Method for preparing single-stranded RNA-DNA chimera

Abstract

Provided in the present disclosure is a method for preparing a single-stranded RNA-DNA chimera. Specifically, provided in the present disclosure is a method for preparing a single-stranded RNA-DNA chimera, which method comprises the steps of: a synthesis step: synthesizing an RNA-DNA chimeric fragment of a first strand, and a first nucleic acid fragment group and a second nucleic acid fragment group which are respectively located at both sides of the RNA-DNA chimeric fragment, and synthesizing a DNA fragment group of a second strand; an annealing step; and a linking step. The method provided in the present disclosure can realize the chimerization of RNA and DNA of any length and the accurate chemical modification at any site therein, and can obtain a double-stranded assembly formed by the complementation of a continuous single-stranded RNA-DNA chimera and a fragmented single-stranded DNA, wherein the assembly can be denaturated to obtain a single-stranded long-chain RNA-DNA chimera, which is beneficial for the biomedical application thereof.

Description

A method for preparing single-stranded RNA-DNA chimera Priority and related applications The present disclosure claims the priority of Chinese patent application 202311441875.0 filed on November 01, 2023, entitled “A method for preparing single-stranded RNA-DNA chimeras”, and all the contents of the application including the appendix are incorporated into the present disclosure as a reference. Technical Field The present disclosure belongs to the field of synthetic biology. Specifically, the present disclosure relates to a method for preparing a single-stranded RNA-DNA chimera, and more specifically, to a method for preparing a long single-stranded RNA-DNA chimera. Background Art Single strand RNA-DNA chimeras (ssRDCs) are nucleic acid chains formed by connecting single strands of RNA and DNA via phosphodiester bonds. RNA-DNA chimeras have two nucleotides, RNA and DNA, so they have both the stability of DNA and a higher specific binding ability to target DNA. 1 , and can have multiple biological functions of RNA 2 , has many application prospects both in vivo and in vitro. For example, the 3' end of siRNA generally has two dTdT protrusions to improve its stability 3-4 ; Replacing ribonucleotides with some deoxyribonucleotides in crRNA can reduce the off-target rate of the CRISPR / Cas system, etc. 5 Recently, Xuerui Yang et al. found that RNA-DNA chimeras are widely present in the human body and have obvious tissue specificity. 6 Therefore, achieving the artificial synthesis of single-stranded RNA-DNA chimeras is of great significance for improving their application value and studying their biological functions. At present, the methods for artificially synthesizing RNA-DNA chimeras are mainly through direct synthesis by solid phase synthesis and click chemistry reaction connection. First, the solid phase synthesis method directly connects ribonucleotide monomers and deoxyribonucleotide monomers together through a solid phase synthesizer with a phosphodiester bond. 7-8 This method can obtain a series of sequence-designable RNA-DNA chimeras. However, due to the limitation of chemical reaction efficiency, the synthesis yield of RNA-DNA chimeras synthesized by solid-phase synthesizer will decrease with the increase of base number. When the number of bases is large (greater than 80nt), the flexibility of nucleic acid chain will increase, which will lead to chain entanglement and further reduce the synthesis efficiency. 9 In addition, multiple short nucleic acid chains (less than 80 nt) containing chemical modifications (such as alkyne and azide modifications) can be linked together through click chemistry reactions. 10This method can obtain longer single-stranded RNA-DNA chimeras, but the synthesis cost of short-chain nucleic acids containing special modifications is high and the efficiency is low; the linking groups introduced by click chemistry will affect the formation of the secondary structure of the nucleic acid chain; the chemical groups and reagents introduced by click chemistry reactions have certain toxicity, which will affect subsequent biological applications. 11 Therefore, there is an urgent need to develop new methods for synthesizing single-stranded RNA-DNA chimeras, especially longer single-stranded RNA-DNA chimeras (also referred to as long-chain RNA-DNA chimeras or long-chain RNA-DNA), which can achieve stable and large-scale production of long-chain RNA-DNA chimeras and meet the needs of precise modification of specific base sites in RNA-DNA chimeras. Summary of the invention Problem that the invention aims to solve There is no method for synthesizing long-chain RNA-DNA chimeras connected by phosphodiester bonds at present. The present disclosure provides a method for preparing long-chain RNA-DNA chimeras, which is based on the multi-element kinetic interlocking theory, can synthesize long-chain RNA-DNA chimeras with arbitrary sequences through assembly and enzyme connection steps, and can accurately modify any site of the long-chain RNA-DNA chimeras, and has the advantages of low synthesis difficulty, high accuracy and low cost. Solutions for solving problems [1]. A method for preparing a single-stranded RNA-DNA chimera, comprising the following steps: Synthesis step: synthesizing the first-chain RNA-DNA chimeric fragment, and the first nucleic acid fragment group and the second nucleic acid fragment group located on both sides of the RNA-DNA chimeric fragment, and synthesizing the second-chain DNA fragment group; The RNA-DNA chimeric fragment is located at the junction of the RNA single strand and the DNA single strand in the RNA-DNA chimera, and optionally, the RNA-DNA chimeric fragment of the first strand includes at least one; The first nucleic acid fragment group includes nucleic acid fragment n i The second nucleic acid fragment group includes nucleic acid fragment q ii , the DNA fragment group includes DNA fragment m0 ​​and DNA fragment p0; i and ii are independently selected from positive integers greater than 1; The 3' end sequence of DNA fragment m0 ​​is complementary to the 3' end sequence of RNA-DNA chimeric fragment, and the 5' end sequence of DNA fragment m0 ​​is complementary to the 5' end sequence of nucleic acid fragment n. i The 5' end sequence is a complementary sequence; The 5' end sequence of DNA fragment p0 is complementary to the 5' end sequence of RNA-DNA chimeric fragment, and the 3' end sequence of DNA fragment p0 is complementary to the 5' end sequence of nucleic acid fragment q iiThe 3' end sequence is a complementary sequence; Annealing step: mixing the first nucleic acid fragment group, the second nucleic acid fragment group and the RNA-DNA chimeric fragment, and the second chain DNA fragment group in the same reaction system, annealing, and forming a double-stranded assembly precursor; wherein there is a nick between two adjacent fragments in the first chain, and there is a nick between two adjacent fragments in the second chain; the nick between two adjacent fragments in the first chain fragment and the nick between two adjacent fragments in the second chain fragment are staggered; Connecting step: connecting the connectors between the fragments in the first chain to obtain a double-stranded assembly formed by the complementarity of the continuous single-stranded RNA-DNA chimera and the fragmented single-stranded DNA. [2] The method for preparing a single-stranded RNA-DNA chimera according to [1], wherein the method further comprises the following steps: Denaturation step: denaturing the double-stranded assembly to obtain a continuous single-stranded RNA-DNA chimera; Optionally, the method further comprises a purification step: purifying the continuous single-stranded RNA-DNA chimera from the reaction system. [3]. The method for preparing a single-stranded RNA-DNA chimera according to [1] or [2], wherein the 5' end sequence of the RNA-DNA chimera fragment is an RNA sequence and the 3' end sequence is a DNA sequence, or the 5' end sequence of the RNA-DNA chimera fragment is a DNA sequence and the 3' end sequence is an RNA sequence. [4] The method for preparing a single-stranded RNA-DNA chimera according to any one of [1] to [3], wherein: The first nucleic acid fragment group also includes nucleic acid fragment n i+1 The second nucleic acid fragment group also includes nucleic acid fragment q ii+1 The DNA fragment group also includes DNA fragment m i and DNA fragment p ii ; Among them, DNA fragment m i The 5' end sequence of the nucleic acid fragment n i+1 The 5' end sequence of the DNA fragment m i The 3' end sequence of the nucleic acid fragment n i The 3' end sequence is a complementary sequence; DNA fragment p ii The 5' end sequence of the nucleic acid fragment q ii The 5' end sequence of the DNA fragment p ii The 3' end sequence of the nucleic acid fragment q ii+1 The 3' end sequence is a complementary sequence; Optionally, The nucleic acid fragment n i+1 The 3' end sequence of the second strand is a complementary sequence or an unpaired sequence to the 3' end sequences of other DNA fragments in the second strand DNA fragment group; The nucleic acid fragment q ii+1 The 5' end sequence of the second strand is a complementary sequence or an unpaired sequence to the 5' end sequences of other DNA fragments in the second strand DNA fragment group; Optionally, The nucleic acid fragment n i+1 The 3' end sequence of DNA fragment m i+1 The 3' end sequence of the DNA fragment m is a complementary sequence. i+1 The 5' end sequence of the nucleic acid fragment is a complementary sequence to the other nucleic acid fragments of the first nucleic acid fragment group; The nucleic acid fragment q ii+1 The 5' end sequence of DNA fragment p ii+1 The 5' end sequence of the DNA fragment is a complementary sequence. ii+1 The 3' end sequence of the nucleic acid fragment is a complementary sequence to the nucleic acid fragment of the second nucleic acid fragment group. [5] The method for preparing a single-stranded RNA-DNA chimera according to any one of [1] to [4], wherein the length of the continuous single-stranded RNA-DNA chimera is 60 nt or more, preferably 80 nt or more, and more preferably 80-1000 nt. [6]. The method for preparing a single-stranded RNA-DNA chimera according to any one of [1] to [5], wherein the length of any one of the first nucleic acid fragment group, the second nucleic acid fragment group, the RNA-DNA chimeric fragment and the second strand DNA fragment group is 8-120 nt, preferably 10-80 nt, and more preferably 15-50 nt. [7]. The method for preparing a single-stranded RNA-DNA chimera according to any one of [1] to [6], wherein the 5' end sequence length of any of the first nucleic acid fragment group, the second nucleic acid fragment group, the RNA-DNA chimeric fragment and the second strand DNA fragment group is 4 nt or longer, preferably 4-50 nt, more preferably 6-30 nt, and most preferably 10-25 nt; or The length of the 3' end sequence of any DNA fragment in the first nucleic acid fragment group, the second nucleic acid fragment group, the RNA-DNA chimeric fragment and the second chain DNA fragment group is more than 4 nt, preferably 4-50 nt, more preferably 6-30 nt, and most preferably 10-25 nt. [8] The method for preparing a single-stranded RNA-DNA chimera according to any one of [1] to [7], wherein any one of the first nucleic acid fragment group, the second nucleic acid fragment group and the RNA-DNA chimeric fragment contains a phosphate group at the 5' end and a hydroxyl group at the 3' end; in the connection step, the phosphate group and the hydroxyl group on both sides of the connection port are connected to form a phosphodiester bond; Optionally, adjacent phosphate groups and hydroxyl groups in the first strand are linked as phosphodiester bonds by enzymatic or chemical ligation. [9] The method for preparing a single-stranded RNA-DNA chimera according to any one of [1] to [8], wherein one or more positions of any of the first nucleic acid fragment group, the second nucleic acid fragment group, the RNA-DNA chimeric fragment, and the second strand DNA fragment group contain modified bases, and the bases at the positions adjacent to the connector are unmodified bases; Optionally, the modification is selected from m 6 A, Ψ, m 1 A.m 5 A.ms 2 i 6 A.i 6 A.m 3 C.m 5 C. ac 4 C.m 7 G. m2,2G,m 2 G、m 1 G, Q, m 5 U、mcm 5 U、ncm 5 U、ncm 5 Um、D、mcm 5 s 2 U、Inosine(I)、hm 5 C.s 4 U.s. 2 U, azobenzene, Cm, Um, Gm, t 6 A, yW, ms 2 t 6 A or its derivatives.

[0010] . The method for preparing a single-stranded RNA-DNA chimera according to any one of [1] to [9], wherein one or more positions of any of the first nucleic acid fragment group, the second nucleic acid fragment group, the RNA-DNA chimera fragment, and the second strand DNA fragment group contain modified ribose or deoxyribose, and the ribose or deoxyribose at the position adjacent to the connector is unmodified ribose or deoxyribose; Optionally, the modification is selected from LNA, 2'-OMe, 3'-OMeU, vmoe, 2'-F or 2'-OBn (2'-O-benzyl group) or derivatives thereof.

[0011] . The method for preparing a single-stranded RNA-DNA chimera according to any one of [1] to

[0010] , wherein one or more positions of any of the first nucleic acid fragment group, the second nucleic acid fragment group, the RNA-DNA chimeric fragment, and the second strand DNA fragment group contain a modified phosphodiester bond, and the phosphodiester bond at the position adjacent to the connector is an unmodified phosphodiester bond; Optionally, the modification is selected from phosphorothioate (PS), nucleotide triphosphate (NTPαS) or a derivative thereof.

[0012] . The method for preparing a single-stranded RNA-DNA chimera according to any one of [1] to

[0011] , wherein in the annealing step, the first nucleic acid fragment group, the second nucleic acid fragment group, the RNA-DNA chimera fragment and the second strand DNA fragment group are incubated and then cooled to form a double-stranded assembly precursor; Optionally, the incubation temperature is any temperature of 0-100°C, preferably any temperature of 50-98°C, more preferably any temperature of 70-85°C.

[0013] . The method for preparing a single-stranded RNA-DNA chimera according to any one of [1] to

[0012] , wherein in the annealing step, the first nucleic acid fragment group, the second nucleic acid fragment group, the RNA-DNA chimeric fragment and the second chain DNA fragment group are dissolved in the same solvent to obtain the reaction system.

