TdT variant comprising an amino acid sequence at least 70% identical to an amino acid sequence also selected from SEQ ID NO:5 to SEQ ID NO:38, said second TdT variant being different from the first TdT variant.

[0029] In some embodiments, the kit comprises at least one TdT variant comprising an amino acid sequence at least 70% identical to an amino acid sequence selected from SEQ ID NO:40 to SEQ ID NO:73. In a particular embodiment the kit comprises two TdT variants, the first TdT variant comprising an amino acid sequence at least 70% identical to an amino acid sequence elected from SEQ ID NO: 40 to SEQ ID NO: 73 and the second TdT variant comprising an amino acid sequence at least 70% identical to an amino acid sequence also selected from SEQ ID NO:40 to SEQ ID NO:73, said second TdT variant being different from the first TdT variant.

[0030] Advantageously, the TdT variants according to the invention overcome the technical problems of prior art TdT variants and prevent deletions, insertions and lower incorporation of other undesired triphosphates, for example chemically damaged dNTPs, during the enzymatic synthesis of nucleic acids. In particular, the TdT variants according to the invention improve the low insertion rates of 3’-O-modified deoxyadenosine triphosphates (dATPs) in difficult sequences, which low insertion rates are commonly observed with the TdT variants of the prior art.

[0031] The present invention also relates to a method of synthesizing a polynucleotide, the method comprising the steps of: a. providing at least one initiator having a 3 ’-terminal nucleotide which has a free 3 ’-hydroxyl; b. contacting under elongation conditions said at least one initiator having a free 3 ’-hydroxyl with a 3’-O-blocked nucleoside triphosphate and a TdT variant according to the invention, so that said at least one initiator is elongated by incorporation of a 3’-O-blocked nucleoside triphosphate to form a 3’-O-blocked elongated fragment, and c. deblocking the elongated fragment to form an elongated fragment having free 3 ’-hydroxyl, and d. repeating steps b. and c. by contacting under elongation conditions the elongated fragment obtained in step c., until the polynucleotide is formed.

[0032] In further embodiments, the invention includes at least one nucleic acid molecule encoding a TdT variant described above, preferably the invention includes more than one nucleic acid molecule, each said nucleic acid molecule encoding a protein sequence corresponding to a TdT variant that has been described.

[0033] The invention also includes at least one expression vector comprising such a nucleic acid molecule, and at least one host cell comprising the aforementioned nucleic acid molecule or the aforementioned expression vector. In still further embodiments, the invention includes methods for producing at least one TdT variant of the invention, wherein a host cell is cultivated under culture conditions allowing the expression of the nucleic acid encoding said TdT variant, and wherein the TdT variant is optionally retrieved.

[0034] Brief description of the drawing

[0035] Fig. 1 illustrates diagrammatically the steps of a method of template-free enzymatic nucleic acid synthesis using TdT variants of the invention.

[0036] Detailed description of the invention

[0037] Definition

[0038] The amino acids are represented in this description by a one-letter or three-letter code according to the following nomenclature: A: Ala (alanine); R: Arg (arginine); N: Asn (asparagine); D: Asp (aspartic acid); C: Cys (cysteine); Q: Gin (glutamine); E: Glu (glutamic acid); G: Gly (glycine); H: His (histidine); I: He (isoleucine); L: Leu (leucine); K: Lys (lysine); M: Met (methionine); F: Phe (phenylalanine); P: Pro (proline); S: Ser (serine); T: Thr (threonine); W: Trp (tryptophan); Y: Tyr (tyrosine); V: Vai (valine) and also X (undetermined amino acid).

[0039] “Terminal deoxynucleotidyl transferase (TdT) variant” in the context of the invention, means a group of TdT mutants that share a set of mutations or alterations. An alteration or mutation can be a substitution, an insertion and / or a deletion in one or more positions and allowing to preserve a DNA polymerase activity. For example, one, two, three, or more mutations are shared by a group of TdT mutants. In particular, TdTs having the amino acid sequences set forth in SEQ ID NO:5 to SEQ ID NO:38 are mutants and said TdTs share a set of mutations and constitute a variant. TdTs having the amino acid sequences set forth in SEQ ID NO:40 to SEQ ID NO:73 also are mutants and said TdTs share a set of mutations and also constitute a variant.

[0040] TdT variants according to the invention are preferably truncated TdT variants by comparison with the wildtype TdT proteins having the highest identity percentage in the N-ter region with said TdT variant according to the invention. The TdT variants can be obtained by various techniques well known in the art. In particular, examples of techniques for modifying the DNA sequence encoding wild-type proteins include, without being limited thereto, directed mutagenesis, random mutagenesis, and the construction of synthetic polynucleotides.

[0041] “Truncated TdT variant”, in the context of the invention, means a TdT which does not comprise the N- terminal part of the corresponding wild-type TdT. In particular, TdT variants according to the invention are N-terminally truncated TdTs lacking amino acids residues 1 to 147 of the corresponding wild-type parent NP_001036693. 1 [Mus musculus] TdT sequence. As will be explained in greater details further below, the N-terminal part of the truncated TdT variants according to the invention may nevertheless comprise an inserted Tag, such as for example the Tag of SEQ ID NO:4 added at the N-terminus of the variant.

[0042] “Undetermined amino acid” or “unknown amino acid” or “X”, in the context of the invention, mean an amino acid which can be one of the 20 amino acids selected from the group consisting of Alanine, Arginine, Asparagine, Aspartic acid, Cysteine, Glutamic acid, Glutamine, Glycine, Histidine, Isoleucine, Leucine, Lysine, Methionine, Phenylalanine, Proline, Serine, Threonine, Tryptophan, Tyrosine and Valine.

[0043] “Substituted amino acid” or “replaced amino acid” in the context of the invention, means a substitution of an original amino acid (before substitution or mutation) with another amino acid at a specific position, in particular at a position selected from a first group consisting of positions 32, 35, 52, 58, 61, 74, 103, 107, 137, 145, 155, 168, 170, 172, 188, 206, 208, 216, 230, 246, 248, 262, 264, 298, 304, 305, 307, 308 and 309, which positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO: 1 or selected from a second group consisting of positions 17, 20, 37, 43, 46, 59, 88, 92, 122, 130, 140, 153, 155, 157, 173, 191, 193, 201, 215, 231, 233, 247, 249, 283, 289, 290, 292, 293 and 294, which positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO:39. For example at position 32 with respect to SEQ ID NO: 1 or at position 17 with respect to SEQ ID NO:39, the original amino acid is Y and the substituted amino acid is N in the sequences of SEQ ID NO:34 and SEQ ID NO:69.

[0044] “% of identity” or “percentage of identity” or “at least % identical to” between two nucleic acid or amino acid sequences in the sense of the present invention is understood to designate the percentage of nucleotides or of amino acid residues which are identical between the two sequences to be compared, which is obtained after the best alignment, this percentage being purely statistical and the differences between the two sequences being distributed randomly and over their entire length. In cases where the lengths of the two sequences being compared are different, the percentage of identity is calculated over the entire length of the shortest sequence. The best alignment of the sequences for the comparison can be carried out, besides manually, by means of the local homology algorithm of Smith and Waterman (1981) (Ad. App. Math. 2:482), by means of the local homology algorithm of Neddleman and Wunsch (1970) (J. Mol. Biol. 48:443), by means of the similarity search method of Pearson and Lipman (1988) (Proc. Natl. Acad. Sci. USA 85:2444), by means of computer software using these algorithms (GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), by means of the online alignment software Mutalin (http: / / multalin.toulouse.inra.fr / multalin / multalin.html; 1988, Nucl. Acids Res., 16 (22), 10881-10890).

[0045] “Functionally equivalent sequence” in the sense of the present invention is understood to mean a sequence of a DNA polymerase of the polX family, in particular TdT, having a sequence, i.e. an amino acid sequence, of at least 70%, 75%, 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98% or 99% of identity to any one of the group consisting of SEQ ID NO:5 to SEQ ID NO:38 and SEQ ID NO:40 to SEQ ID NO:73 and having an identical functional role.

[0046] “Functionally equivalent residue” is understood to mean a residue in a sequence of a DNA polymerase of the polX family, in particular TdT, having a sequence homologous to any one of SEQ ID NO: 5 to SEQ ID NO:72 and having an identical functional role. Functionally equivalent residues are identified by using sequence alignments, for example, using the Mutalin line alignment software (http: / / multalin.toulouse.inra.fr / multalin / multalin.html; 1988, Nucl. Acids Res., 16 (22), 5 10881-10890). After alignment, the functionally equivalent residues are at homologous positions on the different sequences considered. Sequence alignments and identification of functionally equivalent residues may be between any DNA polymerases of the polX family and their natural variants, including inter-species. The “functionally equivalent position” is thus the position of the functionally equivalent residue in the homologous sequence.

