Modified oligonucleotides and methods of use thereof
Patent Information
- Application Number
- PCT/US2024/054153
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-11-03
- Filing Date
- 2024-11-01
- Publication Date
- 2025-08-21
AI Technical Summary
Current oligonucleotide therapeutics face challenges in maintaining on-target potency while minimizing off-target binding and resisting nuclease degradation, which affects their efficacy and stability in vivo.
The development of double-stranded compounds comprising modified nucleotide components, specifically incorporated into the sense or antisense strands to induce seed-pairing destabilization and enhance resistance to nuclease degradation, thereby improving targeted delivery and stability.
These modified oligonucleotides effectively maintain on-target potency while reducing off-target binding and enhancing resistance to nuclease degradation, leading to improved therapeutic efficacy and stability in vivo.
Smart Images

Figure US2024054153_21082025_PF_FP_ABST
Abstract
Description
Attorney Docket No. BCR-010WO MODIFIED OLIGONUCLEOTIDES AND METHODS OF USE THEREOF CROSS-REFERENCE
[0001] This application claims the benefit of and priority to U.S. Provisional Patent Application No.63 / 595,949, filed November 3, 2023, the disclosure of which is hereby incorporated by reference in its entirety herein. SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing XML which has been submitted electronically and is hereby incorporated by reference in its entirety. Said XML copy, created on Month XX, 20XX, is named XXXXX, and is XXX,XXX bytes in size. FIELD OF THE INVENTION
[0001] The disclosure relates to conjugates of double stranded compounds, including oligonucleotides such as siRNA, that comprise one or more modified nucleotide components. SUMMARY
[0002] The present disclosure is based, in part, on double-stranded compounds comprising one or more modified nucleotide components (e.g., one or more independent occurrences of Formula (I), Formula (II), Formula (III), or Formula (IV) as described herein) as therapeutic payloads, and methods of use thereof. In certain embodiments, one or more of the modified nucleotide components are incorporated into the sense strand or the antisense strand of the present double-stranded compounds to induce seed-pairing destabilization (e.g., at position AS6 or AS7) to selectively destabilize off-target binding while maintaining on-target potency in vivo. In some embodiments, one or more of the modified nucleotide components are incorporated into the sense strand or the antisense strand to improve the resistance of the double-stranded compound to nuclease degradation (e.g., 3’-nuclease or 5’-nuclease degradation). Furthermore, the conjugates described herein, in certain embodiments, are contemplated as useful for the targeted delivery of oligonucleotide therapeutics to inhibit the expression of a gene (e.g., expression of a gene described herein) for the treatment of various disorders. 1 IPTS / 128755678.3Attorney Docket No. BCR-010WO
[0003] Accordingly, in one aspect, the disclosure provides a double-stranded compound comprising a sense strand and an antisense strand, wherein the sense strand or the antisense strand comprises one or more independent occurrences of: (a) a modified nucleotide component represented by Formula (I): O B1 ;(b) a modified nucleotide component represented by Formula (IIa) or Formula (IIb):(c) a modified nucleotide component represented by Formula (III): or
[0004] (d) a modified nucleotide component represented by Formula (IV): IPTS / 128755678.3Attorney Docket No. BCR-010WO Formula (IV)
[0005] wherein: each of B1, B2, B3, and B4is a nucleobase; R1and R2are taken together to the carbon to which they are attached to form optionally substituted C3–6cycloalkyl; and R3is selected from the group consisting of hydrogen and C1–6 alkyl.
[0006] In another aspect, provided herein is a pharmaceutical composition comprising a double-stranded compound described herein and a pharmaceutically acceptable excipient.
[0007] Furthermore, in another aspect, disclosed herein is a method of treating a disorder (e.g., a disorder described herein) in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a double-stranded compound described herein.
[0008] Furthermore, in an additional aspect, described herein is method of treating a disease mediated by expression of ANGPTL3 or AGT in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a double-stranded compound described herein. BRIEF DESCRIPTION OF THE DRAWINGS
[0009] FIG.1 depicts the percent of inhibition of ANGPTL3 mRNA in primary human hepatocytes (PHH) after free uptake with modified siRNA L96 GalNAc conjugates of a certain oligonucleotide sequencece.
[0010] FIG.2 depicts the percent of inhibition of ANGPTL3 mRNA in primary human hepatocytes (PHH) ) after free uptake with modified siRNA L96 GalNAc conjugates of a certain oligonucleotide sequence.
[0011] FIG.3 depicts the knockdown of ANGPTL3 mRNA in mice dosed with 1 mg / kg unmodified or modified siRNA L96 GalNAc conjugates of a certain oligonucleotide sequence.
[0012] FIG.4 depicts the knockdown of ANGPTL3 mRNA in mice dosed with 1 mg / kg unmodified or modified siRNA L96 GalNAc conjugates of a certain oligonucleotide sequence. 3 IPTS / 128755678.3Attorney Docket No. BCR-010WO
[0013] FIG.5 depicts the 3’-nuclease stability of certain modified oligonucleotide sequences.
[0014] FIG.6 depicts the 5’-nuclease stability of certain modified oligonucleotide sequences.
[0015] FIG.7 depicts an exemplary comparison of AGT mRNA reduction in wild- type mice hydrodynamic injected with DNA plasmid dosed with 1 or 3 mg / kg modified siRNA L96 GalNAc conjugates as compared to a PBS control.
[0016] FIG.8. depicts differential gene expression in primary human hepatocytes (PHH) after free uptake of modified siRNA L96 GalNAc conjugates.
[0017] FIG.9 depicts the percent of inhibition of ANGPTL3 mRNA in primary human hepatocytes (PHH) after free uptake with unmodified or 2’-spirocyclopropyl-modified siRNAs of a certain oligonucleotide sequence.
[0018] FIG.10 depicts the percent of inhibition of ANGPTL3 mRNA in primary human hepatocytes (PHH) after free uptake with unmodified or 2’-spirocyclopropyl-modified siRNAs of a certain oligonucleotide sequence.
[0019] FIG.11 depicts an exemplary comparison of ANGPTL3 reduction in wild- type mice for 2’-spirocyclopropyl-modified siRNAs dosed at 1 mg / kg as compared to a PBS control.
[0020] FIG.12 depicts an exemplary comparison of ANGPTL3 reduction in wild- type mice for 2’-spirocyclopropyl-modified siRNAs dosed at 1 mg / kg as compared to a PBS control.
[0021] FIGS.13A, 13B, 13C, 13D, 13E, 13F, 13G, 13H, 13I, and 13J show percent inhibition INHBE dose-response plots of exemplary siRNA compounds from Table 14. DETAILED DESCRIPTION
[0022] The details of one or more embodiments of the invention are set forth in the description below. Other features, objects, and advantages of the invention will be apparent from the description, the drawings, and from the claims. Definitions 4 IPTS / 128755678.3Attorney Docket No. BCR-010WO
[0023] As used herein, all numerical values or numerical ranges comprise whole integers within or encompassing such ranges and fractions of the values or the integers within or encompassing ranges unless the context clearly indicates otherwise. Thus, for example, reference to a range of 90-100%, comprises 91%, 92%, 93%, 94%, 95%, 95%, 97%, etc., as well as 91.1%, 91.2%, 91.3%, 91.4%, 91.5%, etc., 92.1%, 92.2%, 92.3%, 92.4%, 92.5%, etc., and so forth. In another example, reference to a range of 1-5,000-fold comprises 1-, 2-, 3-, 4- , 5-, 6-, 7-, 8-, 9-, 10-, 11-, 12-, 13-, 14-, 15-, 16-, 17-, 18-, 19-, or 20-fold, etc., as well as 1.1-, 1.2-, 1.3-, 1.4-, or 1.5-fold, etc., 2.1-, 2.2-, 2.3-, 2.4-, or 2.5-fold, etc., and so forth.
[0024] The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element, e.g., a plurality of elements.
[0025] Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context.
[0026] The term “including” is used herein to mean, and is used interchangeably with, the phrase “including but not limited to”.
[0027] The term “about” is used herein to mean within the typical ranges of tolerances in the art. For example, “about” can be understood as about 2 standard deviations from the mean. In certain embodiments, about means ±10%. In certain embodiments, about means ±5%. When about is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range
[0028] The term “at least” prior to a number or series of numbers is understood to include the number adjacent to the term “at least”, and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, “at least 19 nucleotides of a 21 nucleotide nucleic acid molecule” means that 19, 20, or 21 nucleotides have the indicated property. When at least is present before a series of numbers or a range, it is understood that “at least” can modify each of the numbers in the series or range.
[0029] As used herein, “no more than” or “less than” is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. For example, a duplex with an overhang of “no more than 2 nucleotides” has a 2, 1, or 0 nucleotide overhang. When “no more than” is present before a series of numbers or a range, it is 5 IPTS / 128755678.3Attorney Docket No. BCR-010WO understood that “no more than” can modify each of the numbers in the series or range. As used herein, ranges include both the upper and lower limit.
[0030] "G," "C," "A" and "U" each generally stand for a nucleotide that contains guanine, cytosine, adenine, and uracil as a base, respectively. “T” and “dT” are used interchangeably herein and refer to a deoxyribonucleotide wherein the nucleobase is thymine, e.g., deoxyribothymine. However, it will be understood that the term “ribonucleotide” or “nucleotide” or “deoxyribonucleotide” can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety. The skilled person is well aware that guanine, cytosine, adenine, and uracil may be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base may base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine may be replaced in the nucleotide sequences of the disclosure by a nucleotide containing, for example, inosine. Sequences comprising such replacement moieties are embodiments of the disclosure.
[0031] “ANGPTL3” refers to the Angiopoietin-like 3 gene. According to the NCBI NLM website, this gene encodes a secreted protein that functions in angiogenesis. The encoded protein, which is expressed predominantly in the liver, is further processed into an N-terminal coiled-coil domain-containing chain and a C-terminal fibrinogen chain. The N-terminal chain is important for lipid metabolism, while the C-terminal chain may be involved in angiogenesis. Mutations in this gene cause familial hypobetalipoproteinemia type 2. Diseases associated with ANGPTL3 include Hypobetalipoproteinemia, Familial, 2 and Hypobetalipoproteinemia, Familial, 1. A human ANGPTL3 mRNA sequence is GenBank accession number NM_014495.4. A rhesus monkey (Macaca mulatta) ANGPTL3 mRNA sequence is GenBank accession number XM_015141187.2; a dog (Canis familiaris) ANGPTL3 mRNA sequence is GenBank accession number XM_038666015.1. A mouse (Mus musculus) mRNA sequence is GenBank accession number NM_013913.4.
[0032] As used herein, “target sequence” refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a gene (e.g., a gene described herein), including mRNA that is a product of RNA processing of a primary transcription product.
[0033] As used herein, the term “strand comprising a sequence” refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature. 6 IPTS / 128755678.3Attorney Docket No. BCR-010WO
[0034] As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person.
[0035] For example, a first nucleotide sequence can be described as complementary to a second nucleotide sequence when the two sequences hybridize (e.g., anneal) under stringent hybridization conditions. Hybridization conditions include temperature, ionic strength, pH, and organic solvent concentration for the annealing and / or washing steps. The term stringent hybridization conditions refers to conditions under which a first nucleotide sequence will hybridize preferentially to its target sequence, e.g., a second nucleotide sequence, and to a lesser extent to, or not at all to, other sequences. Stringent hybridization conditions are sequence dependent, and are different under different environmental parameters. Generally, stringent hybridization conditions are selected to be about 5 °C lower than the thermal melting point (Tm) for the nucleotide sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the first nucleotide sequences hybridize to a perfectly matched target sequence. An extensive guide to the hybridization of nucleic acids is found in, e.g., Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology--Hybridization with Nucleic Acid Probes part I, chap. 2, “Overview of principles of hybridization and the strategy of nucleic acid probe assays,” Elsevier, N.Y. (“Tijssen”).
[0036] Other conditions, such as physiologically relevant conditions as may be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.
[0037] This includes base-pairing of the oligonucleotide or polynucleotide comprising the first nucleotide sequence to the oligonucleotide or polynucleotide comprising the second nucleotide sequence over the entire length of the first and second nucleotide sequence. Such sequences can be referred to as “fully complementary” with respect to each other herein. However, where a first sequence is referred to as “substantially complementary” with respect to a second sequence herein, the two sequences can be fully complementary, or they may form one or more, but generally not more than 4, 3 or 2 mismatched base pairs upon hybridization, while retaining the ability to hybridize under the conditions most relevant to 7 IPTS / 128755678.3Attorney Docket No. BCR-010WO their ultimate application. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, may yet be referred to as “fully complementary” for the purposes described herein.
[0038] “Complementary” sequences, as used herein, may also include, or be formed entirely from, non-Watson-Crick base pairs and / or base pairs formed from non-natural and modified nucleotides, in as far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs includes, but not limited to, G:U Wobble or Hoogsteen base pairing.
[0039] The terms “complementary,” “fully complementary” and “substantially complementary” herein may be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of a dsRNA and a target sequence, as will be understood from the context of their use.
[0040] As used herein, a polynucleotide that is “substantially complementary to at least part of” a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding a gene described herein) including a 5’ UTR, an open reading frame (ORF), or a 3’ UTR. For example, a polynucleotide is complementary to at least a part of an a gene described herein mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding a gene described herein.
[0041] In one embodiment, the antisense strand of the dsRNA is sufficiently complementary to a target mRNA so as to cause cleavage of the target mRNA.
[0042] The term “double-stranded RNA” or “dsRNA,” as used herein, refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary, as defined above, nucleic acid strands. In general, the majority of nucleotides of each strand are ribonucleotides, but as described in detail herein, each or both strands can also include at least one non-ribonucleotide, e.g., a deoxyribonucleotide and / or a modified nucleotide. In addition, as used in this specification, “dsRNA” may include chemical modifications to ribonucleotides, including substantial modifications at multiple nucleotides and including all types of modifications disclosed herein or known in the 8 IPTS / 128755678.3Attorney Docket No. BCR-010WO art. Any such modifications, as used in an siRNA type molecule, are encompassed by “dsRNA” for the purposes of this specification and claims.
[0043] The two strands forming the duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA molecules. Where the two strands are part of one larger molecule, and therefore are connected by an uninterrupted chain of nucleotides between the 3’-end of one strand and the 5’-end of the respective other strand forming the duplex structure, the connecting RNA chain is referred to as a “hairpin loop.” Where the two strands are connected covalently by means other than an uninterrupted chain of nucleotides between the 3’-end of one strand and the 5’-end of the respective other strand forming the duplex structure, the connecting structure is referred to as a “linker.” The RNA strands may have the same or a different number of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of the dsRNA minus any overhangs that are present in the duplex. In addition to the duplex structure, a dsRNA may comprise one or more nucleotide overhangs. The term “siRNA” is also used herein to refer to a dsRNA as described above.
[0044] As used herein, a “nucleotide overhang” refers to the unpaired nucleotide or nucleotides that protrude from the duplex structure of a dsRNA when a 3'-end of one strand of the dsRNA extends beyond the 5'-end of the other strand, or vice versa. “Blunt” or “blunt end” means that there are no unpaired nucleotides at that end of the dsRNA, i.e., no nucleotide overhang. A “blunt ended” dsRNA is a dsRNA that is double-stranded over its entire length, i.e., no nucleotide overhang at either end of the molecule.
[0045] The term “antisense strand” refers to the strand of a dsRNA which includes a region that is substantially complementary to a target sequence. As used herein, the term “region of complementarity” refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches are most tolerated in the terminal regions and, if present, are generally in a terminal region or regions, e.g., within 6, 5, 4, 3, or 2 nucleotides of the 5’ and / or 3’ terminus.
[0046] The term “sense strand,” as used herein, refers to the strand of a dsRNA that includes a region that is substantially complementary to a region of the antisense strand.
[0047] “Introducing into a cell,” when referring to a compound of the disclosure (e.g., a double-stranded compound described herein), means facilitating uptake or absorption into the cell, as is understood by those skilled in the art. Absorption or uptake of dsRNA can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. The 9 IPTS / 128755678.3Attorney Docket No. BCR-010WO meaning of this term is not limited to cells in vitro; a dsRNA may also be "introduced into a cell,” wherein the cell is part of a living organism. In such instance, introduction into the cell will include the delivery to the organism. For example, for in vivo delivery, dsRNA can be injected into a tissue site or administered systemically. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein or known in the art.
