Antibody against interleukin-7 receptor (il-7r), and antibody-drug conjugate (ADC) including said antibody

Abstract

The present disclosure relates to: an isolated monoclonal antibody capable of binding to a human interleukin-7 receptor (IL-7R), or an antigen-binding fragment thereof; a humanized antibody or an antigen-binding fragment thereof; and a pharmaceutical composition containing the antibody or an antigen-binding fragment thereof.

Description

Antibodies against interleukin-7 receptor (IL-7R) and antibody-drug conjugates (ADCs) containing said antibodies

[0001] The present disclosure relates to antibodies against interleukin-7 receptor (IL-7R) and antibody drug conjugates (ADCs) comprising such antibodies.

[0002] IL-7 is known as a cytokine essential for the development and homeostasis of T cells (Non-Patent Document 1). IL-7Rα is slowly internalized, with some returning to the cell surface and some being degraded (Non-Patent Document 1). Stimulation with IL-7 shortens the half-life of IL-7Rα from approximately 24 hours to 3 hours (Non-Patent Document 1). It has also been shown that IL-7R is responsible for steroid resistance in cancer (Non-Patent Document 2). Non-Patent Document 2 suggests that suppressing downstream signaling of IL-7R is effective in treating steroid resistance. Patent Document 1 discloses that ADCs of IL-7R antibodies and cytotoxic agents are effective in treating hematopoietic tumors (e.g., leukemia and lymphoma) and inflammatory diseases (e.g., rheumatoid arthritis and ulcerative colitis). Patent Document 1 also discloses that cell lines that have acquired steroid resistance highly express IL-7R.

[0003] Li et al., 2016, PLOS Medicine, 13(12): e1002200Henriques et al., 2010, Blood, 115(16): 3269-3277

[0004] WO2018 / 159808A

[0005] The present disclosure provides antibodies against interleukin-7 receptor (IL-7R) and antibody-drug conjugates (ADCs) comprising the antibodies. The present disclosure also relates to pharmaceutical compositions comprising the antibodies or ADCs.

[0006] According to the present disclosure, the following inventions are exemplified: [1] An isolated monoclonal antibody or antigen-binding fragment thereof that binds to human interleukin-7 receptor (IL-7R), wherein the antibody and antigen-binding fragment thereof comprise: (1) a heavy chain variable region comprising a heavy chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 17, a heavy chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 18, and a heavy chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 19, and a light chain variable region comprising a light chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 20, a light chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 21, and a light chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 22; (2) a heavy chain variable region comprising a heavy chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 25, a heavy chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 26, and a heavy chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 27, and a light chain variable region comprising a light chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 28, a light chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 29, and a light chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 30; (3) A heavy chain variable region comprising a heavy chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 33, a heavy chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 34, and a heavy chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 35, and a light chain variable region comprising a light chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 36, a light chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 37, and a light chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 38; or (4) A heavy chain variable region comprising a heavy chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 41, a heavy chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 42, and a heavy chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 43, and a light chain variable region comprising a light chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 44, a light chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 45, and a light chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 46. [2] The antibody or antigen-binding fragment thereof according to [1] above, which is a human chimeric antibody or an antigen-binding fragment thereof. [3] The antibody or antigen-binding fragment thereof according to [1] above, which is a humanized antibody or antigen-binding fragment thereof.[4] The antibody or antigen-binding fragment thereof according to [3] above, wherein the humanized antibody has a heavy chain constant region, an Fc region, and a light chain constant region of a subclass selected from the group consisting of human IgG1, IgG2, and IgG4. [5] An antibody-drug conjugate comprising an antibody or antigen-binding fragment thereof and a drug, wherein the antibody or fragment is linked to the drug via a linker, and the antibody or fragment comprises the antibody or antigen-binding fragment thereof according to any of [1] to [4] above. [6] A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof according to any of [1] to [4] above. [7] The pharmaceutical composition according to [6] above, wherein the antibody or antigen-binding fragment thereof has antibody-dependent cellular cytotoxicity and / or complement-dependent cytotoxicity. [8] A pharmaceutical composition comprising the antibody-drug conjugate according to [5] above. [9] The pharmaceutical composition according to any of [6] to [8] above, for use in treating cancer in a subject in need thereof.

[10] The pharmaceutical composition according to any one of the above-mentioned [6] to [8], for use in treating an immune disease or a disease caused by an immune disease in a subject in need thereof.

[0007]

[21] The antibody or antigen-binding fragment thereof according to any one of [1] to [4] above, comprising heavy chain framework region 1 (heavy chain FR1), heavy chain FR2, heavy chain FR3, and heavy chain FR4 of the antibody subclasses consisting of human IgG1, human IgG2, human IgG3, and human IgG4, and light chain framework region 1 (light chain FR1), light chain FR2, light chain FR3, and light chain FR4 of a human κ chain or λ chain.

[22] The antibody or antigen-binding fragment thereof according to any one of [1] to [4] above, comprising: a heavy chain variable region comprising heavy chain framework region 1 (heavy chain FR1), heavy chain FR2, heavy chain FR3, and heavy chain FR4 of one or more antibodies selected from antibody group A; and a light chain variable region comprising light chain framework region 1 (light chain FR1), light chain FR2, light chain FR3, and light chain FR4 of one or more antibodies selected from the above group; or a heavy chain variable region and a light chain variable region having amino acid sequences that have 90% or more sequence identity with the amino acid sequences of the FR regions of the heavy chain variable region and light chain variable region.

[23] A heavy chain variable region having a heavy chain FR1 having the amino acid sequence set forth in SEQ ID NO: 51, a heavy chain FR2 having the amino acid sequence set forth in SEQ ID NO: 52, a heavy chain FR3 having the amino acid sequence set forth in SEQ ID NO: 53, and a heavy chain FR4 having the amino acid sequence set forth in SEQ ID NO: 54, and a light chain variable region having a light chain FR1 having the amino acid sequence set forth in SEQ ID NO: 55, a light chain FR2 having the amino acid sequence set forth in SEQ ID NO: 56, a light chain FR3 having the amino acid sequence set forth in SEQ ID NO: 57, and a light chain FR4 having the amino acid sequence set forth in SEQ ID NO: 58; or an antibody or antigen-binding fragment thereof according to any of [1] to [4] above, having a heavy chain variable region and a light chain variable region having amino acid sequences that have 90% or more sequence identity to the amino acid sequences of the FR regions of the heavy chain variable region and light chain variable region.

[24] A heavy chain variable region having a heavy chain FR1 having the amino acid sequence set forth in SEQ ID NO: 59, a heavy chain FR2 having the amino acid sequence set forth in SEQ ID NO: 60, a heavy chain FR3 having the amino acid sequence set forth in SEQ ID NO: 61, and a heavy chain FR4 having the amino acid sequence set forth in SEQ ID NO: 62, and a light chain variable region having a light chain FR1 having the amino acid sequence set forth in SEQ ID NO: 63, a light chain FR2 having the amino acid sequence set forth in SEQ ID NO: 64, a light chain FR3 having the amino acid sequence set forth in SEQ ID NO: 65, and a light chain FR4 having the amino acid sequence set forth in SEQ ID NO: 66; or an antibody or antigen-binding fragment thereof according to any of [1] to [4] above, having a heavy chain variable region and a light chain variable region having amino acid sequences that have 90% or more sequence identity with the amino acid sequences of the FR regions of the heavy chain variable region and light chain variable region.

[25] An antibody-drug conjugate comprising an antibody or its antigen-binding fragment and a drug, wherein the antibody or fragment is linked to the drug via a linker, and the antibody or fragment comprises the antibody or its antigen-binding fragment described in any of

[21] to

[24] above.

[26] A pharmaceutical composition comprising the antibody or its antigen-binding fragment described in any of

[21] to

[24] above.

[27] The pharmaceutical composition described in

[26] above, wherein the antibody or its antigen-binding fragment has antibody-dependent cellular cytotoxicity and / or complement-dependent cytotoxicity.

[28] A pharmaceutical composition comprising the antibody-drug conjugate described in

[25] above.

[29] The pharmaceutical composition described in any of

[26] to

[28] above, for use in treating cancer in a subject in need thereof.

[30] The pharmaceutical composition described in any of

[26] to

[28] above, for use in treating an immune disease or a disease caused by an immune disease in a subject in need thereof.

[0008]

[101] A nucleic acid (e.g., DNA or messenger RNA (mRNA)) encoding the antibody or antigen-binding fragment thereof according to any of [1] to [4] above.

[102] A cell (e.g., a protein-producing cell such as a Chinese hamster ovary (CHO) cell or a CHO-derived cell, a human embryonic kidney (HEK) cell (e.g., HEK293 cell), or a cell derived from a HEK cell), comprising the nucleic acid according to

[101] above.

[103] A nucleic acid comprising the nucleic acid according to

[101] above and a regulatory sequence operably linked to the nucleic acid.

[104] A vector comprising the nucleic acid according to

[102] or

[103] above.

[105] A cell (e.g., a protein-producing cell such as a Chinese hamster ovary (CHO) cell or a CHO-derived cell, a human embryonic kidney (HEK) cell (e.g., HEK293 cell), or a cell derived from a HEK cell), comprising the vector according to

[104] above.

[0009]

[201] An isolated multispecific binding peptide (preferably a bispecific binding protein), comprising a binding domain that binds to human interleukin-7 receptor (IL-7R) and a binding domain that binds to a T cell receptor complex, wherein the binding domain that binds to IL-7R comprises an antigen-binding fragment of an antibody according to any of [1] to [4] and

[21] to

[24] above.

[202] The multispecific binding peptide according to

[201] above, wherein the binding domain that binds to the T cell receptor complex comprises an antigen-binding fragment of an antibody that binds to CD3 (e.g., the CD3ε chain).

[0010]

[301] A chimeric antigen receptor (CAR) comprising an antigen-binding fragment of the antibody according to any one of [1] to [4] and

[21] to

[24] above.

[302] The chimeric antigen receptor according to

[301] above, wherein the antigen-binding fragment is an scFv.

[303] The chimeric antigen receptor according to

[301] or

[302] above, further comprising an extracellular hinge domain, a transmembrane domain, and an activation signaling domain.

[304] The chimeric antigen receptor according to

[303] above, further comprising a costimulatory molecule signaling domain.

[305] The chimeric antigen receptor according to

[304] above, wherein the costimulatory molecule signaling domain comprises a costimulatory molecule signaling domain of one or more costimulatory molecules selected from the group consisting of CD28, 4-1BB, OX40, CD27, and ICOS.