[0047] “Comprise at least one amino acid substitution” in the sense of the present invention is understood to mean that the variant has one or more substitutions or mutations as indicated with respect to the sequence SEQ ID NO: 1, but it can have other modifications, in particular substitutions, deletions or additions.

[0048] “Comprise at least one amino acid replacement” in the sense of the present invention is understood to mean that the variant has one or more substitutions or mutations as indicated with respect to the sequence SEQ ID NO:39, but it can have other modifications, in particular substitutions, deletions or additions.

[0049] The invention relates to variant of DNA polymerases of the polX family, in particular TdT variants, which are stabilized variants of the TdT polymerase that can be used for synthesizing polynucleotides, such as DNA or RNA, without a template strand. The TdT variants of the invention allow modified nucleotides, and more particularly 3’O-reversibly blocked nucleoside triphosphates, to be used in an enzyme-based method of polynucleotide synthesis. In particular, the TdT variant is a truncated TdT variant, more particularly a N-terminal truncated TdT variant.

[0050] Template-Free Enzymatic Synthesis

[0051] Template-free enzymatic synthesis of polynucleotides may be carried out by a variety of known protocols using template-free polymerases, such as terminal deoxynucleotidyl transferase (TdT), including variants thereof engineered to have improved characteristics, such as greater temperature stability or greater efficiency in the incorporation of 3’-O-blocked deoxynucleoside triphosphates (3’-O-blocked dNTPs), such as those used in WO / 2015 / 159023; WO / 2017 / 216472; US5,436,143; US5,763,594; Jensen et al, Biochemistry, 57: 1821-1832 (2018); Mathews et al, Organic & Biomolecular Chemistry, DOI: 0.1039 / c6ob01371f (2016); Schmitz et al, Organic Lett., 1(11): 1729-1731 (1999). In some embodiments, the method of enzymatic DNA synthesis comprises repeated cycles of steps, such as are illustrated in Fig. 1, in which a nucleotide is added in each cycle. Initiator polynucleotides (100) are provided, for example, attached to solid support (102), which have free 3’-hydroxyl groups (103). To the initiator polynucleotides (100) (or elongated initiator polynucleotides in subsequent cycles) are added a 3’- O-protected-dNTP and a TdT variant under conditions (104) effective for the enzymatic incorporation of the 3’-O-protected-dNTP onto the 3’ end of the initiator polynucleotides (100) (or elongated initiator polynucleotides). This reaction produces elongated initiator polynucleotides whose 3 ’-hydroxyls are protected (106). If the elongated initiator polynucleotide contains a completed sequence, then the 3’-O-protection group is removed, or deprotected, and the desired sequence is cleaved from the original initiator polynucleotide (110). Such cleavage may be carried out using any of a variety of single strand cleavage techniques, for example, by inserting a cleavable nucleotide or cleavable linker at a predetermined location within the original initiator polynucleotide. Exemplary cleavable nucleotides or linkers include, but are not limited to, (i) a uracil nucleotide which is cleaved by uracil DNA glycosylase; (ii) a photocleavable group, such as a nitrobenzyl linker, as described in U.S. patent 5,739,386; or an inosine which is cleaved by endonuclease V. If the elongated initiator polynucleotide does not contain a completed sequence, then the 3’-O-protection groups are removed (108) to expose free 3’-hydroxyls (103) and the elongated initiator polynucleotides are subjected to another cycle of nucleotide addition and deprotection.

[0052] In other words, the method of synthesizing a polynucleotide, comprises the steps of : a. providing at least one initiator having a 3 ’-terminal nucleotide having a free 3 ’-hydroxyl; b. contacting under elongation conditions said at least one initiator having free 3 ’-hydroxyl with a 3’-O-blocked nucleoside triphosphate and a TdT variant according to the invention, so that the initiator is elongated by incorporation of the 3’-O-blocked nucleoside triphosphate to form a 3’- O-blocked elongated fragment; c. deblocking the elongated fragment to form an elongated fragment having a free 3 ’-hydroxyl; and d. repeating steps b. and c. by contacting under elongation conditions the elongated fragment obtained in step c.; until the polynucleotide is formed.

[0053] In some embodiments, a cleaved polynucleotide may have a free 5 ’-hydroxyl; in other embodiments, a cleaved polynucleotide may have a 5 ’-phosphorylated end.

[0054] As used herein, the terms “protected” and “blocked” in reference to specified groups, such as, a 3 ’-hydroxyl of a nucleotide or a nucleoside, are used interchangeably and are intended to mean a moiety is attached covalently to the specified group that prevents a chemical change to the group during a chemical or enzymatic process. Whenever the specified group is a 3 ’-hydroxyl of a nucleoside triphosphate, or an extended fragment (or “extension intermediate”) in which a 3 ’-protected (or blocked)-nucleoside triphosphate has been incorporated, the prevented chemical change is a further, or subsequent, extension of the extended fragment (or “extension intermediate”) by an enzymatic coupling reaction. In some embodiments, an ordered sequence of nucleotides are coupled to an initiator nucleic acid using a TdT in the presence of 3’-O-reversibly blocked dNTPs in each synthesis step. In some embodiments, the method of synthesizing a polynucleotide comprises the steps of (a) providing an initiator having a free 3’- hydroxyl; (b) reacting under extension conditions the initiator or an extension intermediate having a free 3 ’-hydroxyl with a TdT in the presence of a 3’-O-blocked nucleoside triphosphate to produce a 3’-O- blocked extension intermediate; (c) deblocking the extension intermediate to produce an extension intermediate with a free 3 ’-hydroxyl; and (d) repeating steps (b) and (c) until the polynucleotide is synthesized. Sometime “an extension intermediate” is also referred to as an “elongation fragment.”

[0055] In some embodiments, an initiator is provided as an oligonucleotide attached to a solid support, e.g. by its 5’ end. The above method may also include washing steps after the reaction, or extension, step, as well as after the de-blocking step. For example, the step of reacting may include a sub-step of removing unincorporated nucleoside triphosphates, e.g. by washing, after a predetermined incubation period, or reaction time. Such predetermined incubation periods or reaction times may be a few seconds, e.g. 30 sec, to several minutes, e.g. 30 min.

[0056] The above method may also include capping step(s) as well as washing steps after the reacting, or extending, step, as well as after the deblocking step. As mentioned above, in some embodiments, capping steps may be included in which non-extended free 3 ’-hydroxyls are reacted with compounds that prevent any further extensions of the capped strand. In some embodiments, such compound may be a dideoxynucleoside triphosphate. In other embodiments, non-extended strands with free 3 ’-hydroxyls may be degraded by treating them with a 3 ’-exonuclease activity, e.g. Exo I. For example, see Hyman, U.S. patent 5436143. Likewise, in some embodiments, strands that fail to be deblocked may be treated to either remove the strand or render it inert to further extensions.

[0057] In some embodiments that comprise serial synthesis of polynucleotides, capping steps may be undesirable as capping may prevent the production of equal molar amounts of a plurality of polynucleotides. Without capping, sequences will have a uniform distribution of deletion errors, but each of a plurality of polynucleotides will be present in equal molar amounts. This would not be the case where non-extended fragments are capped.

[0058] In some embodiments, reaction conditions for an extension or elongation step may comprise the following: from 2.0 pM to 50 pM purified TdT, preferably about 25 pM purified TdT; from 125 pM to 600 pM 3’- O-blocked dNTP (e.g. 3’-O-NH2-blocked dNTP); from about 10 mM to about 500 mM potassium cacodylate buffer (pH between 6.5 and 7.5) and from about 0.01 to about 10 mM of a divalent cation (e.g. CoCU or MnCU), where the elongation reaction may be carried out in a 50 pL reaction volume, at a temperature within the range of from room temperature to about 45°C, for a duration of, e.g., 3 minutes. In some embodiments, in which the 3’-O-blocked dNTPs are 3’-O-NH2-blocked dNTPs, reaction conditions for a deblocking step may comprise the following: 700 mM NaNCE; 1 M sodium acetate (adjusted with acetic acid to pH in the range of 4.8-6.5), where the deblocking reaction may be carried out in a 50 pL volume, at a temperature within the range of from room temperature to 45°C for a duration of about 30 seconds to several minutes.