[0048] The terms “silence,” “inhibit the expression of,” “down-regulate the expression of,” “suppress the expression of” and the like in as far as they refer to a gene described herein, herein refer to the at least partial suppression of the expression of a gene described herein, as manifested by a reduction of the amount of mRNA which may be isolated from a first cell or group of cells in which a gene described herein is transcribed and which has or have been treated such that the expression of a gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or have not been so treated (control cells). The degree of inhibition is usually expressed in terms of (mRNAin control cells) - (mRNA in treated cells) •100 % (mRNAin control cells)
[0049] Alternatively, the degree of inhibition may be given in terms of a reduction of a parameter that is functionally linked to gene expression, e.g., the amount of protein encoded by a gene described herein which is secreted by a cell, the level of plasma lipid levels or the number of cells displaying a certain phenotype. In principle, gene silencing may be determined in any cell expressing the target, either constitutively or by genomic engineering, and by any appropriate assay. However, when a reference is needed in order to determine whether a given dsRNA inhibits the expression of a gene by a certain degree and therefore is encompassed by of the disclosure, the assays provided in the Examples below shall serve as such reference.
[0050] For example, in certain instances, expression of a gene described herein is suppressed by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by administration of the double-stranded oligonucleotide of the disclosure. In some embodiments, a gene described herein is suppressed by at least about 60%, 70%, or 80% by administration of the double-stranded oligonucleotide of the disclosure. In some embodiments, a gene described herein is suppressed by at least about 85%, 90%, or 95% by administration of the double- stranded of the disclosure. 10 IPTS / 128755678.3Attorney Docket No. BCR-010WO
[0051] A “subject” to which administration is contemplated includes, but is not limited to, humans (i.e., a male or female of any age group, e.g., a pediatric subject (e.g., infant, child, adolescent) or adult subject (e.g., young adult, middle–aged adult or senior adult)) and / or a non-human animal, e.g., a mammal such as primates (e.g., cynomolgus monkeys, rhesus monkeys), cattle, pigs, horses, sheep, goats, rodents, cats, and / or dogs. In certain embodiments, the subject is a human. In certain embodiments, the subject is a non-human animal. The terms “patient,” “individual,” and “subject” are used interchangeably herein.
[0052] As used herein, and unless otherwise specified, the terms “treat,” “treating” and “treatment” contemplate an action that occurs while a subject is suffering from the specified disease, disorder or condition, which reduces the severity of the disease, disorder or condition, or retards or slows the progression of the disease, disorder or condition. In an alternative embodiment, the present disclosure contemplates administration of the compounds described herein as a prophylactic before a subject begins to suffer from the specified disease, disorder or condition.
[0053] In general, the “effective amount” of a compound as used herein refers to an amount sufficient to elicit the desired biological response. As will be appreciated by those of ordinary skill in this art, the effective amount of a compound of the present disclosure (e.g., a double-stranded compound described herein) may vary depending on such factors as the desired biological endpoint, the pharmacokinetics of the compound, the disease being treated, the mode of administration, and the age, health, and condition of the subject.
[0054] As used herein, and unless otherwise specified, a “therapeutically effective amount” of a compound is an amount sufficient to provide a therapeutic benefit in the treatment of a disease, disorder or condition, or to delay or minimize one or more symptoms associated with the disease, disorder or condition. A therapeutically effective amount of a compound means an amount of therapeutic agent, alone or in combination with other therapies, which provides a therapeutic benefit in the treatment of the disease, disorder or condition. The term “therapeutically effective amount” can encompass an amount that improves overall therapy, reduces or avoids symptoms or causes of disease or condition, or enhances the therapeutic efficacy of another therapeutic agent.
[0055] As used herein, a “pharmaceutical composition” comprises a pharmacologically effective amount of a compound described herein and a pharmaceutically acceptable excipient or a pharmaceutically acceptable carrier.
[0056] The term “pharmaceutically acceptable carrier” refers to a carrier for administration of a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, 11 IPTS / 128755678.3Attorney Docket No. BCR-010WO dextrose, water, glycerol, ethanol, and combinations thereof. The term specifically excludes cell culture medium. For drugs administered orally, pharmaceutically acceptable carriers include, but are not limited to pharmaceutically acceptable excipients such as inert diluents, disintegrating agents, binding agents, lubricating agents, sweetening agents, flavoring agents, coloring agents and preservatives. Suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrating agents. Chemical Definitions
[0057] Definitions of specific functional groups and chemical terms are described in more detail below. The chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75thEd., inside cover, and specific functional groups are generally defined as described therein. Additionally, general principles of organic chemistry, as well as specific functional moieties and reactivity, are described in Thomas Sorrell, Organic Chemistry, University Science Books, Sausalito, 1999; Smith and March, March’s Advanced Organic Chemistry, 5thEdition, John Wiley & Sons, Inc., New York, 2001; Larock, Comprehensive Organic Transformations, VCH Publishers, Inc., New York, 1989; and Carruthers, Some Modern Methods of Organic Synthesis, 3rdEdition, Cambridge University Press, Cambridge, 1987.
[0058] When a range of values is listed, it is intended to encompass each value and sub– range within the range. For example “C1–6 alkyl” is intended to encompass, C1, C2, C3, C4, C5, C6, C1–6, C1–5, C1–4, C1–3, C1–2, C2–6, C2–5, C2–4, C2–3, C3–6, C3–5, C3–4, C4–6, C4–5, and C5–6alkyl.
[0059] The term “alkyl” as used herein refers to a radical of a straight–chain or branched saturated hydrocarbon group. In some embodiments, an alkyl group has 1 to 12 carbon atoms (“C1–12 alkyl”). In some embodiments, an alkyl group has 1 to 10 carbon atoms (“C1–10 alkyl”). In some embodiments, an alkyl group has 1 to 9 carbon atoms (“C1–9alkyl”). In some embodiments, an alkyl group has 1 to 8 carbon atoms (“C1–8 alkyl”). In some embodiments, an alkyl group has 1 to 7 carbon atoms (“C1–7alkyl”). In some embodiments, an alkyl group has 1 to 6 carbon atoms (“C1–6 alkyl”, also referred to herein as “lower alkyl”). In some embodiments, an alkyl group has 1 to 5 carbon atoms (“C1–5alkyl”). In some embodiments, an alkyl group has 1 to 4 carbon atoms (“C1–4 alkyl”). In some embodiments, an alkyl group has 1 to 3 carbon atoms (“C1–3alkyl”). In some embodiments, an alkyl group 12 IPTS / 128755678.3Attorney Docket No. BCR-010WO has 1 to 2 carbon atoms (“C1–2alkyl”). In some embodiments, an alkyl group has 1 carbon atom (“C1alkyl”). In some embodiments, an alkyl group has 2 to 6 carbon atoms (“C2–6alkyl”). Examples of C1–6 alkyl groups include methyl (C1), ethyl (C2), n–propyl (C3), isopropyl (C3), n–butyl (C4), tert–butyl (C4), sec–butyl (C4), iso–butyl (C4), n–pentyl (C5), 3– pentanyl (C5), amyl (C5), neopentyl (C5), 3–methyl–2–butanyl (C5), tertiary amyl (C5), and n– hexyl (C6). Additional examples of alkyl groups include n–heptyl (C7), n–octyl (C8) and the like. Common alkyl abbreviations include Me (-CH3), Et (-CH2CH3), iPr (-CH(CH3)2), nPr (- CH2CH2CH3), n-Bu (-CH2CH2CH2CH3), or i-Bu (-CH2CH(CH3)2).
[0060] The term “alkylene” as used herein refers to a divalent radical of a straight–chain or branched saturated hydrocarbon group. In some embodiments, an alkylene group has 1 to 12 carbon atoms (“C1–12 alkylene”). In some embodiments, an alkylene group has 1 to 10 carbon atoms (“C1–10 alkylene”). In some embodiments, an alkylene group has 1 to 9 carbon atoms (“C1–9 alkylene”). In some embodiments, an alkylene group has 1 to 8 carbon atoms (“C1–8 alkylene”). In some embodiments, an alkylene group has 1 to 7 carbon atoms (“C1–7 alkylene”). In some embodiments, an alkylene group has 1 to 6 carbon atoms (“C1–6 alkylene”, also referred to herein as “lower alkylene”). In some embodiments, an alkylene group has 1 to 5 carbon atoms (“C1–5alkylene”). In some embodiments, an alkylene group has 1 to 4 carbon atoms (“C1–4 alkylene”). In some embodiments, an alkylene group has 1 to 3 carbon atoms (“C1–3alkylene”). In some embodiments, an alkylene group has 1 to 2 carbon atoms (“C1–2 alkylene”). In some embodiments, an alkyl group has 1 carbon atom (“C1 alkylene”).
[0061] The term “cycloalkyl” as used herein refers to a radical of a saturated or partially unsaturated cyclic hydrocarbon group having from 3 to 10 ring carbon atoms (“C3–10cycloalkyl”) and zero heteroatoms in the ring system. In some embodiments, a cycloalkyl group has 3 to 8 ring carbon atoms (“C3–8cycloalkyl”). In some embodiments, a cycloalkyl group has 3 to 6 ring carbon atoms (“C3–6 cycloalkyl”). In some embodiments, a cycloalkyl group has 3 to 6 ring carbon atoms (“C3–6 cycloalkyl”). In some embodiments, a cycloalkyl group has 5 to 10 ring carbon atoms (“C5–10cycloalkyl”). Exemplary C3–6cycloalkyl groups include, without limitation, cyclopropyl (C3), cyclopropenyl (C3), cyclobutyl (C4), cyclobutenyl (C4), cyclopentyl (C5), cyclopentenyl (C5), cyclohexyl (C6), cyclohexenyl (C6), cyclohexadienyl (C6), and the like. Exemplary C3–8 cycloalkyl groups include, without limitation, the aforementioned C3–6cycloalkyl groups as well as cycloheptyl (C7), cycloheptenyl (C7), cycloheptadienyl (C7), cycloheptatrienyl (C7), cyclooctyl (C8), cyclooctenyl (C8), bicyclo[2.2.1]heptanyl (C7), bicyclo[2.2.2]octanyl (C8), and the like. 13 IPTS / 128755678.3Attorney Docket No. BCR-010WO Exemplary C3–10cycloalkyl groups include, without limitation, the aforementioned C3–8cycloalkyl groups as well as cyclononyl (C9), cyclononenyl (C9), cyclodecyl (C10), cyclodecenyl (C10), octahydro–1H–indenyl (C9), decahydronaphthalenyl (C10), spiro[4.5]decanyl (C10), and the like. As the foregoing examples illustrate, in certain embodiments, the cycloalkyl group is either monocyclic (“monocyclic cycloalkyl”) or contain a fused, bridged or spiro ring system such as a bicyclic system (“bicyclic cycloalkyl”). “Cycloalkyl” also includes ring systems wherein the cycloalkyl ring, as defined above, is fused with one or more aryl or heteroaryl groups wherein the point of attachment is on the cycloalkyl ring or the one or more aryl or heteroaryl groups, and in such instances, the number of carbons continue to designate the number of carbons in the cycloalkyl ring system.
[0062] The term “aryl” as used herein refers to a radical of a monocyclic or polycyclic (e.g., bicyclic or tricyclic) 4n+2 aromatic ring system (e.g., having 6, 10, or 14 π electrons shared in a cyclic array) having 6 to 14 ring carbon atoms and zero heteroatoms provided in the aromatic ring system (“C6–14 aryl”). In some embodiments, an aryl group has six ring carbon atoms (“C6 aryl”; e.g., phenyl). In some embodiments, an aryl group has ten ring carbon atoms (“C10 aryl”; e.g., naphthyl such as 1–naphthyl and 2–naphthyl). In some embodiments, an aryl group has fourteen ring carbon atoms (“C14aryl”; e.g., anthracyl). Typical aryl groups include, but are not limited to, groups derived from aceanthrylene, acenaphthylene, acephenanthrylene, anthracene, azulene, benzene, chrysene, coronene, fluoranthene, fluorene, hexacene, hexaphene, hexalene, as-indacene, s-indacene, indane, indene, naphthalene, octacene, octaphene, octalene, ovalene, penta-2,4-diene, pentacene, pentalene, pentaphene, perylene, phenalene, phenanthrene, picene, pleiadene, pyrene, pyranthrene, rubicene, triphenylene, and trinaphthalene. Particularly aryl groups include phenyl, naphthyl, indenyl, and tetrahydronaphthyl.
[0063] The term “heteroaryl” as used herein refers to a radical of a 5 to 10 membered monocyclic or bicyclic 4n+2 aromatic ring system (e.g., having 6 or 10 π electrons shared in a cyclic array) having ring carbon atoms and 1 to 4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen and sulfur (“5 to 10 membered heteroaryl”). In heteroaryl groups that contain one or more nitrogen atoms, the point of attachment can be a carbon or nitrogen atom, as valency permits. Heteroaryl bicyclic ring systems can include one or more heteroatoms in one or both rings. “Heteroaryl” also includes ring systems wherein the heteroaryl ring, as defined above, is fused with one or more aryl groups wherein the point of attachment is either on the aryl or heteroaryl ring, and in such instances, the number of ring members designates the number of 14 IPTS / 128755678.3Attorney Docket No. BCR-010WO ring members in the fused (aryl / heteroaryl) ring system. Bicyclic heteroaryl groups wherein one ring does not contain a heteroatom (e.g., indolyl, quinolinyl, carbazolyl, and the like) the point of attachment can be on either ring, i.e., either the ring bearing a heteroatom (e.g., 2– indolyl) or the ring that does not contain a heteroatom (e.g., 5–indolyl).
[0064] In some embodiments, a heteroaryl group is a 5 to 10 membered aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5 to 10 membered heteroaryl”). In some embodiments, a heteroaryl group is a 5 to 8 membered aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5 to 8 membered heteroaryl”). In some embodiments, a heteroaryl group is a monocyclic 5 to 6 membered aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5 to 6 membered heteroaryl”). In some embodiments, the 5 to 6 membered heteroaryl has 1 to 3 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments, the 5 to 6 membered heteroaryl has 1 to 2 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments, the 5 to 6 membered heteroaryl has 1 ring heteroatom selected from nitrogen, oxygen, and sulfur. In some embodiments, a heteroaryl group is a monocyclic 5 membered aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5- membered heteroaryl”). In some embodiments, a heteroaryl group is a monocyclic 6 membered aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“6-membered heteroaryl”).
[0065] Exemplary 5–membered heteroaryl groups containing one heteroatom include, without limitation, pyrrolyl, furanyl and thiophenyl. Exemplary 5-membered heteroaryl groups containing two heteroatoms include, without limitation, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, and isothiazolyl. Exemplary 5-membered heteroaryl groups containing three heteroatoms include, without limitation, triazolyl, oxadiazolyl, and thiadiazolyl. Exemplary 5–membered heteroaryl groups containing four heteroatoms include, without limitation, tetrazolyl. Exemplary 6–membered heteroaryl groups containing one heteroatom include, without limitation, pyridinyl. Exemplary 6–membered heteroaryl groups containing two heteroatoms include, without limitation, pyridazinyl, pyrimidinyl, and 15 IPTS / 128755678.3Attorney Docket No. BCR-010WO pyrazinyl. Exemplary 6–membered heteroaryl groups containing three or four heteroatoms include, without limitation, triazinyl and tetrazinyl, respectively. Exemplary 7–membered heteroaryl groups containing one heteroatom include, without limitation, azepinyl, oxepinyl, and thiepinyl. Exemplary 5,6–bicyclic heteroaryl groups include, without limitation, indolyl, isoindolyl, indazolyl, benzotriazolyl, benzothiophenyl, isobenzothiophenyl, benzofuranyl, benzoisofuranyl, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzoxadiazolyl, benzthiazolyl, benzisothiazolyl, benzthiadiazolyl, indolizinyl, and purinyl. Exemplary 6,6– bicyclic heteroaryl groups include, without limitation, naphthyridinyl, pteridinyl, quinolinyl, isoquinolinyl, cinnolinyl, quinoxalinyl, phthalazinyl, and quinazolinyl.