[351] A cell (particularly an immune cell, preferably a T cell or an NK cell) expressing the chimeric antigen receptor according to any one of

[301] to

[305] above.

[352] A nucleic acid encoding the chimeric antigen receptor according to any one of

[301] to

[305] above.

[353] A nucleic acid comprising the nucleic acid according to

[352] above and a regulatory sequence operably linked to the nucleic acid.

[354] A vector comprising the nucleic acid according to

[352] or

[353] above.

[355] A cell comprising the nucleic acid or vector according to any one of

[352] to

[354] above.

[371] A composition comprising the cell according to

[351] above.

[372] A pharmaceutical composition comprising the cell according to

[351] above.

[373] The pharmaceutical composition according to

[372] above, for use in treating a subject with cancer, an inflammatory disease, or an immune disease.

[374] The pharmaceutical composition according to

[372] or

[373] above, for use in treating cancer, an inflammatory disease, or an immune disease in a subject.

[0011]

[401] The ADC according to any one of [5] or

[25] above, wherein the drug is a cytotoxic agent.

[402] The ADC according to any one of [5] or

[25] above, wherein the drug is an anticancer drug (e.g., a chemotherapeutic agent or a radioisotope).

[403] The ADC according to any one of [5] or

[25] above, wherein the drug is a nucleic acid.

[404] The ADC according to any one of [5] or

[25] above, wherein the drug is a signal transduction inhibitor (e.g., a kinase inhibitor).

[405] The ADC according to any one of [5] or

[25] above, wherein the drug is a JAK inhibitor.

[451] The ADC according to any one of [5],

[25] , and

[401] to

[405] above, wherein the linker is a cleavable linker or a non-cleavable linker.

[452] The ADC according to

[451] above, wherein the linker comprises polyethylene glycol (PEG), valine-citrulline, and p-aminobenzylcarbamate (PABC), linked via a thiol group of a cysteine ​​residue of the antibody.

[471] A composition comprising the ADC according to any of

[401] to

[405] ,

[451] , and

[452] above.

[472] A pharmaceutical composition comprising the ADC according to any of

[401] to

[405] ,

[451] , and

[452] above.

[473] The pharmaceutical composition according to

[472] above, for use in treating a subject with cancer, an inflammatory disease, or an immune disease.

[474] The pharmaceutical composition according to

[472] or

[473] above, for use in treating cancer, an inflammatory disease, or an immune disease in a subject.

[0012]

[0033] Figure 1 shows the results of a test confirming the reactivity of various monoclonal antibody clones that bind to IL-7 receptor (IL-7R) to IL-7R.

[0034] Figure 2 shows the results of a test confirming the reactivity and dose dependency of various monoclonal antibody clones to IL-7R-expressing human cells.

[0035] Figure 3 shows the dose dependency of cytotoxicity of drug-antibody conjugates comprising human chimeric antibodies derived from the various antibody clones shown and the cytotoxic agent monomethyl auristatin E (MMAE) against cultured cells (specifically, IL-7R-expressing human cells).

[0036] Figure 4 shows the antitumor effect of drug-antibody conjugates comprising human chimeric antibodies and the cytotoxic agent monomethyl auristatin E (MMAE) in a xenograft model.

[0037] Figure 5 shows the results of a test confirming the reactivity of the indicated human chimeric antibody clones and humanized antibody clones to IL-7R-expressing human cells.

[0038] Figure 6 shows the dose dependency of cytotoxicity of drug-antibody conjugates comprising human chimeric antibodies or humanized antibodies and the cytotoxic agent monomethyl auristatin E (MMAE) against cultured cells (specifically, IL-7R-expressing human cells). Figure 1 shows the antitumor effects of clone 577 chimeric antibody and clone 165 chimeric antibody in IgG1 format and IgG4 format on a tumor-bearing model. The vertical axis represents tumor volume, and the horizontal axis represents the number of days since the start of treatment. Figure 1 shows the antitumor effects of various ADCs with PNU-159682 as a payload on cultured tumor cells. Figure 1 shows the antitumor effects of ADCs with PNU-159682 as a payload on a tumor-bearing model. The vertical axis represents tumor volume, and the horizontal axis represents the number of days since the start of treatment.

[0013] Definition of Terms As used herein, "subject" means a mammal, which may in particular be a human.

[0014] As used herein, the term "treatment" includes both therapy (therapeutic treatment) and prevention (prophylactic treatment). As used herein, "treatment" refers to the treatment, cure, prevention, or improvement in remission of a disease or disorder, or the reduction in the rate of progression of a disease or disorder. As used herein, "prevention" refers to reducing the likelihood of developing a disease or condition, or delaying the onset of a disease or condition.

[0015] As used herein, "disease" refers to a condition for which treatment is beneficial. Diseases include, for example, cancer, inflammatory diseases, and immune disorders.

[0016] As used herein, a "therapeutically effective amount" refers to an amount of a drug effective to treat (prevent or cure) a disease or condition. A therapeutically effective amount of a drug is capable of slowing the rate of worsening of symptoms of a disease or condition, halting the worsening of the symptoms, ameliorating the symptoms, curing the symptoms, or inhibiting the onset or development of the symptoms. A pharmaceutical composition includes a therapeutically effective amount of a therapeutically active ingredient. The therapeutically active ingredient may be a pharmaceutically acceptable salt. The therapeutically active ingredient may be a pharmaceutically acceptable solvate (e.g., hydrate). The drug moiety of an ADC may be in the free form or a pharmaceutically acceptable salt. The drug moiety of an ADC may be a pharmaceutically acceptable solvate (e.g., hydrate).

[0017] As used herein, "resistance" means ineffectiveness (e.g., lack of significant efficacy) in response to treatment. As used herein, "sensitivity" means efficacy in response to treatment. Reducing resistance has the same meaning as increasing sensitivity, and increasing resistance has the same meaning as decreasing sensitivity. For example, in the case of nephrotic syndrome, steroid resistance can be defined as failure to achieve complete remission even after daily administration of prednisolone for four weeks or more. Furthermore, in the case of other inflammatory and autoimmune diseases or malignant diseases such as leukemia and malignant lymphoma, steroid resistance can be defined as failure to improve or worsen symptoms even after administration of various therapeutic steroids such as prednisolone, methylprednisolone, dexamethasone, and betamethasone. Based on knowledge in the field of steroid therapy, physicians can understand and grasp the nature of resistance and appropriately determine whether a subject is resistant.

[0018] As used herein, "IL-7R" refers to the interleukin-7 receptor. When IL-7 (interleukin-7) binds to IL-7R, JAK1, JAK2, and JAK3 are activated, resulting in autophosphorylation of the receptor. STATs bind to the phosphorylated receptor and are phosphorylated by JAKs, resulting in dimerization. It is believed that dimerized STATs activate gene transcription. IL-7R has a high internalization activity, and is internalized from the membrane, degraded, or recycled and then exposed to the membrane. Antibodies against IL-7R are internalized into cells along with IL-7R, making antibodies targeting IL-7R suitable for intracellular drug delivery. It has also been reported that IL-7R-positive monocytes and macrophages appear in inflammatory and autoimmune diseases. In this case, it is thought that inflammation and autoimmune diseases can be effectively controlled by delivering drugs that inhibit JAK1 / JAK2 / JAK3 / TYK2, which are highly expressed in monocytes and macrophages, to monocytes and macrophages (References 1-3).

[0019] As used herein, "blocking" means neutralizing the binding of two proteins. Blocking includes partial dissociation as well as complete dissociation. For example, blocking can be achieved by reducing the binding of two proteins by 50% or more.

[0020] As used herein, "steroid" refers to steroidal anti-inflammatory drugs (SAIDs). The active ingredient of steroids is primarily glucocorticoid or its derivatives. When steroids bind to the glucocorticoid receptor (GRα) within cells, GRα dissociates from hsp90, forms a dimer, and translocates into the nucleus, where it regulates transcription. Synthetic steroids include cortisols such as hydrocortisone and hydrocortisone succinate; prednisolones such as prednisolone, methylprednisolone, and methylprednisolone succinate; triamcinolones such as triamcinolone and triamcinolone acetonide; dexamethasone; and betamethasone. All of these are derivatives of glucocorticoids and function within cells via mechanisms similar to those of glucocorticoids.

[0021] As used herein, the term "antibody" refers to an immunoglobulin, including polyclonal and monoclonal antibodies, with monoclonal antibodies being preferred.

[0022] The origin of the antibody is not particularly limited, but examples include antibodies from non-human animals (e.g., antibodies from non-human mammals) and human antibodies. The antibody may also be a chimeric antibody or a humanized antibody. The antibody may also be a bispecific antibody. The origin of the antibody is preferably a humanized antibody or a human antibody.

[0023] Antibodies are classified into subclasses IgG, IgA, IgE, IgM, and IgD. Human IgG is classified into subclasses IgG1, IgG2, IgG3, and IgG4. Human IgG1, IgG2, and IgG4 are preferably used in pharmaceuticals, and antibodies having sequences of these subclasses can be used as human chimeric antibodies and humanized antibodies.

[0024] The antibody is preferably a chimeric monoclonal antibody, a humanized monoclonal antibody, or a human monoclonal antibody. When used as a pharmaceutical, a chimeric monoclonal antibody is preferably used, more preferably a humanized monoclonal antibody or a human monoclonal antibody, and each is preferably isolated. Note that chimeric monoclonal antibodies and humanized monoclonal antibodies can be prepared from antibodies of non-human animals by methods known per se.

[0025] A humanized antibody has heavy and light chain variable regions containing CDRs from a non-human animal antibody and framework regions from a human antibody, a heavy chain constant region and Fc region from a human antibody, and a light chain constant region. Humanized antibodies are typically produced by replacing the CDRs of a human antibody with the corresponding CDRs from a non-human animal antibody. Humanized antibodies may be produced by introducing amino acid modifications selected from the group consisting of addition, insertion, deletion, and substitution into one or more of the CDRs or framework regions. Amino acid modifications are typically made to enhance or restore the affinity of the humanized antibody for the antigen.

[0026] A human chimeric antibody has the heavy and light chain variable regions of a non-human animal antibody and the heavy and Fc regions and light chain constant regions of a human antibody, and can be produced by replacing the heavy and Fc regions and light chain constant regions of a human antibody with the corresponding regions of a non-human animal.

[0027] An antibody has a structure in which two heavy chains and two light chains are associated. The heavy chain consists of a heavy chain variable region (VH), a heavy chain constant region (CH1, CH2, and CH3), and a hinge region located between the heavy chain variable region and the heavy chain constant region. The light chain consists of a light chain variable region (VL) and a light chain constant region (CL). The heavy chain variable region and the light chain variable region each have three complementarity-determining regions (CDRs), which characterize the antigen specificity of the antibody. The CDRs are called heavy chain CDR1, heavy chain CDR2, and heavy chain CDR3, and light chain CDR1, light chain CDR2, and light chain CDR3, respectively, from the N-terminus of the heavy chain and light chain. Antibodies include full-length antibodies.