[0059] Depending on particular applications, the steps of deblocking and / or cleaving may include a variety of chemical or physical conditions, e.g. light, heat, pH, presence of specific reagents, such as enzymes, which are able to cleave a specified chemical bond. Guidance in selecting 3’-O-blocking groups and corresponding de-blocking conditions may be found in the following references, which are incorporated by reference: US5,808,045; US8,808,988; WO91 / 06678; and references cited below. In some embodiments, the cleaving agent (also sometimes referred to as a de-blocking reagent or agent) is a chemical cleaving agent, such as, for example, dithiothreitol (DTT). In alternative embodiments, a cleaving agent may be an enzymatic cleaving agent, such as, for example, a phosphatase, which may cleave a 3 ’-phosphate blocking group. It will be understood by the person skilled in the art that the selection of deblocking agent depends on the type of 3 ’-nucleotide blocking group used, whether one or multiple blocking groups are being used, whether initiators are attached to living cells or organisms or to solid supports, and the like, that necessitate mild treatment. For example, a phosphine, such as tris(2-carboxyethyl)phosphine (TCEP) can be used to cleave 3’0-azidomethyl groups, palladium complexes can be used to cleave 3’0-allyl groups, or sodium nitrite can be used to cleave 3’0-amino groups. In particular embodiments, the cleaving reaction involves TCEP, a palladium complex or sodium nitrite.

[0060] As noted above, in some embodiments it is desirable to employ two or more blocking groups that may be removed using orthogonal deblocking conditions. The following exemplary pairs of blocking groups may be used in parallel synthesis embodiments, such as those described above. It is understood that other blocking group pairs, or groups containing more than two, may be available for use in these embodiments of the invention.

[0061] Synthesizing oligonucleotides on living cells requires mild deblocking, or deprotection, conditions, that is, conditions that do not disrupt cellular membranes, denature proteins, interfere with key cellular functions, or the like. In some embodiments, deprotection conditions are within a range of physiological conditions compatible with cell survival. In such embodiments, enzymatic deprotection is desirable because it may be carried out under physiological conditions. In some embodiments specific enzymatically removable blocking groups are associated with specific enzymes for their removal. For example, ester- or acyl-based blocking groups may be removed with an esterase, such as acetylesterase, or like enzyme, and a phosphate blocking group may be removed with a 3’ phosphatase, such as T4 polynucleotide kinase. By way of example, 3’-O-phosphates may be removed by treatment with as solution of 100 mM Tris-HCl (pH 6.5) 10 mM MgC h , 5 mM 2-mercaptoethanol, and one Unit T4 polynucleotide kinase. The reaction proceeds for one minute at a temperature of 37°C.

[0062] A "3 '-phosphate-blocked” or “3’-phosphate-protected” nucleotide refers to nucleotides in which the hydroxyl group at the 3'-position is blocked by the presence of a phosphate containing moiety. Examples of 3 '-phosphate-blocked nucleotides in accordance with the invention are nucleotidyl-3 '-phosphate monoes- ter / nucleotidyl-2',3'-cyclic phosphate, nucleotidyl-2'-phosphate monoester and nucleotidyl-2' or 3'-al- kylphosphate diester, and nucleotidyl -2' or 3 '-pyrophosphate. Thiophosphate or other analogs of such compounds can also be used, provided that the substitution does not prevent dephosphorylation resulting in a free 3 ’-OH by a phosphatase.

[0063] Further examples of synthesis and enzymatic deprotection of 3’-O-ester-protected dNTPs or 3’-O-phos- phate-protected dNTPs are described in the following references: Canard et al, PNAS., 92: 10859-10863 (1995); Canard et al, Gene, 148: 1-6 (1994); Cameron et al, Biochemistry, 16(23): 5120-5126 (1977); Ra- solonjatovo et al, Nucleosides & Nucleotides, 18(4&5): 1021-1022 (1999); Ferrero et al, Monatshefte fur Chemie, 131: 585-616 (2000); Taunton-Rigby et al, J. Org. Chem., 38(5): 977-985 (1973); Uemura et al, Tetrahedron Lett., 30(29): 3819-3820 (1989); Becker et al, J. Biol. Chem., 242(5): 936-950 (1967); Tsien, International patent publication WO1991 / 006678.

[0064] As used herein, an “initiator” (or equivalent terms, such as, “initiating fragment,” “initiator nucleic acid,” “initiator oligonucleotide,” or the like) refers to a short oligonucleotide sequence with a free 3 ’-end, which can be further elongated by a template-free polymerase, such as TdT. In one embodiment, the initiating fragment is a DNA initiating fragment. In an alternative embodiment, the initiating fragment is an RNA initiating fragment. In some embodiments, the initiating fragment possesses between 3 and 100 nucleotides, in particular between 3 and 20 nucleotides. In some embodiments, the initiating fragment is singlestranded. In an alternative embodiment, the initiating fragment is double-stranded. In a particular embodiment, an initiator oligonucleotide synthesized with a 5 ’-primary amine may be covalently linked to magnetic beads using the manufacturer’s protocol. Likewise, an initiator oligonucleotide synthesized with a 3 ’-primary amine may be covalently linked to magnetic beads using the manufacturer’s protocol. A variety of other attachment chemistries amenable for use with embodiments of the invention are well-known in the art, e.g. Integrated DNA Technologies brochure, “Strategies for Attaching Oligonucleotides to Solid Supports,” v.6 (2014); Hermanson, Bioconjugate Techniques, Second Edition (Academic Press, 2008); and like references.

[0065] Many of the 3’-O-blocked dNTPs employed in the invention may be purchased from commercial vendors or synthesized using published techniques, e.g. US7,057,026; W02004 / 005667; WO91 / 06678; Canard et al, Gene (cited above); Metzker et al, Nucleic Acids Research, 22: 4259-4267 (1994); Meng et al, J. Org. Chem., 14: 3248-3252 (3006); US2005 / 037991. In some embodiments, the modified nucleotides comprise a modified nucleotide or nucleoside molecule comprising a purine or pyrimidine base and a ribose or deoxyribose sugar moiety having a removable 3 ’-OH blocking group covalently attached thereto, such that the 3’ carbon atom has attached a group of the structure:

[0066] -O-Z wherein -Z is any of -C(R’)2-O-R”, -C(R’)2-N(R”)2, -C(R’)2-N(H)R”, -C(R’)2-S-R” and -C(R’)2-F, wherein each R” is or is part of a removable protecting group; each R’ is independently a hydrogen atom, an alkyl, substituted alkyl, arylalkyl, alkenyl, alkynyl, aryl, heteroaryl, heterocyclic, acyl, cyano, alkoxy, aryloxy, heteroaryloxy or amido group, or a detectable label attached through a linking group; with the proviso that in some embodiments such substituents have up to 10 carbon atoms and / or up to 5 oxygen or nitrogen heteroatoms; or (R’)2represents a group of formula =C(R”’)2wherein each R’” may be the same or different and is selected from the group comprising hydrogen and halogen atoms and alkyl groups, with the proviso that in some embodiments the alkyl of each R’” has from 1 to 3 carbon atoms; and wherein the molecule may be reacted to yield an intermediate in which each R” is exchanged for H or, where Z is - (R’)2-F, the F is exchanged for OH, SH or NH2, preferably OH, which intermediate dissociates under aqueous conditions to afford a molecule with a free 3 ’-OH; with the proviso that where Z is -C(R’)2-S-R”, both R’ groups are not H. In certain embodiments, R’ of the modified nucleotide or nucleoside is an alkyl or substituted alkyl, with the proviso that such alkyl or substituted alkyl has from 1 to 10 carbon atoms and from 0 to 4 oxygen or nitrogen heteroatoms. In certain embodiments, -Z of the modified nucleotide or nucleoside is of formula -C(R’)2-N3. In certain embodiments, Z is an azidomethyl group.

[0067] In some embodiments, Z is a cleavable organic moiety with or without heteroatoms having a molecular weight of 200 or less. In other embodiments, Z is a cleavable organic moiety with or without heteroatoms having a molecular weight of 100 or less. In other embodiments, Z is a cleavable organic moiety with or without heteroatoms having a molecular weight of 50 or less. In some embodiments, Z is an enzymatically cleavable organic moiety with or without heteroatoms having a molecular weight of 200 or less. In other embodiments, Z is an enzymatically cleavable organic moiety with or without heteroatoms having a molecular weight of 100 or less. In other embodiments, Z is an enzymatically cleavable organic moiety with or without heteroatoms having a molecular weight of 50 or less. In other embodiments, Z is an enzymatically cleavable ester group having a molecular weight of 200 or less. In other embodiments, Z is a phosphate group removable by a 3 ’-phosphatase. In some embodiments, one or more of the following 3 ’-phosphatases may be used with the manufacturer’s recommended protocols: T4 polynucleotide kinase, calf intestinal alkaline phosphatase, recombinant shrimp alkaline phosphatase (e.g. available from New England Biolabs, Beverly, MA).