[0066] In certain embodiments, compounds described herein are pharmaceutically acceptable salts. As used herein, the term “pharmaceutically acceptable salt” refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, Berge et al., describes pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences (1977) 66:1–19. Pharmaceutically acceptable salts of the compounds of the present disclosure include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2–hydroxy–ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2–naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3–phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p–toluenesulfonate, undecanoate, valerate salts, and the like. Pharmaceutically acceptable salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium and N+(C1–4alkyl)4salts. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharmaceutically acceptable salts include, when 16 IPTS / 128755678.3Attorney Docket No. BCR-010WO appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, lower alkyl sulfonate, and aryl sulfonate. Double-Stranded Compounds
[0067] In one aspect, the disclosure provides a double-stranded compound comprising a sense strand and an antisense strand, wherein the sense strand or the antisense strand comprises one or more independent occurrences of: (a) a modified nucleotide component represented by Formula (I): O B1 ;(b) a modified nucleotide component represented by Formula (IIa) or Formula (IIb):(c) a modified nucleotide component represented by Formula (III): or(d) a modified nucleotide component represented by Formula (IV): 17 IPTS / 128755678.3Attorney Docket No. BCR-010WOwherein: each of B1, B2, B3, and B4is a nucleobase; R1and R2are taken together to the carbon to which they are attached to form optionally substituted C3–6 cycloalkyl; and R3is selected from the group consisting of hydrogen and C1–6alkyl.
[0068] In some embodiments, each of B1, B2, B3, and B4is independently selected from the group consisting of adenine, uracil, thymine, cytosine, guanine, and modified analogs thereof. In some embodiments, each of B1, B2, B3, and B4is independently selected from uracil, cytosine, and modified analogs thereof. In some embodiments, R1and R2, taken together with the carbon atom to which they are attached, form cyclopropyl. In some embodiments, R3is C1–6alkyl. In some embodiments, R3is -CH3.
[0069] In some embodiments, only the sense strand comprises the one or more independent occurrences of the modified nucleotide component of Formula (I), the modified nucleotide component of Formula (II), the modified nucleotide component of Formula (III), or the modified nucleotide of Formula (IV). In some embodiments, only the antisense strand comprises the one or more independent occurrences of the modified nucleotide component of Formula (I), the modified nucleotide component of Formula (II), the modified nucleotide component of Formula (III), or the modified nucleotide component of Formula (IV). In some embodiments, each of the sense strand and the antisense strand comprises one or more independent occurrences of the modified nucleotide component of Formula (I), the modified nucleotide component of Formula (II), the modified nucleotide component of Formula (III), or the modified nucleotide component of Formula (IV).
[0070] In some embodiments, the sense strand comprises at least one modified nucleotide component selected from the group consisting of a 2'-deoxy-2'-fluoro modified nucleotide component, a 2'-deoxy-modified nucleotide component, a locked nucleotide, an abasic nucleotide, a 2’-amino-modified nucleotide component, a 2’-alkyl-modified nucleotide component, a morpholinonucleotide, a phosphoramidate, and a non-natural base comprising nucleotide. In some embodiments, the antisense strand comprises at least one modified 18 IPTS / 128755678.3Attorney Docket No. BCR-010WO nucleotide component selected from the group consisting of a 2'-deoxy-2'-fluoro modified nucleotide component, a 2'-deoxy-modified nucleotide component, a locked nucleotide, an abasic nucleotide, a 2’-amino-modified nucleotide component, a 2’-alkyl-modified nucleotide component, a morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide. In some embodiments, the sense strand comprises at least one internucleoside linkage selected from the group consisting of a phosphorothioate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoromorpholidate linkage, a phosphoropiperazidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage. In some embodiments, the antisense strand comprises at least one internucleoside linkage selected from the group consisting of a phosphorothioate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoromorpholidate linkage, a phosphoropiperazidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage.
[0071] In some embodiments, the sense strand comprises a sequence of at least 15 contiguous nucleotides (e.g., 15 to 25 contiguous nucleotides or 20 to 24 contiguous nucleotides) comprising the one or more independent occurrences of the modified nucleotide component of Formula (I), the modified nucleotide component of Formula (II), the modified nucleotide component of Formula (III), or the modified nucleotide component of Formula (IV). In some embodiments, the sense strand comprises a sequence of 21 contiguous nucleotides comprising the one or more independent occurrences of the modified nucleotide component of Formula (I), the modified nucleotide component of Formula (II), the modified nucleotide component of Formula (III), or the modified nucleotide component of Formula (IV). In some embodiments, the antisense strand comprises a sequence of at least 15 contiguous nucleotides (e.g., 15 to 25 contiguous nucleotides or 20 to 24 contiguous nucleotides) comprising the one or more independent occurrences of the modified nucleotide component of Formula (I), the modified nucleotide component of Formula (II), the modified nucleotide component of 19 IPTS / 128755678.3Attorney Docket No. BCR-010WO Formula (III), or the modified nucleotide component of Formula (IV). In some embodiments, the antisense strand comprises a sequence of 23 contiguous nucleotides comprising the one or more independent occurrences of the modified nucleotide component of Formula (I), the modified nucleotide component of Formula (II), the modified nucleotide component of Formula (III), or the modified nucleotide component of Formula (IV). In some embodiments, the sequence shares at least 80% identity (e.g., at least 90% identity, at least 95% identity, or at least 99% identity) with an equal length portion of SEQ ID NO: 1, SEQ ID NO: 18, SEQ ID NO: 30, SEQ ID NO: 36, SEQ ID NO: 44, SEQ ID NO: 54, SEQ ID NO: 71, SEQ ID NO: 80, SEQ ID NO: 85, SEQ ID NO: 93, or SEQ ID NO: 91.
[0072] In some embodiments, the modified nucleotide component is represented by Formula (III-a):wherein n is from 1 to 3. In some embodiments, n is 1.
[0073] In some embodiments, the double-stranded compound further comprises a ligand or targeting moiety. In some embodiments, the ligand or targeting moiety is conjugated to the 5’ end, 3’ end or both ends of the dsRNA. In some embodiments, the ligand or targeting moiety is conjugated to the 3’ end of the sense strand of the dsRNA. In some embodiments, the ligand or targeting moiety comprises at least one N-Acetyl-Galactosamine (GalNAc). In some embodiments, the ligand or targeting moiety is L96. In some embodiments, the ligand or targeting moiety is represented by Formula (A): 20 IPTS / 128755678.3Attorney Docket No. BCR-010WOor a pharmaceutically acceptable salt thereof, wherein: A1is the point of attachment to the double-stranded compound; each occurrence of T1and T2is independently selected from 5- membered heterocyclyl and alkylene; each occurrence of X is selected from the group consisting of -OH and -SH; and each occurrence of L is a linker; LAis absent or a linker; and n is an integer from 1 to 6. In some embodiments, the ligand or targeting moiety is tri- GalNAc6.
[0074] In other embodiments, a double-stranded compound described herein comprises a sense strand and an antisense strand, wherein the sense strand or the antisense strand comprises one or more independent occurrences of: (a) a modified nucleotide component represented by Formula (I): OB1; IPTS / 128755678.3Attorney Docket No. BCR-010WO Formula (I) (b) a modified nucleotide component represented by Formula (II): or(c) a modified nucleotide component represented by Formula (IV):wherein: each of B1, B2, and B4is a nucleobase; and R3is selected from the group consisting of hydrogen and C1–6 alkyl.
[0075] In some embodiments, R3is C1–6 alkyl. In some embodiments, R3is -CH3. In some embodiments, each of B1and B2is selected from the group consisting of adenine, uracil, cytosine, guanine, and modified analogs thereof. In some embodiments, each of B1and B2is selected from uracil and cytosine.
[0076] In some embodiments, only the sense strand comprises the one or more independent occurrences of the modified nucleotide component of Formula (I) or the modified nucleotide component of Formula (II). In some embodiments, only the antisense strand comprises the one or more independent occurrences of the modified nucleotide component of Formula (I) or the modified nucleotide component of Formula (II). In some embodiments, each of the sense strand and the antisense strand comprises one or more independent occurrences of the modified nucleotide component of Formula (I), the modified nucleotide component of Formula (II), or the modified nucleotide component of Formula (IV). 22 IPTS / 128755678.3Attorney Docket No. BCR-010WO
[0077] In some embodiments, the sense strand comprises at least one modified nucleotide component selected from the group consisting of a 2'-deoxy-2'-fluoro modified nucleotide component, a 2'-deoxy-modified nucleotide component, a locked nucleotide, an abasic nucleotide, a 2’-amino-modified nucleotide component, a 2’-alkyl-modified nucleotide component, a morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide.
[0078] In some embodiments, the antisense strand comprises at least one modified nucleotide component selected from the group consisting of a 2'-deoxy-2'-fluoro modified nucleotide component, a 2'-deoxy-modified nucleotide component, a locked nucleotide, an abasic nucleotide, a 2’-amino-modified nucleotide component, a 2’-alkyl-modified nucleotide component, a morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide. In some embodiments, the sense strand comprises at least one internucleoside linkage selected from the group consisting of a phosphorothioate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoromorpholidate linkage, a phosphoropiperazidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage. In some embodiments, the antisense strand comprises at least one internucleoside linkage selected from the group consisting of a phosphorothioate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoromorpholidate linkage, a phosphoropiperazidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage.
[0079] In some embodiments, the sense strand comprises a sequence of at least 15 contiguous nucleotides (e.g., 15 to 25 contiguous nucleotides or 20 to 24 contiguous nucleotides) comprising the one or more independent occurrences of the modified nucleotide component of Formula (I), the modified nucleotide component of Formula (II), or the modified nucleotide component of Formula (IV). In some embodiments, the sense strand comprises a sequence of 21 contiguous nucleotides comprising the one or more independent occurrences 23 IPTS / 128755678.3Attorney Docket No. BCR-010WO of the modified nucleotide component of Formula (I), the modified nucleotide component of Formula (II), or the modified nucleotide component of Formula (IV). In some embodiments, the antisense strand comprises a sequence of at least 15 contiguous nucleotides (e.g., 15 to 25 contiguous nucleotides or 20 to 24 contiguous nucleotides) comprising the one or more independent occurrences of the modified nucleotide component of Formula (I), the modified nucleotide component of Formula (II), or the modified nucleotide component of Formula (IV). In some embodiments, the antisense strand comprises a sequence of 23 contiguous nucleotides comprising the one or more independent occurrences of the modified nucleotide component of Formula (I), the modified nucleotide component of Formula (II), or the modified nucleotide component of Formula (IV). In some embodiments, the sequence shares at least 80% identity (e.g., at least 90% identity, at least 95% identity, or at least 99% identity) with an equal length portion of SEQ ID NO: 1, SEQ ID NO: 18, SEQ ID NO: 30, SEQ ID NO: 36, SEQ ID NO: 44, SEQ ID NO: 54, SEQ ID NO: 71, SEQ ID NO: 80, SEQ ID NO: 85, SEQ ID NO: 93, or SEQ ID NO: 91.
[0080] In other embodiments, provided herein is a double-stranded compound comprising a sense strand and an antisense strand, wherein the sense strand or the antisense strand comprises one or more of: a modified nucleotide component represented by Formula (III):wherein: B3is a nucleobase; and R1and R2are taken together to the carbon to which they are attached form optionally substituted C3–6 cycloalkyl.
[0081] In some embodiments, each of B3and B4is selected from the group consisting of adenine, uracil, thymine, cytosine, guanine, and modified analogs thereof. In some embodiments, each of B3and B4is selected from uracil and cytosine. In some embodiments, R1and R2, taken together with the carbon atom to which they are attached, form cyclopropyl. In some embodiments, R3is C1–6 alkyl. In some embodiments, R3is -CH3. 24 IPTS / 128755678.3Attorney Docket No. BCR-010WO
[0082] In some embodiments, the modified nucleotide component is represented by Formula (III-a):wherein n is from 1 to 3. In some embodiments, n is 1.
[0083] In some embodiments, only the sense strand comprises the one or more independent occurrences of the modified nucleotide component of Formula (III). In some embodiments, only the antisense strand comprises the one or more independent occurrences of the modified nucleotide component of Formula (III). In some embodiments, each of the sense strand and the antisense strand comprises one or more independent occurrences of the modified nucleotide component of Formula (III).
[0084] In some embodiments, the sense strand comprises at least one modified nucleotide component selected from the group consisting of a 2'-deoxy-2'-fluoro modified nucleotide component, a 2'-deoxy-modified nucleotide component, a locked nucleotide, an abasic nucleotide, a 2’-amino-modified nucleotide component, a 2’-alkyl-modified nucleotide component, a morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide. In some embodiments, the antisense strand comprises at least one modified nucleotide component selected from the group consisting of a 2'-deoxy-2'-fluoro modified nucleotide component, a 2'-deoxy-modified nucleotide component, a locked nucleotide, an abasic nucleotide, a 2’-amino-modified nucleotide component, a 2’-alkyl-modified nucleotide component, a morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide. In some embodiments, the sense strand comprises at least one internucleoside linkage selected from the group consisting of a phosphorothioate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoromorpholidate linkage, a phosphoropiperazidate 25 IPTS / 128755678.3Attorney Docket No. BCR-010WO linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage. In some embodiments, the antisense strand comprises at least one internucleoside linkage selected from the group consisting of a phosphorothioate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoromorpholidate linkage, a phosphoropiperazidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage.
[0085] In some embodiments, the sense strand comprises a sequence of at least 15 contiguous nucleotides (e.g., 15 to 25 contiguous nucleotides or 20 to 24 contiguous nucleotides) comprising the one or more independent occurrences of the modified nucleotide component of Formula (III).
[0086] In some embodiments, the sense strand comprises a sequence of 21 contiguous nucleotides comprising the one or more independent occurrences of the modified nucleotide component of Formula (III). In some embodiments, the antisense strand comprises a sequence of at least 15 contiguous nucleotides (e.g., 15 to 25 contiguous nucleotides or 20 to 24 contiguous nucleotides) comprising the one or more independent occurrences of the modified nucleotide component of Formula (III). In some embodiments, the antisense strand comprises a sequence of 23 contiguous nucleotides comprising the one or more independent occurrences of the modified nucleotide component of Formula (III). In some embodiments, the sequence shares at least 80% identity (e.g., at least 90% identity, at least 95% identity, or at least 99% identity) with an equal length portion of SEQ ID NO: 1, SEQ ID NO: 18, SEQ ID NO: 30, SEQ ID NO: 36, SEQ ID NO: 44, SEQ ID NO: 54, SEQ ID NO: 71, SEQ ID NO: 80, SEQ ID NO: 85, SEQ ID NO: 93, or SEQ ID NO: 91.
[0087] Exemplary compounds of the disclosure also include, for example, those compounds disclosed in Tables 1, 2, 7, 8, 10, and 11, such as BCR-0000507, BCR-0000843, BCR- 0000844, BCR-0000845, BCR-0000846, BCR-0000847, BCR-0000848, BCR-0000849, BCR-0000850, BCR-0000851, BCR-0000852, BCR-0000853, BCR-0000854, BCR- 0000855, BCR-0000856, BCR-0000857, BCR-0000858, BCR-0000515, BCR-0000859, 26 IPTS / 128755678.3Attorney Docket No. BCR-010WO BCR-0000860, BCR-0000861, BCR-0000862, BCR-0000863, BCR-0000864, BCR- 0000865, BCR-0000542, BCR-0000838, BCR-0000839, BCR-0000840, BCR-0000841, BCR-0000842, BCR-0001044, BCR-0001045, BCR-0001046, BCR-0001047, BCR- 0001048, BCR-0001049, BCR-0001050, BCR-0000515, BCR-00001051, BCR-00001052, BCR-00001053, BCR-00001054, BCR-00001055, BCR-00001056, BCR-00001057, BCR- 00001058, and BCR-00001059.
[0088] The compounds provided herein can be administered as the sole active agent, or they can be administered in combination with other active agents. In some embodiments, the present invention provides a combination of a compound of the present invention and another pharmacologically active agent. Administration in combination can proceed by any technique apparent to those of skill in the art including, for example, separate, sequential, concurrent, and alternating administration.