[0028] As used herein, a "bispecific binding protein" refers to a protein that has two or more domains that bind to two different antigens or epitopes and is capable of binding to the two different antigens. The domains are typically derived from an antibody, preferably comprising the heavy and light chain variable regions of an antibody. A bispecific binding protein has a first binding domain that binds to a first antigen and a second binding domain that binds to a second antigen, where the first and second antigens bind to different epitopes on the same molecule or different epitopes on the same molecule. The first and second binding domains are derived from antibodies, respectively, and comprise, for example, the heavy and light chain variable regions of antibodies that bind to the first and second antigens, respectively. Examples of bispecific binding proteins include antibodies or antigen-binding fragments thereof that have, in addition to the heavy and light chain variable regions of antibodies that bind to the first and second antigens, heavy chain constant regions and Fc regions, and light chain constant regions, preferably of subclasses selected from the group consisting of human IgG1, IgG2, and IgG4. Bispecific binding proteins also include fusion proteins of an scFv that binds to a first antigen and an scFv that binds to a second antigen.

[0029] As used herein, the term "antigen-binding fragment" refers to a portion of an antibody that retains its ability to bind to an antigen. The antigen-binding fragment may include the heavy chain variable region, the light chain variable region, or both of an antibody of the present disclosure. The antigen-binding fragment may be chimerized or humanized. Examples of antigen-binding fragments include Fab, Fab', F(ab')2, Fv, scFv (single-chain Fv), diabody, sc(Fv)2 (single-chain (Fv)2), and half-molecule Ig. Antigen-binding fragments of these antibodies may be used in the present disclosure. Such antibody fragments can be obtained, for example, by treating the antibody with an enzyme, but are not limited to this. For example, Fab can be obtained by digesting the antibody with papain. Alternatively, F(ab')2 can be obtained by digesting the antibody with pepsin, and Fab' can be obtained by further reduction. These fragments can be expressed and purified as recombinant proteins in prokaryotic or eukaryotic expression systems.

[0030] As used herein, "antibody-drug conjugate" (ADC) refers to a substance in which a monoclonal antibody or its antigen-binding fragment (hereinafter sometimes simply referred to as "antibody, etc.") is directly or indirectly linked to a drug. In an ADC, the monoclonal antibody, etc. and the drug can be linked via an appropriate linker. The ADC binds to a membrane component (e.g., a transmembrane protein such as a receptor) on the cell membrane, is taken up into the cell by endocytosis or internalization, and can be released intracellularly after detaching from the antibody, etc. By introducing a cleavable linker between the antibody, etc. and the drug intracellularly, the linker can be cleaved intracellularly, for example, in an endosome, allowing the drug to be separated from the antibody, etc. and released into the cytoplasm. Even if the ADC does not internalize intracellularly, the bystander effect can still produce the desired efficacy of the drug (e.g., a small molecule compound such as a cytotoxic agent) on the target cell. Using a cytotoxic agent as the drug can kill the cell to which the drug is delivered. Chemotherapeutic agents, radioisotopes, and toxins can be used as cytotoxic agents. Furthermore, when a signal transduction inhibitor is used as a drug, it is possible to inhibit the signal transduction in cells to which the drug is delivered. Examples of signal transduction inhibitors include kinase inhibitors (see, for example, WO 2020 / 130125A). Examples of signal transduction inhibitors include inhibitors of signal pathways downstream of IL-7R, particularly JAK inhibitors. By using a JAK inhibitor as the payload of an ADC targeted to IL-7R, it is possible to allow the JAK inhibitor to act selectively on IL-7R-expressing cells. Therefore, it is expected that this will reduce the side effects of the JAK inhibitor on IL-7R non-expressing cells and / or enhance the effect on IL-7R-expressing cells.

[0031] <Antibodies and antigen-binding fragments thereof of the present disclosure> According to the present disclosure, there is provided an isolated monoclonal antibody or antigen-binding fragment thereof that binds to human interleukin-7 receptor (IL-7R). In a preferred embodiment, the antibody and antigen-binding fragment thereof comprise: (1) a heavy chain variable region comprising a heavy chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 17, a heavy chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 18, and a heavy chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 19, and a light chain variable region comprising a light chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 20, a light chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 21, and a light chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 22; (2) a heavy chain variable region comprising a heavy chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 25, a heavy chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 26, and a heavy chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 27, and a light chain variable region comprising a light chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 28, a light chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 29, and a light chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 30; (3) A heavy chain variable region comprising a heavy chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 33, a heavy chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 34, and a heavy chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 35, and a light chain variable region comprising a light chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 36, a light chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 37, and a light chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 38; or (4) A heavy chain variable region comprising a heavy chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 41, a heavy chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 42, and a heavy chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 43, and a light chain variable region comprising a light chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 44, a light chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 45, and a light chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 46.

[0032] In a preferred embodiment, the antibody and its antigen-binding fragment may be a human chimeric antibody or an antigen-binding fragment thereof. In a preferred embodiment, the antibody and its antigen-binding fragment may be a humanized antibody or an antigen-binding fragment thereof. As an active ingredient of a pharmaceutical composition, a human chimeric antibody and its antigen-binding fragment may be preferably used, and a humanized antibody and its antigen-binding fragment may be more preferably used.

[0033] Antibodies from non-human mammals can be humanized using techniques well known in the art (e.g., the techniques described in Winter et al., Immunol. Today, 14:43-46 (1993)). Humanized monoclonal antibodies can be engineered, for example, by using recombinant DNA techniques to replace the CH1, CH2, CH3, hinge, and / or framework domains of an antibody from a non-human mammal with corresponding human sequences (e.g., the techniques described in WO 92 / 02190 and U.S. Pat. Nos. 5,530,101, 5,585,089, 5,693,761, 5,693,792, 5,714,350, and 5,777,085).

[0034] In a preferred embodiment, the human chimeric antibody has a heavy chain constant region and Fc region derived from human IgG1 and a human light chain constant region. In a preferred embodiment, the human chimeric antibody has a heavy chain constant region and Fc region derived from human IgG2 and a human light chain constant region. In a preferred embodiment, the human chimeric antibody has a heavy chain constant region and Fc region derived from human IgG4 and a human light chain constant region.

[0035] In a preferred embodiment, the humanized antibody has a heavy chain constant region, Fc region, and light chain constant region of a subclass selected from the group consisting of human IgG1, IgG2, IgG3, and IgG4. In a preferred embodiment, the humanized antibody has a heavy chain constant region, Fc region, and light chain constant region of a subclass selected from the group consisting of human IgG1, IgG2, and IgG4. In a preferred embodiment, the humanized antibody has a heavy chain constant region, Fc region, and light chain constant region of human IgG1. In a preferred embodiment, the humanized antibody has a heavy chain constant region, Fc region, and light chain constant region of human IgG2. In a preferred embodiment, the humanized antibody has a heavy chain constant region, Fc region, and light chain constant region of human IgG4.

[0036] In some embodiments, the humanized or chimeric antibody may have antibody-dependent cellular cytotoxicity (ADCC) or complement-dependent cytotoxicity (CDC). To this end, the humanized or chimeric antibody may have an Fc region derived from human IgG1. ADCC and CDC activities can be measured by conventional methods.

[0037] The heavy chain variable region of an antibody typically comprises heavy chain framework region 1 (heavy chain FR1), heavy chain CDR1, heavy chain FR2, heavy chain CDR2, heavy chain FR3, heavy chain CDR3, and heavy chain FR4, as in the heavy chain variable region of a humanized antibody.The light chain variable region of an antibody typically comprises light chain framework region 1 (light chain FR1), light chain CDR1, light chain FR2, light chain CDR2, light chain FR3, light chain CDR3, and light chain FR4, as in the light chain variable region of a humanized antibody.

[0038] In a preferred embodiment, the heavy chain framework region 1 (heavy chain FR1), heavy chain CDR1, heavy chain FR2, heavy chain CDR2, heavy chain FR3, heavy chain CDR3, and heavy chain FR4, and the light chain framework region 1 (light chain FR1), light chain CDR1, light chain FR2, light chain CDR2, light chain FR3, light chain CDR3, and light chain FR4 are selected from the group consisting of avituzumab, abrilumab, adalimumab, alemtuzumab, alirocumab, anifrolumab, atezolizumab, bapineuzumab, belimumab, benralizumab, bevacizumab, bimagrumab, brosozumab, bococizumab, briakinumab, Brodalumab, canakinumab, carlumab, certolizumab, cixutumumab, clazakizumab, codrituzumab, crenezumab, dacetuzumab, daclizumab, dalotuzumab, daratuzumab, denosumab, drozizumab, durigotuzumab, dupilumab, eculizumab, efalizumab, eldelumab, elotuzumab, emibetuzumab, enokizumab, epratuzumab, etrolizumab, evolocumab, farletuzumab, fezakinumab, fezakinumab, ficlatuzumab, figituzumab, fretikumab, foralumab, fresolimumab, fluticamic acid, Ranumab, ganitumab, gantenerumab, gemtuzumab, gevokizumab, gelenbatumumab, golimumab, guselkumab, ivalizumab, imgatuzumab, inotuzumab, ipilimumab, ixekizumab, lampalizumab, lebrikizumab, lenzilumab, rindilumab, lirilumab, matuzumab, mavrilimumab, mepolizumab, mogamulizumab, motavizumab, muromonab, natalizumab, necituzumab, nimotuzumab, nivolumab, obinutuzumab, ocrelizumab, octatumumab, olaratumab, olokizumab, omalizumab, onartuzumab , otelixizumab, otraltuzumab, ozanezumab, palivizumab, panitumumab, panobacumab, palsatuzumab, patrituzumab, pembrolizumab, pertuzumab, pinatuzumab, polatuzumab, ponezumab, radletumab, ramucirumab, ranibizumab, reslizumab, rilotumumab, lobatumumab, romosozumab, sarilumab, secukinumab, seribantumab, sifalimumab, simtuzumab, simtuzumab, tabalumab, tanezumab, teplizumab, tigatuzumab, tildrakizumab, tocilizumab, tobetumab, tralokinumab,The heavy chain framework region 1 (heavy chain FR1), heavy chain CDR1, heavy chain FR2, heavy chain CDR2, heavy chain FR3, heavy chain CDR3, and heavy chain FR4 of one or more antibodies selected from the group consisting of trastuzumab, tremelimumab, urelumab, ustekinumab, vedolizumab, veltuzumab, visilizumab, zalutuzumab, and zanolimumab (antibody group A), and the light chain framework region 1 (light chain FR1), light chain CDR1, light chain FR2, light chain CDR2, light chain FR3, light chain CDR3, and light chain FR4 of one or more antibodies selected from the above group. Heavy chain framework regions 1 to 4 may each be derived from different antibodies or from the same antibody. Light chain framework regions 1 to 4 may each be derived from different antibodies or from the same antibody. Heavy chain framework regions 1-4 and light chain framework regions 1-4 may each be derived from different antibodies or from the same antibody.