[0068] In a further particular embodiments, the 3’-O-blocked nucleotide triphosphate is blocked by either a 3’-O- azidomethyl, 3’-O-NH2or 3’-O-allyl group. In other embodiments, the 3 ’-blocked nucleotide triphosphate is blocked by either a 3’-O-azidomethyl or a 3’-O-NH2. In some embodiments, 3’-O-blocking groups of the invention include 3’-O-methyl, 3 ’-O-(2 -nitrobenzyl), 3’-O-allyl, 3’-0-amine, 3’-O-azidomethyl, 3’-O-tert-butoxy ethoxy, 3 ’-O-(2 -cyanoethyl), and 3’-O-propar- gyi-

[0069] TdT variant

[0070] According to a first aspect of the invention, the TdT variant according to the invention comprises the amino acid sequence as set forth in SEQ ID NO: 1, wherein said amino acid sequence comprises at least one amino acid substitution with an amino acid at aposition selected from the group consisting of positions 32, 35, 52, 58, 61, 74, 103, 107, 137, 145, 155, 168, 170, 172, 188, 206, 208, 216, 230, 246, 248, 262, 264, 298, 304, 305, 307, 308 and 309, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO: 1. In particular, the TdT variant according to the invention (i) is capable of synthesizing a nucleic acid fragment without a template and (ii) is capable of incorporating a 3’-O-modified nucleotide onto a nucleic acid fragment.

[0071] In a particular embodiment, said amino acid sequence can comprise more than one amino acid substitution, preferably at least two, at least three, at least four, more preferably at least five, amino acid substitutions selected from the group consisting of positions 32, 35, 52, 58, 61, 74, 103, 107, 137, 145, 155, 168, 170, 172, 188, 206, 208, 216, 230, 246, 248, 262, 264, 298, 304, 305, 307, 308 and 309. Said TdT variants are capable of synthesizing a DNA strand and / or an RNA strand.

[0072] In another embodiment, the TdT variant according to the invention has the amino acid sequence as set forth in SEQ ID NO: 1, wherein said amino acid sequence comprises at least one amino acid substitution with an amino acid at a position selected from the group consisting of positions 32, 35, 52, 58, 61, 74, 103, 107, 137, 145, 155, 168, 170, 172, 188, 206, 208, 216, 230, 246, 248, 262, 264, 298, 304, 305, 307, 308 and 309, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO: 1.

[0073] According to a second aspect of the invention, the TdT variant according to the invention comprises an amino acid sequence at least 70% identical to SEQ ID NO: 1, preferably at least 75%, 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 1 and optionally less than 100% identical to SEQ ID NO: 1, wherein said amino acid sequence comprises at least one amino acid substitution with a substitute amino acid at position selected from the first group consisting of positions 32, 35, 52, 58, 61, 74, 103, 107, 137, 145, 155, 168, 170, 172, 188, 206, 208, 216, 230, 246, 248, 262, 264, 298, 304, 305, 307, 308 and 309, or at functionally equivalent positions of each position of said first group, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO: 1. In particular, the TdT variant according to the invention (i) is capable of synthesizing a nucleic acid fragment without a template and (ii) is capable of incorporating a 3’-O-modified nucleotide onto a nucleic acid fragment.

[0074] In a particular embodiment, said amino acid sequence can comprise more than one amino acid substitution, preferably at least two, at least three, at least four, more preferably at least five, amino acid substitutions, selected from the group consisting of positions 32, 35, 52, 58, 61, 74, 103, 107, 137, 145, 155, 168, 170, 172, 188, 206, 208, 216, 230, 246, 248, 262, 264, 298, 304, 305, 307, 308 and 309. Said TdT variants are capable of synthesizing a DNA strand and / or an RNA strand.

[0075] In another embodiment, the TdT variant according to the invention has an amino acid sequence at least 70% identical to SEQ ID NO: 1, preferably at least 75%, 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 1 and optionally less than 100% identical to SEQ ID NO: 1, wherein said amino acid sequence comprises at least one amino acid substitution with a substitute amino acid at a position selected from the group consisting of positions 32, 35, 52, 58, 61, 74, 103, 107, 137, 145, 155, 168, 170,

[0076] 172, 188, 206, 208, 216, 230, 246, 248, 262, 264, 298, 304, 305, 307, 308 and 309, or at functionally equivalent positions of each position of said first group, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO: 1.

[0077] According to a third aspect of the invention, the TdT variant according to the invention comprises an amino acid sequence at least 70% identical to SEQ ID NO:39, preferably at least 75%, 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:39 and optionally less than 100% identical to SEQ ID NO:39, wherein said amino acid sequence comprises at least one amino acid replacement with a replacing amino acid at a position selected from the second group consisting of positions 17, 20, 37, 43, 46, 59, 88, 92, 122, 130, 140, 153, 155, 157, 173, 191, 193, 201, 215, 231, 233, 247, 249, 283, 289, 290, 292, 293 and 294, or at functionally equivalent position of each position of said second group, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO:39. In particular, the TdT variant according to the invention (i) is capable of synthesizing a nucleic acid fragment without a template and (ii) is capable of incorporating a 3’-O-modified nucleotide onto a nucleic acid fragment.

[0078] In a particular embodiment, said amino acid sequence can comprise more than one amino acid replacement, preferably at least two, at least three, at least four, more preferably at least five amino acid replacements, selected from the second group consisting of positions 17, 20, 37, 43, 46, 59, 88, 92, 122, 130, 140, 153, 155, 157, 173, 191, 193, 201, 215, 231, 233, 247, 249, 283, 289, 290, 292, 293 and 294. Said TdT variants are capable of synthesizing a DNA strand and / or an RNA strand.

[0079] In another embodiment, the TdT variant according to the invention has an amino acid sequence at least 70% identical to SEQ ID NO:39, preferably at least 75%, 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:39 and optionally less than 100% identical to SEQ ID NO:39, wherein said amino acid sequence comprises at least one amino acid replacement with a replacing amino acid at a position selected from the group consisting of positions 17, 20, 37, 43, 46, 59, 88, 92, 122, 130, 140, 153, 155, 157,

[0080] 173, 191, 193, 201, 215, 231, 233, 247, 249, 283, 289, 290, 292, 293 and 294, or at functionally equivalent position of each position of said first group, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO: 39.

[0081] In another embodiment, the TdT variant comprises the amino acid sequence as set forth in SEQ ID NO: 1, wherein said amino acid sequence comprises at least one amino acid substitution with an amino acid at a position corresponding to one residue selected from the group consisting ofY32, L35, N52, A58, R61, T74, S103, A107, M137, 1145, Q155, V168, G170, T172, W188, K206, 1208, 1216, P230, D246, V248, V262, T264, 1298, M304, C305, Y307, E308 and N309, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO: 1. For example, residue Y32 corresponds to the Tyrosine amino acid at position 32 before substitution.

[0082] In another embodiment, the TdT variant comprises the amino acid sequence as set forth in SEQ ID NO:39, wherein said amino acid sequence comprises at least one amino acid replacement with an amino acid at a position corresponding to one residue selected from the group consisting ofY17, L20, N37, A43, R46, T59, S88, A92, M122, 1130, Q I 40. VI53, G155, T157, W173, K191, 1193, 1201, P215, D231, V233, V247, T249, 1283, M289, C290, Y292, E293, N294, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO:39. For example, residue Y17 corresponds to the Tyrosine amino acid at position 17 before replacement.

[0083] In another embodiment, the TdT variant comprises an amino acid sequence at least 70% identical to SEQ ID NO: 1, wherein said amino acid sequence comprises at least one amino acid substitution with a substitute amino acid at a position corresponding to one residue selected from the group consisting ofY32, L35, N52, A58, R61, T74, S103, A107, M137, 1145, Q155, V168, G170, T172, W188, K206, 1208, 1216, P230, D246, V248, V262, T264, 1298, M304, C305, Y307, E308 and N309, or at a functionally equivalent position of each position of said group, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO: 1. For example, residue Y32 corresponds to the Tyrosine amino acid at position 32 before substitution.