[0089] The present disclosure also embraces isotopically labeled compounds which are identical to those recited herein, except that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number usually found in nature. Examples of isotopes that can be incorporated into compounds described herein include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine and chlorine, such as2H,3H,13C,14C,15N,18O,17O,31P,32P,35S,18F, and36Cl, respectively. For example, a compound of the disclosure (e.g., a double-stranded compound described herein) may have one or more H atom replaced with deuterium. Double-stranded ribonucleic acids (dsRNA)
[0090] The present disclosure provides, in certain embodiments, GalNAc compounds comprising a double stranded ribonucleic acid (dsRNA) molecule. In one aspect of the disclosure, provided herein are compounds comprising double-stranded ribonucleic acid (dsRNA) molecules for inhibiting the expression of a gene e.g., in a cell within a subject, such as a mammal (for example a human). In some embodiments, the gene is a gene of the disclosure, e.g., AGT or ANGPTL3. The use of these dsRNA oligonucleotides enables the targeted degradation of mRNAs of the corresponding gene (e.g., a gene described herein, such as AGT or ANGPTL3) in mammals.
[0091] In certain embodiments, the dsRNA comprises an antisense strand having a region of complementarity which is complementary to at least a part of an mRNA or an 27 IPTS / 128755678.3Attorney Docket No. BCR-010WO mRNA fragment formed in the expression of a gene, e.g., a gene of the disclosure. In some embodiments, the dsRNA comprises at least 70% complementarity to the mRNA or the fragment mRNA of human mRNA.
[0092] In certain embodiments, the dsRNA comprises a sense strand and an antisense strand each 15 to 30 nucleotides in length, wherein the antisense strand comprises at least 15 contiguous nucleotides of an antisense strand sequence shown in Table 1, 2, 3, or 4.
[0093] In some embodiments, the sense strand is 70 - 80% or more identical to the sense strands listed in Tables 1, 2, 7, 8, 10, or 11. In some embodiments, the sense strand comprises at least 15 contiguous nucleotides of a sense strand sequence shown in Tables 1, 2, 7, 8, 10, and 11. In some embodiments, the sense strand comprises at least 16, 17, 18, 19, 20, or 21 contiguous nucleotides of a sense strand sequence shown in Table 1, 2, or 3. In some embodiments, the sense strand comprises 21 contiguous nucleotides of a sense strand sequence shown in Tables 1, 2, 7, 8, 10, or 11. In some embodiments, the sense strand sequence is selected from a sense strand sequence shown in Tables 1, 2, 7, 8, 10, or 11.
[0001] In some embodiments, the antisense strand is 70 - 80% or more identical to the antisense strands listed in Tables 1, 2, 7, 8, 10, or 11. In some embodiments, the antisense strand comprises at least 16, 17, 18, 19, 20, or 21 contiguous nucleotides of an antisense sense strand sequence shown in Tables 1, 2, 7, 8, 10, or 11. In some embodiments, the antisense strand comprises 21 contiguous nucleotides of an antisense sense strand sequence shown in Table 1, 2, 3, or 4. In some embodiments, the antisense strand is selected from an antisense strand sequence shown in Tables 1, 2, 7, 8, 10, or 11.
[0002] In some embodiments, the sense strand sequence is selected from a sense strand sequence shown in Tables 1, 2, 7, 8, 10, or 11and the antisense strand is selected from an antisense strand sequence shown in Tables 1, 2, 7, 8, 10, or 11.
[0003] In some embodiments, the dsRNA has a mismatch to a fragment of an mRNA (e.g., an mRNA for a gene such as AGT or ANGPTL3). In some embodiments, the dsRNA comprises one or two mismatches to the mRNA or fragment of a human mRNA (e.g., a human mRNA for a gene described herein). In some embodiments, the dsRNA is more than 70% identical to the mRNA or fragment of a human mRNA (e.g., a human mRNA for a gene described herein). In some embodiments, the dsRNA is more than 70%, 75%, 80%, 85%, 90%, or 95 % identical to the mRNA or fragment of a human mRNA (e.g., a human mRNA for a gene described herein). In some embodiments, the antisense strand comprises a 28 IPTS / 128755678.3Attorney Docket No. BCR-010WO nucleotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to a target mRNA corresponding to a fragment of an mRNA of the disclosure. In some embodiments, the antisense strand of the dsRNA comprises at least 80% complementarity to the fragment of the mRNA of the disclosure. In some embodiments, the mismatch is in the sense strand. In some embodiments, the mismatch is in the antisense strand. In some embodiments, the antisense strand of the dsRNA comprises one, two, three, or four mismatches to the fragment of the mRNA of the disclosure. In some embodiments, the mismatch is located in the middle of the dsRNA. In some embodiments, the mismatch is in the 5’ or 3’ region of the dsRNA. In some embodiments, the mismatch is no more than 5 nucleotides from the 5’ or 3’ end of the dsRNA.
[0004] In some embodiments, at least one strand of the dsRNA comprises a 3’ or 5’ overhang of at least 1 nucleotide. In some embodiments, the overhang is at least 2 or a at least 3 nucleotides. In some embodiments, in the dsRNA at least one strand comprises a 3’ overhang. In some embodiments, in the dsRNA at least one strand comprises a 5’ overhang.
[0005] In some embodiments, the antisense strand has a 3’ end nucleotide overhang compared to the sense strand. In some embodiments, the 3’ end nucleotide overhang comprises 1, 2, or 3 nucleotides compared to the sense strand. In some embodiments, the antisense and the sense strand are at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary. In some embodiments, the antisense strand and the sense strand are at least 80% complementary. In some embodiments, the antisense strand and the sense strand comprise at least one, at least two, at least three, or at least four mismatched nucleotides.
[0006] The dsRNA can be synthesized by standard methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc. The dsRNA includes two RNA strands that are sufficiently complementary to hybridize to form a duplex structure. One strand of the dsRNA (the antisense strand) includes a region of complementarity that is complementary to a target sequence, derived from the sequence of an mRNA formed during the expression of a gene of the disclosure, the other strand (the sense strand) includes a region that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions.
[0007] In some embodiments, the duplex structure is between 15 and 30 or between 25 and 30, or between 18 and 25, or between 19 and 24, or between 19 and 21, or 19, 20, or 21 29 IPTS / 128755678.3Attorney Docket No. BCR-010WO base pairs in length. In one embodiment the duplex is 19 base pairs in length. In another embodiment the duplex is 20 base pairs in length. In another embodiment the duplex is 21 base pairs in length. When two different single stranded RNAs (ssRNA) are used in combination, the duplex lengths can be identical or can differ.
[0008] In some embodiments, each strand of the dsRNA of the disclosure is between 15 and 30, or between 18 and 25, or 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In other embodiments, each is strand is about 25-30 nucleotides in length. In some embodiments, each strand of the duplex is the same length or of different lengths. When two different ssRNAs are used in combination, the lengths of each strand of each ssRNA can be identical or can differ.
[0009] In some embodiments, the dsRNA includes dsRNA that is longer than 21-23 nucleotides, e.g., dsRNA that is long enough to be processed by the RNase III enzyme Dicer into 21-23 base pair siRNA which is then incorporated into a RNA-induced silencing complex (RISC). Accordingly, a dsRNA of the disclosure is at least 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, or at least 100 base pairs in length.
[0010] Inhibition of the expression of a gene of the disclosure can be assayed by, for example, a nucleic acid based assay, such as by quantitative PCR, or by a protein-based method, such as by Western blot. Expression of a gene of the disclosure can be reduced by at least 50% when measured by an assay as described in the Examples below. For example, expression of a gene of the disclosure in cell culture, such as in Huh-7 cells, can be assayed by measuring mRNA levels for a gene of the disclosure, such as by quantitative PCR assay, or by measuring protein levels, such as by ELISA assay.
[0011] In another aspect, the disclosure provides a single-stranded antisense oligonucleotide RNAi. An antisense oligonucleotide is a single-stranded oligonucleotide that is complementary to a sequence within the target mRNA. Antisense oligonucleotides can inhibit translation in a stoichiometric manner by base pairing to the mRNA and physically obstructing the translation machinery, see Dias, N. et al., (2002) Mol. Cancer Ther.1:347- 355. Antisense oligonucleotides can also inhibit target protein expression by binding to the mRNA target and promoting mRNA target destruction via RNase-H. The single-stranded antisense RNA molecule can be about 13 to about 30 nucleotides in length and have a sequence that is complementary to a target sequence. For example, the single-stranded antisense RNA molecule can comprise a sequence that is at least about 13, 14, 15, 16, 17, 18, 30 IPTS / 128755678.3Attorney Docket No. BCR-010WO 19, 20, or more contiguous nucleotides from one of the antisense sequences in Table 1, 2, 3, or 4. Modifications
[0012] In certain embodiments, the dsRNA is chemically modified to enhance stability of the dsRNA. The nucleic acids featured in the disclosure may be synthesized and / or modified by methods well established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, S.L. et al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated herein by reference. Specific examples of dsRNA compounds useful in this disclosure include dsRNAs containing modified backbones or non- natural internucleoside linkages. As defined in this specification, dsRNAs having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified dsRNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
[0013] In some embodiments, a modified dsRNA backbone includes at least one of: a 2'- O-methyl modified nucleotide, a nucleotide comprising a 5'-phosphorothioate group, a 2'- fluoro modified nucleotide; an inverted abasic nucleotide, a thymidine-glycol nucleic acid (GNA) S-Isomer; an inosine, and inverted deoxyribonucleotide (3'-3' linked nucleotide), and a thymidine-glycol nucleic acid (GNA) S-Isomer.
[0014] In some embodiments, the modification includes one or more phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these) having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included.
[0015] In some embodiments, the modified nucleotide includes at least one of: 5’-vinyl phosphonate nucleotide, a 5’-phosphate or phosphate mimic, a locked nucleic acid (LNA), a 2’-MOE (methoxyethyl)nucleotide, and / or a 2’-arabino fluoro (2’-araF) nucleotide. In some embodiments, the modified nucleotide antisense strand comprises a phosphate mimic at the 31 IPTS / 128755678.3Attorney Docket No. BCR-010WO 5’ end; optionally wherein the phosphate mimic is a 5'-E-Vinyl-phosphonate or a 4'-O- phosphonate.
[0016] In some embodiments, the modified nucleotide comprises at least one of: a 2'- deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, 2’-amino-modified nucleotide, 2’-alkyl-modified nucleotide, morpholino nucleotide, a phosphoramidate, and / or a non-natural base comprising nucleotide.
[0017] In some embodiments, the antisense strand and / or the sense strand comprises at least one internucleoside linkage selected from the group consisting of a phosphorothioate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoromorpholidate linkage, a phosphoropiperazidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage. In some embodiments, the antisense strand and / or the sense strand comprises at least one nucleotide modified linkage. In some embodiments, all the nucleotide linkages in the antisense strand are modified linkages. In some embodiments, the antisense strand and / or the sense strand comprises at least one a phosphorothioate (PS) bond. Conjugates
[0018] Another modification of the dsRNAs of the disclosure involves chemically linking to the dsRNA one or more ligand or targeting moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the dsRNA (e.g., a GalNAc of the present disclosure, e e.g., GalNAc3, tri-GalNAc4, tri-GalNAc5, and tri-GalNAc6). Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533- 538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl- ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron 32 IPTS / 128755678.3Attorney Docket No. BCR-010WO Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969- 973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).
[0019] In some embodiments, the ligand or targeting moiety (e.g., a GalNAc described herein, e.g., GalNAc3, tri-GalNAc4, tri-GalNAc5, and tri-GalNAc6) is conjugated to the 5’ end, 3’ end or both ends of the dsRNA. In some embodiments, the ligand or targeting moiety (e.g., a GalNAc described herein, e.g., GalNAc3, tri-GalNAc4, tri-GalNAc5, and tri- GalNAc6) is conjugated to the 3’ end of the sense strand of the dsRNA. In some embodiments, the ligand or targeting moiety (e.g., a GalNAc described herein, e.g., GalNAc3, tri-GalNAc4, tri-GalNAc5, and tri-GalNAc6) is conjugated to the 3’ end of the antisense strand of the modified dsRNA.
[0020] In some embodiments, the dsRNA may be modified by a non-ligand group. A number of non-ligand molecules have been conjugated to dsRNAs in order to enhance the activity, cellular distribution or cellular uptake of the dsRNA, and procedures for performing such conjugations are available in the scientific literature. Such non-ligand moieties include lipid moieties, such as cholesterol (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a phospholipid, e.g., di-hexadecyl-rac- glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Typical conjugation protocols involve the synthesis of dsRNAs bearing an aminolinker at one or more positions of the oligonucleotide sequence. The amino 33 IPTS / 128755678.3Attorney Docket No. BCR-010WO group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction may be performed either with the dsRNA still bound to the solid support or following cleavage of the dsRNA in solution phase. The dsRNA conjugate can be purified for example by HPLC methods.
[0094] Conjugating a ligand to a dsRNA can enhance its cellular absorption as well as targeting to a particular tissue or uptake by specific types of cells such as liver cells. In certain instances, a hydrophobic ligand is conjugated to the dsRNA to facilitate direct permeation of the cellular membrane and or uptake across the liver cells. Alternatively, the ligand conjugated to the dsRNA is a substrate for receptor-mediated endocytosis. These approaches have been used to facilitate cell permeation of antisense oligonucleotides as well as dsRNA agents. For example, cholesterol has been conjugated to various antisense oligonucleotides resulting in compounds that are substantially more active compared to their non-conjugated analogs. See M. Manoharan Antisense & Nucleic Acid Drug Development 2002, 12, 103. Other lipophilic compounds that have been conjugated to oligonucleotides include 1-pyrene butyric acid, 1,3-bis-O-(hexadecyl)glycerol, and menthol. One example of a ligand for receptor-mediated endocytosis is folic acid. Folic acid enters the cell by folate- receptor-mediated endocytosis. dsRNA compounds bearing folic acid would be efficiently transported into the cell via the folate-receptor-mediated endocytosis. Pharmaceutical Compositions Excipients
[0095] Described herein in certain embodiments is a pharmaceutical composition comprising a compound of the disclosure (e.g., a double-stranded compound described herein) and a pharmaceutically acceptable excipient. In contrast to a carrier compound, a “pharmaceutical carrier” or “pharmaceutically acceptable excipient” is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient may be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pre-gelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen 34 IPTS / 128755678.3Attorney Docket No. BCR-010WO phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc.).
[0096] Pharmaceutically acceptable organic or inorganic excipients suitable for non- parenteral administration which do not deleteriously react with nucleic acids can also be used to formulate the compositions of the present disclosure. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
[0097] Formulations for topical administration of nucleic acids may include sterile and non- sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions may also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used.
[0098] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
[0099] The compositions of the present disclosure may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the compositions of the present disclosure, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present disclosure. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and / or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation. 35 IPTS / 128755678.3Attorney Docket No. BCR-010WO
[0100] Aqueous suspensions may contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and / or dextran. The suspension may also contain stabilizers. Administration
[0101] Also disclosed herein are methods of administration for the pharmaceutical compositions and formulations which include the compounds and pharmaceutical compositions of the disclosure. In some embodiments, the compound or pharmaceutical composition of the disclosure is administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated.
[0102] In certain embodiments, administration of the pharmaceutical composition is topical (including buccal and sublingual), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. In some embodiments, parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intraparenchymal, intrathecal or intraventricular, administration.
[0103] Pharmaceutical compositions containing a compound of the disclosure (e.g., a double-stranded compound described herein), can be presented in a dosage unit form and can be prepared by any suitable method. A pharmaceutical composition should be formulated to be compatible with its intended route of administration. Useful formulations can be prepared by methods well known in the pharmaceutical art. For example, see Remington's Pharmaceutical Sciences, 18th ed. (Mack Publishing Company, 1990).
[0104] Pharmaceutical formulations, for example, are sterile. Sterilization can be accomplished, for example, by filtration through sterile filtration membranes. Where the composition is lyophilized, filter sterilization can be conducted prior to or following lyophilization and reconstitution.
[0105] In certain embodiments, the compound of the disclosure (e.g., a double- stranded compound described herein) is delivered in a manner to target a particular tissue, for example the liver.
[0106] The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the 36 IPTS / 128755678.3Attorney Docket No. BCR-010WO particular mode of administration. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound (e.g., a compound of the disclosure (e.g., a double-stranded compound described herein), which produces a therapeutic effect.