[0039] In a preferred embodiment, the heavy chain FR1, heavy chain FR2, heavy chain FR3, and heavy chain FR4 are derived from a heavy chain constant region of a subclass selected from the group consisting of human IgG1, IgG2, IgG3, and IgG4. In a preferred embodiment, the heavy chain FR1, heavy chain FR2, heavy chain FR3, and heavy chain FR4 are derived from a heavy chain constant region of a subclass selected from the group consisting of human IgG1, IgG2, and IgG4. In a preferred embodiment, the light chain FR1, light chain FR2, light chain FR3, and light chain FR4 are derived from a kappa chain or a lambda chain.

[0040] In a preferred embodiment, heavy chain FR1, heavy chain FR2, heavy chain FR3, and heavy chain FR4 have the amino acid sequence set forth in SEQ ID NO: 7, the amino acid sequence set forth in SEQ ID NO: 8, the amino acid sequence set forth in SEQ ID NO: 9, and the amino acid sequence set forth in SEQ ID NO: 10, respectively. In a preferred embodiment, light chain FR1, light chain FR2, light chain FR3, and light chain FR4 have the amino acid sequence set forth in SEQ ID NO: 11, the amino acid sequence set forth in SEQ ID NO: 12, the amino acid sequence set forth in SEQ ID NO: 13, and the amino acid sequence set forth in SEQ ID NO: 14, respectively.

[0041] In a preferred embodiment, heavy chain FR1, heavy chain FR2, heavy chain FR3, and heavy chain FR4 have the amino acid sequences set forth in SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, and SEQ ID NO: 54, respectively. In a preferred embodiment, light chain FR1, light chain FR2, light chain FR3, and light chain FR4 have the amino acid sequences set forth in SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO: 58, respectively.

[0042] In a preferred embodiment, heavy chain FR1, heavy chain FR2, heavy chain FR3, and heavy chain FR4 have the amino acid sequences set forth in SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, and SEQ ID NO: 62, respectively. In a preferred embodiment, light chain FR1, light chain FR2, light chain FR3, and light chain FR4 have the amino acid sequences set forth in SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, and SEQ ID NO: 66, respectively.

[0043] In a preferred embodiment, the antibody and antigen-binding fragment thereof have: (1) a heavy chain variable region comprising a heavy chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 17, a heavy chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 18, and a heavy chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 19; and a light chain variable region comprising a light chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 20, a light chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 21, and a light chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 22; wherein the heavy chain variable region comprises a heavy chain FR1, a heavy chain FR2, a heavy chain FR3, and a heavy chain FR4, and the heavy chain FR1, the heavy chain FR2, the heavy chain FR3, and the heavy chain FR4 have the amino acid sequences set forth in SEQ ID NO: 51, the amino acid sequence set forth in SEQ ID NO: 52, the amino acid sequence set forth in SEQ ID NO: 53, and the amino acid sequence set forth in SEQ ID NO: 54, respectively; The light chain variable region has light chain FR1, light chain FR2, light chain FR3, and light chain FR4, and light chain FR1, light chain FR2, light chain FR3, and light chain FR4 have the amino acid sequence set forth in SEQ ID NO:55, the amino acid sequence set forth in SEQ ID NO:56, the amino acid sequence set forth in SEQ ID NO:57, and the amino acid sequence set forth in SEQ ID NO:58, respectively.

[0044] In a preferred embodiment, the antibody and antigen-binding fragment thereof comprises: (4) a heavy chain variable region comprising a heavy chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 41, a heavy chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 42, and a heavy chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 43; and a light chain variable region comprising a light chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 44, a light chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 45, and a light chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 46; wherein the heavy chain variable region comprises a heavy chain FR1, a heavy chain FR2, a heavy chain FR3, and a heavy chain FR4, and the heavy chain FR1, the heavy chain FR2, the heavy chain FR3, and the heavy chain FR4 have the amino acid sequences set forth in SEQ ID NO: 59, the amino acid sequence set forth in SEQ ID NO: 60, the amino acid sequence set forth in SEQ ID NO: 61, and the amino acid sequence set forth in SEQ ID NO: 62, respectively; The light chain variable region has light chain FR1, light chain FR2, light chain FR3, and light chain FR4, and light chain FR1, light chain FR2, light chain FR3, and light chain FR4 have the amino acid sequence set forth in SEQ ID NO: 63, the amino acid sequence set forth in SEQ ID NO: 64, the amino acid sequence set forth in SEQ ID NO: 65, and the amino acid sequence set forth in SEQ ID NO: 66, respectively.

[0045] The heavy chain FR1-FR4 and light chain FR1-FR4 may have amino acid sequences that are 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more identical to the corresponding amino acid sequences of the heavy chain FR1-FR4 and light chain FR1-FR4, respectively. Alternatively, the heavy chain FR1-FR4 and light chain FR1-FR4 may have one to several (e.g., 1 to 5, 1 to 4, 1 to 3, or 1 to 2) amino acid mutations relative to the corresponding amino acid sequences of the heavy chain FR1-FR4 and light chain FR1-FR4, respectively. The amino acid mutations may be one or more selected from the group consisting of amino acid addition, insertion, substitution, and deletion.

[0046] In certain aspects, antigen-binding fragments of any of the above-described humanized antibodies are provided. In certain preferred aspects, the antigen-binding fragment may comprise, for example, Fab, Fab', or scFv. In certain preferred aspects, the antigen-binding fragment may comprise scFv. In certain preferred aspects, the antigen-binding fragment may be, for example, Fab, Fab', or scFv, e.g., scFv. These fragments may be fused to other proteins or other fragments. For example, by fusing them to other fragments that bind to other epitopes or antigens, multispecific binding proteins (e.g., bispecific binding proteins) can be obtained. Furthermore, these fragments (typically scFv) or multispecific binding proteins (e.g., bispecific binding proteins) containing such fragments may be fused to other proteins and incorporated into chimeric antigen receptors (first, second, and third generation).

[0047] As used herein, a "chimeric antigen receptor" (CAR) is a chimeric molecule comprising an antigen-binding fragment of an antibody (particularly, an scFv) and an immune cell activation domain. A CAR is generally a molecule comprising an scFv, an extracellular hinge domain, a transmembrane domain (e.g., CD8α or CD28), and an activation signaling domain (e.g., CD3ζ) linked together. A CAR can be introduced into a cell and expressed on the cell surface. A cell expressing a CAR can target a specific antigen. A CAR is introduced into immune cells, such as T cells or NK cells, to target the immune cells, such as T cells or NK cells, to target cells, such as cancer cells. While first-generation CARs comprise an scFv, an extracellular hinge domain, a transmembrane domain (e.g., CD8α or CD28), and an activation signaling domain (e.g., CD3ζ), second-generation CARs further comprise a costimulatory molecule signaling domain to activate the immune cells into which the CAR is introduced. Costimulatory factors such as CD28, 4-1BB, OX40, CD27, and ICOS are used as costimulatory molecule signaling domains. Third-generation CARs incorporate multiple costimulatory factors (e.g., a combination of the above costimulatory factors). Thus, improvements have been made to CARs to enable sustained proliferation of CAR-introduced immune cells in vivo. It is preferable that all domains other than the scFv portion are derived from human proteins.

[0048] Antibody-Drug Conjugates (ADCs) of the Present Disclosure In certain aspects, an antibody or its antigen-binding fragment may be in the form of a conjugate with a drug. According to the present disclosure, a conjugate (ADC) comprising an antibody or its antigen-binding fragment and a drug is provided, where the antibody may be an antibody or its antigen-binding fragment of the present disclosure. The drug may be a molecule to be delivered to IL-7R-positive cells by the antibody. Examples of drugs include, but are not limited to, physiologically active substances, preferably small molecular weight compounds, cytokines, and nucleic acids. Drugs also include imaging agents. Examples of small molecular weight compounds include cytotoxic agents and signal transduction inhibitors (preferably inhibitors of signaling pathways downstream of IL-7R, preferably JAK inhibitors). Examples of cytotoxic agents include, but are not limited to, toxins, anticancer drugs, and radioisotopes.

[0049] Examples of toxins include Pseudomonas aeruginosa exotoxin (PE) or cytotoxic fragments thereof (eg, PE38), diphtheria toxin, ricin A, and the like.

[0050] Examples of anticancer agents include chemotherapeutic agents (e.g., anticancer agents such as commercially available anticancer agents, e.g., auristatins (auristatin E, auristatin F phenylenediamine (AFP), monomethylauristatin E, monomethylauristatin F, and derivatives thereof), maytansinoids DM1 and DM4, and derivatives thereof), camptothecins (SN-38, topotecan, and exotecan, and derivatives thereof (e.g., deruxtecan)), DNA minor groove binders (enediynes, lexitropsin, duocarmycin, and derivatives thereof), taxanes (paclitaxel and docetaxel, and derivatives thereof), polyketides (discodermolide and derivatives thereof), anthraquinones (mitoxantrone and derivatives thereof), and benzodiazepines. benzodiazepines (pyrrolobenzodiazepines, indolinobenzodiazepines, and oxazolidinobenzodiazepines and their derivatives), vinca alkaloids (vincristine, vinblastine, vindesine, and vinorelbine and their derivatives), doxorubicins (doxorubicin, morpholino-doxorubicin, PNU-159682 (CAS Registry Number: 202350-68-3), and cyanomorpholino-doxorubicin and their derivatives), cardiac glycosides (digitoxin and its derivatives), calechiamycin, epothilones, cryptophycins, cemadotin, rhizoxin, netropsin, combretastatin, ereutherin, etoposide, T67 (Tularik), and nocodazole), radioactive isotopes (e.g., ３２ P. ６０ C. ９０ Y. １１１ In, １３１ I, １２５ I, １５３ Sm, １８６ Re, １８８ Re, and ２１２ Bi), and toxins (e.g., diphtheria toxin A, Pseudomonas endotoxin, ricin, saporin, etc.), which can be used as cytotoxic agents in the ADCs of the present disclosure. Any cytotoxic agent used in the treatment of cancer can be used.