[0084] In another embodiment, the TdT variant comprises an amino acid sequence at least 70% identical to SEQ ID NO:39, wherein said amino acid sequence comprises at least one amino acid replacement with a replacing amino acid at a position corresponding to one residue selected from the group consisting ofY17, L20, N37, A43, R46, T59, S88, A92, M122, 1130, Q I 40. V153, G155, T157, W173, K191, 1193, 1201, P215, D231, V233, V247, T249, 1283, M289, C290, Y292, E293, N294, or at functionally equivalent position of each position of said group, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO:39. For example, residue Y17 corresponds to the Tyrosine amino acid at position 17 before replacement.

[0085] In some embodiments, the TdT variant according to the invention comprises the amino acid sequence as set forth in SEQ ID NO: 1 or a functionally equivalent sequence as set forth in SEQ ID NO: 1, wherein said amino acid sequence comprises at least one amino acid substitution with an amino acid at a position selected from the group consisting of positions 32, 35, 52, 58, 61, 74, 103, 107, 137, 145, 155, 168, 170, 172, 188, 206, 208, 216, 230, 246, 248, 262, 264, 298, 304, 305, 307, 308 and 309, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO: 1.

[0086] In the context of the invention, the TdT variant can be from any species or be a chimeric protein. By “chimeric protein”, is meant that portions of the variant are from at least 2 different species. Said chimeric protein is formed by the addition, and in particular fusion or conjugation, of one or more predetermined sequences of a protein of one species and at least one another predetermined sequence of a second species which is a member of the polX family, in particular a TdT. Preferably, the TdT variant is a chimeric protein, more preferably the chimeric protein comprises portions from 2 different species, in particular a predetermined sequence from mouse and a predetermined sequence from bovine.

[0087] In a particular embodiment, the TdT variant according to the invention comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90% of identity or homology to the amino acid sequence as set forth in SEQ ID NO: 1 or in SEQ ID NO:39, preferably at least 93%, 95%, 96%, 97%, 98%, 99% and less than 100% identity or homology with the sequence according to SEQ ID NO: 1 or to SEQ ID NO:39.

[0088] In another particular embodiment, the TdT variant according to the invention comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90% of identity or homology to an amino acid sequence selected from the group consisting of the sequences from SEQ ID NO: 5 to SEQ ID NO: 38, together with the sequences from SEQ ID NO:40 to SEQ ID NO:73, more preferably at least 93%, 95%, 96%, 97%, 98%, 99% and less than 100% identity or homology with an amino acid sequence selected from the group consisting of the sequences from SEQ ID NO:5 to SEQ ID NO:38, together with the sequences from SEQ ID NO:40 to SEQ ID NO:73.

[0089] In a particular embodiment, the at least one amino acid substitution with the substitute amino acid at a position selected from the group consisting of positions 32, 35, 52, 58, 61, 74, 103, 107, 137, 145, 155, 168, 170, 172, 188, 206, 208, 216, 230, 246, 248, 262, 264, 298, 304, 305, 307, 308 and 309 results in an amino acid selected from the group consisting of A, C, D, E, F, H, I, K, N, P, Q, R, T, V and W.

[0090] In a particular embodiment, the at least one amino acid replacement with the replacing amino acid at position selected from the group consisting of positions Y17, L20, N37, A43, R46, T59, S88, A92, M122, 1130, Q I 40. V153, G155, T157, W173, K191, 1193, 1201, P215, D231, V233, V247, T249, 1283, M289, C290, Y292, E293, N294 results in an amino acid selected from the group consisting of A, C, D, E, F, H, I, K, N, P, Q, R, T, V and W.

[0091] In some embodiments, the amino acid sequence as set forth in SEQ ID NO: 1 comprises at least two, at least three, at least four, preferably at least five, substitutions at positions selected from the group consisting of positions 32, 35, 52, 58, 61, 74, 103, 107, 137, 145, 155, 168, 170, 172, 188, 206, 208, 216, 230, 246, 248, 262, 264, 298, 304, 305, 307, 308 and 309.

[0092] In some embodiments, the amino acid sequence as set forth in SEQ ID NO:39 comprises at least two, at least three, at least four, preferably at least five, replacements at positions selected from the group consisting of positions Y 17, L20, N37, A43, R46, T59, S88, A92, M122, 1130, Q i 40. V153, G155, T157, W173, K191, 1193, 1201, P215, D231, V233, V247, T249, 1283, M289, C290, Y292, E293, N294.

[0093] In a particular embodiment the at least two, at least three, at least four, preferably at least five substitutions result in an amino acid selected from the group consisting of A, C, D, E, F, H, I, K, N, P, Q, R, T, V and W.

[0094] In a particular embodiment the at least two, at least three, at least four, preferably at least five replacements result in an amino acid selected from the group consisting of A, C, D, E, F, H, I, K, N, P, Q, R, T, V and W.

[0095] In some embodiments, the amino acid sequence at least 70% identical to SEQ ID NO: 1 comprises at least five substitutions at positions selected from the group consisting of positions 145, 206, 246, 262, 264, 298 and 307.

[0096] In some embodiments, the amino acid sequence at least 70% identical to SEQ ID NO:39 comprises at least five replacements at positions selected from the group consisting of positions 130, 191, 231, 247, 249, 283 and 292.

[0097] In a particular embodiment, the five substitutions result in amino acids selected from the group consisting ofV, H, N, A, R, V and W.

[0098] In a particular embodiment, the five replacements result in amino acids selected form the group consisting ofV, H, N, A, R, V and W.

[0099] In a particular embodiment, the amino acid sequence of the TdT variant according to the invention as set forth in SEQ ID NO: 1 comprises at least one amino acid substitution selected from I145V, K206H, D246N, V262A, T264R, I298V and Y307W.

[0100] In a particular embodiment, the amino acid sequence of the TdT variant according to the invention as set forth in SEQ ID NO:39 comprises at least one amino acid replacement selected from I130V, K191H, D23 IN, V247A, T249R, I283V and Y292W.

[0101] In some embodiments, the amino acid sequence at least 70% identical to SEQ ID NO: 1 comprises at least one amino acid substitution selected from I145V, K206H, D246N, V262A, T264R, I298V and Y307W.

[0102] In some embodiments, the amino acid sequence at least 70% identical to SEQ ID NO:39 comprises at least one amino acid replacement selected from I130V, K191H, D231N, V247A, T249R, I283V and Y292W.

[0103] Alternatively or additionally, the amino acid sequence of the TdT variant as set forth in SEQ ID NO: 1 may comprise at least one amino acid substitution selected from R61C, V168A, G170R, T172E, I208E, M304V, E308D and N309R / C. By “N309R / C”, is described that Asparagine is substituted at position 309 with an amino acid selected from Arginine (R) and Cysteine (C).

[0104] Alternatively or additionally, the amino acid sequence of the TdT variant as set forth in SEQ ID NO:39 may comprise at least one amino acid replacement selected from R46C, V153A, G155R, T157E, I193E, M289V, E293D and N294R / C. By “N294R / C”, is described that Asparagine is replaced at position 294 with an amino acid selected from Arginine (R) and Cysteine (C).

[0105] In some embodiments, the amino acid sequence of the TdT variant as set forth in SEQ ID NO: 1 comprises at least two, at least three, at least four, preferably at least five, amino acid substitutions selected from 1145 V, K206H, D246N, V262A, T264R, I298V and Y307W, more preferably the at least five amino acid substitutions include I145V, D246N, V262A, T264R and I298V.

[0106] In some embodiments, the amino acid sequence of the TdT variant as set forth in SEQ ID NO:39 comprises at least two, at least three, at least four, preferably at least five, amino acid replacements selected from I130V, K191H, D231N, V247A, T249R, I283V and Y292W, more preferably the at least five amino acid replacements include II 130V. D23 IN, V247A, T249R and I283V. In some embodiments, the amino acid sequence at least 70% identical to SEQ ID NO: 1 comprises at least two, at least three, at least four, preferably at least five, amino acid substitutions selected from 1145V, K206H, D246N, V262A, T264R, I298V and Y307W, more preferably the at least five amino acid substitutions include I145V, D246N, V262A, T264R and I298V.

[0107] In some embodiments, the amino acid sequence at least 70% identical to SEQ ID NO:39 comprises at least two, at least three, at least four, preferably at least five, amino acid replacements selected from I130V, K191H, D231N, V247A, T249R, I283V and Y292W, more preferably the at least five amino acid replacements include I130V, D231N, V247A, T249R and I283V.