[0107] In certain embodiments, a formulation of the present disclosure comprises an excipient selected from the group consisting of cyclodextrins, celluloses, liposomes, micelle forming agents, e.g., bile acids, and polymeric carriers, e.g., polyesters and polyanhydrides; and a compound of the present disclosure. In certain embodiments, an aforementioned formulation renders orally bioavailable a compound of the present disclosure (e.g., a double- stranded compound described herein).
[0108] Formulations of the disclosure suitable for oral administration may be in the form of capsules, cachets, pills, tablets, lozenges (using a flavored basis, usually sucrose and acacia or tragacanth), powders, granules, or as a solution or a suspension in an aqueous or non-aqueous liquid, or as an oil-in-water or water-in-oil liquid emulsion, or as an elixir or syrup, or as pastilles (using an inert base, such as gelatin and glycerin, or sucrose and acacia) and / or as mouth washes and the like, each containing a predetermined amount of a compound of the present disclosure (e.g., a double-stranded compound described herein) as an active ingredient. A compound of the present disclosure (e.g., a double-stranded compound described herein) may also be administered as a bolus, electuary or paste.
[0109] Liquid dosage forms for oral administration of the compounds of the disclosure (e.g., a double-stranded compound described herein) include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. Liposomal Formulations
[0110] In certain embodiments, pharmaceutical compositions disclosed herein comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.
[0111] In some embodiments, the GalNAc compounds of the disclosure (e.g., a double-stranded compound described herein) is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain embodiments, 37 IPTS / 128755678.3Attorney Docket No. BCR-010WO dsRNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue. Methods of Use
[0112] In an embodiment, provided herein are methods of inhibiting the expression of a gene (e.g., a gene described herein) in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a double-stranded compound described herein, or pharmaceutical composition thereof.
[0113] The instantly disclosed compounds are useful in the treatment of various disorders. In an embodiment, provided herein is a method of treating a disorder in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a compound described herein or pharmaceutically acceptable salt thereof, or pharmaceutical composition thereof. In some embodiments, the disorder is a liver disorder. In some embodiments, the disorder is selected from the group consisting of non-alcoholic fatty liver disease (NAFLD), obesity, hypertension, and hypercholesteremia. In some embodiments, the NAFLD is non-alcoholic steatohepatitis (NASH). In another embodiment, provided herein is a method of treating a disorder mediated by the expression of ANGPTL3 or AGT in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a compound described herein or pharmaceutically acceptable salt thereof, or pharmaceutical composition thereof. In some embodiments, the method further comprises administering to the patient one or more additional therapeutic agents.
[0114] Additional embodiments of the disclosure include the following: EXAMPLES
[0115] The compounds provided herein can be prepared from readily available starting materials using the following general methods and procedures. It will be appreciated 38 IPTS / 128755678.3Attorney Docket No. BCR-010WO that where typical or preferred process conditions (i.e., reaction temperatures, times, mole ratios of reactants, solvents, pressures, etc.) are given, other process conditions can also be used unless otherwise stated. Optimum may vary with the particular reactants or solvent used, but such conditions can be determined by one skilled in the art by routine optimization. Abbreviations ACN acetonitrile AGT angiotensinogen Alloc allyloxycarbonyl ANGPTL3 Angiopoietin-like 3 gene araF arabino fluoro BSA bis(trimethylsilyl)acetamide CPG controlled pore glass DCE 1,2-Dichloroethane DCI 4,5-Dicyanoimidazole DCM dichloromethane DIPEA N,N-Diisopropylethylamine DMAP 4-Dimethylaminopyridine DMSO dimethyl sulfoxide DMTr 4,4'-Dimethoxytrityl DMTrCl / DMT-Cl 4,4'-Dimethoxytrityl chloride DNA deoxyribonucleic acid dsRNA double-stranded RNA DTT dithiothreitol EA ethyl acetate EDCI 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide ELISA enzyme-linked immunosorbent assay ESI electrospray ionization GalNAc N-acetylgalactosamine GNA thymidine-glycol nucleic acid h hour(s) HBTU hexafluorophosphate benzotriazole tetramethyl uronium HDI hydrodynamic injection 39 IPTS / 128755678.3Attorney Docket No. BCR-010WO HOBT hydroxybenzotriazole HPLC high-performance liquid chromatography iRNA informational RNA KD knockdown LCMS liquid chromatography mass spectrometry LNA locked nucleic acid min minute(s) MOE methoxyethyl mRNA messenger RNA MTBE methyl tert-butyl ether NAFLD non-alcoholic fatty liver disease NASH non-alcoholic steatohepatitis NeoR neorhodopsin NMR nuclear magnetic resonance ORF open reading frame PBS phosphate-buffered saline PCR polymerase chain reaction PE petroleum ether PS phosphorothioate Py / Pyr pyridine RISC RNA-induced silencing complex RNA ribonucleic acid r.t. room temperature siRNA small interfering RNA ssRNA single stranded RNA TBAI tetra-n-butylammonium iodide TBSCl tert-Butyldimethylsilyl chloride TEA triethylamine TFA trifluoroacetic acid THF tetrahydrofuran TLC thin-layer chromatography TMS trifluoromethyltrimethylsilane TMSOTf trimethylsilyl trifluoromethanesulfonate UTR untranslated region 40 IPTS / 128755678.3Attorney Docket No. BCR-010WO UV ultra-violet EXAMPLE 1. Preparation of Monomer 1H2SO4(5 mL), and the reaction mixture was stirred at r.t. for 2 h, TLC shows 1 was consumed completely, a solution of Na2CO3 in H2O was carefully added while cooling to maintain the temperature at 20 ºC, after stirring for a further 2.5 h, solid Na2CO3and K2CO3was added to bring the pH to 7.0. Then the reaction solution was filtered directly and filter cake was washed with acetone. The combined filtrates was concentrated to give the crude, which was purified by silica gel column (DCM: MeOH = 200: 1) to give 2 (66.0 g, 0.4 mol, 74.4% yield).1H NMR (600 MHz, DMSO-d6) δ 5.80 – 5.79 (d, J = 3.6 Hz, 1H), 5.12 (d, J = 4.8 Hz, 1H), 4.61 – 4.59 (t, J = 11.25 Hz, 1H), 4.37 – 4.36 (d, J = 3.6 Hz, 1H), 3.99 – 3.94 (m, 2H), 3.62 – 3.58 (m, 1H), 3.52 – 3.48 (m, 1H), 1.37 (s, 3H), 1.22 (s, 3H).
[0117] Step 2: To a solution of 2 (66.0 g, 347.0 mmol) and in ACN (1320 mL) was added iodomethane (120.5 g, 0.9 mol) and silver oxide (94.3 g, 0.4 mol) at r.t.. The reaction mixture was stirring at r.t. for 48 h, TLC shows that most of 2 was consumed , and the reaction mixture was filtered, wash the filter cake with DCM until there is no product, filtrate 41 IPTS / 128755678.3Attorney Docket No. BCR-010WO was concentrated to get crude product which was purified by silica gel column to give 3(33.0 g, 161.6 mmol, 46.6% yield).1H NMR (600 MHz, DMSO-d6) δ 5.83 – 5.82 (d, J = 3.6 Hz, 1H), 4.39-4.38 (d, J = 3.6 Hz, 1H), 4.09 – 4.04 (m, 1H), 4.96 – 4.95 (d, J = 2.4 Hz, 1H), 3.60 – 3.56 (m, 1H), 3.43 – 3.39 (m, 1H), 3.26 (s, 3H), 1.37 (s, 3H), 1.22 (s, 3H).
[0118] Step 3: To a solution of 3 (33.0 g, 161.6 mmol) in DCM (400 mL) containing Pyr (33 mL) was added Alloc-Cl (47.9 g, 397.4 mmol) at r.t. Then the reaction mixture was stirred at r.t. for 12 h, TLC shows that half of 3 was consumed, then the reaction mixture was poured into saturated sodium bicarbonate solution, EA was added for extraction, the organic phase dried over Na2SO4 and concentrated to give to give 4 (33.3 g, 115.5 mmol, 71.5% yield), which was used next step directly.
[0119] Step 4: To a solution of 4 (33.3 g, 115.5 mmol) in AcOH (450 mL) was added Ac2O (45 mL), after cooling the reaction flask to 10 ºC followed by slow drip addition of H2SO4 (4.5 mL), then the reaction mixture was stirred at r.t. for 12h, TLC shows that the 4 was disappeared ,the reaction was quenched by addition of ice and 5% aqueous NaHCO3, DCM was added for extraction, and organic phase was washed by brine and dried over NaSO4. The organic phase was concentrated to give crude product which was purified by silica gel column to give 5 (35.0 g, 105.4 mmol, 91.2% yield).1H NMR (400 MHz, DMSO- d6) δ 6.44-6.11 (m, 1H), 5.98-5.86 (m, 1H), 5.43 – 5.20 (m, 4H), 4.71 – 4.52 (m, 3H), 3.62 – 3.42 (m, 2H), 3.36 (s, 3H), 2.12-2.06 (m, 6H).
[0120] Step 5: To a solution of 5 (35.0 g, 105.4 mmol) in ACN (700 mL) was added Uracil(13.8 g, 123.1mmol) and BSA (42.9 g, 210.9 mmol) at r.t. The reaction mixture was stirred at 80ºC for 1 h and then cooled down 20 ºC. TMSOTf (70.3 g, 316.3 mmol) was added, and the reaction mixture was heated to reflux for 12 h. LCMS and TLC (EA: PE=1:1) shows that the 5 was disappeared, the reaction solution was poured into saturated sodium bicarbonate solution, the resulting product was extracted with EA. The combined organic layer was washed with brine, dry over Na2SO4 and concentrated to get crude product which was purified by silica gel column and MPLC to give 6 (24.3 g, 63.3 mmol, 60.0%yield). ESI- LCMS: m / z= 385.0 [M+H]+;1H NMR (400 MHz, DMSO-d6) δ 8.77(s, 1H),7.64 – 7.62 (d, J = 8.4 Hz, 1H), 6.06-6.05 (d, J = 3.2 Hz, 1H), 5.95 – 5.90 (m, 1H), 5.79 – 5.77 (m, 1H), 5.41 – 5.31 (m, 4H), 4.68 – 4.66 (m, 2H), 4.38 – 4.42 (m, 1H),3.78 – 3.62 (m, 2H), 3.41 (s, 3H), 2.14 (s, 3H).
[0121] Step 6: To a solution of 6 (24.3 g, 63.3 mmol) in DCM (600 mL) was added pph3 (13.6 g, 51.8 mmol), piperidine (50 mL) and Pd(dba)3 (3.7 g, 4.0 mmol), the mixture was stirred at r.t. for 15 min. LC-MS showed 6 was consumed completely, then the reaction 42 IPTS / 128755678.3Attorney Docket No. BCR-010WO mixture was concentrated to give the crude product which was purified by MPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN / H2O (0.5% NH4HCO3) = 0 / 1 increasing to CH3CN / H2O (0.5% NH4HCO3) = 1 / 4 within 20 min to give 7 (11.1 g, 37.0 mmol, 61.0% yield). ESI-LCMS: m / z= 301.0 [M+H]+.
[0122] Step 7: To a solution of 7 (11.1 g, 37.0 mmol) in Pyr (110 mL) was added DMTrCl (18.8 g, 55.5 mmol), then the reaction mixture was stirred at r.t. for 48 h, LCMS shows 7 was consumed mainly, and the reaction mixture was added to an aqueous solution of NaHCO3in ice-water. Then extracted product with EA(300 mL*2), washed the organic phase with brine, and dried the organic phase over Na2SO4, concentrated to give the crude product which was purified by silica gel column (DCM : MeOH=100:1 to 50:1) to give 8 (10.8 g, 17.4 mmol, 48.5% yield). LCMS m / z =601.3 [M-H]+;1H NMR (400 MHz, DMSO- d6) δ 8.63 – 8.50 (m, 1H), 7.98 – 7.96 (d, J = 8.2 Hz, 1H), 7.46 – 7.43 (m, 2H), 7.35 – 7.26 (m, 7H), 6.84 – 6.82 (m, 4H), 5.80 – 5.79 (d, J = 5.2 Hz, 1H), 5.69 – 5.67 (d, J = 8.2 Hz, 1H), 5.00 – 4.97 (t, J = 11.0 Hz, 1H), 4.50 – 4.47 (t, J = 11.4 Hz, 1H), 3.80 (m, 6H), 3.42-3.52 (m, 3H), 1.98 (s, 3H).
[0123] Step 8: To a solution of 8 (3.5 g, 5.8 mmol) in MeOH (250 mL) was added 1M NaOH (35 mL), the reaction mixture was stirred at r.t. for 1h. LC-MS showed 8 was consumed completely. Then extracted product with DCM (500 mL), washed the organic phase with brine, and dried the organic phase over Na2SO4, concentrated to give the crude product which was purified by silica gel column (DCM :MeOH = 10:1) to give 9 (3.0 g, 5.4 mmol, 92.1% yield). LCMS m / z =559.2 [M-H]+.
[0124] Step 9: To a suspension of 9 (3.0 g, 5.4 mmol) in DCM (45 mL) was added DCI (0.54 g, 4.6 mmol) and CEP[N(iPr)2]2(2.4 g, 8.0 mmol) at r.t. under N2. The mixture was stirred at r.t. for 3 h. LC-MS showed 9 was consumed. The solution was concentrated to give the crude product, which was purified by MPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN / H2O (0.5% NH4HCO3) = 2 / 3 increasing to CH3CN / H2O (0.5% NH4HCO3) = 1 / 4 to give Monomer 1 (3.1 g, 4.1 mmol 76.1% yield). ESI-LCMS: m / z 761.3 [M+H]+;1H NMR (400 MHz, DMSO-d6) δ 11.37 – 11.32 (d, J = 19.6 Hz, 1H), 7.89 – 7.82 (m, 1H), 7.40 – 7.22 (m, 9H), 6.70 – 6.85 (m, 4H), 5.63 – 5.51 (m, 2H), 4.23 – 4.15 (m, 1H), 3.97 – 3.84 (m, 2H),3.75 (s, 6H), 3.71 – 3.45 (m, 6H), 3.35 – 3.30 (t, J = 19.6 Hz, 3H), 2.70 – 2.49 (m, 2H), 1.11 – 0.99 (m, 12H) ;31P NMR (162 MHz, DMSO-d6) δ 150.33, 149.50. 43 IPTS / 128755678.3Attorney Docket No. BCR-010WO EXAMPLE 2. Preparation of Monomer 2, cooled to 0ºC, and POCl3(7.4 g, 48.4 mmol) was added into the mixture at N2atmosphere. The reaction mixture was stirred at r.t. for 4 h, TLC shows 1 was consumed completely, a solution of NH3·H2O (37 mL) was added while cooling to maintain the temperature at 10 ºC, after stirring for a further 48 h, EA was added for extraction, The combined organic was concentrated to give 2 (11.7 g, 19.5 mmol). ESI-LCMS: m / z= 600.2 [M-H]+.
[0126] Step 2: To a solution of 2 (11.7 g, 19.5 mmol) in Pyr (117 mL) was added BzCl (120.5 g, 0.9 mol) at 0ºC under N2atmosphere. The reaction mixture was stirring at r.t. for 12 h, TLC shows that most of 2 was consumed, the reaction mixture was poured into saturated sodium bicarbonate solution, and the resulting product was extracted with EA. The combined organic layer was washed with brine, dry over Na2SO4and concentrated to get crude product 3 (12.0 g, 19.5 mmol), used next step directly.