[0051] Examples of radioisotopes include, but are not limited to, therapeutic nuclides. ３２ P. １４ C. ６０ C. １１１ I, １２５ I, ３ H. １３１ I, ２１１ At, ９０ Y. １８６ Re, １８８ Re, and ２１２ Bi and the like.

[0052] The JAK inhibitor is not particularly limited as long as it is a molecule that can inhibit JAK, and examples thereof include ruxolitinib, tofacitinib, baricitinib, pacritinib, peficitinib, upadacitinib, and filgonitib. The JAK inhibitor is preferably capable of inhibiting one or more selected from the group consisting of JAK1, JAK2, JAK3, and TYK2.

[0053] Examples of cytokines include proteins such as cytokines that activate immunocompetent cells (for example, human interleukin 2, human granulocyte macrophage colony-stimulating factor, human macrophage colony-stimulating factor, and human interleukin 12).

[0054] Nucleic acids include natural nucleic acids such as natural DNA and natural RNA, antisense oligonucleotides (ASOs), siRNA, shRNA, microRNA, gapmers, mixmers, modified nucleic acids such as modified DNA and modified RNA, artificial nucleic acids, and combinations thereof. Examples of modified nucleic acids include fluorescent dye-modified nucleic acids, biotinylated nucleic acids, and nucleic acids into which cholesteryl groups have been introduced. To enhance the stability of RNA, bases may be modified with 2'-O-methyl, 2'-fluoro, or 2'-methoxyethyl (MOE), and the phosphodiester bond in the nucleic acid backbone may be replaced with a phosphorothioate bond. Examples of artificial nucleic acids include nucleic acids in which the oxygen atom at the 2' position and the carbon atom at the 4' position are bridged. Examples of such artificial nucleic acids include locked nucleic acid (LNA), which is a cross-linked DNA in which the oxygen atom at the 2' position and the carbon atom at the 4' position are cross-linked via methylene; ENA, which is a cross-linked DNA in which the oxygen atom at the 2' position and the carbon atom at the 4' position are cross-linked via ethylene; and nucleotides in which the oxygen atom at the 2' position and the carbon atom at the 4' position are cross-linked via -CH ２ OCH ２ -bridged BNA ＣＯＣ , the oxygen atom at the 2' position and the carbon atom at the 4' position are -NR-CH ２ -BNA bridged via {where R is methyl or hydrogen atom} ＮＣ Bridged nucleic acids (BNAs) such as: ２ (OCH ３ )-bridged cMOE, the oxygen atom at the 2' position and the carbon atom at the 4' position are -CH ２ (CH ３Examples of such RNAs include cEt bridged via a 2'-linker, AmNA bridged via an amide at the 2' and 4' carbon atoms, scpBNA bridged via a methylene at the 2' oxygen atom and the 4' carbon atom, forming a cyclopropane at the 6' position, and peptide nucleic acids (PNAs) with a polymer backbone in which N-(2-aminoethyl)glycine is amide-linked instead of deoxyribose or ribose. Examples of RNA include artificial RNAs for gene silencing, such as siRNA and shRNA, non-coding RNAs, such as microRNA (miRNA) and aptamers, and natural RNAs, such as mRNA. These RNAs can be modified to be stabilized in vivo.

[0055] The targets of the conjugate drug of the present disclosure are not particularly limited, and examples thereof include the following: Clusterin gene, Nucleolin gene, AKT1 protein kinase gene, BIRC5 gene, MAGEC1 gene, MAGEC2 gene, CTAG1 gene, TPBG gene, Hsp27 gene, β-Catenin gene, CXCL12 (SDF-1) gene, STAT-3 gene, PKN3 gene, PLK1 gene, mutant KRAS (G12D) gene, Grb-2 gene, androgen receptor gene, TGFβ gene (TGFβ-1 gene, TGFβ-2 gene, TGFβ-3 gene), STAT-3 gene, VEGF gene, KSP (E g5) gene, CEBPA gene, Nek2 gene, p53 gene, MUC1 gene, TPBG gene, HIF-1α gene, RPN2 gene, EphA2 gene, RRM1 gene, CDC45 gene, six-1 gene, IGF-1 receptor gene, HoxA1 ​​gene, IGFBP-2 gene, IGFBP-5 gene, EGF receptor gene, Raf-1 gene, mTOR gene, Bcl-2 gene, Casein kinase-2 gene, KRAS gene, c-Myc gene, COX-2 gene, β-3tubin gene, ITCH gene, VEGF gene, VEGF receptor 2 gene, SIP1 gene, AGT gene, ERV-9 LTR gene, EVI1 gene, TNF-α gene, PAX-2 gene, Srpx2 gene, IRS-1 gene, Survivin gene, DUSP6 gene, HPV E6 / E7 gene, HSPA9 gene, mitochondrial RNA (non-coding mitochondrial RNA), EWS FLI1 gene, SRC-3 gene, MDR1 gene, NTRK1 gene, NTRK2 gene, MDX3 gene, NR2F6 gene, MYD88 gene, NOTCH1 gene, β-3 integrin gene, c-FLIP gene, MADD gene, HER2 gene, CCAT2 gene, CTCFL gene, HIF-2α gene, BMI-1 gene, NETO-2 gene, CTFR gene, PD-1 gene, PD-L1 gene, PD-L2 (B7-DC (CD273)) gene, CLTA4 gene, HLA gene (HLA-A,HLA-B, HLA-C, HLA-DR, HLA-DP, HLA-DQ, HLA-E, HLA-G), MCH gene, gene, 4-1BB gene, 4-1 BBL gene, CD3 gene (CD3α, CD3β, CD3γ, CD3δ, CD3ε, CD3ζ gene), IL-6 gene, IL-17 gene, IL-23 gene, ICOS gene, CD70 gene, CD27 gene, OX40 gene, OX40L gene, TL1A gene, DR3 gene, GITRL gene, GITR gene, CD30L gene, CD30 gene, TIM1 gene, TIM1L gene, TIM4 gene, SLAM gene, CD48 gene, CD58 gene, CD2 gene, CD155 gene, CD112 gene, CD226 gene, CD80 (B7-1) gene, CD86 (B7-2) gene, B7-H2 gene, LIGHT gene, HVEM gene, C D40 gene, CD40L gene, Galectin9 gene, CD113, Collagen gene, CD160 gene, LAG3 gene, PSA gene, PSMA gene, PSCA gene, STEAP gene, BIRC5 gene, MAGEC1 gene, MAGEC2 gene, CTAG1 gene, TPBG gene, or molecules such as proteins encoded by these genes, or mRNA encoding proteins encoded by these genes, proteins known as the HDGF family (prototype protein, HDGF; HRP-1, HRP-2, HRP-3, HRP-4 (HRP = HDGF-related protein (HDGF Related Protein)) Protein); and LEDGF (particularly HRP-3), TrkB receptor, or genes or mRNAs encoding these receptors, miR-34, miR-34a, miR-16, miR-155, miR-17, miR-17-92, miR-215, let-7, miR-34, miR-10b, miR-3157, miR-34, miR-7, miR-21, miR-574-5p, miR-221, miR-484, miR-205, miR-210, miR-3189-3p, miR-3151, miR-199, miR-101, miR-96, miR-182, and other miRNAs.

[0056] In the ADCs of the present disclosure, the drug and antibody are linked by a linker. The linker may be a cleavable linker or a non-cleavable linker. Examples of cleavable linkers include linkers having an -S-S- bond in their structure that is cleaved in the reducing environment within a cell (e.g., an SS linker or a DMSS linker), linkers having a hydrazone bond in their structure that is cleaved by the low pH within an endosome, linkers having an orthoester bond in their structure, and linkers having a peptide bond in their structure that is cleaved by cathepsin B (e.g., a linker having a valine-citrulline bond in the molecule (Val-Cit linker)), which can be preferably used in the present disclosure. In addition to the above, other cleavable linkers include linkers having a sugar chain in their structure that is cleaved by a glycolytic enzyme such as glucuronidase, which can be preferably used in the present disclosure.

[0057] Examples of non-cleavable linkers include linkers (sometimes referred to herein as maleimide linkers) that do not have a binding site that is cleavable in an intracellular environment (for example, the low pH environment in an endosome and the reducing environment in a cell) in their structure, and can be preferably used in the present disclosure.

[0058] An example of a cleavable linker is a linker having a succinimidyl group obtained by reacting the S atom of a cysteine ​​residue of an antibody with a maleimide group, a first spacer, valine-citrulline, and a second spacer. The first spacer can be polyalkylene glycol (preferably polyethylene glycol). The second spacer can be p-aminobenzyl carbamate (PABC). An example of a cleavable linker is a linker containing a succinimidyl group obtained by reacting the S atom of a cysteine ​​residue of an antibody with a maleimide group, polyalkylene glycol (preferably polyethylene glycol), valine-citrulline, and p-aminobenzyl carbamate (PABC). In some embodiments, the drug-antibody ratio (DAR) can be a natural number from 1 to 8. The DAR indicates the number of drugs linked to one antibody.

[0059] In some embodiments, the ADC may have the structure: {wherein "mAb" represents a monoclonal antibody and "PEG 12 " represents polyethylene glycol with a degree of polymerization of 12, and "t" represents the drug-antibody ratio. Here, t is a natural number from 1 to 8 when the mAb is IgG1. PEG may be replaced with an alkyl having 1 to 10 carbon atoms (e.g., a lower alkyl having 1 to 6 carbon atoms).

[0060] Those skilled in the art will understand that an antigen-binding fragment of an antibody can be used instead of an antibody in the ADC. That is, the ADC comprises an antigen-binding fragment of an antibody and a drug, and the fragment and the drug can be linked via the linker. The drug may be directly linked to the linker, or the drug may be encapsulated in a drug delivery carrier (e.g., lipid nanoparticles), and the lipid nanoparticles may be directly linked to the linker. The linker may be directly linked to the thiol group of a cysteine ​​residue or the amino group (preferably the thiol group) of a lysine residue. In a preferred embodiment, the linker is linked to the thiol group of a cysteine ​​residue of the antibody via a succinimidyl group.

[0061] The present disclosure also provides an antibody-drug conjugate (ADC) of an antibody that binds to IL-7R and PNU-159682. The antibody and PNU-159682 can be linked via a linker. Any antibody can be used as long as it can bind to IL-7R expressed on the cell membrane. Examples of antibodies that can be incorporated into ADCs include the antibodies disclosed herein, as well as antibodies having heavy chain CDRs 1-3 and light chain CDRs 1-3 of anti-IL-7R antibodies such as GSK2618960 and PF-06342674. The presence of one to several (e.g., 1-5, 1-3, or 1) amino acid mutations in the amino acid sequence does not necessarily result in a loss of binding affinity to IL-7R. Therefore, antibodies having one to several (e.g., 1-5, 1-3, or 1) amino acid mutations in the amino acid sequence can also be preferably used in the present disclosure, as long as they retain binding affinity to IL-7R.