[0014] . According to the method for preparing a single-stranded RNA-DNA chimera described in

[0013] , the pH of the reaction system is 3-11, preferably pH 4-10, more preferably pH 5-9, and most preferably pH 6-8.

[0015] . The method for preparing a single-stranded RNA-DNA chimera according to

[0013] or

[0014] , wherein in the reaction system, the molar ratio of any two fragments among the first nucleic acid fragment group, the second nucleic acid fragment group and the RNA-DNA chimeric fragment is 1:(0.1-10), preferably 1:(0.5-1), and most preferably 1:1.

[0016] . The method for preparing a single-stranded RNA-DNA chimera according to any one of

[0013] to

[0015] , wherein in the reaction system, the molar ratio of any nucleic acid fragment belonging to RNA from the first nucleic acid fragment group and the second nucleic acid fragment group of the first chain to the nucleic acid fragment from the second chain DNA fragment group that is partially complementary to the nucleic acid fragment belonging to RNA is 1:(0.1-10), preferably 1:(2-4), most preferably 1:2; and / or, The molar ratio of any nucleic acid fragment belonging to DNA from the first nucleic acid fragment group and the second nucleic acid fragment group of the first chain to the nucleic acid fragment from the DNA fragment group of the second chain that is partially complementary to the nucleic acid fragment belonging to DNA is 1:(0.1-10), preferably 1:(0.5-1), and most preferably 1:1.

[0017] . A single-stranded RNA-DNA chimera, wherein the single-stranded RNA-DNA chimera is prepared by the method described in any one of [1]-