[0127] Step 3: To a solution of 3 (12.0 g, 19.5 mmol) in MeOH(120mL) was added a solution of 2M NaOH in MeOH, and the reaction mixture was stirring at 0ºC for 1 h, LC-MS shows that 3 was consumed, the reaction solution was poured into H2O(500 mL), EA was added for extraction, the organic layer was concentrated to give a crude product which was purified by silica gel column (AE: PE =1: 2 to 5: 1) to give 4(4.0 g, 6.0 mmol, 49.8% yield). ESI-LCMS: m / z= 662.3 [M-H]+;1H NMR (400 MHz, DMSO-d) δ 11.21 (s, 1H), 8.37 – 8.35 (d, J = 8.6 Hz, 1H), 8.02 – 7.99 (t, J = 7.3 Hz, 2H), 7.64 – 7.60 (m, 1H), 7.53 – 7.49 (t, J = 15.3 Hz, 2H), 7.41 – 7.40 (d, J = 6.1 Hz, 2H), 7.31 – 7.25 (m, 4H), 7.22 – 7.14 (m, 5H), 6.87 – 6.82 (m, 4H), 5.56 – 5.49 (m, 2H), 4.14 – 4.13 (d, J = 4.6 Hz, 1H), 3.84 – 3.80 (m, 1H), 3.73 – 3.72 (d, J = 3.3 Hz, 6H), 3.63 – 3.59 (m, 1H), 3.36 (s, 3H), 3.33 (s, 2H); 44 IPTS / 128755678.3Attorney Docket No. BCR-010WO
[0128] Step 4: To a suspension of 9 (4.0 g, 6.0 mmol) in DCM (60 mL) was added DCI (0.61 g, 5.1 mmol) and CEP[N(iPr)2]2(2.7 g, 9.0 mmol) at r.t. under N2. The mixture was stirred at r.t. for 3 h. LC-MS showed 9 was consumed mainly. The crude product which was purified by MPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN / H2O (0.5% NH4HCO3) = 2 / 3 increasing to CH3CN / H2O (0.5% NH4HCO3) = 1 / 0 to give Monomer 2 (4.2 g, 4.9 mmol, 80.7% yield). ESI-LCMS: m / z 865.3 [M+H]+;1H NMR (400 MHz, DMSO-d) δ 11.21 (s, 1H), 8.47 – 8.38 (m, 1H), 8.02 – 7.99 (m, 2H), 7.64 – 7.61 (t, J = 14.8 Hz, 4H), 7.53 – 7.41 (m, 3H), 7.28 – 7.09 (m, 9H), 6.88 – 6.82 (m, 4H), 5.68 – 5.65 (d, J = 14.8 Hz, 1H), 4.24 – 4.17 (m, 1H), 4.10 – 4.00 (m, 1H), 3.88 – 3.65 (m, 9H), 3.54 – 3.41 (m, 4H), 3.35 – 3.31 (t, J = 16.8 Hz, 3H), 2.74 – 2.40 (m, 2H), 1.14 – 0.95 (m, 12H) ;31P NMR (162 MHz, DMSO-d6) δ 149.79, 149.47. EXAMPLE 3. Preparation of Monomer 3was 85, # 12, p.4111 – 4153.
[0130] Step 1: A solution of 1 (21g, 56.7 mmol ) in 210 mL of toluene with an inert atmosphere of nitrogen was added Urcil (7.6 g, 68.0 mmol) and BSA (23.0 g, 113.4 mmol,) to 90 ℃. Stirring and heating was continued until a clear soln. Then the TMSOTf (31.5 ml, 170.1 mmol) was added in 3 portions over a period of 2 min. After 1 h (monitored by TLC), the mixture was cooled to r.t. and poured into an ice-cold stirred mixture of 100 ml of sat. 45 IPTS / 128755678.3Attorney Docket No. BCR-010WO aq.NaHCO3.soln. / EA 1 :1. The organic layer was separated, the aq. layer was extracted with EA, and the combined organic layers were washed with brine. and dried over Na2SO4. Then the solution was concentrated under reduced pressure and purify with column chromatography(EA / DCM=2 / 5). This resulted in to give 6 (15.0 g, 35.5mmol, 64% yield). ESI-LCMS: m / z 423.1 [M+H]+;
[0131] Step 2: A solution of 6 (15.0 g, 35.5 mmol) in 150 mL of THF / MeOH / H2O = 5:4:1 was cooled to 0℃, and 18 mL (35.7 mmol) of 2M aq. NaOH was slowly added. After 20 min, the soln. was neutralized with 2M aq. HCl. The mixture was concentrated under reduced pressure, until the desired product started to precipitate. This resulted in to give 7 (7.5g, 35.5 mmol, 98.6% yield). ESI-LCMS: m / z 215.2 [M+H]+;
[0132] Step 3: A solution of 3 (7.5 g, 35.5 mmol) in 75mL dioxane / H2O= 5:1 and NaIO4(9.2g 42.6mmol) was added. After 2h, the solution was filtered .the filtration was concentrated under reduced pressure, the residuum was dissolved in MeOH(75ml).the mixture was added NaBH4(2.6g70 mmol).after 30mins the solution was neutralized with NH4Cl .The mixture was concentrated under reduced pressure. The crude used directly next step 4 (6.8g, 15.2mmol). ESI-LCMS: m / z 239.1 [M+NH4]+
[0133] Step 4: To a solution of 4 (6.8g, 15.2mmol) in pyridine (65 mL) added DMTrCl (5.1g, 15.2mmol). Then the solution was stirred at r.t for 2 h. LCMS showed 4 was consumed completely. Then the solution was quench with NaHCO3(aq.) and diluted with EA, washed with water twice and brine. The organic phase dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure to get a crude. The crude was purified by silica gel and SFC (mobile phase,EA / PE =1 / 1)to give 5 (2.6 g, 5mmol, 48% yield, 98% purity) as a white solid. ESI-LCMS: m / z: 517.3. [M-H]-.1H NMR (400 MHz, DMSO-d6) δ 11.31 (d, J = 2.2 Hz, 1H), 7.62 (d, J = 8.0 Hz, 1H), 7.43 – 7.18 (m, 9H), 6.94 – 6.83 (m, 4H), 5.71 – 5.58 (m, 2H), 5.18 (s, 1H), 3.74 (s, 6H), 3.68 – 3.57 (m, 3H), 3.57 – 3.49 (m, 1H), 3.09 (dddd, J = 41.0, 8.9, 6.6, 3.9 Hz, 2H).
[0134] Step 5: To a solution of 5 (2.6 g, 5 mmol) in DCM (26 mL) was added DCI (500 mg, 4.25 mmol) and CEP[N(iPr)2]2(1.8 g, 6 mmol) under N2. The mixture was stirred at r.t for 1 h. LCMS showed 5 was consumed completely. The product was extracted with DCM, The organic layer was washed with H2O and brine. Then the solution was concentrated under reduced pressure and the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN / H2O (0.05% NH4HCO3) = 1 / 1 increasing to CH3CN / H2O (0.05% NH4HCO3) = 1 / 0 within 25 min, the eluted product was collected at CH3CN / H2O (0.05% NH4HCO3) = 1 / 0; Detector, UV 254 46 IPTS / 128755678.3Attorney Docket No. BCR-010WO nm. This resulted in to give Monomer 3 (2.0 g, 1.1 mmol, 70% yield, 99% purity) as a white solid. ESI-LCMS: m / z = 717.3[M-H]-.1H NMR (400 MHz, DMSO-d6) δ 11.34 (s, 1H), 7.66 (dd, J = 8.1, 4.4 Hz, 1H), 7.43 – 7.18 (m, 9H), 6.92 – 6.83 (m, 4H), 5.83 (td, J = 5.3, 2.7 Hz, 1H), 5.64 (dd, J = 8.0, 2.4 Hz, 1H),J = 8.2, 6.1, 3.1 Hz, 2H), 3.73 (s, 9H), 3.53 (dddd, J = 20.5, 18.0, 9.1, 5.1 Hz, 3H), 3.21 – 2.98 (m, 2H), 2.72 (t, J = 5.9 Hz, 2H), 1.08 (dd, J = 17.6, 6.7 Hz, 12H).31P NMR (162 MHz, DMSO-d6) δ 148.54 , 148.17. EXAMPLE 4. Preparation of Monomer 4was 85, # 12, p.4111 – 4153.
[0136] Step 1: A solution of 1 (20.0 g, 54.0 mmol ) in 200 mL of toluene with an inert atmosphere of nitrogen was added ABz(15.5 g, 64.8 mmol) and BSA ( 21.9g, 108 mmol) to 90 ℃. Stirring and heating was continued until a clear solution . Then the TMSOTf (28.8 ml,162 mmol) was added in 3 portions over a period of 2 min. After 5 h (monitored by TLC), the mixture was cooled to r.t. and poured into an ice-cold stirred mixture of 200 mL of sat. 47 IPTS / 128755678.3Attorney Docket No. BCR-010WO aq.NaHCO3.soln. / EA 1:1. The organic layer was separated, the aq.layer was extracted with EA, and the combined organic layers were washed with brine. and dried over Na2SO4. Then the solution was concentrated under reduced pressure and purify with column chromatography (EA / PE=1 / 2). This resulted in to give 2 (21.3 g, 38.8 mmol, 71% yield). ESI-LCMS: m / z 550.2 [M+H]+;
[0137] Step 2: A solution of 2 (21.3 g, 38.8 mmol) in 125 mL of 300 ml of THF / MeOH / H2O= 5:4:1 was cooled to 0 ℃, and 39 ml 77.6 mmol) of 2M aq. NaOH was slowly added. After 20 min, the soln. was neutralized with 2M aq. HCl. The mixture was concentrated under reduced pressure, until the desired product started to precipitate. This resulted in to give 7 (10.8 g, 31.6mmol, 92% yield). ESI-LCMS: m / z 342.0 [M+H]+;
[0138] Step 3: A solution of 3 (10.4 g, 30.3 mmol) in 100 mL dioxane / H2O= 5 :1 and NaIO4(7.7 g 36.6 mmol)was added. After 2h, the solution was filtered .the filtration was concentrated under reduced pressure, the residuum was dissolved in MeOH(100 mL). the mixture was added NaBH4(2.6 g, 70 mmol). after 30mins the solution was neutralized with NH4Cl. The mixture was concentrated under reduced pressure. The crude was purified by silica gel: mobile phase, DCM / MeOH=10 / 1 to give 2 (3.4 g, 9.9mmol, 32% yield, 98% purity) as a white solid. ESI-LCMS: m / z 343.1[M+H]+.
[0139] Step 4: To a solution of 4 (3.4 g, 9.9 mmol) in pyridine (34 mL) added DMTrCl (4.0 g, 11.8 mmol). Then the solution was stirred at r.t for 2 h. LCMS showed 4 was consumed completely. Then the solution was quenched with NaHCO3 (aq.) and diluted with EA, washed with water twice and brine. The organic phase dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure to get a crude. The crude was purified by silica gel and SFC (mobile phase, DCM / MeOH=100 / 1 increasing to DCM / MeOH = 20 / 1) the eluted product was collected at DCM / MeOH =30 / 1 to give 2 (3.0 g, 4.6 mmol, 51% yield, 98% purity) as a white solid. ESI-LCMS: m / z 644.3 [M-H]-.1H NMR (400 MHz, DMSO-d6) δ 11.20 (s, 1H), 8.69 (d, J = 45.9 Hz, 2H), 8.12 – 8.01 (m, 2H), 7.69 – 7.52 (m, 3H), 7.34 – 7.24 (m, 4H), 7.23 – 7.13 (m, 5H), 6.92 – 6.80 (m, 4H), 5.89 (dd, J = 7.0, 4.9 Hz, 1H), 5.29 (t, J = 5.9 Hz, 1H), 4.04 (ddt, J = 44.3, 11.2, 5.9 Hz, 2H), 3.72 (d, J = 0.9 Hz, 7H), 3.60 – 3.38 (m, 1H), 3.18 – 2.93 (m, 2H).
[0140] Step 5: To a solution of 5 (3.0 g, 4.6 mol) in DCM (30 mL) was added DCI (461 mg, 3.9 mol) and CEP[N(iPr)2]2 (1.6 g, 5.5 mmol) under N2. The mixture was stirred at r.t. for 1 h. LCMS showed 5 was consumed completely. The product was extracted with DCM, The organic layer was washed with H2O and brine. Then the solution was concentrated under reduced pressure and the residue was purified by Flash-Prep-HPLC with the following 48 IPTS / 128755678.3Attorney Docket No. BCR-010WO conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN / H2O (0.05% NH4HCO3) = 1 / 1 increasing to CH3CN / H2O (0.05% NH4HCO3) = 1 / 0 within 25 min, the eluted product was collected at CH3CN / H2O (0.05% NH4HCO3) = 1 / 0; Detector, UV 254 nm. This resulted in to give Monomer 4 (2.05 g, 2.9 mmol, 70% yield, 99% purity) as a white solid. ESI-LCMS: m / z =844.3 [M-H]-.1H NMR (400 MHz, DMSO-d6) δ 11.20 (s, 1H), 8.66 (d, J = 1.1 Hz, 2H), 8.10 – 8.01 (m, 2H), 7.70 – 7.51 (m, 3H), 7.35 – 7.13 (m, 9H), 6.90 – 6.80 (m, 4H), 6.08 (dt, J = 7.5, 4.7 Hz, 1H), 4.42 – 4.07 (m, 2H), 3.83 – 3.33 (m, 12H), 3.20 – 2.93 (m, 2H), 2.75 – 2.59 (m, 2H), 1.13 – 0.81 (m, 12H).31P NMR (162 MHz, DMSO-d6) δ 148.67 , 148.29. EXAMPLE 5. Preparation of Monomer 5Attorney Docket No. BCR-010WO
[0141] Step 1: To a solution of 1 (70.0 g, 530.3 mmol) in DCM (700.0 mL) with an inert atmosphere of nitrogen was added TBDPSCI (145.9 g, 530.3 mmol) at 0°C. Then imidazole (41.5 g, 609.9 mmol) was added in the mixture. Then the reaction mixture was stirred at r.t. for 3.0 h. LCMS showed 1 was consumed. The solution was diluted with DCM (2.5 L) and washed with H2O, saturated aqueous sodium bicarbonate and washed with brine and dried over Na2SO4. Then the solution was concentrated under reduced pressure. This resulted in to give 2 (200.0 g, 540.5 mmol) as a yellow solid which was used directly for the next step. ESI-LCMS: m / z 388.2 [M+H]+.
[0142] Step 2: To a solution of 2 (200.0 g, 540.5 mmol) in a mixture of AcOH (900.0 mL) and H2O (100.0 mL) at 100.0℃. The reaction mixture was allowed to stir reflux or heat for 30.0 min. The LCMS showed 2 was consumed. Then the solution was concentrated under reduced pressure. After filtration, the organic solvent was removed in vacuo and the crude residue was purified by flash column chromatography (SiO2, PE:EA=10:1) to afford the compound 3 (170.0 g, 515.2 mmol, 90.0% purity, 95.0% yield). ESI-LCMS: m / z 348.1[M+H]+. H-NMR (400 MHz, DMSO-d6) δ = 7.69-7.67 (m, 4H), 7.47-7.42 (m, 6H), 4.47-4.69 (m, 1H), 4.51-4.50 (m, 1H), 3.68-3.59 (m, 2H), 3.56-3.53 (m, 1H), 3.45-3.44 (m, 1H), 3.43-3.40 (m, 1H), 1.01 (s, 9H).
[0143] Step 3: To a solution of 3 (70.0 g, 212.1 mmol) in dry DMF (700 ml) with an inert atmosphere of nitrogen was added BnBr (91.0 g, 530.3 mmol). Then NaH (60%) (22.0 g, 530.3 mmol) at 0 °C was added in the mixture. The reaction mixture was stirred at r.t. for 30.0 min. The LCMS showed 3 was consumed. The reaction mixture to quenching in 10% citric acid aqueous solution .The organic layer was washed with brine and dried over Na2SO4. After filtration, the organic solvent was removed in vacuum and the crude residue was purified by flash column chromatography (SiO2, PE:EA=100:1) to afford the compound 4 (74.0 g, 99.3 mmol, 90.0% purity, 65.0% yield). ESI-LCMS: m / z 528.2[M+H]+. H-NMR (400 MHz, CDCl3) δ = 7.67-7.65 (m, 4H), 7.42-7.21 (m, 17H), 4.63 (s, 2H), 4.53-4.52 (m, 2H), 3.79-3.78(m, 2H), 3.74-3.69 (m, 2H), 3.68-3.61 (m, 1H), 1.05-1.04 (m, 10H).