[0062] As an example, the structure of a conjugate between an antibody and PNU-159682 is shown below. In this conjugate, the payload PNU-159682 is linked to the S atom of a cysteine ​​residue of the antibody via a succinimidyl group, via crosslinking using PEG4, valine-citrulline dipeptide, p-aminobenzyl, and a crosslinking agent. When the antibody is IgG1, the drug-antibody ratio can be 1 to 8. When the antibody is IgG4, the drug-antibody ratio can also be 1 to 8. In addition, the space between the two carbamate bonds formed by the crosslinker can be substituted or unsubstituted alkylene, alkynylene, or alkenylene (e.g., methyl, ethyl, or propyl), and one or more carbons can be replaced by heteroatoms, such as heteroatoms selected from the group consisting of S, N, and O.

[0063] <Bispecific Binding Proteins of the Present Disclosure> According to the present disclosure, an antibody or antigen-binding fragment thereof of the present disclosure may be a bispecific protein. That is, an antibody or antigen-binding fragment thereof of the present disclosure has a first binding domain that binds to a first antigen or epitope and a second binding domain that binds to a second antigen or epitope. In some embodiments, the first and second antigens are different. In some embodiments, the first and second antigens are identical, but the epitope of the first binding domain is different from the epitope of the second binding domain. In some preferred embodiments where the first and second antigens are identical, the first and second binding domains can bind to the antigen simultaneously (do not compete for binding to the antigen).

[0064] In a preferred embodiment, the first antigen binds to IL-7R and the second antigen binds to a T cell antigen (e.g., the T cell receptor complex, preferably CD3, e.g., the CD3 epsilon chain (CD3ε)). In this embodiment, the bispecific antibody links tumor cells or immune cells to T cells, thereby capable of killing the tumor cells or immune cells.

[0065] In a preferred embodiment, the first binding domain and the second binding domain can simultaneously bind to IL-7R. In this embodiment, the bispecific binding protein may have ADCC activity. In this embodiment, the bispecific binding protein may also be in the form of a conjugate with a drug (ADC), which may or may not have ADCC activity. For more details about ADCs, see the section on antibody drug conjugates (ADCs) of this disclosure above.

[0066] The first and second binding domains may comprise the heavy and light chain variable regions of an antibody, respectively. The first and second binding domains may comprise the Fab or scFv fragments of an antibody, respectively.

[0067] In a preferred embodiment, the bispecific binding protein may be a whole IgG-type bispecific antibody. In a whole IgG-type bispecific antibody, the first binding domain and the second binding domain each comprise a Fab fragment. In a preferred embodiment, the bispecific binding protein comprises a first binding domain and a second binding domain each comprise an scFv fragment, and preferably, the first binding domain and the second binding domain are linked via a peptide linker (e.g., a GS linker or a Whitlow linker (see, e.g., US 2019 / 0092818A)).

[0068] <Pharmaceutical Compositions of the Present Disclosure> The present disclosure provides a pharmaceutical composition comprising an antibody or antigen-binding fragment thereof of the present disclosure. The present disclosure also provides a pharmaceutical composition comprising an ADC of the present disclosure. The present disclosure further provides a pharmaceutical composition comprising a bispecific binding protein of the present disclosure. The pharmaceutical composition may further comprise a pharmaceutically acceptable additive.

[0069] Pharmaceutically acceptable additives include, but are not limited to, salts, solvents (e.g., water and ethanol), buffers, sugars and sugar alcohols, surfactants, isotonicity agents, preservatives, antioxidants, chelating agents, and excipients.The pharmaceutical composition of the present disclosure may be formulated according to conventional methods as a medicament for intravenous, subcutaneous, intraperitoneal, or intratumoral administration.According to the present disclosure, the conjugate may be prepared as a medicament using a vehicle suitable for administration (e.g., sterilized pyrogen-free water) before use.

[0070] The pharmaceutical compositions of the present disclosure can be used, for example, to treat tumors, inflammatory diseases, or immune diseases.

[0071] Many cancer cells are IL-7R positive. Therefore, many cancers can be targets for treatment with the medicaments of the present disclosure. Furthermore, in order to identify a target population with high efficacy, in certain aspects of the present disclosure, the cancer can be an IL-7R-positive cancer or a cancer confirmed to be IL-7R-positive. IL-7R-positive cancers include leukemia, lymphoma, lung cancer, pancreatic cancer, head and neck cancer, prostate cancer, bladder cancer, breast cancer, esophageal cancer, gastric cancer, colorectal cancer, uterine cancer, ovarian cancer, skin cancer, thyroid cancer, thymic cancer, kidney cancer, testicular cancer, penile cancer, liver cancer, biliary tract cancer, brain tumors, bone and soft tissue tumors, retroperitoneal tumors, angiolymphangiosarcoma, and metastatic cancers thereof (e.g., metastatic solid tumors). Many cancers, for example, leukemia, lymphoma, advanced cancers, and metastatic cancers, are IL-7R positive. Whether a cell is IL-7R positive or negative can be easily determined using techniques such as immunostaining or FACS using an anti-IL-7R antibody.

[0072] The pharmaceutical compositions of the present disclosure can be used to treat IL-7R-positive cells (e.g., cancer cells, immune cells, inflammatory cells) that are resistant to treatments that block the binding of IL-7R to IL-7.

[0073] Furthermore, WO 2018 / 159808A discloses that IL-7R is involved in conferring steroid resistance. In particular, IL-7R becomes positive in steroid-resistant cells. Thus, according to the present disclosure, there is provided a pharmaceutical composition for use in treating a steroid-resistant disease or condition, the pharmaceutical composition comprising an antibody-drug conjugate comprising an antibody or antigen-binding fragment thereof of the present disclosure and a drug. In one aspect, there is provided a pharmaceutical composition for use in reducing steroid resistance in a disease or condition, the pharmaceutical composition comprising an antibody-drug conjugate comprising an antibody or antigen-binding fragment thereof of the present disclosure and a drug. In one aspect, the steroid-resistant disease or condition is cancer, an inflammatory disease, or an immune disease. Furthermore, WO 2018 / 159808A discloses that IL-7R expression is increased after steroid treatment. In particular, IL-7R-positive cells are more likely to survive after steroid treatment, thereby enhancing the efficacy of the conjugate of the present disclosure. Even if IL-7R-negative cells survive (e.g., in patients after steroid treatment), a therapeutic effect can be expected because the bystander effect of PDC is expected to kill IL-7R-negative cells in the vicinity of IL-7R-positive cells.

[0074] In certain aspects, the cells to be treated may be steroid-resistant IL-7R-positive cells. Thus, the pharmaceutical compositions of the present disclosure may be used to treat subjects having steroid-resistant IL-7R-positive cells (e.g., cancer cells, inflammatory cells, immune cells).

[0075] In certain aspects, a pharmaceutical composition is provided for use in treating a disease or condition, such as cancer, an inflammatory disease, or an immune disease, in a subject receiving steroid therapy, the pharmaceutical composition comprising an antibody drug conjugate of the present disclosure.

[0076] In certain aspects, steroids can be administered while reducing steroid resistance with the pharmaceutical compositions of the present disclosure. Accordingly, certain aspects of the present disclosure provide pharmaceutical compositions for use in treating a steroid-resistant disease or condition, the pharmaceutical composition comprising an antibody-drug conjugate of an antibody or antigen-binding fragment thereof of the present disclosure and a cytotoxic agent, in combination with a steroid. Alternatively, the present disclosure provides pharmaceutical compositions for use in reducing the steroid resistance of a disease or condition (or increasing the steroid sensitivity of a disease or condition), the pharmaceutical composition comprising an antibody-drug conjugate of an antibody or antigen-binding fragment thereof of the present disclosure and a cytotoxic agent. In these aspects, the subject may be a subject with a steroid-resistant disease or condition.

[0077] Furthermore, WO 2018 / 159808A discloses that an antibody-drug conjugate of the antibody or antigen-binding fragment thereof of the present disclosure and a cytotoxic agent can suppress lymph node swelling in a cancer subject. Thus, the present disclosure provides a pharmaceutical composition for use in suppressing lymph node swelling in a cancer subject, the pharmaceutical composition comprising an antibody-drug conjugate comprising the antibody or antigen-binding fragment thereof of the present disclosure and a drug.

[0078] WO 2018 / 159808A also demonstrated that antibody-drug conjugates comprising an antibody of the present disclosure and a drug are effective in alleviating symptoms of inflammatory diseases such as ulcerative colitis and rheumatoid arthritis. This suggests that IL-7R-positive cells are strongly involved in the onset or maintenance of inflammatory diseases, and means that killing IL-7R-positive cells in inflammatory conditions is useful for alleviating inflammation. Thus, the present specification provides a pharmaceutical composition for use in treating inflammatory diseases, comprising an antibody-drug conjugate comprising an antibody or antigen-binding fragment thereof of the present disclosure and a drug. As used herein, inflammatory diseases include collagen diseases, and also include autoimmune diseases, type 1 diabetes, multiple sclerosis, systemic lupus erythematosus, allergic diseases, rejection after organ transplantation, and graft-versus-host disease. Inflammatory diseases also include inflammatory bowel diseases such as Crohn's disease. Other autoimmune diseases and collagen diseases include Sjogren's syndrome, scleroderma, dermatomyositis, polyarteritis nodosa, mixed connective tissue disease, Cogan's syndrome, polymyalgia rheumatica, adult Still's disease, giant cell arteritis, antiphospholipid syndrome, Guillain-Barré syndrome, myasthenia gravis, autoimmune hepatitis, autoimmune pancreatitis, primary biliary cholangitis, Takayasu's arteritis, Goodpasture's syndrome, rapidly progressive glomerulonephritis, autoimmune hemolytic anemia, autoimmune neutropenia, idiopathic thrombocytopenic purpura, Graves' disease, Hashimoto's disease, primary hypothyroidism, idiopathic Addison's disease, pemphigus, pustular psoriasis, plaque psoriasis, pemphigoid, herpes gestationis, and fibroids. Examples of IL-7R-positive lymphocytes include autoimmune diseases or collagen diseases selected from the group consisting of IgA bullous dermatitis, epidermolysis bullosa acquisita, alopecia areata, vitiligo, Harada's disease, autoimmune optic neuropathy, autoimmune inner ear disorder, idiopathic azoospermia, and habitual abortion. Lymphocyte-related type 4 allergies include organ transplant rejection and bronchial asthma caused by innate lymphocytes. In many inflammations, lymphocytes are IL-7R-positive. Specifically, since IL-7R is positive in T lymphocytes and B lymphocytes, which are adaptive immune system lymphocytes, as well as innate immune system lymphocytes, many inflammatory diseases caused by these cells can be treated with the pharmaceutical composition of the present disclosure.