[0016] ; Preferably, the single-stranded RNA-DNA chimera comprises a modified base, ribose or deoxyribose, or a phosphodiester bond at one or more positions. Effects of the Invention The present disclosure provides a universal and simple method for preparing long-chain RNA-DNA chimeras, which can efficiently prepare long-chain RNA-DNA chimeras of any sequence, and can achieve chemical modification of any site in the sequence. The synthesis of long-chain RNA-DNA chimeras does not rely on exogenous templates, RNA polymerase or DNA polymerase, etc., has the advantages of high accuracy, low synthesis difficulty, low cost, etc., has the potential for large-scale production, and is suitable for popularization and application. In some embodiments, the long-chain RNA-DNA chimeras provided by the present disclosure are all prepared by the above-mentioned method for preparing long-chain RNA-DNA chimeras, and the target long-chain RNA-DNA chimera sequence is divided into several target short chains and complementary short chains. The basic principle is that the stability of the assembly formed by these short chains is similar, and a highly stable linear assembly can be obtained through annealing assembly through the synergistic enhancement mechanism of supramolecular interactions of multiple primitives. 5'-phosphate modification is introduced only at the 5 end of the target fragment, but not in the complementary chain; the assembly is treated with a ligase, and the target short chains are connected by phosphodiester bonds to obtain the target long-chain ssRDCs. In particular, an RNA-DNA chimeric short chain is designed to connect the RNA part and the DNA part to improve the connection efficiency. This chimeric short chain will be obtained by solid phase synthesis. Finally, through the corresponding purification steps, the target long-chain ssRDCs are separated from the by-products and raw material short chains. BRIEF DESCRIPTION OF THE DRAWINGS FIG1 shows a schematic diagram of assembling a long-chain RNA-DNA chimera in the method for preparing a single-stranded RNA-DNA chimera provided by the present disclosure. FIG2 shows a schematic diagram of the synthesis of a long-chain RNA-DNA chimera in the method for preparing a single-stranded RNA-DNA chimera provided by the present disclosure; FIG3 shows the polyacrylamide gel electrophoresis characterization of a 190 nt long-chain RNA-DNA chimera prepared by the method for preparing a single-stranded RNA-DNA chimera provided by the present disclosure; 4A-4C show the results of the optimization experiment and comparative example of the method for preparing single-stranded RNA-DNA chimera provided by the present disclosure; FIG5 shows a graph showing the variation of the synthesis efficiency of a 190 nt long-chain RNA-DNA chimera prepared by the method for preparing a single-stranded RNA-DNA chimera provided by the present disclosure with the enzyme catalysis time; FIG6 shows the DNase I and RNase A enzyme digestion verification of 124nt, 144nt, and 190nt long-chain RNA-DNA chimeras prepared by the method for preparing single-stranded RNA-DNA chimeras provided by the present disclosure; FIG. 7 shows the polyacrylamide gel electrophoresis characterization of a 580 nt RNA-DNA chimera prepared by the method for preparing a single-stranded RNA-DNA chimera provided by the present disclosure. DETAILED DESCRIPTION Various exemplary embodiments, features and aspects of the present disclosure will be described in detail below. The word "exemplary" used herein means "used as an example, embodiment or illustrative". Any embodiment described herein as "exemplary" is not necessarily to be interpreted as being superior or better than other embodiments. In addition, in order to better illustrate the present disclosure, numerous specific details are given in the following specific embodiments. It should be understood by those skilled in the art that the present disclosure can also be implemented without certain specific details. In other examples, methods, means, equipment and steps well known to those skilled in the art are not described in detail in order to highlight the main purpose of the present disclosure. Unless otherwise stated, the units used in this specification are all international standard units, and the numerical values ​​and numerical ranges appearing in this disclosure should be understood to include the inevitable systematic errors in industrial production. In the present disclosure, a numerical range expressed using "a numerical value A to a numerical value B" means a range including the numerical values ​​A and B at the endpoints. In the present disclosure, unless otherwise stated, the word “multiple” in “multiple”, “multiple”, “plurality”, etc. means a numerical value of 2 or more. In the present disclosure, the term “substantially”, “substantially” or “essentially” means that the error is less than 5%, or less than 3% or less than 1% compared with the relevant perfect standard or theoretical standard. In the present disclosure, unless otherwise specified, "%" means mass percentage. In the present disclosure, the use of “may” includes both the meanings of performing a certain process and the meaning of not performing a certain process. In the present disclosure, "optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where the event occurs and instances where it does not. In this disclosure, although the disclosed content supports the definition of the terms "or" and "alternatively" as only alternatives and "and / or", the terms "or" and "alternatively" in the claims mean "and / or" unless it is clearly stated that there are only alternatives or the alternatives are mutually exclusive. The "water" used in the present disclosure includes any feasible water such as tap water, deionized water, distilled water, double distilled water, purified water, ion-exchanged water, etc. In the present disclosure, "double-stranded assembly" and "double-stranded assembly precursor" may be formed by the complementarity of a continuous single-stranded RNA-DNA chimera and a fragmented single-stranded DNA. In the present disclosure, a "connector" is also called a nick, which exists between two adjacent nucleotides in a single-stranded nucleic acid chain and is caused by the lack of a phosphodiester bond between the two adjacent nucleotides. First aspect The first aspect of the present disclosure provides a method for preparing single-stranded RNA-DNA chimeras (ssRDCs), which is specifically a one-pot method for synthesizing sequence-controllable long-chain ssRDCs, comprising the following steps: Synthesis step: synthesizing the first-chain RNA-DNA chimeric fragment, and the first nucleic acid fragment group and the second nucleic acid fragment group located on both sides of the RNA-DNA chimeric fragment, and synthesizing the second-chain DNA fragment group; The RNA-DNA chimeric fragment is located at the junction of the RNA single strand and the DNA single strand in the RNA-DNA chimera, and optionally, the RNA-DNA chimeric fragment of the first strand includes at least one; The first nucleic acid fragment group includes nucleic acid fragment n i , The second nucleic acid fragment group includes nucleic acid fragment q ii , The second strand DNA fragment group includes DNA fragment m0 ​​and DNA fragment p0; Wherein, i and ii are independently selected from positive integers greater than 1; The 3' end sequence of the DNA fragment m0 ​​is complementary to the 3' end sequence of the RNA-DNA chimeric fragment. The 5' end sequence of DNA fragment m0 ​​and nucleic acid fragment n i The 5' end sequence is a complementary sequence; The 5' end sequence of DNA fragment p0 is complementary to the 5' end sequence of RNA-DNA chimeric fragment, and the 3' end sequence of DNA fragment p0 is complementary to the 5' end sequence of nucleic acid fragment q ii The 3' end sequence is a complementary sequence. Annealing step: mixing the first nucleic acid fragment group, the second nucleic acid fragment group and the RNA-DNA chimeric fragment, and the second chain DNA fragment group in the same reaction system, annealing, and forming a double-stranded assembly precursor; wherein there is a nick between two adjacent fragments in the first chain, and there is a nick between two adjacent fragments in the second chain; the nick between two adjacent fragments in the first chain fragment and the nick between two adjacent fragments in the second chain fragment are staggered; Connecting step: connecting the connectors between the fragments in the first chain to obtain a double-stranded assembly formed by the complementarity of the continuous single-stranded RNA-DNA chimera and the fragmented single-stranded DNA. <Sequences that divide RNA-DNA chimeras> (RNA-DNA chimera) In the present disclosure, RNA-DNA chimeras include single strand RNA-DNA chimeras (ssRDCs), which are nucleic acid chains formed by connecting a single strand of RNA and a single strand of DNA via a phosphodiester bond. In some embodiments, the RNA-DNA chimera includes at least one RNA single strand and at least one DNA single strand connected by a phosphodiester bond, and the at least one RNA single strand and the at least one DNA single strand can be arranged and connected in any order according to the specific sequence of the RNA-DNA chimera to be synthesized. In some exemplary embodiments, the RNA-DNA chimera may include a single RNA strand and a single DNA strand, which are connected by a phosphodiester bond to form a nucleic acid chain, for example, having a structure of [RNA single strand]-[DNA single strand], or having a structure of [DNA single strand]-[RNA single strand]. In other exemplary embodiments, the RNA-DNA chimera may include two RNA single strands and one DNA single strand, connected by phosphodiester bonds to form a nucleic acid chain, for example, having a structure of [RNA single strand]-[DNA single strand]-[RNA single strand]. In other exemplary embodiments, the RNA-DNA chimera may include one RNA single strand and two DNA single strands, connected by phosphodiester bonds to form a nucleic acid chain, for example, having a structure of [DNA single strand]-[RNA single strand]-[DNA single strand]. In other exemplary embodiments, the RNA-DNA chimera may include two RNA single strands and two DNA single strands, connected by phosphodiester bonds to form a nucleic acid chain, for example, having a structure of [DNA single strand]-[RNA single strand]-[DNA single strand]-[RNA single strand], or having a structure of [RNA single strand]-[DNA single strand]-[RNA single strand]-[DNA single strand]. And so on, the present disclosure does not enumerate this exhaustively. Before preparing RNA-DNA chimeras, the sequences of RNA-DNA chimeras must first be divided. FIG1 exemplarily shows a variety of long-chain double-stranded structures, wherein the first chain is the target synthesized RNA-DNA chimera, and the second chain is a single-stranded nucleic acid chain complementary to the first chain. The nucleotide sequences of the first chain and the second chain are divided respectively, so that the nucleotide sequences of the first chain and the second chain are divided into several short-chain nucleic acid fragment sequences. Specifically, the nucleic acid fragment group forming the first chain is composed of RNA fragments, DNA fragments and RNA-DNA chimeric fragments, and the nucleic acid fragment group forming the second chain is composed of DNA fragments. In some embodiments, the first strand nucleic acid fragment group includes at least one RNA-DNA chimeric fragment, and a first nucleic acid fragment group and a second nucleic acid fragment group located on both sides of the RNA-DNA chimeric fragment, respectively. In some embodiments, for the first nucleic acid fragment group and the second nucleic acid fragment group on both sides of an RNA-DNA chimeric fragment, the first nucleic acid fragment group is composed of RNA fragments (for example, when the RNA-DNA chimera only contains a junction between a single RNA strand and a single DNA strand, it corresponds to the RNA portion of the RNA-DNA chimera other than the RNA sequence contained in the RNA-DNA chimera); the second nucleic acid fragment group is composed of DNA fragments (for example, when the RNA-DNA chimera only contains a junction between a single RNA strand and a single DNA strand, it corresponds to the DNA portion of the RNA-DNA chimera other than the DNA sequence contained in the RNA-DNA chimera). In other embodiments, for the first nucleic acid fragment group and the second nucleic acid fragment group on both sides of an RNA-DNA chimeric fragment, the first nucleic acid fragment group is composed of DNA fragments (for example, when the RNA-DNA chimera only contains a junction between a single RNA strand and a single DNA strand, it corresponds to the DNA portion of the RNA-DNA chimera other than the DNA sequence contained in the RNA-DNA chimera); the second nucleic acid fragment group is composed of RNA fragments (for example, when the RNA-DNA chimera only contains a junction between a single RNA strand and a single DNA strand, it corresponds to the RNA portion of the RNA-DNA chimera other than the RNA sequence contained in the RNA-DNA chimera). In some embodiments, the 5' end sequence of the RNA-DNA chimeric fragment is an RNA sequence, and the 3' end sequence is a DNA sequence. In other embodiments, the 5' end sequence of the RNA-DNA chimeric fragment is a DNA sequence, and the 3' end sequence is an RNA sequence. The RNA-DNA chimeric fragment corresponds to (is designed at) the junction of the RNA single strand and the DNA single strand in the RNA-DNA chimera. When the RNA-DNA chimera contains multiple junctions of RNA single strands and DNA single strands, an RNA-DNA chimeric fragment is correspondingly arranged at each junction. That is, an RNA-DNA chimeric fragment is arranged at the junction of each RNA single strand and DNA single strand of the RNA-DNA chimera. It is understandable that when the RNA-DNA chimera contains multiple junctions of RNA single strands and DNA single strands, the nucleic acid types of the parts between the RNA-DNA chimeric fragments disposed at two adjacent junctions may be the same, for example, both are DNA or both are RNA. Those skilled in the art can select the nucleic acid types of the first nucleic acid fragment group and the second nucleic acid fragment group on both sides of each RNA-DNA chimeric fragment according to the specific sequence of the RNA-DNA chimera. In some embodiments, for the first nucleic acid fragment group and the second nucleic acid fragment group on both sides of an RNA-DNA chimeric fragment, the first nucleic acid fragment group includes nucleic acid fragment n i The second nucleic acid fragment group includes nucleic acid fragment q ii . In some embodiments, the set of nucleic acid fragments of the second strand includes a set of DNA fragments. In some specific embodiments, for the first nucleic acid fragment group and the second nucleic acid fragment group on both sides of an RNA-DNA chimeric fragment, the second strand DNA fragment group includes DNA fragment m0 ​​and DNA fragment p0. In some embodiments, i and ii are independently selected from positive integers greater than 1. In some specific embodiments, the 3' end sequence of the DNA fragment m0 ​​is complementary to the 3' end sequence of the RNA-DNA chimeric fragment ch, and the 5' end sequence of the DNA fragment m0 ​​is complementary to the 5' end sequence of the nucleic acid fragment n. i The 5' end sequence is a complementary sequence. In some embodiments, the 5' end sequence of the DNA fragment p0 is complementary to the 5' end sequence of the RNA-DNA chimeric fragment ch, and the 3' end sequence of the DNA fragment p0 is complementary to the 5' end sequence of the nucleic acid fragment q. ii The 3' end sequence is a complementary sequence. In some embodiments, the first nucleic acid fragment group further includes nucleic acid fragment n i+1 The second nucleic acid fragment group also includes nucleic acid fragment q ii+1 The DNA fragment group also includes DNA fragment m i and DNA fragment p ii . In some embodiments, the DNA fragment m i The 5' end sequence of the nucleic acid fragment n i+1 The 5' end sequence of the DNA fragment m i The 3' end sequence of the nucleic acid fragment n i The 3' end sequence is a complementary sequence. In some embodiments, the DNA fragment p ii The 5' end sequence of the nucleic acid fragment q ii The 5' end sequence of the DNA fragment p ii The 3' end sequence of the nucleic acid fragment q ii+1 The 3' end sequence is a complementary sequence. (RNA-DNA chimeric fragment ch and DNA fragment m0 ​​and DNA fragment p0 in the DNA fragment group) As shown in A of FIG. 1 , in some embodiments, the first chain includes an RNA-DNA chimeric fragment ch, and the nucleic acid sequence of the second chain DNA fragment group complementary to the sequence of the first chain RNA-DNA chimeric fragment ch is divided into sequences including DNA fragment m0 ​​and DNA fragment p0. The 3' end sequence of DNA fragment m0 ​​is complementary to the 3' end sequence of RNA-DNA chimeric fragment ch, and the 5' end sequence of DNA fragment p0 is complementary to the 5' end sequence of RNA-DNA chimeric fragment ch. The double-stranded sequence division containing the target long-chain RNA-DNA chimera (the first chain, the sequence of the RNA-DNA chimeric fragment ch portion) is achieved. In some specific embodiments, the 3' end sequence of the DNA fragment m0 ​​is complementary to the 3' end sequence of the RNA-DNA chimeric fragment ch, and the 5' end sequence of the DNA fragment m0 ​​is complementary to the 5' end sequence of the nucleic acid fragment n. iThe 5' end sequence is a complementary sequence. In some embodiments, the 5' end sequence of the DNA fragment p0 is complementary to the 5' end sequence of the RNA-DNA chimeric fragment ch, and the 3' end sequence of the DNA fragment p0 is complementary to the 5' end sequence of the nucleic acid fragment q. ii The 3' end sequence is a complementary sequence. (DNA fragment m in the first nucleic acid fragment group and the DNA fragment group i ) As shown in Figure 1A, in some embodiments, the first nucleic acid segment group on one side of the RNA-DNA chimeric segment ch includes nucleic acid segments n i and nucleic acid fragment n i+1 That is, in the example of A in FIG. 1 , in the first-strand RNA-DNA chimera, the sequence of the RNA or DNA portion other than the RNA or DNA contained in the RNA-DNA chimera fragment ch is divided into nucleic acid fragments n i Sequences and nucleic acid fragments i+1 The nucleic acid sequence of the second strand of the DNA fragment group complementary to the sequence of the RNA or DNA portion of the first strand is divided into the DNA fragment m i The sequence of the nucleic acid fragment m i The 5' end sequence of the nucleic acid fragment n i+1 The 5' end sequence of the DNA fragment m i The 3' end sequence of the nucleic acid fragment n i The complementary pairing of the 3' end sequence of the target long-chain RNA-DNA chimera (the first chain, the sequence of the RNA or DNA portion other than the RNA or DNA contained in the RNA-DNA chimera fragment ch) is achieved. Furthermore, the first nucleic acid fragment group may also include other nucleic acid fragments. In some embodiments, the first nucleic acid fragment group includes nucleic acid fragment n i 、Nucleic acid fragment n i+1 、Nucleic acid fragment n i+2 In some embodiments, the first nucleic acid fragment group includes nucleic acid fragment n i 、Nucleic acid fragment n i+1 、Nucleic acid fragment n i+2 、Nucleic acid fragment n i+3 In some embodiments, the first nucleic acid fragment group includes nucleic acid fragment n i 、Nucleic acid fragment n i+1 、Nucleic acid fragment n i+2 、Nucleic acid fragment n i+3 、Nucleic acid fragment n i+4 By analogy, the first nucleic acid fragment group may also include other numbers of nucleic acid fragments, which are not exhaustively listed in the present disclosure. Exemplarily, the first nucleic acid fragment group includes at least x fragments, where x is a positive integer greater than 1. For example, x is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc., which are not exhaustive in the present disclosure. Furthermore, the second strand DNA fragment set may also include other DNA fragments. In some embodiments, the DNA fragment set includes DNA fragment m i , DNA fragment m i+1 , where DNA fragment m i The 3' end sequence of the nucleic acid fragment Segment i The 3' end sequence of the DNA fragment m i The 5' end sequence of the nucleic acid fragment n i+1 The 5' end sequence of DNA fragment m i+1 The 3' end sequence of the nucleic acid fragment n i+1 The 3' end sequence of the DNA fragment m i+1 The 5' end sequence of the nucleic acid fragment n i+2 The 5' end sequence of the nucleic acid fragment is