[0144] Step 4: To a solution of 4 (74.0 g, 145.1 mmol) in THF (370.0 mL) was added. Then TBAF (56.8 g, 217.6 mmol) was added in the mixture. Then the reaction mixture was stirred at 25℃ for 16.0 h. The LCMS showed 4 was consumed. Water (100.0 mL) was added. The product was extracted with EA (3*200.0 mL). Wash organic phase in 1 M HCL aqueous solution. The organic layer was washed with brine and dried over Na2SO4. After filtration, the organic solvent was removed in vacuo and the crude residue was purified by flash column chromatography (SiO2,PE:EA=100:1) to afford the compound 5 (27.0 g, 145.1 mmol, 90.0% 50 IPTS / 128755678.3Attorney Docket No. BCR-010WO purity, 65.0% yield). As colorless transparent oil which was used directly for the next step. ESI-LCMS: m / z 295.3[M+H]+.1H-NMR (400 MHz, CDCl3-d) δ = 7.35-7.23 (m, 10H), 4.71- 4.62 (m, 2H), 4.59-4.49 (m, 2H), 3.76-3.57 (m, 5H), 2.19 (s, 1H).
[0145] Step 5: To a solution of 5 (34.0 g, 125.0 mmol) in DCM (340 mL) was added paraformaldehyde (12.0 g, 137.5 mmol) at r.t. The mixture solution was stirred at 0°C under HCl for 6.0 h. The mixture was added CaCl2(34.0 g) and the mixture was stirred for 20.0 min. Then the mixture solution was filtered and the filtrate was concentrated under reduced pressure. This resulted in to give 6 (41.0 g) as a red oil which was used directly for the next step. ESI-LCMS: m / z 320.2[M+H]+
[0146] Step 6: To a solution of 6 (10.5 g, 93.8 mmol) in DCE (200.0 mL) was added BSA (38.0 g, 187.5 mmol) at 25 °C. The mixture solution was refluxed at 80 ℃ for 30 min till a clear solution was formed. To the mixture solution was added TBAI (3.5 g, 4.0 mmol) and 6 (30.0 g, 93.8 mmol) in DCE (10.0 mL) at 25°C. The mixture solution was refluxed at 80 °C for 3.0 h. TLC and LCMS show 10 was completely consumed. Then the solution was added water (2 L), the product was extracted with DCM, and was washed with water. Then washed the organic phase once with saturated brine and dried over by Na2SO4. After filtration, the organic solvent was removed in vacuo and the crude residue was purified by flash column chromatography (SiO2, PE:EA=10:1) to afford the compound 7 (15.0 g, 37.9 mmol, 90.0% purity,40.0% yield). ESI-LCMS: m / z 414.2[M+H]+;1H-NMR (400 MHz, DMSO-d6) δ = 7.71-7.69 (m, 1H), 7.36-7.27 (m, 10H), 5.62-5.61 (m, 1H), 5.12 (s, 2H), 4.59- 4.50 (m, 2H), 4.48-4.45 (m, 2H), 3.73-3.37(m, 5H).
[0147] Step 7: To a solution of 7 (18.0 g, 45.5 mmol) in MeOH (180.0 mL) was added Pd(OH)2 / C (9 g) at 25 °C. The mixture solution was stirred under H2at 25 °C for 3.0 h. LC-MS show SM was completely consumed. Then the mixture solution was filtered and the filtrate was concentrated under reduced pressure. The residue was isolated by recrystallization with (PE:EA=2:1) to give 8 (8.9 g, 41.2 mmol, 90.0% yield) as a white solid. ESI-LCMS: m / z 217.2[M+H]+,1H-NMR (400 MHz, DMSO-d6) δ = 11.3(s, 1H), 7.70-7.68 (m, 1H), 5.62-5.59 (m, 1H), 5.11-5.06 (m, 2H), 4.87 (s, 1H), 4.73 (s, 1H), 3.54-3.49(m, 2H).,3.39-3.17(m,4H).
[0148] Step 8: To a solution of 8 (9.0 g, 41.7 mmol) in pyridine (90.0 mL), was added TBSCl (7.6 g, 50.0 mmol) at 0°C under N2 atmosphere, mixture was stirred at 25°C for 3.0 h, LCMS showed 8 was consumed completely. Quenched by water (100.0 mL) and added DCM (2.0 L), the mixture was washed by water (500mL *3), the organic was concentrated and then purified by column chromatography (SiO2, DCM / MeOH = 100:1 to 10:1) to give 9 (8.0 g, 51 IPTS / 128755678.3Attorney Docket No. BCR-010WO 24.2 mmol, 90.0% purity, 60.0% yield) as solid. ESI-LCMS: m / z 331.1[M+H]+.1H-NMR (400 MHz, DMSO-d6) δ = 11.29(s, 1H), 7.68-7.66 (m, 1H), 5.59-5.57 (m, 1H), 5.07 (s, 2H), 4.81-4.19 (m, 1H), 3.56-3.31(m, 5H), 0.85-0.83(m, 8H).0.02-0.01(m, 6H).
[0149] Step 9: To a solution of 9 (2.5 g, 7.6 mmol) in pyridine (25.0 mL) with an inert atmosphere of nitrogen was added DMAP (0.9 g, 7.6 mmol) and TEA (1.3 g, 12.9 mmol). Then DMTrCl (3.8 g, 11.4 mmol) at 25 °C was added in the mixture. The mixture solution was stirred at 25 °C for 16.0 h. LC-MS show 9 was completely consumed. Then the solution was concentrated under reduced pressure. The residue was diluted with DCM (300 mL) and was washed with water. Then washed the organic phase once with saturated brine and dried over by Na2SO4. Then the solution was concentrated under reduced pressure. The residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN / H2O (0.5% NH4HCO3) = 1 / 1 increasing to CH3CN / H2O (0.5% NH4HCO3) = 1 / 0 within 20 min, the eluted product was collected at CH3CN / H2O (0.5% NH4HCO3) = 6 / 1; Detector, UV 254 nm. This resulted in to give 10 (3.3 g, 5.2 mmol, 90.0% purity, 70.0% yield) as a white solid. ESI-LCMS: m / z 631.2[M-H]-.1H- NMR (400 MHz, DMSO-d6) δ = 11.01(s, 1H), 7.76-7.74 (m, 1H), 7.54-7.32 (m, 9H), 6.99- 6.97 (m, 4H), 5.70-5.68(m, 1H), 5.16-5.09(m, 2H), 3.85(s, 6H)., 3.54-3.42(m,1H), 3.41- 3.38(m,3H), 3.13-3.09(m,1H), 0.91-0.88(m,9H), 0.01-0(m,6H).
[0150] Step 10: To a solution of 10 (3.3 g,5.2 mmol) in THF (33.0 mL) was added Triethylamine trihydrofluoride (1.4 g, 8.9 mmol) at 25°C under N2 atmosphere, the mixture was stirred at 50°C for 16.0 h. LCMS showed 10 was consumed completely. The organic solvent was removed in vacuo and the crude residue was purified by flash column chromatography (SiO2,DCM:MeHO=100:1) to give 11 (2.4 g, 90.0% purity, 90.0% yield) as a white solid. ESI-LCMS: m / z 517.2[M-H]-.
[0151] Step 11: To a solution of 11 (2.5g, 4.8 mmol) in dichloromethane (25.0 mL) with an inert atmosphere of nitrogen was added CEOP[N(iPr)2]2 (2.2g, 7.2 mmol) and DCI (0.5g, 4.3 mmol) in order at room temperature. The resulting solution was stirred for 1.0 h at room temperature and diluted with 50 mL dichloromethane and washed with 2 x 50 mL of saturated aqueous sodium bicarbonate and 1 x 50 mL of saturated aqueous sodium chloride respectively. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated till no residual solvent left under reduced pressure. The residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN / H2O (0.5% NH4HCO3) = 1 / 1 increasing to CH3CN / H2O (0.5% NH4HCO3) = 1 / 0 within 20 min, the eluted product was collected at CH3CN / H2O (0.5% 52 IPTS / 128755678.3Attorney Docket No. BCR-010WO NH4HCO3) = 6 / 1; Detector, UV 254 nm. This resulted in to give Monomer 5 (2.4 g, 98.0% purity, 70.0% yield) as an white solid. ESI-LCMS: m / z 719.2[M+H]+ 1H-NMR (400 MHz, DMSO-d6): δ=11.44 (s, 1H), 7.61-7.59 (m, 1H), 7.42-7.19 (m, 9H), 6.89-6.85 (m, 4H), 5.58- 5.56 (m, 1H), 5.01-4.95 (m, 2H), 3.69-3.61 (m, 8H), 3.51-3.45(m, 3H), 3.28-3.21 (m, 3H), 2.73-2.66 (m, 2H), 1.23-1.00 (m, 12H);31P-NMR (162 MHz, DMSO-d6): δ =147.09,146.70. EXAMPLE 6. Preparation of Monomer 6an inert atmosphere of nitrogen was added PPh3(6.4 g, 24.2 mmol) and Benzoic acid(2.9 g, 24.2 mmol). Then DIAP (4.9 g, 24.2 mmol) at 0°C was added in the mixture. The reaction mixture was stirred at r.t. for 3h. The LCMS showed 10 was consumed. The solution was concentrated and extracted by DCM (100.0 mL *3) and the organic was washed by brine. Then washed the organic phase once with saturated brine and dried over by Na2SO4. After filtration, then the solution was concentrated under reduced pressure. The residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN / H2O (0.5% NH4HCO3) = 1 / 1 increasing to CH3CN / H2O (0.5% NH4HCO3) = 1 / 0 within 20 min, the eluted product was collected at CH3CN / H2O (0.5% NH4HCO3) = 6 / 1; Detector, UV 254 nm. This resulted in to give 11b (5.4 g, 12.4 mmol, 80.0% purity, 80.0% yield). As white solid which was used directly for the next step. ESI-LCMS: m / z 433.2 [M-H]-.1H-NMR (400 MHz, DMSO-d6): δ=11.33 (s, 1H), 53 IPTS / 128755678.3Attorney Docket No. BCR-010WO 7.95-7.92 (m, 2H), 7.69-7.64 (m, 2H), 7.54-7.51 (m, 2H), 5.57-5.55 (m, 1H), 55.15-5.09 (m, 3H), 3.82-3.76 (m, 4H), 2.51-2.49(m, 3H), 0.83-0.79 (m, 9H), 0.05 (m, 7H).
[0153] Step 2: To a solution of 11b (6.4 g, 14.7 mmol) in Amino methane (64.0 mL) was mixture solution was stirred at 25 °C for 16.0 h. LC-MS show 11b was completely consumed. Then the mixture solution was filtered and the filtrate was concentrated under reduced pressure. The residue was isolated by recrystallization with (PE:EA=40:1) to give 12b(4.0 g, 12.1 mmol,90.0% purity, 80.0% yield) as a white solid. ESI-LCMS: m / z 329.2[M- H]-.1H-NMR (400 MHz, DMSO-d6): δ=11.33 (s, 1H), 7.68-7.66 (m, 1H), 5.60-5.57 (m, 1H), 5.08 (s, 2H), 3.56-3.28 (m, 5H), 0.83-0.79 (m, 9H), 0.05-0 (m, 6H).
[0154] Step 3: To a solution of 12b (3.7 g, 11.2 mmol) in pyridine (37.0 mL) with an inert atmosphere of nitrogen was added DMAP (1.4 g, 11.2 mmol) and TEA (1.9 g, 19.1 mmol). Then DMTrCl (5.7 g, 16.9 mmol) at 25 °C was added in the mixture. The mixture solution was stirred at 25 °C for 16.0 h. LC-MS show 12b was completely consumed. Then the solution was concentrated under reduced pressure. The residue was diluted with DCM (300 mL) and was washed with water. Then washed the organic phase once with saturated brine and dried over by Na2SO4. Then the solution was concentrated under reduced pressure. The residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN / H2O (0.5% NH4HCO3) = 1 / 1 increasing to CH3CN / H2O (0.5% NH4HCO3) = 1 / 0 within 20 min, the eluted product was collected at CH3CN / H2O (0.5% NH4HCO3) = 6 / 1; Detector, UV 254 nm. This resulted in to give 13b (2.4 g, 3.8 mmol, 90.0% purity, 30.0% yield) as a white solid. ESI-LCMS: m / z 631.3 [M-H]-.
[0155] Step 4: To a solution of 13b (2.4 g,3.8 mmol) in THF (24.0 mL) was added Triethylamine trihydrofluoride (1.0 g, 6.5 mmol) at 25°C under N2atmosphere, the mixture was stirred at 50°C for 16.0 h. LCMS showed 12b was consumed completely. The organic solvent was removed in vacuo and the crude residue was purified by flash column chromatography (SiO2, DCM:MeHO=100:1) to give 14b (1.7 g, 90.0% purity, 85.0% yield) as a white solid. ESI-LCMS: m / z 517.2 [M-H]-.1H-NMR (400 MHz, DMSO-d6): δ=11.34 (m, 1H), 7.61-7.41 (m, 1H), 7.39-7.19 (m, 10H), 6.86-6.83(m, 2H), 5.58-5.56 (m, 1H), 4.96- 4.95 (m, 2H), 4.49-4.46 (m, 1H), 3.73(s, 6H), 3.39-3.34 (m, 1H), 3.14-3.11 (m, 1H), 3.05- 3.03 (m, 3H)
[0156] Step 5: To a solution of 14b (1.7 g, 3.3 mmol) in dichloromethane (17.0 mL) with an inert atmosphere of nitrogen was added CEOP[N(iPr)2]2 (1.5 g, 4.9 mmol) and DCI (0.3 g, 2.9 mmol) in order at room temperature. The resulting solution was stirred for 1.0 h at room temperature and diluted with 50 mL dichloromethane and washed with 2 x 50 mL of 54 IPTS / 128755678.3Attorney Docket No. BCR-010WO saturated aqueous sodium bicarbonate and 1 x 50 mL of saturated aqueous sodium chloride respectively. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated till no residual solvent left under reduced pressure. The residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN / H2O (0.5% NH4HCO3) = 1 / 1 increasing to CH3CN / H2O (0.5% NH4HCO3) = 1 / 0 within 20 min, the eluted product was collected at CH3CN / H2O (0.5% NH4HCO3) = 6 / 1; Detector, UV 254 nm. This resulted in to give Monomer 6 (1.6 g, 98.0% purity, 70.0% yield) as an white solid. ESI-LCMS: m / z 717.3 [M-H]- 1H-NMR (400 MHz, DMSO-d6): δ=11.30 (s, 1H), 7.61-7.59 (m, 1H), 7.42-7.29 (m, 2H), 7.27-7.21 (m, 7H), 6.87- 6.85 (m, 4H), 5.58-5.56 (m, 1H), 4.99-4.97 (m, 2H), 3.73 (s, 6H), 3.67-3.49 (m, 2H), 3.47- 3.34 (m, 9H), 3.26-3.23 (m, 2H), 3.11-3.09 (m, 1H), 2.73-2.68 (m, 2H), 1.10-1.00 (m, 12H);31P-NMR (162 MHz, DMSO-d6): δ =147.10,146.71. EXAMPLE 7. Synthesis of Doubled-Stranded siRNA Compounds.
[0157] Exemplary siRNA compounds prepared using the were structures of Examples 1-6 prepared with the following procedure:
[0158] Sense and antisense strand sequences of siRNAs were synthesized using oligonucleotide synthesizers following a standard solid phase synthesis protocol based on phosphoramidite chemistry. The ligand-CPG succinates were used as solid supports continued by two incorporations of the ligand phosphoramidites. Crude single strand product was isolated by lyophilization and purified by ion pairing reversed phase HPLC (IP- RPHPLC). Purified single strand oligonucleotide product from IP-RP-HPLC was converted to sodium salt by addition of NaOAc followed by desalting. Annealing of equimolar complementary sense stand and antisense strand oligonucleotide was carried out in nuclease- free water to form the double strand siRNAs, followed by a lyophilization procedure.
[0159] Exemplary compounds prepared by the above procedures are shown in Tables 1, 2, 7, 8, 10, and 11. EXAMPLE 8. Protocol for ANGPTL3 in vitro assay using modified siRNA 55 IPTS / 128755678.3Attorney Docket No. BCR-010WO
[0160] Purpose: To screen for siRNA-based inhibition of the ANGPTL3 gene in primary human hepatocyte (PHH) cells using modified siRNA comprising a modified sugar or TNA analog.