[0079] In the present disclosure, the inflammatory disease can be a disease or condition that is resistant to steroids or to treatments that block the binding of IL-7R to IL-7.

[0080] In certain aspects of the present disclosure, there is provided a method of treating cancer, an inflammatory disease, or an immune disease in a subject in need thereof, the method comprising administering to the subject an antibody-drug conjugate comprising an antibody or antigen-binding fragment thereof of the present disclosure and a drug. The conjugate may be administered in a therapeutically effective amount. In certain aspects of the present disclosure, the subject may be a subject who is resistant to steroid treatment or a subject who has received steroid treatment. In certain aspects of the present disclosure, there is provided a method of treating cancer, an inflammatory disease, or an immune disease in a subject in need thereof, the method comprising administering to the subject an antibody-drug conjugate comprising an antibody or antigen-binding fragment thereof of the present disclosure and a drug, and administering to the subject a steroidal anti-inflammatory drug. In certain aspects of the present disclosure, the subject may be a subject who is resistant to steroid treatment or a subject who has received steroid treatment.

[0081] In certain aspects of the present disclosure, there is provided a method of treating a steroid-resistant disease or condition in a subject in need thereof, the method comprising administering to the subject an antibody-drug conjugate comprising an antibody or antigen-binding fragment thereof of the present disclosure and a drug.

[0082] In certain aspects of the present disclosure, there is provided a method of reducing steroid resistance of a disease or condition in a subject in need thereof, the method comprising administering to the subject an antibody drug conjugate comprising an antibody or antigen-binding fragment thereof of the present disclosure and a drug.

[0083] Certain aspects of the present disclosure provide use of an antibody or antigen-binding fragment thereof of the present disclosure in the manufacture of a medicament for use in treating cancer, an inflammatory disease, or an immune disease, comprising an antibody-drug conjugate comprising the antibody or antigen-binding fragment thereof of the present disclosure and a drug. Certain aspects of the present disclosure provide use of an antibody or antigen-binding fragment thereof and a cytotoxic agent in the manufacture of a medicament for use in treating cancer, an inflammatory disease, or an immune disease, comprising an antibody-drug conjugate comprising the antibody or antigen-binding fragment thereof of the present disclosure and a drug. Certain aspects of the present disclosure provide use of an antibody-drug conjugate comprising the antibody or antigen-binding fragment thereof of the present disclosure and a drug in the manufacture of a medicament for use in treating cancer, an inflammatory disease, or an immune disease.

[0084] In one aspect of the present disclosure, there is provided the use of an antibody-drug conjugate comprising an antibody or antigen-binding fragment thereof of the present disclosure and a drug in a method for treating cancer, an inflammatory disease, or an immune disease.

[0085] In the present disclosure, instead of killing IL-7R-expressing cells with ADCs, it may be possible to suppress the expression of IL-7R in IL-7R-expressing cells. Thus, in certain aspects of the present disclosure, a pharmaceutical composition for use in treating cancer, an inflammatory disease, or an immune disease is provided, comprising an IL-7R expression inhibitor. The present disclosure also provides a pharmaceutical composition for use in treating a steroid-resistant disease or condition, comprising an IL-7R expression inhibitor. The present disclosure further provides a pharmaceutical composition for use in reducing steroid resistance in a disease or condition, comprising an IL-7R expression inhibitor. The present disclosure still further provides a pharmaceutical composition for use in treating a steroid-resistant disease or condition, comprising an IL-7R expression inhibitor in combination with a steroid. The present disclosure still further provides a pharmaceutical composition for use in suppressing lymph node swelling in a subject with cancer, comprising an IL-7R expression inhibitor.

[0086] Examples of inhibitors of IL-7R expression that can be used in the present disclosure include siRNA, shRNA, and antisense oligonucleotides against IL-7R. Examples of inhibitors of IL-7R expression also include expression vectors containing DNA encoding siRNA or shRNA.

[0087] According to the present disclosure, a bispecific binding protein that binds to an IL-7R-expressing cell and a T cell receptor (TCR) complex (preferably CD3, e.g., CD3 epsilon chain (CD3ε)) may be used instead of an ADC. For details of such bispecific binding proteins, see the section on bispecific binding proteins of the present disclosure. According to the present disclosure, a pharmaceutical composition comprising a bispecific binding protein of the present disclosure is provided. Additives to be added to the pharmaceutical composition and uses of the pharmaceutical composition are as described above.

[0088] According to the present disclosure, T cells (CAR-T cells) or NK cells (CAR-NK cells) expressing a chimeric antigen receptor that binds to IL-7R may be used instead of ADCs. CARs can activate CAR-expressing cells when they bind to cells expressing a target antigen. According to the present disclosure, there is provided a pharmaceutical composition comprising the CAR-expressing cells of the present disclosure (e.g., T cells (e.g., cytotoxic T cells) or NK cells). Additives to be added to the pharmaceutical composition and uses of the pharmaceutical composition are as described above.

[0089] Immunization of IL-7R KO Mice. IL-7R KO mice were provided by Dr. Ikuta of the Department of Immunoregulation, Institute for Virus Research and Frontier Medical Sciences, Kyoto University. Recombinant human IL-7R (R&D Systems) produced in HEK293 cells and carrying an Fc tag attached to its C-terminus was administered as an immunogen. The antigen was diluted with sterile phosphate-buffered saline (PBS) to prepare a 40 μg / ml antigen solution, which was placed in a 1 ml syringe. An equal volume of Freund's Complete Adjuvant (Difco) was placed in another 1 ml syringe, and the syringes were connected with an adapter to form an emulsion. For the first immunization, 100 μl of the resulting emulsion was administered intraperitoneally. For the second and subsequent immunizations, the immunogen was adjusted to 250 μg / ml in sterilized PBS and mixed with an equal volume of GERBU ADJUVANT 100 (Nacalai Tesque) in a 1.5 ml tube. The mixture was then administered using a 1 ml syringe. 100 μl of the immunogen was administered intraperitoneally.

[0090] Blood was collected from the tail vein of immunized mice. After centrifugation at 13,000 × g for 10 minutes at 4°C, the supernatant was collected and used as a sample. Antibody titers were measured by indirect ELISA using serially diluted samples, from 1:500 to 1:64,000. Recombinant Human IL-7Rα Fc Chimera (R&D Systems) was diluted with 0.1 M phosphate buffer to a final concentration of 0.1 μg / ml, and 50 μl of the solution was added to a 96-well immunoplate (MaxiSorp™, Thermo Fisher Scientific). The plate was then allowed to stand at room temperature for 1 hour for immobilization. After washing three times with 200 μL / well of TBS-T, 200 μL / well of PBS / 0.1% Tween 20 / 0.25% skim milk (BD) blocking solution was added and allowed to stand at room temperature for 30 minutes. After discarding the solution and washing three times with TBS-T, 50 μl / well of serially diluted samples in blocking solution was added and incubated at room temperature for 1 hour. After discarding the sample and washing three times, 50 μl / well of secondary antibody diluted 5000-fold in blocking solution was added and incubated at room temperature for 30 minutes. The secondary antibody used was Peroxidase-conjugated AffiniPure Goat anti-mouse IgG (H+L) (Jackson ImmunoResearch). After discarding the solution and washing three times with TBS-T, 100 μl / ml of chromogenic substrate solution (0.2 M sodium citrate / TMB / 30% H2O2) was added and incubated at room temperature for 15 minutes. The reaction was stopped by adding 30 μl / well of 2N H2SO4. The absorbance at 450 nm was then measured using a Spectra Max paradigm (Molecular Devices).

[0091] Cell fusion and generation of anti-IL-7R antibody-producing hybridomas. The mouse myeloma cell line P3X63-Ag8.653 (hereafter referred to as "x63") was purchased from the JCRB Cell Bank. It was cultured in 440 ml of RPMI 1640 (Wako) supplemented with 50 ml of inactivated fetal bovine serum (FBS, Gibco) and 10 ml of 100 units / ml penicillin, 100 μg / ml streptomycin, and 250 ng / ml amphotericin B (Wako) at 37°C in a 5% CO2 incubator (Sanyo). When the cells reached semi-confluence, occupying approximately 80% of a 150 mm dish (Corning), they were passaged in a clean bench. The cells were detached by pipetting and placed in a 15 ml centrifuge tube (Corning). The cells were centrifuged at 270 × g for 3 min at 4°C using a centrifuge (Universal Centrifuge 5800, Kubota). The supernatant was removed and the cells were suspended in 5 ml of RPMI 1640. A new 150 mm dish was prepared, and an appropriate amount of the cell suspension was added thereto. The dish was then gently shaken. The dish was then cultured in a CO2 incubator.

[0092] Mice were sacrificed under inhalation anesthesia by cardiac bleed using a 1 mL syringe (Terumo). The spleens were then surgically removed and placed in RPMI 1640 medium supplemented with 200 units / mL penicillin, 200 μg / mL streptomycin, and 500 ng / mL amphotericin B. To prevent infection, the spleens were immersed in 70% ethanol for several seconds, washed with RPMI 1640, and then transferred to a 100 mm dish containing RPMI 1640. RPMI 1640 was injected into the spleen using a 10 mL syringe (Terumo) and a 22G needle (Terumo), and splenocytes were extracted. The spleens were then passed through an EASY strainer with a 70 μm mesh (Greiner). The collected cell suspension was centrifuged at 270 × g for 5 minutes at room temperature, the supernatant removed, and the cells were suspended in 10 ml of RPMI 1640. This washing process was repeated twice with RPMI 1640, and the cells were suspended in 5 ml of RPMI 1640. Next, P3X63-Ag8.653 cells were prepared for cell fusion with splenocytes. The cells were detached by pipetting, centrifuged at 270 × g for 3 minutes at room temperature, the supernatant removed, and the cells were suspended in 10 ml of RPMI 1640. This washing process was repeated twice with RPMI 1640, and the cells were suspended in 5 ml of RPMI 1640. The cells were mixed at a lymph node cell to P3X63-Ag8.653 ratio of 5:1 to 7:1, and the mixture was centrifuged at 270 × g for 3 minutes at room temperature, and the supernatant removed. 1.8 g of PEG 4000 was dissolved in 2 ml of RPMI 1640 and filtered through a 0.22 μm MILLEX-GV Syringe Driven Filter Unit. 1 ml of the PEG 4000 solution was added to the cells, which had been thoroughly loosened by tapping, at a rate of 1 ml / min while vortexing. Next, 2 ml of RPMI 1640 was added at a rate of 1 ml / min, followed by 8 ml at a rate of 4 ml / min while vortexing. The cells were centrifuged at 170 × g for 5 min at room temperature, and the supernatant was removed. Fusion medium was prepared with the composition listed in Table 2-2 (see Table 1). Cells were suspended in Fusion medium and seeded onto Costar 96-well cell culture plates (Corning).