a complementary sequence. i+2 The 3' end sequence is an unpaired sequence. In some embodiments, the set of second strand DNA fragments includes DNA fragment m i , DNA fragment m i+1 , DNA fragment m i+2 Among them, DNA fragment m i The 3' end sequence of the nucleic acid fragment n i The 3' end sequence of the DNA fragment m i The 5' end sequence of the nucleic acid fragment n i+1 The 5' end sequence of DNA fragment m i+1 The 3' end sequence of the nucleic acid fragment n i+1 The 3' end sequence of the DNA fragment m i+1 The 5' end sequence of the nucleic acid fragment n i+2 The 5' end sequence of DNA fragment m i+2 The 3' end sequence of the nucleic acid fragment n i+2 The 3' end sequence of the DNA fragment m i+2 The 5' end sequence of the nucleic acid fragment n i+3 The 5' end sequence of the nucleic acid fragment is a complementary sequence. i+3 The 3' end sequence is an unpaired sequence. In some embodiments, the set of second strand DNA fragments includes DNA fragment m i , DNA fragment mi+1 , DNA fragment m i+3 Among them, DNA fragment m i The 3' end sequence of the nucleic acid fragment n i The 3' end sequence of the DNA fragment m i The 5' end sequence of the nucleic acid fragment n i+1 The 5' end sequence of DNA fragment m i+1 The 3' end sequence of the nucleic acid fragment n i+1 The 3' end sequence of the DNA fragment m i+1 The 5' end sequence of the nucleic acid fragment n i+2 The 5' end sequence of DNA fragment m i+2 The 3' end sequence of the nucleic acid fragment n i+2 The 3' end sequence of the DNA fragment m i+2 The 5' end sequence of the nucleic acid fragment n i+3 The 5' end sequence of DNA fragment m i+3 The 3' end sequence of the nucleic acid fragment n i+3 The 3' end sequence of the DNA fragment m i+3 The 5' end sequence of the nucleic acid fragment n i+4 The 5' end sequence of the nucleic acid fragment is a complementary sequence. i+4 The 3' end of the DNA fragment is an unpaired sequence. By analogy, the DNA fragment group may also include other numbers of DNA fragments, which are not exhaustively listed in the present disclosure. (The second nucleic acid fragment group and the DNA fragment p in the DNA fragment group ii ) As shown in Figure 1A, in some embodiments, the second nucleic acid fragment group on the other side of the RNA-DNA chimeric fragment ch includes nucleic acid fragment q ii and nucleic acid fragment q ii+1 That is, in the example of A in FIG. 1 , in the first-strand RNA-DNA chimera, the sequence of the RNA or DNA portion other than the RNA or DNA contained in the RNA-DNA chimera fragment ch is divided into nucleic acid fragments q ii Sequences and nucleic acid fragments q ii+1 The nucleic acid sequence of the second strand of the DNA fragment group that is complementary to the sequence of the RNA or DNA portion of the first strand is divided into the DNA fragment p ii The sequence of the nucleic acid fragment p ii The 5' end sequence of the nucleic acid fragment q ii The 5' end sequence of the DNA fragment p ii The 3' end sequence of the nucleic acid fragment q ii+1The complementary pairing of the 3' end sequence of the target long-chain RNA-DNA chimera (the first chain, the sequence of the RNA or DNA portion other than the RNA or DNA contained in the RNA-DNA chimera fragment ch) is achieved. Furthermore, the second nucleic acid fragment group may also include other nucleic acid fragments. In some embodiments, the second nucleic acid fragment group includes nucleic acid fragment q ii , nucleic acid fragment q ii+1 , nucleic acid fragment q ii+2 In some embodiments, the second nucleic acid fragment group includes nucleic acid fragment q ii , nucleic acid fragment q ii+1 , nucleic acid fragment q ii+2 , nucleic acid fragment q ii+3 In some embodiments, the second nucleic acid fragment group includes nucleic acid fragment q ii , nucleic acid fragment q ii+1 , nucleic acid fragment q ii+2 , nucleic acid fragment q ii+3 , nucleic acid fragment q ii+4 By analogy, the second nucleic acid fragment group may also include other numbers of nucleic acid fragments, which are not exhaustively listed in the present disclosure. Exemplarily, the second nucleic acid fragment group includes at least y fragments, where y is a positive integer greater than 1. For example, y is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc., which are not exhaustive in the present disclosure. Furthermore, the second strand DNA fragment set may also include other DNA fragments. In some embodiments, the DNA fragment set includes DNA fragment p ii , DNA fragment p ii+1 , where DNA fragment p ii The 3' end sequence of the nucleic acid fragment q ii+1 The 3' end sequence of the DNA fragment p ii The 5' end sequence of the nucleic acid fragment q ii The 5' end sequence of the DNA fragment p ii+1 The 3' end sequence of the nucleic acid fragment q ii+2 The 3' end sequence of the DNA fragment p ii+1 The 5' end sequence of the nucleic acid fragment q ii+1 The 5' end sequence of the nucleic acid fragment q ii+2 The 5' end sequence is an unpaired sequence. In some embodiments, the set of second strand DNA fragments includes DNA fragment p ii , DNA fragment p ii+1 , DNA fragment pii+2 The DNA fragment p ii The 3' end sequence of the nucleic acid fragment q ii+1 The 3' end sequence of the DNA fragment p ii The 5' end sequence of the nucleic acid fragment q ii The 5' end sequence of the DNA fragment p ii+1 The 3' end sequence of the nucleic acid fragment q ii+2 The 3' end sequence of the DNA fragment p ii+1 The 5' end sequence of the nucleic acid fragment q ii+1 The 5' end sequence of the DNA fragment p ii+2 The 3' end sequence of the nucleic acid fragment q ii+3 The 3' end sequence of the DNA fragment p ii+2 The 5' end sequence of the nucleic acid fragment q ii+2 The 5' end sequence of the nucleic acid fragment q ii+3 The 5' end sequence is an unpaired sequence. In some embodiments, the set of second strand DNA fragments includes DNA fragment p ii , DNA fragment p ii+1 , DNA fragment p ii+3 The DNA fragment p ii The 3' end sequence of the nucleic acid fragment q ii+1 The 3' end sequence of the DNA fragment p ii The 5' end sequence of the nucleic acid fragment q ii The 5' end sequence of the DNA fragment p ii+1 The 3' end sequence of the nucleic acid fragment q ii+2 The 3' end sequence of the DNA fragment p ii+1 The 5' end sequence of the nucleic acid fragment q ii+1 The 5' end sequence of the DNA fragment p ii+2 The 3' end sequence of the nucleic acid fragment q ii+3 The 3' end sequence of the DNA fragment p ii+2 The 5' end sequence of the nucleic acid fragment q ii+2 The 5' end sequence of the DNA fragment p ii+3 The 3' end sequence of the nucleic acid fragment q ii+4 The 3' end sequence of the DNA fragment p ii+3 The 5' end sequence of the nucleic acid fragment q ii+3 The 5' end sequence of the DNA fragment q ii+4 The 5' end sequence of is an unpaired sequence. By analogy, the DNA fragment group may also include other numbers of DNA fragments, which are not exhaustively listed in the present disclosure. In the present disclosure, the 5' end sequence and the 3' end sequence refer to the division of the nucleotide fragment along the 5' to 3' direction, so that the nucleotide fragment is divided into two regions. Among them, the sequence of one region close to the 5' end is called the 5' end sequence, and the sequence of the other region close to the 3' end is called the 3' end sequence. In the present disclosure, the 5' end is a nucleotide located at the 5' most tail position in the nucleotide chain along the 5' to 3' direction, which generally has a phosphate group at the 5' end. The 3' end is a nucleotide located at the 3' most tail position in the nucleotide chain along the 5' to 3' direction, which generally has a hydroxyl group at the 3' end. In addition, the number of fragments in the first nucleic acid fragment group, the second nucleic acid fragment group, the RNA-DNA chimeric fragment and / or the second chain DNA fragment group of the first chain can be increased or decreased according to actual needs. By increasing or decreasing the above-mentioned fragments, the division of RNA-DNA chimeras of different lengths and / or different numbers or types of RNA single-stranded and DNA single-stranded junctions can be achieved. Specifically, whether the first nucleic acid fragment group, the second nucleic acid fragment group and / or the second chain DNA fragment group of the first chain include other fragments and the number of other fragments included, And the number of RNA-DNA chimeric fragments is determined by the sequence of the desired long-chain RNA-DNA chimera to be synthesized. Through the above design, RNA-DNA chimeras of any length and desired sequence can be synthesized. Furthermore, after the nucleotide sequence of the first chain and the second chain is divided, there will be a connection port between the two connected fragments. i and nucleic acid fragment n i+1 There is a junction between the first strand and the nucleic acid fragment n i There is a junction between the RNA-DNA chimeric fragment ch and the DNA fragment m in the second strand. i There is a connection between the DNA fragment m0 ​​and the DNA fragment m1. In order to make the double-stranded assembly precursor obtained after annealing have relatively good stability, when the target RNA-DNA chimera is sequenced, the connection between the first nucleic acid fragment group, the RNA-DNA chimeric fragment, and the adjacent fragments in the second nucleic acid fragment group of the first chain and the connection between the adjacent fragments in the DNA fragment group of the second chain are staggered. Furthermore, when the target long-chain RNA-DNA chimera is sequenced, the melting temperatures (T m) should be as close as possible and avoid the existence of complex higher-order structures within the chain to reduce the difficulty of fragment annealing to form a double-stranded assembly precursor. In some specific embodiments, the length of the 5' end sequence of any fragment in the first nucleic acid fragment group of the first chain, the RNA-DNA chimeric fragment, the second nucleic acid fragment group, and the second chain DNA fragment group is 4 nt or more, preferably 4-50 nt, more preferably 6-30 nt, and most preferably 10-25 nt. For example, the length of the 5' end sequence of any fragment is 4 nt, 6 nt, 8 nt, 10 nt, 12 nt, 14 nt, 16 nt, 18 nt, 20 nt, etc. In some specific embodiments, the length of the 3' end sequence of any fragment in the first nucleic acid fragment group of the first chain, the RNA-DNA chimeric fragment, the second nucleic acid fragment group, and the second chain DNA fragment group is 4 nt or more, preferably 4-50 nt, more preferably 6-30 nt, and most preferably 10-25 nt. For example, the length of the 3' end sequence of any fragment is 4 nt, 6 nt, 8 nt, 10 nt, 12 nt, 14 nt, 16 nt, 18 nt, 20 nt, etc. In some specific embodiments, the length of any fragment in the first nucleic acid fragment group of the first chain, the RNA-DNA chimeric fragment, the second nucleic acid fragment group and the second chain DNA fragment group is 6-120 nt, preferably 10-80 nt, and more preferably 15-50 nt. In some specific embodiments, the RNA portion and the DNA portion of the RNA-DNA chimeric fragment are of the same or different lengths. In some specific embodiments, the length of the continuous RNA-DNA chimera is 60 nt or more, preferably 80 nt or more, preferably 100 nt or more, preferably 120 nt or more, and more preferably 80-1000 nt. For example, the length of the continuous RNA-DNA chimera is 60 nt, 70 nt, 80 nt, 90 nt, 100 nt, 120 nt, 140 nt, 160 nt, 180 nt, 200 nt, 220 nt, 240 nt, 250 nt, 260 nt, 267 nt, 270 nt, 300 nt, 320 nt, 340 nt, 360 nt, 400 nt, 500 nt, 600 nt, 700 nt, 800 nt, 900 nt, 1000 nt, and the like. In some specific embodiments, the first strand is a single-stranded RNA-DNA chimera assembled from a DNA fragment, an RNA-DNA chimera fragment, and an RNA fragment. After the connectors in the first strand are connected, a continuous single-stranded RNA-DNA chimera is obtained. The length of the continuous single-stranded RNA-DNA chimera is 60 nt or more, preferably 80 nt or more, preferably 100 nt or more, preferably 120 nt or more, and more preferably 80-1000 nt. For example, the length of the single-stranded RNA-DNA chimera is 60 nt, 70 nt, 80 nt, 90 nt, 100 nt, 120 nt, 140 nt, 160 nt, 180 nt, 200 nt, 300 nt, 400 nt, 500 nt, 600 nt, 700 nt, 800 nt, 900 nt, 1000 nt, 1200 nt, 1400 nt, 1600 nt, 1800 nt, 2000 nt, 3000 nt, 4000 nt, 5000 nt, 6000 nt, 7000 nt, 8000 nt, 9000 nt, 10000 nt, 12000 nt, 14000 nt, 16000 nt, 18000 nt, 20000 nt, 30000 nt, 40000 nt, 50000 nt, 220nt, 240nt, 250nt, 260nt, 267nt, 270nt, 300nt, 320nt, 340nt, 360nt, 400nt, 500nt, 600nt, 700nt, 800nt, 900nt, 1000nt and so on. In some specific embodiments, the second strand is a single-stranded DNA, and the second strand is present in a double-stranded assembly, which is a fragmented single-stranded nucleic acid chain. The length of the second strand in the double-stranded assembly is 60nt or more, preferably 80nt or more, preferably 100nt or more, preferably 120nt or more, and more preferably 80-1000nt. For example, the length of the single-stranded RNA is 60nt, 70nt, 80nt, 90nt, 100nt, 120nt, 140nt, 160nt, 180nt, 200nt, 220nt, 240nt, 250nt, 260nt, 267nt, 270nt, 300nt, 320nt, 340nt, 360nt, 400nt, 500nt, 600nt, 700nt, 800nt, 900nt, 1000nt, etc. The above specific description of the "Sequences of RNA-DNA Chimeras" section is mainly based on the example of the junction of a single RNA strand and a single DNA strand in the RNA-DNA chimera. Based on the above description, when there are multiple junctions (RNA-DNA chimera fragments) in the RNA-DNA chimera, the sequence of the RNA-DNA chimera can be divided accordingly. As an example, the following exemplary description is given of the junctions (RNA-DNA chimera fragments) containing multiple single RNA strands and single DNA strands in the RNA-DNA chimera. (The RNA-DNA chimera contains multiple junctions between RNA single strands and DNA single strands (RNA-DNA chimera fragments)) B in FIG. 1 exemplarily shows a long double-stranded structure, wherein the first strand is a target synthesized RNA-DNA chimera, for example, having a structure of [RNA single strand]-[DNA single strand]-[RNA single strand], and the second strand is a single-stranded nucleic acid strand complementary to the first strand. The nucleotide sequences of the first strand and the second strand are divided respectively, so that the nucleotide sequences of the first strand and the second strand are divided into a plurality of short-stranded nucleic acid fragment sequences. Specifically, the nucleic acid fragment group forming the first strand is composed of RNA fragments, DNA fragments and RNA-DNA chimeric fragments, and the nucleic acid fragment group forming the second strand is composed of DNA fragments. In some embodiments, the first chain nucleic acid fragment group includes at least one RNA-DNA chimeric fragment, for example, two RNA-DNA chimeric fragments, RNA-DNA chimeric fragment ch and RNA-DNA chimeric fragment ch', and a first nucleic acid fragment group and a second nucleic acid fragment group respectively located on both sides of each RNA-DNA chimeric fragment. As shown in B in Figure 1, for the first nucleic acid fragment group and the second nucleic acid fragment group on both sides of the RNA-DNA chimeric fragment ch', the first nucleic acid fragment group on one side of the RNA-DNA chimeric fragment ch' is composed of RNA fragments, that is, the RNA portion of the portion from the RNA-DNA chimeric fragment ch' to the 3' end of the RNA-DNA chimera in the corresponding RNA-DNA chimera, excluding the RNA sequence contained in the RNA-DNA chimera fragment ch'; the second nucleic acid fragment group on the other side of the RNA-DNA chimera fragment ch' is composed of DNA fragments. With respect to the first nucleic acid fragment group and the second nucleic acid fragment group on both sides of the RNA-DNA chimeric fragment ch, the first nucleic acid fragment group on one side of the RNA-DNA chimeric fragment ch is composed of DNA fragments; the second nucleic acid fragment group on the other side of the RNA-DNA chimeric fragment ch is composed of RNA fragments, that is, the RNA portion of the portion from the 5' end of the RNA-DNA chimera to the RNA-DNA chimeric fragment ch in the corresponding RNA-DNA chimera, excluding the RNA sequence contained in the RNA-DNA chimeric fragment ch. In the exemplary RNA-DNA chimera of B in FIG1 , the 5' end sequence of the RNA-DNA chimeric fragment ch' is a DNA sequence, and the 3' end sequence is an RNA sequence. The 5' end sequence of the RNA-DNA chimeric fragment ch is an RNA sequence, The 3' end sequence is a DNA sequence. The portion between the RNA-DNA chimeric fragment ch' and the RNA-DNA chimeric fragment ch is a DNA sequence. In some specific embodiments, for the first nucleic acid fragment group and the second nucleic acid fragment group on both sides of the RNA-DNA chimeric fragment ch, the first nucleic acid fragment group on one side of the RNA-DNA chimeric fragment ch includes nucleic acid fragment ni and nucleic acid fragment n i+1 The second nucleic acid fragment group on the other side of the RNA-DNA chimeric fragment ch includes nucleic acid fragment q ii and nucleic acid fragment q ii+1 . In some specific embodiments, for the first nucleic acid fragment group and the second nucleic acid fragment group on both sides of the RNA-DNA chimeric fragment ch', the first nucleic acid fragment group of the RNA-DNA chimeric fragment ch' includes nucleic acid fragment n i ' and nucleic acid fragment n i+1 ', the second nucleic acid fragment group of the RNA-DNA chimeric fragment ch includes nucleic acid fragment q ii ' and nucleic acid fragment q ii+1 '. In some embodiments, the set of nucleic acid fragments of the second strand includes a set of DNA fragments. In some specific embodiments, the second strand DNA fragment group corresponding to the RNA-DNA chimeric fragment ch and the first nucleic acid fragment group and the second nucleic acid fragment group on both sides thereof includes the DNA fragment m i , DNA fragment p ii , DNA fragment m0 ​​and DNA fragment p0. In some embodiments, i and ii are independently selected from positive integers greater than 1. In some specific embodiments, the 3' end sequence of the DNA fragment m0 ​​is complementary to the 3' end sequence of the RNA-DNA chimeric fragment ch, and the 5' end sequence of the DNA fragment m0 ​​is complementary to the 5' end sequence of the nucleic acid fragment n. i The 5' end sequence is a complementary sequence. In some embodiments, the 5' end sequence of the DNA fragment p0 is complementary to the 5' end sequence of the RNA-DNA chimeric fragment ch, and the 3' end sequence of the DNA fragment p0 is complementary to the 5' end sequence of the nucleic acid fragment q. ii The 3' end sequence is a complementary sequence. In some embodiments, the DNA fragment m i The 5' end sequence of the nucleic acid fragment n i+1 The 5' end sequence of the DNA fragment m i The 3' end sequence of the nucleic acid fragment n i The 3' end sequence is a complementary sequence. In some embodiments, the DNA fragment p ii The 5' end sequence of the nucleic acid fragment q ii The 5' end sequence of the DNA fragment p ii The 3' end sequence of the nucleic acid fragment q ii+1 The 3' end sequence is a complementary sequence. In some specific embodiments, the second strand DNA fragment group corresponding to the RNA-DNA chimeric fragment ch' and the first nucleic acid fragment group and the second nucleic acid fragment group on both sides thereof includes the DNA fragment m i ', DNA fragment p ii ', DNA fragment m0' and DNA fragment p0'. In some embodiments, i and ii are independently selected from positive integers greater than 1. In some specific embodiments, the 3' end sequence of the DNA fragment m0' is complementary to the 3' end sequence of the RNA-DNA chimeric fragment ch', and the 5' end sequence of the DNA fragment m0' is complementary to the 5' end sequence of the nucleic acid fragment n i The 5' end sequence of ' is a complementary sequence. In some embodiments, the 5' end sequence of the DNA fragment p0' is complementary to the 5' end sequence of the RNA-DNA chimeric fragment ch', and the 3' end sequence of the DNA fragment p0' is complementary to the 5' end sequence of the nucleic acid fragment q ii The 3' end sequence of ' is a complementary sequence. In some embodiments, the DNA fragment m i '5' end sequence and nucleic acid fragment n i+1 The 5' end sequence of ' is a complementary sequence, and the DNA fragment m i '3' end sequence and nucleic acid fragment n i The 3' end sequence of ' is a complementary sequence. In some embodiments, the DNA fragment p ii '5' end sequence and nucleic acid fragment q ii The 5' end sequence of ' is complementary to the DNA fragment