[0108] In some embodiments where a particularly stable TdT variant is desired, the Tyrosine at residue 307 in SEQ ID NO: 1 (or at residue 292 in SEQ ID NO:39) is replaced by a tryptophan.

[0109] In other embodiments where a particularly stable TdT variant is desired, cysteine residues are introduced at residues R61 and / or N309 of SEQ ID NO: 1 (corresponding, respectively to residues R46 and N294 of SEQ ID NO:39). Without wishing to be bound by theory, the inventors believe that such an introduction of cysteine residues at positions exposed on the surface of the protein have a surprising propensity to stabilize the protein, likely due to their engagement into new disulfide bonds. For example, in some embodiments, a substitution R61C (resp., a replacement R46C) may facilitate the creation of a disulfide bond between the newly introduced C at position 61 (resp. 46) and the cysteine residue naturally present at position 84 in SEQ ID NO:2. For example, in other embodiments, a substitution N309C (resp., a replacement N294C) may facilitate the creation of a disulfide bond between the newly introduced C at position 309 (resp. 294) and the cysteine residue naturally present at position 305 in SEQ ID NO:2.

[0110] In one embodiment, the TdT variant comprises an amino acid sequence at least 70% identical to SEQ ID NO: 1, wherein said amino acid sequence comprises at least five amino acid substitutions with substitute amino acids at positions 145, 246, 262, 264 and 298, preferably I145V, D246N, V262A / T, T264Rand I298V.

[0111] In one embodiment, said variant further comprises at least one, preferably at least two, amino acid substitutions at positions 206 and / or 307, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO: 1, preferably K206H and / or Y307W.

[0112] In one embodiment, said variant further comprises at least one amino acid substitution at a position selected from 32, 35, 58, 103, 168, 188 and 305, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO: 1.

[0113] In a preferred embodiment, said substitutions are selected from Y32N / C / H, L35R / K, A58K / E, S103E / R, V168A / R / N / K / W, W188K / H / R, C305P, and combinations thereof, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO: 1.

[0114] In one embodiment, the TdT variant comprises an amino acid sequence at least 70% identical to SEQ ID NO: 1, wherein said amino acid sequence comprises at least seven amino acid substitutions with substitute amino acids at positions 145, 206, 246, 262, 264, 298 and 307 wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO: 1, preferably I145V, K206H, D246N, V262A / T, T264R, I298V and Y307W.

[0115] In one embodiment, said variant further comprises at least one amino acid substitution at a position selected from 32, 35, 58, 103, 168, 188 and 305, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO: 1.

[0116] In a preferred embodiment, said substitutions are selected from Y32N / C / H, L35R / K, A58K / E, S103E / R, V168A / R / N / K / W, W188K / H / R, C305P, and combinations thereof, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO: 1. In a preferred embodiment the TdT variants of the invention are chimeric variants and are listed in Table 1 below.

[0117]

[0118]

[0119]

[0120]

[0121] In some embodiments, the TdT variant comprises an amino acid sequence selected from the group consisting of sequences from SEQ ID NO:5 to SEQ ID NO:38, together with the sequences from SEQ ID NO:40 to SEQ ID NO:73, preferably the TdT variant comprises an amino acid sequence as set forth in SEQ ID NO:5, SEQ ID NO: 15, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:31, SEQ ID NO:40, SEQ ID NO:50, SEQ ID NO:58, SEQ ID NO:60 or SEQ ID NO:66.

[0122] In some embodiments, the TdT variant comprising the amino acid sequence at least 70% identical to SEQ ID NO: 1 is at least 70 % identical to, preferably at least 75%, 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99% identical to and optionally less than 100% identical to, an amino acid sequence selected from the group consisting of SEQ ID NO:5 to SEQ ID NO:38.

[0123] The TdT variant comprising the amino acid sequence at least 70% identical to SEQ ID NO:39 is at least 70 % identical to, preferably at least 75%, 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99% identical to and optionally less than 100% identical to, an amino acid sequence selected from the group consisting of SEQ ID NO: 40 to SEQ ID NO: 73.

[0124] Said specific TdT variants according to the invention improve the quality of the DNA synthesis and then solve the technical problem. In particular, the TdT variants described herein have a reduced deletion rate for adenosine according to the protocol of Example 4 hereinbelow, of between 0.27% to 0.11% per step, compared to the deletion rate of the TdT variant having the amino acid sequence as set forth in SEQ ID NO:2. Additionally, the TdT variants according to the invention are surprisingly stable compared to TdT variants of the prior art, as demonstrated hereinbelow in Example 2 and Example 5.

[0125] Advantageously, the TdT variants of the invention display an improved activity, as measured by a reduced deletion rate during the addition of an adenosine nucleotide compared to variants of the prior art, whilst retaining a satisfactory stability, as measured by the melting temperature assay.

[0126] In another embodiment, the present invention relates to a nucleic acid coding for a variant of a DNA polymerase of the polX family, in particular a TdT capable of synthesizing a nucleic acid molecule without a template strand according to the present invention. The present invention also relates to an expression cassette of a nucleic acid according to the present invention. The invention further relates to a vector comprising a nucleic acid or an expression cassette according to the present invention. The vector can be selected from a plasmid or a viral vector.

[0127] The nucleic acid coding for the DNA polymerase variant can be DNA (cDNA or gDNA), RNA, or a mixture of the two. It can be in single-strand form or in duplex form or a mixture of the two forms. It can comprise modified nucleotides comprising, for example, a modified bond, a modified purine or pyrimidine base, or a modified sugar. It can be prepared by any of the methods known to the person skilled in the art, including chemical synthesis, recombination, mutagenesis, etc.

[0128] The expression cassette comprises all the elements necessary for the expression of the TdT variant according to the present invention, in particular the elements necessary for transcription and translation in the host cell. The host cell can be prokaryotic or eukaryotic. In particular, the expression cassette comprises a promoter and a terminator, optionally an amplifier. The promoter can be prokaryotic or eukaryotic. The following are examples of preferred prokaryotic promoters: Lacl, LacZ, pLacT, ptac, pARA, pBAD, the bacteriophage T3 or T7 RNA polymerase promoters, the polyhydrin promoter, the lambda phage PR or PL promoter. The following are examples of preferred eukaryotic promoters: the early CMV promoter, the HSV thymidine kinase promoter, the early or late SV40 promoter, the murine metallothionein-L promoter, and LTR regions of certain retroviruses. In general, for the selection of an appropriate promoter, the person skilled in the art can advantageously refer to the work by Sambrook et al. (1989) or to the techniques described by Fuller et al. (1996; Immunology in Current Protocols in Molecular Biology).

[0129] The present invention relates to a vector carrying a nucleic acid or an expression cassette coding for a TdT variant according to the present invention. The vector is preferably an expression vector, i.e., it comprises the elements necessary for the expression of the variant in the host cell. The host cell can be a prokaryote, for example, E. coli, or a eukaryote. The eukaryote can be a lower eukaryote such as a yeast (for example, P. pastoris or K. lactis) or a fungus (for example, of the Aspergillus genus) or a higher eukaryote such as an insect cell (Sf9 or Sf21 , for example), a mammalian cell or a plant cell. The cell can be a mammalian cell, for example, COS (green monkey cell line) (for example, COS 1 (ATCC CRL-1650), COS 7 (ATCC CRL- 1651), CHO (U.S. Pat. Nos. 4,889,803; 5,047,335, CHO-K1 (ATCC CCL-61)), murine cells and human cells. In a particular embodiment, the cell is non-human and non-embryonic. The vector can be a plasmid, a phage, a phagemid, a cosmid, a virus, a YAC, a BAC, an Agrobacterium pTi plasmid, etc. The vector can preferably comprise one or more elements selected from a replication origin, a multiple cloning site and a selection gene. In a preferred embodiment, the vector is a plasmid. The following are non-exhaustive examples of prokaryotic vectors: pQE70, pQE60, pQE-9 (Qiagen), pbs, pDlO, phagescript, psiX174, pbluescrip SK, pbsks, pNH8A, pNH16A, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233- 3, pDR540, pBR322, and pRIT5 (Pharmacia), pET (Novagen). The following are non-exhaustive examples of eukaryotic vectors: pWLNEO, pSV2CAT, pPICZ, pcDNA3.1 (+) Hyg (Invitrogen), pOG44, pXTl, pSG (Strategene); pSVK3, pBPV, pCI-neo (Stratagene), pMSG, pSVL (Pharmacia); and pQE-30 (QLAexpress). The viral vectors can be in a non-exhaustive manner adenoviruses, AAV, HSV, lentiviruses, etc. Preferably, the expression vector is a plasmid or a viral vector.