[0093] One week after cell fusion, the culture supernatant was screened by flow cytometry and ELISA. Limiting dilution was performed on wells that were IL-7R positive and showed strong binding to the IL-7R-positive cell line NALM6. Individual clones were isolated and their binding to the IL-7R-positive cell line NALM6 was again measured by flow cytometry (see Figure 1).

[0094]

[0095] Cloning of antibody genes. Total RNA was extracted from hybridoma cell clones using the RNeasy mini Kit (QIAGEN). Gene fragments for the antibody heavy and light chain variable regions were obtained by 5'-RACE using the SMARTer RACE cDNA Amplification Kit (Clontech). Amplification was performed using KOD One (TOYOBO) polymerase in the first step and Platinum Taq (Thermo Fisher) in the second step.

[0096] Primer sequences used: Forward primer (SEQ ID NO: 1): CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT Reverse primer 1 (SEQ ID NO: 2): GGACTCTGGGATCATTTACCCGGAGAGT Reverse primer 2 (SEQ ID NO: 3): CCTTAGGAGGGAAGATTGGAAGGAGCT

[0097] The gene fragments were cloned into the pTA2 vector (TOYOBO) and sequenced using a DNA sequencer. The amino acid sequences of the heavy and light chain variable regions of each clone are shown below. The boxes in each sequence indicate the complementarity-determining regions (CDRs) predicted by Kabat's numbering system (see Kabat et al., Ann. NY Acad. Sci. 190:382-93 (1971) and "Sequence of Proteins of Immunological Interest," U.S. Dept. Health and Human Services, 1983).

[0098]

[0099]

[0100]

[0101]

[0102] Human Chimerization of Antibodies. The antibody gene fragments of clones 577, 2D5, 24, and 165 were amplified by PCR and cloned into the pcDNA3.3 vector (Thermo Fisher) incorporating human antibody constant regions to generate expression vectors. The sequences were confirmed by DNA sequencing. The constructed expression vectors were transfected into CHO cells using the Expi CHO Expression System (Thermo Fisher) for transient antibody expression. For clones 577, 2D5, 24, and 165, the constant and Fc regions were prepared in two antibody formats, IgG1 and IgG4, and monoclonal antibodies of each clone in the IgG1 and IgG4 formats were produced in CHO cells. More specifically, the heavy chain variable region of each clone was linked to the heavy chain constant region and Fc region of human IgG1 having the amino acid sequence set forth in SEQ ID NO: 4, and the light chain variable region of each clone was linked to the light chain constant region having the amino acid sequence set forth in SEQ ID NO: 6 to generate chimeric antibodies in the IgG1 format. Furthermore, the heavy chain variable region of each clone was linked to the heavy chain constant region and Fc region of human IgG4 having the amino acid sequence of SEQ ID NO:5, and the light chain variable region of each clone was linked to the light chain constant region having the amino acid sequence of SEQ ID NO:6 to obtain a chimeric antibody in IgG4 format.

[0103] The resulting antibodies were collected from the culture supernatant, affinity purified with Protein A, and purified by gel filtration column chromatography before use in experiments.

[0104] The binding of the anti-human IL-7R antibody clones 577, 2D5, 24, and 165 in IgG1 and IgG4 formats to the human IL-7R-positive pre-B cell line NALM6 and the strongly IL-7R-positive cell line REH was measured by flow cytometry (see Figure 2).

[0105] Furthermore, we created antibody-drug conjugates (ADCs) with MMAE as the payload and confirmed their in vitro cell-killing effects against NALM6 and REH. Both showed strong cell-killing effects (see Figure 3). Furthermore, the IgG1 format clone 577 chimeric antibody showed strong antitumor effects in an animal model of NALM6 (see Figure 4). We also created an ADC with PNU-159682 as the payload and confirmed its in vitro cell-killing effects in the same way, demonstrating a significantly higher cell-killing effect than the ADC with an MMAE payload.

[0106] PNU-159682 has the following structure, and the prepared ADC has the following structure: The drug-antibody ratio of the prepared ADC was 3-4.

[0107]

[0108] In addition to the clone 577 chimeric antibody, we also prepared the clone 165 chimeric antibody in IgG1 and IgG4 formats, and produced ADCs with MMAE as the payload. When we examined the antitumor effects in the NALM6 animal model, we found that the IgG1 format of both clone 577 and clone 165 had stronger antitumor effects than the IgG4 format (Figure 7).

[0109] Furthermore, we constructed ADCs with the payload PNU-159682 for the clone 577 chimeric antibody, clone 165 chimeric antibody, and clone 24 chimeric antibody, and confirmed their in vitro cytotoxicity against NALM6 and REH. All of these showed strong in vitro cytotoxicity (Figure 8). It should be noted that free cytotoxic agents typically act at lower concentrations than ADCs, and this does not necessarily mean that the ADCs are less effective. Furthermore, in an animal model of NALM6, we confirmed the antitumor effects of two ADCs, one with an MMAE payload and the other with a PNU-159682 payload, for the IgG1 format clone 577 chimeric antibody. The latter showed stronger antitumor activity at a lower dose (0.5 mg / kg) than the former (Figure 9).

[0110] Antibody humanization: Human chimeric clones 577 and 165 were humanized. Multiple amino acid variants were designed for each clone according to the literature (Methods Mol Biol. 2014;1060:123-37.doi: 10.1007 / 978-1-62703-586-6), and gene fragments were prepared using artificial genes. Cloning and purification were performed using the same method as for human chimeric antibody generation and used in the experiments. For comparison, a previously reported anti-IL-7R antibody clone, B12 (Leukemia. 2019;33(9):2155-2168.), was also prepared as a human chimeric antibody in IgG1 format and used.

[0111] The binding of the anti-human IL-7R antibody clone 577 in IgG1 format to the IL-7R-positive cell line NALM6 and the strongly IL-7R-positive cell line REH was measured by flow cytometry (see Figure 5).

[0112] Furthermore, we constructed an antibody-drug conjugate (ADC) with MMAE as the payload. Specifically, the above-mentioned anti-human IL-7R antibody clone was reduced by treatment with cysteine ​​at 37°C for 30 minutes, and then reacted with the reduced antibody clone (VcMMAE) at 4°C overnight to obtain the ADC. We confirmed that the in vitro cytotoxicity against NALM6 and REH was higher than that of the previously reported clone B12 (Leukemia. 2019 doi: 10.1038 / s41375-019-0434-8). Both clones exhibited strong cytotoxicity (see Figure 6).

[0113] All documents cited herein are incorporated by reference in their entirety.

[0114]

Claims

1. An isolated monoclonal antibody or antigen-binding fragment thereof that binds to human interleukin-7 receptor (IL-7R), comprising: (1) a heavy chain variable region comprising a heavy chain CDR1 having the amino acid sequence set forth in SEQ ID NO:17, a heavy chain CDR2 having the amino acid sequence set forth in SEQ ID NO:18, and a heavy chain CDR3 having the amino acid sequence set forth in SEQ ID NO:19, and a light chain variable region comprising a light chain CDR1 having the amino acid sequence set forth in SEQ ID NO:20, a light chain CDR2 having the amino acid sequence set forth in SEQ ID NO:21, and a light chain CDR3 having the amino acid sequence set forth in SEQ ID NO:22; (2) a heavy chain variable region comprising a heavy chain CDR1 having the amino acid sequence set forth in SEQ ID NO:25, a heavy chain CDR2 having the amino acid sequence set forth in SEQ ID NO:26, and a heavy chain CDR3 having the amino acid sequence set forth in SEQ ID NO:27, and a light chain variable region comprising a light chain CDR1 having the amino acid sequence set forth in SEQ ID NO:28, a light chain CDR2 having the amino acid sequence set forth in SEQ ID NO:29, and a light chain CDR3 having the amino acid sequence set forth in SEQ ID NO:30; (3) a heavy chain variable region comprising a heavy chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 33, a heavy chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 34, and a heavy chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 35, and a light chain variable region comprising a light chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 36, a light chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 37, and a light chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 38; or (4) a heavy chain variable region comprising a heavy chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 41, a heavy chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 42, and a heavy chain CDR3 having the amino acid sequence set forth in SEQ ID NO: 43, and a light chain variable region comprising a light chain CDR1 having the amino acid sequence set forth in SEQ ID NO: 44, a light chain CDR2 having the amino acid sequence set forth in SEQ ID NO: 45, and a light chain CDR3 having the amino acid sequence set forth in SEQ ID NO:

46. An antibody or an antigen-binding fragment thereof comprising:

2. The antibody or antigen-binding fragment thereof described in claim 1, which is a human chimeric antibody or antigen-binding fragment thereof.

3. The antibody or antigen-binding fragment thereof described in claim 1, which is a humanized antibody or antigen-binding fragment thereof.

4. The antibody or antigen-binding fragment thereof according to claim 3, wherein the humanized antibody has a heavy chain constant region and an Fc region and a light chain constant region of a subclass selected from the group consisting of human IgG1, IgG2, and IgG4.

5. An antibody-drug conjugate comprising an antibody or an antigen-binding fragment thereof and a drug, the antibody or fragment being linked to the drug via a linker, the antibody or fragment comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 4.

6. A pharmaceutical composition comprising an antibody or an antigen-binding fragment thereof according to any one of claims 1 to 4.

7. The pharmaceutical composition according to claim 6, wherein the antibody or antigen-binding fragment thereof has antibody-dependent cytotoxicity and / or complement-dependent cytotoxicity.

8. A pharmaceutical composition comprising the antibody-drug conjugate of claim 5.

9. A pharmaceutical composition according to any one of claims 6 to 8 for use in treating cancer in a subject in need thereof.

10. The pharmaceutical composition according to any one of claims 6 to 8, for use in treating a disease in a subject in need thereof, wherein the disease is selected from the group consisting of cancer, immune diseases, and inflammatory diseases, and diseases caused by cancer, immune diseases, or inflammatory diseases.

Images