p ii '3' end sequence and nucleic acid fragment q ii+1 The 3' end sequence of ' is a complementary sequence. In some specific embodiments, the nucleic acid fragment n i+1 The 3' end sequence of the nucleic acid fragment n is complementary to the 3' end sequence of the other DNA fragments in the second strand of the DNA fragment group; for example, as shown in B in FIG. 1 , the nucleic acid fragment n i+1 3' End sequence and DNA fragment m i+1 The 3' end sequence of the DNA fragment m i+1 The 5' end sequence of the nucleic acid fragment q ii+1 The 5' end sequence of ' is a complementary sequence, so that the part between the RNA-DNA chimeric fragment ch' and the RNA-DNA chimeric fragment ch is connected; or, The nucleic acid fragment q ii+1The 5' end sequence of the nucleic acid fragment q is complementary to the 5' end sequence of the other DNA fragments in the second chain DNA fragment group. For example, as shown in B in FIG. 1 , the nucleic acid fragment q ii+1 '5' end sequence and DNA fragment p ii+1 The 5' end sequence of the DNA fragment p ii+1 '3' end sequence and nucleic acid fragment n i+1 The 3' end sequence of is a complementary sequence, so that the part between the RNA-DNA chimeric fragment ch' and the RNA-DNA chimeric fragment ch is connected. It is understandable that, according to the description and exemplary examples in the previous section <Sequences for dividing RNA-DNA chimeras>, the first nucleic acid fragment group and / or the second nucleic acid fragment group in the first chain, as well as the fragments and number in the DNA fragment group in the second chain can be designed according to the specific sequence of the RNA-DNA chimera, such as the length and type of the sequence between the junctions of two adjacent RNA single strands and DNA single strands in the RNA-DNA chimera. For example, in the example of B in FIG. 1 , the number of nucleic acid fragments in the first nucleic acid fragment group on the side of the RNA-DNA chimeric fragment ch can be increased, and the number of nucleic acid fragments in the second nucleic acid fragment group on the side of the RNA-DNA chimeric fragment ch' can be reduced accordingly, or the number of nucleic acid fragments in the second nucleic acid fragment group on the side of the RNA-DNA chimeric fragment ch' can be increased, and the number of nucleic acid fragments in the first nucleic acid fragment group on the side of the RNA-DNA chimeric fragment ch can be reduced accordingly. Moreover, in the case of C in FIG. 1 , the first nucleic acid fragment group on the side of the RNA-DNA chimeric fragment ch contains only one nucleic acid fragment ni The second nucleic acid fragment group on the side of the RNA-DNA chimeric fragment ch' contains only one nucleic acid fragment qii '. In a specific embodiment, the present disclosure describes a method for preparing single-stranded RNA-DNA chimeras (ssRDCs), comprising the following steps: Synthesis step: synthesizing the first-chain RNA-DNA chimeric fragment, and the first nucleic acid fragment group and the second nucleic acid fragment group located on both sides of the RNA-DNA chimeric fragment, and synthesizing the second-chain DNA fragment group; The first nucleic acid fragment group includes nucleic acid fragment n i , The second nucleic acid fragment group includes nucleic acid fragment q ii , The second strand DNA fragment group includes DNA fragment m0 ​​and DNA fragment p0; Wherein, i and ii are independently selected from positive integers greater than 1; The 3' end sequence of DNA fragment m0 ​​is complementary to the 3' end sequence of RNA-DNA chimeric fragment, and the 5' end sequence of DNA fragment m0 ​​is complementary to the 5' end sequence of nucleic acid fragment n. i The 5' end sequence is a complementary sequence; The 5' end sequence of DNA fragment p0 is complementary to the 5' end sequence of RNA-DNA chimeric fragment, and the 3' end sequence of DNA fragment p0 is complementary to the 5' end sequence of nucleic acid fragment q ii The 3' end sequence is a complementary sequence. Annealing step: mixing the first nucleic acid fragment group, the second nucleic acid fragment group and the RNA-DNA chimeric fragment of the first chain and the DNA fragment group of the second chain in the same reaction system, annealing, and forming a double-stranded assembly precursor; wherein there is a nick between two adjacent fragments in the first chain, and there is a nick between two adjacent fragments in the second chain; the nick between two adjacent fragments in the fragments of the first chain and the nick between two adjacent fragments in the fragments of the second chain are staggered; Connecting step: connecting the connectors between the fragments in the first chain to obtain a double-stranded assembly formed by the complementarity of the continuous single-stranded RNA-DNA chimera and the fragmented single-stranded DNA. Denaturation step: denaturing the double-stranded assembly to obtain a continuous single-stranded RNA-DNA chimera; And, optionally, a purification step: purifying the continuous single-stranded RNA-DNA chimera from the reaction system. <Synthetic Nucleic Acid Fragment> After the sequence of the target long-chain RNA-DNA chimera is divided, the required sequence and the number of nucleic acid fragments (including DNA fragments, RNA fragments, RNA-DNA chimeric fragments) are synthesized. The synthesis method of the nucleic acid fragment can adopt the RNA, DNA, RNA-DNA chimeric fragment synthesis method commonly used in the art, for example, solid phase synthesis. The solid phase synthesis method can be used to prepare short-chain nucleic acid fragments on a large scale, and the sequence accuracy of the nucleic acid fragments can be guaranteed. In some specific embodiments, the length of any nucleic acid fragment in the first nucleic acid fragment group of the first chain, the RNA-DNA chimeric fragment, the second nucleic acid fragment group, and the second chain DNA fragment group is 6-120 nt, preferably 10-80 nt, and more preferably 15-50 nt. For example, the length of the nucleic acid fragment is 22nt, 24nt, 26nt, 28nt, 30nt, 40nt, 50nt, 60nt, 70nt, 80nt, 90nt, 100nt, etc. The length of the nucleic acid fragment determines the difficulty and cost of its synthesis. Controlling the length of the nucleic acid fragment to 15-50nt can effectively reduce the difficulty of nucleic acid fragment synthesis and control the synthesis cost. In some specific embodiments, the first nucleic acid fragment group of the first chain, the RNA-DNA chimeric fragment, the second nucleic acid fragment group, and the second chain DNA fragment group contain modified bases at one or more positions of any nucleic acid fragment. For example, modified bases are contained at 1, 2, 3, 4, etc. positions of the nucleic acid fragment. The method for base modification can adopt the commonly used methods in the art, for example, introducing modified bases during the chemical synthesis of short-chain nucleic acid fragments. Introducing modified bases during the synthesis of nucleic acid fragments can achieve base modification at any site, and after the fragments are assembled into long-chain RNA-DNA chimeras, long-chain RNA-DNA chimeras that can accurately modify bases at any site can be obtained. Specifically, for the modification of the base at any position in the nucleic acid fragment, it can be selected from m 6 A, Ψ, m 1 A.m 5 A.ms 2 i 6 A.i 6 A.m 3 C.m 5 C. ac 4 C.m 7 G, m2,2G, m 2 G、m 1 G, Q, m 5 U、mcm 5 U、ncm 5 U、ncm 5 Um、D、mcm 5 s 2 U、Inosine(I)、hm 5 C.s 4 U.s. 2 U, azobenzene, Cm, Um, Gm, t 6 A, yW, ms 2 t 6 A or its derivatives. In some specific embodiments, one or more positions of any nucleic acid fragment in the first nucleic acid fragment group of the first chain, the RNA-DNA chimeric fragment, the second nucleic acid fragment group, and the DNA fragment group of the second chain contain modified ribose or deoxyribose. For example, modified ribose or deoxyribose is contained at 1, 2, 3, 4, etc. positions of the nucleic acid fragment. The method for modifying ribose or deoxyribose can adopt the commonly used methods in the art, for example, introducing modified ribose or deoxyribose during the chemical synthesis of short-chain nucleic acid fragments. Introducing modified ribose or deoxyribose during the synthesis of nucleic acid fragments can achieve modification of ribose or deoxyribose at any site. After the nucleic acid fragments are assembled into long-chain RNA-DNA chimeras, long-chain RNA-DNA chimeras that can accurately modify ribose or deoxyribose at any site can be obtained. Specifically, the modification mode of ribose or deoxyribose at any position in the nucleic acid fragment can be selected from LNA, 2'-OMe, 3'-OMeU, vmoe, 2'-F or 2'-OBn (2'-O-benzyl group) or their derivatives. In some specific embodiments, one or more positions of any nucleic acid fragment in the first nucleic acid fragment group of the first chain, the RNA-DNA chimeric fragment, the second nucleic acid fragment group, and the second chain DNA fragment group contain a modified phosphorylation residue. Phosphodiester bonds are formed between two adjacent nucleotides of a short-chain nucleic acid fragment. For example, a modified phosphodiester bond is included at 1, 2, 3, 4, etc. positions of the nucleic acid fragment. The method for modifying the phosphodiester bond can adopt a common method in the art, for example, introducing a modified phosphodiester bond during the chemical synthesis of a short-chain nucleic acid fragment. Introducing a modified phosphodiester bond during the synthesis of a nucleic acid fragment can achieve modification of the phosphodiester bond at any site. After the nucleic acid fragment is assembled into a long-chain RNA-DNA chimera, a long-chain RNA-DNA chimera that can accurately modify the phosphodiester bond at any site can be obtained. Specifically, the modification mode of the phosphodiester bond at any position in the nucleic acid fragment can be selected from phosphorothioate (PS), nucleotide triphosphate (NTPαS) or derivatives thereof. In some preferred embodiments, modifications of bases, ribose / deoxyribose and phosphodiester bonds should avoid bases, ribose / deoxyribose and phosphodiester bonds that are adjacent to the connector position to avoid that modifications at the connector of the first chain or the second chain may affect the connector connection in the subsequent double-stranded assembly precursor. By modifying at least one of the bases, ribose / or deoxyribose and phosphodiester bonds at any one or more sites in the nucleic acid fragment, the modified nucleic acid fragment is applied to the synthesis of the long-chain RNA-DNA chimera in the present disclosure, and accurate modification of any site in the long-chain RNA-DNA chimera can be achieved, which effectively solves the problem that it is difficult to synthesize long-chain RNA-DNA chimeras with accurate modification of specific sites in the art. The modified long-chain RNA-DNA chimera not only has improved structural stability, but also can further improve the biological properties of the long-chain RNA-DNA chimera, such as immunogenicity, so that the synthesized long-chain RNA-DNA chimera can be widely used in the biomedical field. In some specific embodiments, the nucleic acid fragments in the first nucleic acid fragment group, RNA-DNA chimeric fragment, and second nucleic acid fragment group of the first chain include RNA fragments, DNA fragments, and RNA-DNA chimeric fragments, and any of the above nucleic acid fragments includes a phosphate group at the 5' end and a hydroxyl group at the 3' end. For example: nucleic acid fragment n i The 5' end of the nucleic acid fragment (eg, a DNA fragment or an RNA fragment) contains a phosphate group and the 3' end contains a hydroxyl group; i+1 The 5' end of the nucleic acid fragment (eg, a DNA fragment or an RNA fragment) contains a phosphate group, the 3' end contains a hydroxyl group, and the nucleic acid fragment n i+2 The 5' end of the nucleic acid fragment (eg, a DNA fragment or an RNA fragment) contains a phosphate group and the 3' end contains a hydroxyl group; i+3 The 5' end of the RNA-DNA chimeric fragment contains a phosphate group and the 3' end contains a hydroxyl group. The 5' end of the RNA-DNA chimeric fragment contains a phosphate group and the 3' end contains a hydroxyl group. Nucleic acid fragment q ii The 5' end of the nucleic acid fragment (eg, an RNA fragment or a DNA fragment) contains a phosphate group and the 3' end contains a hydroxyl group; ii+1 The 5' end of the nucleic acid fragment (for example, an RNA fragment or a DNA fragment) contains a phosphate group, and the 3' end contains a hydroxyl group. ii+2 The 5' end of the nucleic acid fragment (eg, an RNA fragment or a DNA fragment) contains a phosphate group and the 3' end contains a hydroxyl group; ii+3 The 5' end of the fragment (eg, an RNA fragment or a DNA fragment) contains a phosphate group, and the 3' end contains a hydroxyl group. When the nucleic acid fragments of the first chain and the second chain are assembled to form a double-stranded assembly precursor, the connection of the connecting port in the first chain can be achieved by connecting the 5' phosphate groups and 3' hydroxyl groups on both sides of the connecting port into phosphodiester bonds, thereby obtaining a double-stranded assembly formed by the complementarity of the continuous single-stranded RNA-DNA chimera (first chain) and the fragmented single-stranded nucleic acid chain (second chain). For example, the method for introducing the phosphate group at the 5' end of the nucleic acid fragment (including DNA fragment, RNA fragment, RNA-DNA chimeric fragment) can adopt the modification method commonly used in the art, for example, in the synthesis of nucleic acid fragment During the fragmentation process, a phosphate group is directly introduced into the 5' end of the nucleic acid fragment; or a nucleic acid fragment without an introduced phosphate group is treated with a kinase to modify the phosphate group of the 5' end of the nucleic acid fragment. According to the above design method, a 5' phosphate group and a 3' hydroxyl group are added to the nucleic acid fragment of the first-stranded target single-stranded RNA-DNA chimera, so that only the target single-stranded RNA-DNA chimera is connected in the connection step to obtain a continuous single-stranded RNA-DNA chimera, while the nucleic acid chain complementary to the target single-stranded RNA-DNA chimera is still a fragmented nucleic acid chain, which effectively avoids the need to digest, shear, and other treatments of the complementary chain when the target single-stranded RNA-DNA chimera is subsequently recovered. Specifically, the fragmented nucleic acid chain can be a nucleic acid chain composed of DNA fragments. <Double-chain assembly precursor> The first nucleic acid fragment group, the second nucleic acid fragment group and the RNA-DNA chimeric fragment of the first chain and the DNA fragment group of the second chain are mixed in the same reaction system and annealed to obtain a double-stranded assembly precursor formed by at least partial complementarity of the first chain and the second chain; wherein a connection port exists between two adjacent nucleic acid fragments in the first chain, and a connection port exists between two adjacent nucleic acid fragments in the second chain; and the connection ports between adjacent nucleic acid fragments in the first nucleic acid fragment group, the second nucleic acid fragment group and the RNA-DNA chimeric fragment of the first chain and the connection ports between adjacent nucleic acid fragments in the DNA fragment group of the second chain are staggered. DNA molecules contain four kinds of deoxyribonucleotides, which are adenine deoxyribonucleotide (A), guanine deoxyribonucleotide (G), cytosine deoxyribonucleotide (C) and thymine deoxyribonucleotide (T) according to the different types of bases. Similar to DNA containing four kinds of deoxyribonucleotides, RNA molecules contain four different ribonucleotides, which are adenine ribonucleotide (A), guanine ribonucleotide (G), cytosine ribonucleotide (C) and uracil ribonucleotide (U) according to the different types of bases. Bases can be connected to each other through hydrogen bonds, among which A and T, A and U, and C and G can form hydrogen bonds respectively. The precise complementary pairing ability between base pairs enables the two reverse nucleic acid single strands with complementary sequences to form an accurate double-stranded structure by hydrogen bonding. When preparing the double-stranded assembly precursor, the first-stranded nucleic acid fragment and the second-stranded nucleic acid fragment in the reaction system can be reassembled into the initial target long double-stranded structure under the guidance of the base complementary pairing principle after annealing. Specifically, the first nucleic acid fragment group, the second nucleic acid fragment group and the RNA-DNA chimeric fragment of the first chain and the DNA fragment group of the second chain are dissolved in the same solvent, and the two are fully mixed to obtain a reaction system for preparing a double-stranded assembly precursor. The present disclosure does not specifically limit the specific solvent, which can be a polar solvent commonly used in the art, such as water. Regarding the molar ratio of the nucleic acid fragments in the reaction system, the molar ratio of any two nucleic acid fragments in the first nucleic acid fragment group, the second nucleic acid fragment group and the RNA-DNA chimeric fragment of the first chain is 1: (0.1-10), preferably 1: (0.5-2), and most preferably 1: 1. Exemplarily, the molar ratio of any two nucleic acid fragments is 1: 0.2, 1: 0.4, 1: 0.6, 1: 0.8, 1: 1, 1: 2, 1: 4, 1: 6, 1: 8, etc. Regarding the molar ratio of the nucleic acid fragments in the reaction system, the molar ratio of any nucleic acid fragment belonging to RNA in the first nucleic acid fragment group and the second nucleic acid fragment group from the first chain to the nucleic acid fragment from the second chain DNA fragment group that is partially complementary to the nucleic acid fragment belonging to RNA is 1:(0.1-10), preferably 1:(2-4), and most preferably 1:(2-4). Preferably 1:2. For example, as shown in Figure 1 A, when the nucleic acid fragment ni In the case of RNA, the DNA fragments that are partially complementary to it include: DNA fragments mo and DNA fragments mi Therefore, under preferred conditions, the nucleic acid fragment ni With DNA fragments mo and DNA fragments mi The molar ratio is 1:2. Regarding the molar ratio of the nucleic acid fragments in the reaction system, the molar ratio of any nucleic acid fragment belonging to RNA from the first nucleic acid fragment group and the second nucleic acid fragment group of the first chain to the nucleic acid fragment from the second chain DNA fragment group that is partially complementary to the nucleic acid fragment belonging to RNA is 1:(0.1-10), preferably 1:(0.5-1), and most preferably 1:1. For example, as shown in A in FIG. 1 , when the nucleic acid fragment ni In the case of DNA, the DNA fragments that are partially complementary to it include: DNA fragments mo and DNA fragments mi Therefore, under preferred conditions, the nucleic acid fragment ni With DNA fragments mo and DNA fragments mi The molar ratio is 1:1. By setting the above-mentioned molar ratio of nucleic acid fragments, the assembly efficiency of short-chain nucleic acid fragments can be improved. To further improve the assembly efficiency of the double-stranded assembly precursor and the yield of the double-stranded assembly, the pH of the reaction system is set to 3-11, preferably pH 4-10, more preferably pH 5-9, and most preferably pH 6-8. Exemplarily, the pH of the reaction system is 6, 7, 8, 9, and the like. Furthermore, after incubating the first nucleic acid fragment group, the second nucleic acid fragment group and the RNA-DNA chimeric fragment of the first chain and the DNA fragment group of the second chain, the temperature is lowered to form a double-stranded assembly precursor. Optionally, the incubation temperature is any temperature of 0-100°C, preferably any temperature of 50-98°C, more preferably any temperature in the range of 70-85°C, for example 70°C, 73°C, 75°C, 77°C, 79°C, 81°C, 83°C or 85°C, and the incubation time is any desired time. The cooling speed can be any speed, and the temperature can be cooled to any temperature at which the nucleic acid fragments in the reaction system can be hybridized to form a double-stranded assembly precursor. In some preferred embodiments, the temperature is kept at 1-3°C for 20-60 seconds each time the temperature is lowered to 20-30°C, and then kept at 1-10°C for 5-20 minutes. <Double-stranded assembly> Only the junction present