[0130] The sequence coding for the TdT variant according to the present invention may or may not comprise a signal peptide. In the case in which it does not comprise a signal peptide, a methionine can optionally be added to the N-terminal end. In another alternative, a heterologous signal peptide can be introduced. This heterologous signal peptide can be derived from a prokaryote such as E. coli or from a eukaryote, in particular a mammalian cell, an insect cell, or a yeast.

[0131] The present invention relates to the use of a polynucleotide, of an expression cassette or of a vector according to the present invention for transforming or transfecting a cell. The present invention relates to a host cell comprising a nucleic acid, an expression cassette or a vector coding for a TdT variant and to its use for producing a TdT variant according to the present invention. The term “host cell” encompasses the daughter cells resulting from the culture or from the growth of this cell. In a particular embodiment, the cell is non-human and non-embryonic.

[0132] The present invention also relates to a method for producing a TdT variant of the invention, comprising the transformation or transfection of a cell by a polynucleotide, an expression cassette or a vector according to the present invention; the culturing of the transfected / transformed cell; and the harvesting of the TdT variant produced by the cell. In an alternative embodiment, a method for producing a TdT variant according to the present invention comprises the provision of a cell comprising a polynucleotide, an expression cassette or a vector according to the invention; the culturing of the transfected / transformed cell; and the harvesting of the TdT variant produced by the cell. In particular, the cell can be transformed / transfected in a transient or stable manner by the nucleic acid coding for the variant. This nucleic acid can be contained in the cell in the form of an episome or in chromosomal form. The methods for producing recombinant proteins are well known to the person skilled in the art.

[0133] TdT variants may be operably linked to a linker moiety including a covalent or non-covalent bond; amino acid tag (e.g., poly-amino acid tag, poly-His tag, 6His-tag, or the like); chemical compound (e.g., polyethylene glycol); protein-protein binding pair (e.g., biotin-avidin); affinity coupling; capture probes; or any combination of these. The linker moiety can be separate from (as in, for example, SEQ ID NO:40 to 73), or part of a TdT variant (as in, for example, SEQ ID NO:5 to 38). An exemplary His-tag for use with the TdT variants of the invention is MASSHHHHHHSSGSE - (SEQ ID NO: 4). Another exemplary His- tag for use with the TdT variants of the invention is MASSHHHHHHHHSSGSE - (SEQ ID NO:74). Yet another exemplary His-tag for use with the TdT variants of the invention is MASSHHHHHHHHHHSSGSE - (SEQ ID NO:75). The tag-linker moiety does not interfere with the nucleotide binding activity, or catalytic activity of the TdT variants and allows easy purification and isolation of the TdT variants. In an exemplary embodiment, such a Tag is inserted at the N-terminus of the TdT variant, as can be seen in the sequences of SEQ ID NO:5 to SEQ ID NO:38.

[0134] The TdT variants according to the present invention are particularly advantageous for the synthesis of nucleic acids without a template strand. More particularly, the variants according to the invention have a more flexible Loop 1, which is more suitable for accommodating the modified nucleotides exhibiting greater steric hindrance than the natural nucleotides. Also, the T264R mutation in the sequence of SEQ ID NO: 1 (T249R in SEQ ID NO:39) is thought to improve the interaction between the TdT variant and the DNA intitiator.

[0135] Thus, the invention also relates to a use of a TdT variant according to the present invention for synthesizing a nucleic acid molecule without a template strand, from 3 '-OH modified nucleotides, for example such as those described in US7,544,794.

[0136] In another aspect, the invention relates to a kit, in particular for the enzymatic synthesis of a nucleic acid molecule without a template strand, said kit comprises: a. at least one TdT variant according to anyone of the above described embodiments, b. at least one 3’-O-modified nucleoside triphosphate, and c. optionally at least one initiator.

[0137] In particular, the modified nucleoside triphosphate contains a protecting group. This protecting group allows to block / protect the 3 ’-OH and therefore to prevent reaction with other nucleosides in a given synthesis cycle. Therefore, in particular, the kit comprises at least one 3’-O-protected nucleoside triphosphate.

[0138] In a particular embodiment, the kit of the invention comprises at least two TdT variants, preferably at least three TdT variants. When the kit comprises more than one TdT variant, the TdT variants in the kit are preferably different from each other. In a particular embodiment, the kit comprises at least two, at least three TdT variants of the invention.

[0139] Said TdT variants and said kits of the invention are particularly suitable for the enzymatic synthesis of a polynucleotide, i.e. nucleic acid molecule, without a template strand.

[0140] Therefore, the invention also relates to a method for the enzymatic synthesis of a nucleic acid molecule without a template strand, according to which a primer strand is brought in contact with at least one nucleotide, preferably a 3'-OH modified nucleotide, in the presence of a TdT variant according to the invention.

[0141] Thus, the invention relates to a method of synthesizing a polynucleotide, optionally having a predetermined sequence, wherein the method comprising the steps of: a. providing at least one initiator having a 3 ’-terminal nucleotide which has a free 3 ’-hydroxyl; b. contacting under elongation conditions said at least one initiator having a free 3’-O-hydroxyl with a 3’-O-blocked nucleoside triphosphate and a TdT variant according to anyone of the above described embodiments, so that said at least one initiator is elongated by incorporation of a 3’-O- blocked nucleoside triphosphate to form a 3’-O-blocked elongated fragment; c. deblocking the elongated fragment to form an elongated fragment having a free 3 ’-hydroxyl; and d. repeating steps b. and c. by contacting under elongation conditions the elongated fragment obtained in step c. with a 3’-O-blocked nucleoside triphosphate and a TdT variant according to anyone of the above described embodiments, until the polynucleotide is formed.

[0142] In a preferred embodiment, the TdT variants according to the invention can be used to carry out the synthesis methods described in the application WO2015 / 159023 incorporated by reference herein.

[0143] Other features and advantages of the invention will be more apparent from the following examples and results which are non-limiting. Examples

[0144] Example 1 - TdT variants construction, expression and screening

[0145] TdT variant construction

[0146] TdT variants of the invention were created using MEGAWHOP cloning method as disclosed by Miyazaki K. MEGAWHOP cloning: a method of creating random mutagenesis libraries via megaprimer PCR of whole plasmids. Methods Enzymol. 2011;498:399-406. Doi: 10.1016 / B978-0-12-385120-8.00017-6. PMID: 21601687.

[0147] Megaprimers were made by PCR with a pair of primers where at least one primer was mutagenic (containing degenerate codon or predesigned mutation) according to the usual PCR amplification and molecular biology techniques. Purified megaprimers were combined with TDT circular backbone plasmid (pet28 vector) in a second PCR step. After digestion with Dpnl, PCR products were electroporated in E. Cloni 10G cells (Lucigen). Transformants were selected on 2YT-agar plates supplemented with 50 mg / L Kanamycin. Plasmids encoding the TdT variants were prepared either directly from transformation plate bacteria carpets or from overnight liquid cultures (2YT supplemented with 0.5% glucose and 50 mg / L Kanamycin).

[0148] Expression and screening

[0149] For screening, plasmids encoding for TdT variants were retransformed in the commercial E. coli strains BL21 (DE3) (Novagen). The colonies that were capable of growing in kanamycin petri dishes were isolated and labeled. Individual variants of TdT were produced, expressed and purified in 96 well format using Ni- NTA chromatography as described in US 2020 / 0002690. Protein amounts were determined by absorbance at 280 nm.

[0150] Example 2 - Melting temperatures of the TdT variants

[0151] Tm stands for melting temperature of pure TdT variants, determined from thermal shift assay using SYPRO Orange dye.

[0152] Briefly, in an optically sensitive 96-well plate (Bio-Rad HSP9601), 40 pL 500mM Cacodylate buffer at pH 7.4 containing 2x SYPRO-Orange dye (Thermo Fisher S-6650) were mixed with 10 pL of TdT variant protein to obtain a final TdT variant concentration of 2 pM. The plate was transferred into a qPCR machine (Bio-Rad CFX96) and a temperature ramp protocol was applied going from 30°C to 70°C in steps of 0.4°C / 5 sec. Fluorescence was measured at each step of 0.4°C to obtain a melting curve. The inflection point of the melting curve was taken to be the melting temperature (Tm) of the TdT variant.

[0153] Results are detailed in Table 2 below.