in the first strand is ligated to form a double-stranded assembly. Specifically, the 5' phosphate groups and 3' hydroxyl groups on both sides of the connector are connected to form a phosphodiester bond. The connection method can be an enzyme connection using T4 RNA ligase and T4 DNA ligase. Or it can be a chemical connection method. After the connector is connected, a complete double-stranded assembly formed by the complementary first and second chains is obtained. The first chain in the double-stranded assembly is a continuous single-stranded RNA-DNA chimera, and the second chain is a fragmented single-stranded nucleic acid chain composed of DNA fragments, thereby realizing the preparation of a long-chain RNA-DNA chimera. In some preferred embodiments, the usage ratio of T4 RNA ligase to T4 DNA ligase is 1:(0.1-10), preferably 1:(0.5-1), and most preferably 1: 1. In some preferred embodiments, the usage of T4 RNA ligase and T4 DNA ligase is 10-200 U / pmol connector, preferably 30-150 U / pmol connector, preferably 50-120 U / pmol connector, preferably 80-100 U / pmol connector, for example 80 U / pmol connector, 90 U / pmol connector or 100 U / pmol connector. In some preferred embodiments, the ligation reaction is carried out for at least 2 hours, such as 3 hours, 4 hours, 5 hours, 6 hours, 12 hours, 24 hours or 48 hours, preferably 2 hours. Furthermore, the preparation method disclosed herein also includes a denaturation step. For the denaturation step, the double-stranded assembly is subjected to a denaturation treatment to obtain a continuous single-stranded RNA-DNA chimera, that is, the target long-chain RNA-DNA chimera. The denaturation treatment method can be a method commonly used in the art to melt the double-stranded assembly to form a single-stranded RNA-DNA chimera. For example, the single-stranded RNA-DNA chimera is obtained by treating at a temperature of 70°C for 5 minutes. Furthermore, the preparation method disclosed herein also includes a purification step. The purification step is to purify the continuous single-stranded RNA-DNA chimera from the reaction system. The present disclosure does not specifically limit the purification method, and it can be various methods for efficiently recovering RNA-DNA chimeras from the reaction system. The long-chain RNA-DNA chimera obtained after the purification step and free of other substances can be further applied to different fields such as clinical practice, drug development, and biological research. The preparation method disclosed in the present invention has all the advantages of conventional RNA-DNA chimera chemical synthesis methods (including no need for template chains, precise site-specific modification, etc.), while the target long-chain RNA-DNA chimera is divided into several shorter nucleic acid fragments, and the single-stranded nucleic acid chain complementary to the target single-stranded RNA-DNA chimera can be divided into a combination of several shorter DNA fragments. Through this sequence design, the difficulty of chemical synthesis is greatly reduced, and the high accuracy, high yield and site-specific modification ability of the chemical synthesis method for preparing short-chain nucleic acid fragments are retained. The nucleic acid fragments that can be easily prepared by solid phase synthesis are reassembled into double-stranded assembly precursors of the target structure in a specific order through the self-assembly ability of nucleic acids, and the connectors in the assembly are reconnected through phosphodiester bonds by enzyme connection or chemical connection techniques to obtain a double-stranded assembly formed by the complementarity of the continuous single-stranded RNA-DNA chimera and the fragmented single-stranded nucleic acid chain. For the double-stranded assembly, only simple denaturation is required to obtain the single-stranded target long-chain RNA-DNA chimera. Since the solid phase synthesis process can achieve accurate modification of any site of the initial short-chain nucleic acid fragment (except the bases on both sides of the connector), the obtained target long-chain RNA-DNA chimera also has the characteristic of being able to be accurately modified at almost any site. Second aspect The second aspect of the present disclosure provides an RNA-DNA chimera, which is prepared by the method of the first aspect and is a single-stranded long-chain RNA-DNA chimera. The RNA-DNA chimera disclosed in the present invention can achieve accurate modification at any site, and the long-chain RNA-DNA chimera itself has no sequence dependence on the modification, which provides a basis for expanding the application of long single-stranded RNA-DNA chimeras (especially long-chain RNA-DNA chimeras with precise modifications) in the biomedical field. Example The embodiments of the present disclosure will be described in detail below in conjunction with the examples, but those skilled in the art will appreciate that the following examples are only used to illustrate the present disclosure and should not be considered to limit the scope of the present disclosure. If no specific conditions are specified in the examples, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be obtained commercially. The experimental techniques and experimental methods used in this example are all conventional technical methods unless otherwise specified. For example, the experimental methods in the following examples that do not specify specific conditions are usually carried out under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. The materials, reagents, etc. used in the examples can be obtained through regular commercial channels unless otherwise specified. Example 1: Preparation and purification of 190nt long-chain RNA-DNA chimera based on the method disclosed herein: Step 1: Using the first chain of 190nt long RNA-DNA chimera (where RNA is 100nt and DNA is 90nt) as the target long chain, the first chain is cut into two 40nt long short-chain RNA fragments (R-1, R-2), two 40nt long short-chain DNA fragments (D-1, D-2), and one 30nt long short-chain RNA-DNA chimeric fragment (chRD), and the second chain is cut into three 40nt long short-chain DNA fragments (D-m1, D-m2, D-n2), and one 30nt long short-chain DNA fragment (D-n1). Among them, R-1, R-2, chRD, D-1, D-2 are short-chain fragments for synthesizing the first chain, and D-m1, D-m2, D-n1 and D-n2 are DNA fragments for synthesizing the second chain. Step 2: Prepare 9 short-chain nucleic acid fragments by solid phase synthesis. The specific sequences of the 9 short-chain nucleic acid fragments used are shown in Table 1 below: Table 1: Step 3: Mix the above 9 short-chain nucleic acid fragments in 1×TAE-Mg 2+In the buffer (wherein, the molar ratios of the fragments in the first chain are equal, the molar ratio of the RNA nucleic acid fragment in the first chain (abbreviated as the first chain RNA portion, R) to the complementary DNA fragment in the second chain (abbreviated as the second chain RNA complementary portion, Dm) is 1:2, That is, R-1 / R-2:D-m1 / D-m2=1:2; the molar ratio between the DNA nucleic acid fragment in the first chain (abbreviated as, the first chain DNA part, D) and the complementary DNA fragment in the second chain (abbreviated as, the second chain DNA complementary part, Dn) is 1:1, that is, D-1 / D-2:D-n1 / D-n2=1:1), heated at 75°C for 5 minutes, then reduced by 1°C for 40 seconds until 25°C, and placed at 4°C for 10 minutes to obtain the target double-stranded assembly precursor. Step 4: The double-stranded assembly precursor aqueous solution obtained in step 3 was then added with 10×T4 RNA ligase buffer (final concentration of 1×), 10×T4 DNA ligase buffer (final concentration of 1×), H2O, T4 DNA Ligase (100U / pmol connector) and T4 RNA Ligase (100U / pmol connector) according to the manufacturer's instructions and subjected to enzyme ligation at 37°C for 2 hours to connect the four connectors in the first chain so that the five short chain fragments in the first chain formed a complete 190nt RNA-DNA chimera chain, thereby obtaining a crude long-chain RNA-DNA chimera product. Step 5, purification of long-chain RNA-DNA chimeras: add an equal volume of formamide to the reaction system (100 μL) and quench it. After incubation at 75°C for 5 minutes, immediately immerse it in liquid nitrogen and cool it rapidly. Use 6% denaturing polyacrylamide gel electrophoresis containing 8M urea for separation (200V, 6h). Use gel cutting, foaming, and ultrafiltration to extract the separated long-chain RNA-DNA chimeras from the gel to obtain pure long-chain RNA-DNA chimeras. The purified long-chain RNA-DNA chimeras are characterized by 10% denaturing polyacrylamide gel electrophoresis containing 8M urea (300V, 3h). The results are shown in Figure 3. Lane M is the labeled nucleic acid used, and its corresponding length is shown on the right of the figure. Lane ssRDC is the purified 190nt long-chain RNA-DNA chimera, and the others are raw material lanes. The results show that RNA-DNA chimeras of corresponding lengths can be successfully and efficiently synthesized based on the method disclosed in the present invention, and the final product can be easily purified. Comparative Example: Based on the method of Example 1, the design of chRD was cancelled and the short fragment was replaced by: R-1:GCUGAAGCACUGCACGCCGUGUUUUAGAGCUAGAA (SEQ ID NO: 10) R-2:AUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC (SEQ ID NO: 11) R-3:UUGAAAAGUGGCACCGAGUCCGGUGCUUUU (SEQ ID NO: 12) D-1:TgcttcatgtggtcggggtagcggctgaagcactgcacgccGTGGC (SEQ ID NO: 13) D-2:Tcagggtggtcacgagggtgggccagggcacgggcagcttgccg (SEQ ID NO: 14) Dm-1:gccttatattttaacttgctatttctagctctaaaacacggc (SEQ ID NO: 15) Dm-2:gtgccactttttcaagttgataacggacta (SEQ ID NO: 16) Dm-3: cgaccacatgaagcAAAAAgcaccgactcg (SEQ ID NO: 17) Dn-1: caccctcgtgaccaccctgAGCCACggcgtgcagtgcttc (SEQ ID NO: 18) The design of chRD is cancelled. The experimental results show that if the design of chRD is cancelled, the synthesis efficiency is very low, as shown in FIG4A . Example 2: Optimization of 190nt long-chain RNA-DNA chimera based on the method disclosed herein: Based on a similar method to Example 1, the concentration of the second short chain used was adjusted to Dn (second DNA complementary part): D (first DNA part) = 1, 2, 3, 4, 6, 8, 10 or 15; Dm (second RNA complementary part: R (first RNA part) = 1, 2, 3, 4, 6, 8, 10 or 15. The results were evaluated for yield, as shown in Figures 4B and 4C. The yield evaluation method is to use a Nano Drop instrument to measure the concentration of the purified sample, The yield was obtained according to the amount of feed, and the yield of long-chain RNA-DNA chimera was calculated by the following equation: Here, n (长链RNA-DNA嵌合体)Indicates the amount of long-chain RNA-DNA chimera, n (投料) Indicates the amount of material fed (the amount of any short chain of the first chain). The quantitative data of output are shown in Table 2 and Table 3: Table 2: Table 3: The experimental results show that Dm:R=2-4 has a higher synthesis efficiency, and increasing the ratio of Dn:D on the basis of 1:1 is not conducive to the synthesis. Example 3: Exploration of enzyme treatment time and yield of 190nt long-chain RNA-DNA chimera prepared based on the method disclosed in the present invention Based on the synthesis method in Example 1, the enzyme connection time at 37°C in step 4 was set to a gradient of 0.5 hours, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 12 hours, 24 hours, and 48 hours, respectively, and the results were evaluated for yield, as shown in Figure 5. The yield evaluation method is to use a Nano Drop instrument to measure the concentration of the purified sample, and obtain the yield based on the amount of feed. The yield of the long-chain RNA-DNA chimera is calculated by the following equation: calculate: Here, n (长链RNA-DNA嵌合体) Indicates the amount of long-chain RNA-DNA chimera, n (投料) Indicates the amount of material fed (the amount of any short chain of the first chain). The quantitative data of output are shown in Table 4 below: Table 4: The results show that the synthesis efficiency of long-chain RNA-DNA chimeras synthesized based on the method disclosed in the present invention is related to the reaction time, and can reach 20% in about 2 hours, which can meet most application scenarios, and the subsequent yield growth does not change significantly with time. Example 4: DNase I and RNase A digestion verification of 120nt, 144nt and 190nt long-chain RNA-DNA chimeras synthesized based on the method disclosed herein The purified 124nt, 144nt, and 190nt long-chain RNA-DNA chimeras were prepared by the method disclosed in the present invention (the specific method used is similar to that in Example 1, except that the short chain can be replaced), and DNase I and RNase A were used for digestion, respectively. Two portions of 10 pmol of the 120nt, 144nt, and 190nt long-chain RNA-DNA chimeras were taken, 1 μL DNase I (50 U / μL) and 1 μL RNase A (50 U / μL) were added, respectively, and incubated at 37°C for 1 hour. The mixture was characterized by using the 8 M urea denaturing polyacrylamide gel in Example 1. The characterization results are shown in FIG6 . The 124 nt sequence to be synthesized is as follows (SEQ ID NO: 19): GCUGAAGCACUGCACGCCGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUTactgcacgccGTGGCTcagggtg (the underlined part is RNA; the rest is DNA) The short chains used to synthesize the 124nt sequence are shown in Table 5 below: Table 5: The 144 nt sequence to be synthesized is as follows (SEQ ID NO: 21): GCUGAAGCACUGCACGCCGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUTcggctgaagcactgcacgccGTGGCTcagggtggtcacgaggg (the underlined part is RNA; the rest is DNA) The short chains used to synthesize the 144nt sequence are shown in Table 6 below: Table 6: The 190 nt sequence and short chain to be synthesized are the same as those in Example 1. The experimental results show that the method disclosed in the present invention can synthesize a series of RNA-DNA chimeras of different lengths, and the chimeras synthesized after RNase A treatment contain DNA of a specific length, and after DNase 1 treatment, the chimeras synthesized contain RNA of a specific length. Example 5: Synthesis and characterization of 580nt RNA-DNA chimera prepared based on the method disclosed herein Based on the specific experimental scheme provided in Example 1, the first chain is an RNA-DNA chimera with a length of 580 nt (wherein RNA is 100 nt and DNA is 480 nt) as the target long chain, and the first chain is cut into two short-chain RNA fragments with a length of 40 nt (R-1, R-2), 11 short-chain DNA fragments with a length of 40 nt (D-1, D-2, ... D-11), 1 short-chain DNA with a length of 20 nt (D-12) and 1 short-chain RNA-DNA chimeric fragment with a length of 40 nt (chRD), and the second chain is cut into 13 short-chain DNA fragments with a length of 40 nt (D-m1, D-m2, D-n2, D-n2 ... D-n11) and 1 short-chain DNA fragment with a length of 40 nt (D-n1). Among them, R-1, R-2, chRD, D-1, D-2...D-11 are short chain fragments for synthesizing the first chain, D-m1, D-m2, D-n1, D-n2....D-n11 are DNA fragments for synthesizing the second chain, and the rest of the synthesis strategy is consistent with Example 1. The synthesis schematic diagram and results are shown in Figure 7, and the left side is the synthesis result diagram, where M represents the labeled nucleic acid, and the sequence length of the marker is shown on the right, and ssRDC is a synthesized 580nt long RNA-DNA chimera. The sequence of the prepared 580nt RNA-DNA chimera is as follows (SEQ ID NO: 25): GCCGUUGUCGACGACGAGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUcctcggctcacagcgcgcccggctattctcgcaactgacaATGGAACACGTGGCCTTCGGCAGCGAGGACATCGAGAACACCCTGGCCAAGATGGACGACGGCCAGCTGGACGGACTGGCTTTTGGCGCCATTCAGCTGGATGGCGATGGAAATATCCTGCAATACAACGCCGCCGAGGGAGATATCACCGGCAGAGATCCTAAGCAGGTGATCGGCAAGAACTTCTTCAAGGACGTGGCCCCTGGCACCGACTCCCCAGAATTCTACGGCAAGTTCAAGGAAGGCGTGGCTTCTGGCAACCTGAACACCATGTTCGAGTGGATGATCCCCACAAGCCGGGGCCCTACAAAGGTGAAGGTGCACATGAAAAAGGCCCTGAGCGGCGACAGCTACTGGGTCTTTGTGAAAAGAGTGgccggctccggtaccgatgatgatatcgcagcgctcgtcgtcgacaacggctccggcatgtgcaa (The underlined part is RNA; the rest is DNA) The short chains used for synthesizing the 580 nt RNA-DNA chimera are shown below: R-1: GCCGUUGUCGACGACGAGCGGUUUUAGAGCUAGAAAUAGC (SEQ ID NO: 26) R-2: AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU (SEQ ID NO: 2) chRD: GGCACCGAGUCGGUGCUUUUCCTCGGCTCACAGCGCGCCC (SEQ ID NO: 27; the underlined part is RNA; the rest is DNA) D-1: ggctattctcgcaactgacaATGGAACACGTGGCCTTCGG (SEQ ID NO: 28) <h2 style=";text-align:left;direction:ltr">D-2:CAGCGAGGACATCGAGAACACCCTGGCCAAGATGGACGAC(SEQ ID NO:29)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> D-3:GGCCAGCTGGACGGACTGGCTTTTGGCGCCATTCAGCTGG(SEQ ID NO:30)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> D-4:ATGGCGATGGAAATATCCTGCAATACAACGCCGCCGAGGG(SEQ ID NO:31)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> D-5:AGATATCACCGGGCAGAGATCCTAAGCAGGTGATCGGCAAG(SEQ ID NO:32)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> D-6:AACTTCTTCAAGGACGTGGCCCCTGGCACCGACTCCCCAG(SEQ ID NO:33)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> D-7:AATTCTACGGCAAGTTCAAGGAAGGCGTGGCTTCTGGCAA(SEQ ID NO:34)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> D-8:CCTGAACACCATGTTCGAGTGGATGATCCCCACAAGCCGG(SEQ ID NO:35)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> D-9:GGCCCTACAAAGGTGAAGGTGCACATGAAAAAGGCCCTGA(SEQ ID NO:36)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> D-10:GCGGCGACAGCTACTGGGTCTTTGTGAAAAGAGTGgccgg(SEQ ID NO:37)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> D-11:Ctccggtaccgatgatgatatcgcagcgctcgtcgtcgac(SEQ ID NO:38)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> D-12:aacggctccggcatgtgcaa(SEQ ID NO:39)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> D-m1:gactagccttattttaacttgctatttctagctctaaaac(SEQ ID NO:6)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> D-m2:aaaagcaccgactcggtgccactttttcaagttgataacg(SEQ ID NO:7)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> D-n1:tgtcagttgcgagaatagccgggcgcgctgtgagccgagg(SEQ ID NO:40)<h2 style=";text-align:left;direction:ltr"> D-n2:TGTTCTCGATGTCCTCGCTGCCGAAGGCCACGTGTTCCAT (SEQ ID NO: 41) D-n3:GCCAGTCCGTCCAGCTGGCCGTCGTCCATCTTGGCCAGGG (SEQ ID NO: 42) D-n3:CAGGATATTTCCATCGCCATCCAGCTGAATGGCGCCAAAA (SEQ ID NO: 43) D-n4:GATCTCTGCCGGTGATATCTCCCTCGGCGGCGTTGTATTG (SEQ ID NO: 44) D-n5:GCCACGTCCTTGAAGAAGTTCTTGCCGATCACCTGCTTAG (SEQ ID NO: 45) D-n6:CTTGAACTTGCCGTAGAATTCTGGGGAGTCGGTGCCAGGG (SEQ ID NO: 46) D-n7:ACTCGAACATGGTGTTCAGGTTGCCAGAAGCCACGCCTTC (SEQ ID NO: 47) D-n8:ACCTTCACCTTTGTAGGGCCCCGGCTTGTGGGGATCATCC (SEQ ID NO: 48) D-n9:GACCCAGTAGCTGTCGCCGCTCAGGGCCTTTTTCATGTGC (SEQ ID NO: 49) D-n10:tatcatcatcggtaccggagccggcCACTCTTTTCACAAA (SEQ ID NO: 50) D-n11:ttgcacatgccggagccgttgtcgacgacgagcgctgcga (SEQ ID NO: 51) The results show that: based on the method disclosed in the present invention, long-chain RNA-DNA chimeras with a length of more than 500 nt can be successfully synthesized. It should be noted that, although the technical solutions of the present disclosure are introduced with specific examples, those skilled in the art will appreciate that the present disclosure should not be limited thereto. The embodiments of the present disclosure have been described above, and the above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and changes will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments. The selection of terms used herein is intended to best explain the principles of the embodiments, practical applications, or technical improvements in the market, or to enable other persons of ordinary skill in the art to understand the embodiments disclosed herein. References 1.Lesnik, EA; Freier, SM, Relative Thermodynamic Stability of DNA, RNA, and DNA:RNA Hybrid Duplexes: Relationship with Base Composition and Structure. Biochemistry 1995, 34(34), 10807-10815. 2. Goodall, GJ; Wickramasinghe, VO, RNA in cancer. Nature Reviews Cancer 2021, 21(1), 22-36. 3. Park, JH; Hong, SW; Yun, S.; Lee, D.-k.; Shin, C., Effect of siRNA with an Asymmetric RNA / dTdT Overhang on RNA Interference Activity. Nucleic Acid Therapeutics 2014, 24(5), 364-371. 4. Gebauer, F.; Schwarzl, T.; Valcárcel, J.; Hentze, MW, RNA-binding proteins in human genetic disease. Nature Reviews Genetics 2021, 22(3), 185-198. 5.Yin,H.;Song,C.-Q.;Suresh,S.;Kwan,S.-Y.;Wu,Q.;Walsh,S.;Ding,J.;Bogorad,R.L.;Zhu,L.J.;Wolfe,S.A.;Koteliansky,V.;Xue,W.;Langer,R.;Anderson,D.G.,Partial DNA-guided Cas9 enables genome editing with reduced off-target activity.Nature Chemical Biology 2018,14(3),311-316. 6.Wang,Y.;Zou,Q.;Li,F.;Zhao,W.;Xu,H.;Zhang,W.;Deng,H.;Yang,X.,Identification of the cross-strand chimeric RNAs generated by fusions of bi-directional transcripts.Nature Communications 2021,12(1),4645. 7.Horvath,S.J.;Firca,J.R.;Hunkapiller,T.;Hunkapiller,M.W.;Hood,L.,

[0016] An automated DNA synthesizer employing deoxynucleoside 3′-phosphoramidites.In Methods in Enzymology,Academic Press:1987;Vol.154,pp 314-326. 8.Zon,G.;Gallo,K.A.;Samson,C.J.;Shao,K.-l.;Summers,M.F.;Byrd,R.A.,Analytical studies of‘mixed sequence’oligodeoxyribonucleotides synthesized by competitive coupling of either methyl-orβ-cyanoethyl-N,N-diisopropylamino phosphoramidite reagents,including 2′-deoxyinosine.Nucleic Acids Research 1985,13(22),8181-8196. 9.Caruthers,M.H.,The Chemical Synthesis of DNA / RNA:Our Gift to Science.Journal of Biological Chemistry 2013,288(2),1420-1427. 10.Lee,K.;Mackley,V.A.;Rao,A.;Chong,A.T.;Dewitt,M.A.;Corn,J.E.;Murthy,N.,Synthetically modified guide RNA and donor DNA are a versatile platform for CRISPR-Cas9 engineering.eLife 2017,6,e25312. 11.Agard,N.J.;Prescher,J.A.;Bertozzi,C.R.,A Strain-Promoted[3+2]Azide-Alkyne Cycloaddition for Covalent Modification of Biomolecules in Living Systems.Journal of the American Chemical Society 2004,126(46),15046-15047.