[0154] [Table 2]

[0155] It is generally desirable to have access to TdT variants with melting temperatures as high as possible, since this translates into increased enzyme stability, which is critical along the entire enzyme life cycle, for example during enzyme production, purification, storage, but also during enzyme use according to the methods of the invention. In this context, the present inventors have noticed, among others, the criticality of the Y307W mutation (according to the residue numbering of SEQ ID NO: 1), which is thought to confer to those variants that possess such mutation, an increase of about +1°C in melting temperature. This is reflected in the fact that in Table 2 above, out of the 15 variants with the highest Tm, 13 have the Y307W mutation. Additionally, all variants with the Y307W mutation in Table 2 above have a Tm of at least 60.4°C.

[0156] Example 3 - Comparative study

[0157] This study investigates the average count of deletions occurring at adenosine positions during the synthesis of the following sequence TCTGGGTTGTGCACATACCCAGCTT (SEQ ID NO:76) with a TdT variant of the invention (SEQ ID NO:5) and 3’-ONH2 nucleosides triphosphates, compared to those obtained with the TdT variants of SEQ ID NO:2 and SEQ ID NO:3.

[0158] Syntheses are performed at 37°C with 25 pM enzyme, 4 mM C0CI2, 500 pM ONEE-nucleotides, 750 pmols resin (15 pM iDNA) at 20% DMSO, 50 mM NaCl in 0.5 M Cacodylate buffer pH 7.4.

[0159] The sequences synthesized by each TdT variant were sequenced using an iSeq 100 System sequencer from Illumina, Inc. The percentages of deletion are calculated by comparing the sequences obtained from the sequencer to the theoretical targeted sequences.

[0160] The results are detailed in Table 3 below.

[0161] [Table 3]

[0162] From the results in Table 3, it is apparent that the TdT variant of SEQ ID NO:5 performs significantly better during the addition of an adenosine nucleotide to the model sequence of SEQ ID NO:76, than the previously best performing variants of SEQ IN NO:2 and SEQ ID NO:3.

[0163] Example 4 - Comparative study

[0164] This study investigates the average count of deletions occurring at adenosine positions during the synthesis of a set of 12 primer sequences by TdT variants of the invention, compared to those obtained with the TdT variant of SEQ ID NO:2, in the presence of 3’-ONH2 nucleosides triphosphates.

[0165] The 12 primer sequences are the following:

[0166] [Table 4]

[0167] The data was generated in the course of 13 different runs, which each contained the same internal control as well as 3 different variants.

[0168] Syntheses are performed at 37°C with 25 pM enzyme, 4 mM C0CI2, 500 pM ONt -nucIcotidcs. 750 pmols resin (15 pM iDNA) at 20% DMSO, 50 mM NaCl in 0.5 M Cacodylate buffer pH 7.4.

[0169] The 12 sequences synthesized by each TdT variant were sequenced using an iSeq 100 System sequencer from Illumina, Inc. The percentage of deletion are calculated by comparing the sequences obtained from the sequencer to the theoretical targeted sequences.

[0170] [Table 5]

[0171] From the results in Table 5, it is apparent that the TdT variants of the invention, as demonstrated by the average of deletions obtained for variants of SEQ ID NO: 5 to SEQ ID NO: 38, all perform significantly better during the addition of an adenosine nucleotide to the model sequences of SEQ ID NO:77 to SEQ ID NO: 88, than the previously best performing variant of SEQ IN NO:2.

[0172] Example 5 - Comparative study

[0173] Further variants were created based on the TdT variant having SEQ ID NO: 15 and comprising further substitutions, as described in Table 6 below. The melting temperature of these TdT variants was determined from thermal shift assay using SYPRO Orange dye, as detailed in Example 2.

[0174] Results are detailed in Table 6 below.

[0175] [Table 6]

[0176] As shown in Table 6. it was possible to further improve the TdT variant having SEQ ID NO: 15 by including additional substitutions at positions 32, 35, 58, 103, 168, 188 and / or 305 (wherein the positions are numbered by reference to SEQ ID NO: 1).

[0177] Additionally, some of these variants were tested for their performance in synthesis. The study investigated the average count of deletions occurring at adenosine positions during the synthesis of the following sequence GCATGAACCTTTCGACATCTAACCTTTACCCCAATTCCG (SEQ ID NO: 89) with each variant and 3’-ONH2 nucleosides triphosphates, compared to those obtained with the TdT variant SEQ ID NO: 15 used as reference.

[0178] Syntheses were performed at 47°C with 10 pM enzyme, 4 mM CoCE, 100 pM ONEE-nucleotides, 750 pmol resin (15 pM iDNA) at 5% DMSO, 50 mM NaCl in 0.5 M Cacodylate buffer pH 7.4.

[0179] The sequences synthesized by each SEQ ID NO: 15 TdT variant were sequenced using an iSeq 100 System sequencer from Illumina, Inc. The percentages of deletion of nucleotide “A” within the subsequence CCTTTACCCCAAT of SEQ ID NO :89 (SEQ ID NO:90) were calculated by comparing the sequences obtained from the sequencer to the theoretical targeted sequences.

[0180] The results were normalized compared to the results for the variant SEQ ID NO: 15 as a reference (“A deletion %”= 1) and are detailed in Table 7 below.

[0181] [Table 7]

[0182] This example shows that further substitutions can improve, not only the stability of the TdT variant (as reflected by the Tm), but also the activity of the TdT variant (as reflected by the lower percentage of deletions of adenosine.

Claims

Claims1. A terminal deoxynucleotidyl transferase (TdT) variant comprising an amino acid sequence at least 70% identical to SEQ ID NO: 1, wherein said amino acid sequence comprises at least five amino acid substitutions with substitute amino acids at positions 145, 246, 262, 264 and 298 or at functionally equivalent positions, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO: 1.

2. The TdT variant according to claim 1, wherein the amino acid sequence at least 70% identical to SEQ ID NO: 1 comprises at least the following five amino acid substitutions I145V, D246N, V262A / T, T264R and I298V.

3. The TdT variant according to claim 1 or 2, further comprising at least one, preferably at least two, amino acid substitutions at positions 206 and / or 307, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO: 1.

4. The TdT variant according to claim 3, wherein said substitutions are K206H and / or Y307W, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO: 1.

5. The TdT variant according to any of previous claims, further comprising at least one amino acid substitutions at positions selected from 32, 35, 58, 103, 168, 188 and 305, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO: 1.

6. The TdT variant according to claim 5, wherein said substitutions are selected from Y32N / C / H, L35R / K, A58K / E, S103E / R, V168A / R / N / K / W, W188K / H / R, C305P, and combinations thereof, wherein the positions are numbered by reference to the amino acid sequence set forth in SEQ ID NO: 1.

7. The TdT variant according to any one of previous claims, wherein the amino acid sequence at least 70% identical to SEQ ID NO: 1 is at least 70 % identical to an amino acid sequence selected from the group consisting of SEQ ID NO:5 to SEQ ID NO:38.

8. The TdT variant according to anyone of previous claims, wherein the variant’s melting temperature, as determined by the Sypro Orange dye assay, is above 56.5°C, preferably above 57.0°C, more preferably above 58.0°C, even more preferably equal to or above 60.0°C.

9. A kit comprising: a. at least one TdT variant according to any one of previous claims, b. at least one 3’-O-modified nucleoside triphosphate, and c. optionally at least one initiator.

10. A method of synthesizing a polynucleotide having a predetermined sequence, the method comprising the steps of: a. providing at least one initiator having a 3 ’-terminal nucleotide which has a free 3 ’-hydroxyl; b. repeating cycles of (i) contacting under elongation conditions the at least one initiator, or elongated fragments, having free 3 ’-hydroxyl with a 3’-O-blocked nucleoside triphosphate and a TdT variant according to any one of claims 1 to 4, so that said at least one initiator, or elongated fragments, are elongated by incorporation of a 3’-O-blocked nucleoside triphosphate to form 3’-O-blocked elongated fragments, and (ii) deblocking the elongated fragments to form elongated fragments having a free 3 ’-hydroxyl, until the polynucleotide is synthesized.

11. The method according to claim 10 wherein said 3 '-O-blocked nucleoside triphosphate is a 3 '-O-NH2- nucleoside triphosphate, a 3 '-O-azidomethyl-nucleoside triphosphate, or a 3 '-O-allyl-nucleoside triphosphate.

12. The method according to claim 10 or 11 wherein said initiator is attached to a solid support and comprises a cleavable nucleotide or a cleavable linkage at its 3 '-end and wherein said polynucleotides having said predetermined sequences are released from the solid support by cleaving the cleavable nucleotide or the cleavable linkage.

Images