Claims

1. A method for preparing a single-stranded RNA-DNA chimera, comprising the following steps: Synthesis step: synthesizing the first-chain RNA-DNA chimeric fragment, and the first nucleic acid fragment group and the second nucleic acid fragment group located on both sides of the RNA-DNA chimeric fragment, and synthesizing the second-chain DNA fragment group; The RNA-DNA chimeric fragment is located at the junction of the RNA single strand and the DNA single strand in the RNA-DNA chimera, and optionally, the RNA-DNA chimeric fragment of the first strand includes at least one; The first nucleic acid fragment group includes nucleic acid fragment n i The second nucleic acid fragment group includes nucleic acid fragment q ii , the DNA fragment group includes DNA fragment m0 ​​and DNA fragment p0; i and ii are independently selected from positive integers greater than 1; The 3' end sequence of DNA fragment m0 ​​is complementary to the 3' end sequence of RNA-DNA chimeric fragment, and the 5' end sequence of DNA fragment m0 ​​is complementary to the 5' end sequence of nucleic acid fragment n. i The 5' end sequence is a complementary sequence; The 5' end sequence of DNA fragment p0 is complementary to the 5' end sequence of RNA-DNA chimeric fragment, and the 3' end sequence of DNA fragment p0 is complementary to the 5' end sequence of nucleic acid fragment q ii The 3' end sequence is a complementary sequence; Annealing step: mixing the first nucleic acid fragment group, the second nucleic acid fragment group and the RNA-DNA chimeric fragment, and the second chain DNA fragment group in the same reaction system, annealing, and forming a double-stranded assembly precursor; wherein there is a nick between two adjacent fragments in the first chain, and there is a nick between two adjacent fragments in the second chain; the nick between two adjacent fragments in the first chain and the nick between two adjacent fragments in the second chain are staggered; Connecting step: connecting the connectors between the fragments in the first chain to obtain a double-stranded assembly formed by the complementarity of the continuous single-stranded RNA-DNA chimera and the fragmented single-stranded DNA.

2. The method for preparing a single-stranded RNA-DNA chimera according to claim 1, wherein: The method further comprises the steps of: Denaturation step: denaturing the double-stranded assembly to obtain a continuous single-stranded RNA-DNA chimera; Optionally, the method further comprises a purification step: purifying the continuous single-stranded RNA-DNA chimera from the reaction system.

3. The method for preparing a single-stranded RNA-DNA chimera according to claim 1 or 2, wherein: The 5' end sequence of the RNA-DNA chimeric fragment is an RNA sequence, and the 3' end sequence is a DNA sequence, or the 5' end sequence of the RNA-DNA chimeric fragment is a DNA sequence, and the 3' end sequence is an RNA sequence.

4. The method for preparing a single-stranded RNA-DNA chimera according to any one of claims 1 to 3, wherein: The first nucleic acid fragment group also includes nucleic acid fragment n i+1 The second nucleic acid fragment group also includes nucleic acid fragment q ii+1 The DNA fragment group also includes DNA fragment m i and DNA fragment p ii ; Among them, DNA fragment m i The 5' end sequence of the nucleic acid fragment n i+1 The 5' end sequence of the DNA fragment m i The 3' end sequence of the nucleic acid fragment n i The 3' end sequence is a complementary sequence; DNA fragment p ii The 5' end sequence of the nucleic acid fragment q ii The 5' end sequence of the DNA fragment p ii The 3' end sequence of the nucleic acid fragment q ii+1 The 3' end sequence is a complementary sequence; Optionally, The nucleic acid fragment n i+1 The 3' end sequence of the second strand is a complementary sequence or an unpaired sequence to the 3' end sequences of other DNA fragments in the second strand DNA fragment group; The nucleic acid fragment q ii+1 The 5' end sequence of the second strand is a complementary sequence or an unpaired sequence to the 5' end sequences of other DNA fragments in the second strand DNA fragment group; Optionally, The nucleic acid fragment n i+1 The 3' end sequence of DNA fragment m i+1 The 3' end sequence of the DNA fragment m is a complementary sequence. i+1 The 5' end sequence of the nucleic acid fragment is a complementary sequence to the other nucleic acid fragments of the first nucleic acid fragment group; The nucleic acid fragment q ii+1 The 5' end sequence of DNA fragment p ii+1 The 5' end sequence of the DNA fragment p ii+1 The 3' end sequence of the nucleic acid fragment is a complementary sequence to the nucleic acid fragment of the second nucleic acid fragment group.

5. The method for preparing a single-stranded RNA-DNA chimera according to any one of claims 1 to 4, wherein: The length of the continuous single-stranded RNA-DNA chimera is greater than 60 nt, preferably greater than 80 nt, and more preferably 80-1000 nt.

6. The method for preparing a single-stranded RNA-DNA chimera according to any one of claims 1 to 5, wherein: The length of any one of the first nucleic acid fragment group, the second nucleic acid fragment group, the RNA-DNA chimeric fragment and the second chain DNA fragment group is 8-120 nt, preferably 10-80 nt, more preferably 15-50 nt.

7. The method for preparing a single-stranded RNA-DNA chimera according to any one of claims 1 to 6, wherein: The 5' end sequence length of any of the first nucleic acid fragment group, the second nucleic acid fragment group, the RNA-DNA chimeric fragment and the second strand DNA fragment group is 4 nt or longer, preferably 4-50 nt, more preferably 6-30 nt, and most preferably 10-25 nt; or, The length of the 3' end sequence of any DNA fragment in the first nucleic acid fragment group, the second nucleic acid fragment group, the RNA-DNA chimeric fragment and the second chain DNA fragment group is more than 4 nt, preferably 4-50 nt, more preferably 6-30 nt, and most preferably 10-25 nt.

8. The method for preparing a single-stranded RNA-DNA chimera according to any one of claims 1 to 7, wherein: Any of the first nucleic acid fragment group, the second nucleic acid fragment group and the RNA-DNA chimeric fragment comprises a phosphate group at the 5' end and a hydroxyl group at the 3' end; in the connection step, the phosphate group and the hydroxyl group at both sides of the connection port are connected to form a phosphodiester bond; Optionally, adjacent phosphate groups and hydroxyl groups in the first strand are linked as phosphodiester bonds by enzymatic or chemical ligation.

9. The method for preparing a single-stranded RNA-DNA chimera according to any one of claims 1 to 8, wherein: One or more positions of any of the first nucleic acid fragment group, the second nucleic acid fragment group, the RNA-DNA chimeric fragment, and the second strand DNA fragment group contain modified bases, and the bases at positions adjacent to the connector are unmodified bases; Optionally, the modification is selected from m 6 A, Ψ, m 1 A.m 5 A.ms 2 i 6 A.i 6 A.m 3 C.m 5 C. ac 4 C.m 7 G, m2,2G, m 2 G、m 1 G, Q, m 5 U、mcm 5 U、ncm 5 U、ncm 5 Um、D、mcm 5 s 2 U、Inosine(I)、hm 5 C.s 4 U.s 2 U, azobenzene, Cm, Um, Gm, t 6 A, yW, ms 2 t 6 A or its derivatives.

10. The method for preparing a single-stranded RNA-DNA chimera according to any one of claims 1 to 9, wherein: One or more positions of any of the first nucleic acid fragment group, the second nucleic acid fragment group, the RNA-DNA chimeric fragment, and the second strand DNA fragment group contain modified ribose or deoxyribose, and the ribose or deoxyribose at the position adjacent to the connection port is unmodified ribose or deoxyribose; Optionally, the modification is selected from LNA, 2'-OMe, 3'-OMeU, vmoe, 2'-F or 2'-OBn (2'-O-benzyl group) or its derivatives.

11. The method for preparing a single-stranded RNA-DNA chimera according to any one of claims 1 to 10, wherein: One or more positions of any of the first nucleic acid fragment group, the second nucleic acid fragment group, the RNA-DNA chimeric fragment, and the second strand DNA fragment group contain modified phosphodiester bonds, and the phosphodiester bonds at positions adjacent to the connector are unmodified phosphodiester bonds; Optionally, the modification is selected from phosphorothioate (PS), nucleotide triphosphate (NTPαS) or a derivative thereof.

12. The method for preparing a single-stranded RNA-DNA chimera according to any one of claims 1 to 11, wherein: In the annealing step, the first nucleic acid fragment group, the second nucleic acid fragment group, the RNA-DNA chimeric fragment and the second strand DNA fragment group are incubated and then cooled to form a double-stranded assembly precursor; Optionally, the incubation temperature is any temperature of 0-100°C, preferably any temperature of 50-98°C, more preferably any temperature of 70-85°C.

13. The method for preparing a single-stranded RNA-DNA chimera according to any one of claims 1 to 12, wherein: In the annealing step, the first nucleic acid fragment group, the second nucleic acid fragment group, the RNA-DNA chimeric fragment and the second chain DNA fragment group are dissolved in the same solvent to obtain the reaction system.

14. The method for preparing a single-stranded RNA-DNA chimera according to claim 13, wherein: The pH of the reaction system is 3-11, preferably pH 4-10, more preferably pH 5-9, most preferably pH 6-8.

15. The method for preparing a single-stranded RNA-DNA chimera according to claim 13 or 14, wherein: In the reaction system, the molar ratio of any two fragments among the first nucleic acid fragment group, the second nucleic acid fragment group and the RNA-DNA chimeric fragment is 1:(0.1-10), preferably 1:(0.5-1), and most preferably 1:

1.

16. The method for preparing a single-stranded RNA-DNA chimera according to any one of claims 13 to 15, wherein: In the reaction system, the molar ratio of any nucleic acid fragment belonging to RNA from the first nucleic acid fragment group and the second nucleic acid fragment group of the first chain to the nucleic acid fragment from the second chain DNA fragment group that is partially complementary to the nucleic acid fragment belonging to RNA is 1:(0.1-10), preferably 1:(2-4), most preferably 1:2; and / or, The molar ratio of any nucleic acid fragment belonging to DNA from the first nucleic acid fragment group and the second nucleic acid fragment group of the first chain to the nucleic acid fragment from the DNA fragment group of the second chain that is partially complementary to the nucleic acid fragment belonging to DNA is 1:(0.1-10), preferably 1:(0.5-1), and most preferably 1:

1.

17. A single-stranded RNA-DNA chimera, wherein: The single-stranded RNA-DNA chimera is prepared by the method according to any one of claims 1 to 16; Preferably, the single-stranded RNA-DNA chimera comprises a modified base, ribose or deoxyribose, or a phosphodiester bond at one or more positions.

Images