[0161] Protocol: PHH cells were treated with L96 GalNAc conjugated, modified siRNAs by free uptake for 48h at 10 nM and 1 nM. Sequences of exemplary, unmodified and modified siRNA compounds are shown in Table 1 (Sequence 1 siRNAs) and Table 2 (Sequence 2 siRNAs), respectively. ANGPTL3 mRNA level was measured by quantitative PCR and normalized to GAPDH relative to mock treated control cells.
[0162] Table 3 and FIG.1 (Sequence 1) and Table 4 and FIG.2 (Sequence 2) show the results of single dose screens at 10 nM and 1 nM in PHH cells using the selected ANGPTL3 siRNAs. The data are presented as percent inhibition of ANGPLT3 mRNA in the cells transfected with siRNAs relative to ANGPTL3 mRNA in the mock treated control cells. Table 1. Exemplary unmodified and modified-sugar Sequence 1 siRNA L96 conjugatesAttorney Docket No. BCR-010WO Modified siRNA nucleotide sugar, wherein B is the nucleotide base uracil (nucleotide abbreviation: tmU) or cytosine (nucleotide abbreviation tmC) Compound Sense strand (5’ to 3’) SEQ Antisense strand (5’ to 3’) SEQ ID ID ID NO: NO: 45678 9 0 1 2 3 45678 9 0; p p ; p vinyl “(tmU)” represents an siRNA nucleotide with a modified sugar and a uracil base; “(tmC)” represents an siRNA nucleotide with a modified sugar and a cytosine base; “(L96)” represents L96 ligand. Table 2. Exemplary Sequence 2 siRNA L96 conjugates 57 IPTS / 128755678.3Attorney Docket No. BCR-010WOutA) Compound Sense strand (5’ to 3’) SEQ Antisense strand (5’ to 3’) SEQ ID ID ID :modification with 2-OMe; capital letter represents modification with 2-F; v represents vinyl phosphonate; “(utA)” represents a TNA analog with an adenine base; “(L96)” represents L96 ligand. 58 IPTS / 128755678.3Attorney Docket No. BCR-010WO Table 3. Sequence 1 siRNA in vitro knockdown (KD) results Compound ID Free uptake in PHH % KD at 10 nM at 1 nMTable 4. Sequence 2 siRNA in vitro knockdown (KD) results Compound ID Free uptake in PHH % KD59 IPTS / 128755678.3Attorney Docket No. BCR-010WO BCR-0000865 85 40Study
[0163] Purpose: To test modified siRNAs conjugated with GalNAc L96 ligand (L96) targeting ANGPTL3 in wildtype mice.
[0164] Protocol: All GalNAc conjugated, modified siRNA were administrated subcutaneously at 1 mg / kg, with PBS as a negative control. The expression of mouse ANGPTL3 was measured 7 days post dosing by enzyme-linked immunosorbent assay (ELISA). Data showed as ANGPTL3 protein expression relative to pretreatment (Day-1).
[0165] Table 5 and FIG.3 (Sequence 1) and Table 6 and FIG.4 (Sequence 2) show the in vivo knockdown results in mice when dosed at 1 mg / kg using the selected ANGPTL3 siRNAs after 7 days. The data are presented as percent of ANGPLT3 mRNA knockdown. Table 5. Sequence 1 siRNA in vivo knockdown (KD) results Compound ID % in vivo KD at Day 7Table 6. Sequence 2 siRNA in vivo knockdown (KD) results Compound ID % in vivo KD at Day 760 IPTS / 128755678.3Attorney Docket No. BCR-010WO BCR-0000515 68 BCR-0000859 71ility studies
[0166] Purpose: To test the stability of modified siRNA against nuclease activity.
[0167] Protocol: Oligonucleotide (Table 7) was added at 0.1 mg / ml to a solution of 50 mM Tris–HCl (pH 7.2) and 10 mM MgCl2.3’-nuclease stability of oligonucleotide sequence 1 (control) and oligonucleotide sequence 2 was evaluated in the presence of snake venom phosphodiesterase (SVPD). SVPD was added to the oligonucleotide at 750 mU / ml and the percentage of full-length oligonucleotide was measured over a period of 25 hours.5’- nuclease stability of oligonucleotide sequence 3 (control) and oligonucleotide sequence 4 was evaluated in the presence of phosphodiesterase II (PDII) from bovine spleen. PDII was added at 500 mU / ml and the percentage of full-length oligonucleotide was measured over a period of 75 hours.
[0168] FIG.5 depicts the stability of oligonucleotide sequence 1 (control) and oligonucleotide sequence 2 in the presence of SVPD. The data demonstrate that oligonucleotide comprising a 3’ uracil nucleotide with a modified sugar (i.e., tmU) had improved 3’-exonuclease stability when compared to control oligonucleotide comprising a 3’ uracil nucleotide with a 2’OMe modification.
[0169] FIG.6 depicts the stability of oligonucleotide sequence 3 (control) and oligonucleotide sequence 4 in the presence of PDII. The data demonstrate that oligonucleotide comprising two sequential 5’ uracil nucleotides with modified sugar (i.e., tmU) was completely stable against 5’-exonuclease degradation, whereas control oligonucleotide comprising two 5’ uracil nucleotides with a 2’OMe modification was not.
[0170] Overall, the data demonstrate that uracil nucleotides with modified sugars greatly increase 5’ and 3’ nuclease stability compared to uracil nucleotides comprising a 2’OMe-modification.
[0171] 61 IPTS / 128755678.3Attorney Docket No. BCR-010WO Table 7. Modified oligonucleotides for testing 3’-nuclease and 5’-nuclease stability MeO O B Modified siRNA nucleotidebase uracil (nucleotide abbreviation: tmU) Oligonucleotide ID Oligonucleotide strand (5’ to 3’) SEQ ID NO:“(tmU)” represents a nucleotide with a modified sugar and a uracil base. EXAMPLE 11. Protocol for in vivo AGT-HDI model
[0172] Purpose: To test the potency of siRNA modified at position AS6 compared to GNA in Zilebesiran.
[0173] Protocol: 6–8-week-old male C57 mice were subcutaneously injected with a GalNAc-conjugated AGT siRNA (Table 8) at 1 or 3 mg / kg. Three days post injection, the mice are hydrodynamically injected with a DNA plasmid encoding the full-length human AGT transcript. One day after the injection of the plasmid, liver samples were harvested and analyzed for AGT mRNA expression relative to mice treated with the same volume of PBS. The values are normalized to Neo gene included in the plasmid.
[0174] FIG.7 and Table 9 show the results of single dose AGT siRNAs at 1 and 3 mg / kg in the wildtype mice hydrodynamic injected with DNA plasmid encoding the full- length human AGT transcript. The data are presented as percent of remaining AGT mRNA in 62 IPTS / 128755678.3Attorney Docket No. BCR-010WO the liver relative to PBS treated animals. The data demonstrate that modification of Zilebesiran at position AS6 with utU greatly improves potency compared to GNA. Modification of Zilebesiran with utnsU and utnrU at position AS6 retained potency when compared to GNA. Table 8. GalNAc L96-conjugated, AS6-modified AGT-targeting siRNA sequences2’OMe-modified nucleotide component with a uracil base 63 IPTS / 128755678.3Attorney Docket No. BCR-010WO O MeO ONNHModified siRNAabbreviation: tmU) O TNAutU) O TNA analogutnsU) OTNA analog a utnrU) Compound Sense strand (5’ to 3’) SEQ Antisense strand (5’ to 3’) SEQ ID ID ID O: 9 064 IPTS / 128755678.3Attorney Docket No. BCR-010WO BCR- g*u*caucCaCAAugagaguaca(L96) 32 u*G*uac(tmU)cucauugUgGaugac*g*a81 0000839 BCR- g*u*caucCaCAAugagaguaca(L96) 33 u*G*uac(utU)cucauugUgGaugac*g*a82 3 4a thymidine-glycol nucleic acid, i.e., GNA from above; (tmU) represents an siRNA nucleotide with a modified sugar and a uracil base, i.e., tmU from above; “(utU)” represents a TNA analog with a uracil base, i.e., utU from above; “(utnsU)” represents a TNA analog with a uracil base, i.e., utnsU from above; “(utnrU)” represents a TNA analog with a uracil base, i.e., utnrU from above; “(L96)” represents L96 ligand. Table 9. GalNAc L96-conjugated, AS6-modified AGT-targeting siRNA sequences hydrodynamic injection (HDI) results Compound ID Modification % AGT expression in % AGT expression in liver 1 mg / kg liver 3 mg / kgEXAMPLE 12. Protocol for RNASeq analysis of gene expression
[0175] Purpose: To test off-target binding of siRNAs modified at position AS6 compared to GNA in Zilebesiran.
[0176] Protocol: Primary human hepatocytes (PHH) were incubated for 48 hours with PBS (negative control) or 100nM GalNAc L96-conjugated modified AS6-modified AGT-targeting siRNA sequences comprising either (1) a 2’OMe modification at position AS6 (BCR-0000838), (2) a GNA at position AS6 (BCR-0000542), or (3) a utU modification at position AS6 (BCR-0000840). After free uptake of siRNA, RNASeq analysis of differentially expressed genes in PHH was performed using standard methods to determine the off-target profiles for each siRNA tested.
[0177] FIG.8 shows the results of RNASeq analysis in PHH after free uptake of modified AS6-modified AGT-targeting siRNA. The data are presented as plot of the level of 65 IPTS / 128755678.3Attorney Docket No. BCR-010WO significance of each gene (i.e., Log10(adjusted p value)) plotted as a function of the difference between the levels of expression of each gene (i.e., Log2(Fold Change)). Differentially expressed genes (DEG) were determined using an adjusted p value (p.adj) < 0.05 as cutoff. The data demonstrate that modification at position AS6 with 2’OMe showed significant off-target risk (i.e., 37 DEG). By comparison, GNA at position AS6 improves off- target gene expression (i.e., 9 DEG) profiles relative to 2’OMe at position AS6. Modification at position AS6 utU further improves off-target gene expression (i.e., 3 DEG) profiles compared to GNA. EXAMPLE 13. Protocol for ANGPTL3 in vitro assay using 2’-spirocyclopropyl- modified siRNAs
[0178] Purpose: To screen for siRNA-based inhibition of the ANGPTL3 gene in primary human hepatocyte (PHH) cells using 2’-spirocyclopropyl-modified siRNAs.
[0179] Protocol: PHH cells were treated with L96 GalNAc conjugated, 2’- spirocyclopropyl-modified siRNAs by free uptake for 48h at 5 nM and 1 nM. Sequences of exemplary, modified siRNA compounds are shown in Table 10 (Sequence 1 siRNAs) and Table 11 (Sequence 2 siRNAs), respectively. ANGPTL3 mRNA level was measured by quantitative PCR and normalized to GAPDH relative to mock treated control cells.
[0180] Table 12 and FIG.9 (Sequence 1) and Table 13 and FIG.10 (Sequence 2) show the results of single dose screens at 5 nM and 1 nM in PHH cells using the selected ANGPTL3 siRNAs. The data are presented as average percent inhibition of ANGPLT3 mRNA in the cells transfected with siRNAs relative to ANGPTL3 mRNA in the mock treated control cells. Table 10. Exemplary 2’-spirocyclopropyl-modified and unmodified Sequence 1 siRNA OB2’-spirocyclopropyl-modified siRNA nucleotide sugar, wherein B is the nucleotide base uracil (nucleotide abbreviation: cypU) or cytosine (nucleotide abbreviation cypC) 66 IPTS / 128755678.3Attorney Docket No. BCR-010WO Compound Sense strand (5’ to 3’) SEQ Antisense strand (5’ to 3’) SEQ ID ID ID NO: NO:vinyl phosphonate; “(cypU)” represents an siRNA nucleotide with a 2’-spirocyclopropyl- modified sugar and uracil base; “(cypC)” represents an siRNA nucleotide with a 2’- spirocyclopropyl-modified sugar and cytosine base. Table 11. Exemplary 2’-spirocyclopropyl-modified and unmodified Sequence 2 siRNA OOB2’-spirocyclopropyl-modifiedwherein B is the nucleotide base uracil (nucleotide abbreviation: cypU) or cytosine (nucleotide abbreviation cypC) Compound Sense strand (5’ to 3’) SEQ Antisense strand (5’ to 3’) SEQ ID ID ID :67 IPTS / 128755678.3Attorney Docket No. BCR-010WO BCR- G*c*caaaauCAAgauuugcuaa(L96) 50 vu*U*agcAaAucuugAu(cypU)uuggc*99 00001056 u*c BCR- G*c*caaaauCAAgauuugcuaa(L96) 51 vu*U*agcAaA(cypU)cuugAuUuuggc*100 1 2vinyl phosphonate; (cypU) represents an siRNA nucleotide with a 2 -spirocyclopropyl- modified sugar and uracil base; “(cypC)” represents an siRNA nucleotide with a 2’- spirocyclopropyl-modified sugar and cytosine base. Table 12.2’-spirocyclopropyl-modified and unmodified Sequence 1 siRNA % inhibition in vitro Compound ID Average Inhibition % Standard Deviation (SD)Table 13.2’-spirocyclopropyl-modified and unmodified Sequence 2 siRNA % inhibition in vitro Compound ID Average Inhibition % Standard Deviation (SD)68 IPTS / 128755678.3Attorney Docket No. BCR-010WO BCR-00001056 70.01 32.84 2.48 4.92 BCR-00001057 3494 212 1312 482propyl- modified siRNAs
[0181] Purpose: To test modified siRNA targeting of ANGPTL3 in wildtype mice using 2’-spirocyclopropyl-modified siRNAs.
[0182] Protocol: All 2’-spirocyclopropyl-modified siRNA were administrated subcutaneously at 1 mg / kg, with PBS as a negative control. The expression of mouse ANGPTL3 was measured 7, 14, 21 and 28 days post dosing by enzyme-linked immunosorbent assay (ELISA). Data showed as ANGPTL3 protein expression relative to pretreatment (Day-1).
[0183] FIG.11 (Sequence 1) and FIG.12 (Sequence 2) depict comparison of ANGPTL3 reduction in wild-type mice for exemplary 2’-spirocyclopropyl-modified siRNA against unmodified control when dosed at 1 mg / kg. EXAMPLE 15. In Vitro Dose Response Concentration (DRC) Studies of Exemplary siRNA Compounds
[0184] This example describes INHBE DRC studies of exemplary tri-GalNAc6 modified INHBE siRNA compounds in primary human hepatocyte (PHH) cells in a single dose screen. In the concentration studies, EC50 of 10 siRNAs was measured by free uptake (over 48 hours) in PHH under 9 concentrations (maximum 100 nM, 3-fold dilution).
[0185] Table 14 below provides the modified siRNA compounds studied. Table 15 provides the unmodified sense and antisense sequences of the compounds shown in Table 14. Table 16 provides IC50and maximal inhibition values for the exemplary compounds. FIGS. 13A, 13B, 13C, 13D, 13E, 13F, 13G, 13H, 13I, and 13J show percent inhibition INHBE dose-response plots of siRNA compounds of Table 14.
[0186] Table 14. Exemplary tri-GalNAc6 modified INHBE siRNA compounds. The structure of tri-GalNAc6 in the exemplary siRNA compounds is provided below: 69 IPTS / 128755678.3Attorney Docket No. BCR-010WO siRNAutA) 70 IPTS / 128755678.3Attorney Docket No. BCR-010WO Comp SEQ SEQ ound Sense 5'-3' (modified) ID Antisense 5'-3' (modified) ID ID NO: NO: 7 8 9 0 1 1 1 2 3 4 =5-E-Vinyl-phosphonate; (utA) = a TNA analog with a adenine base, i.e., utA from above; (L6) = tri-GalNAc6 ligand.
[0187] Table 15. Unmodified sense and antisense strand sequences of exemplary siRNA compounds from Table 14. Compound ID Sense 5'-3' SEQ Antisense 5'-3' SEQ ID (unmodified) ID NO: (unmodified) NO:71 IPTS / 128755678.3Attorney Docket No. BCR-010WO Compound ID Sense 5'-3' SEQ Antisense 5'-3' SEQ ID (unmodified) ID NO: (unmodified) NO: BCR-0001541GGCUUAUACTUUCUUAAUA116 UUAUUAAGAAAGUAUAAGCCAG 117INHBE INHBE maximal Compound ID inhibition72 IPTS / 128755678.3
Claims
Attorney Docket No. BCR-010WO CLAIMS 1. A double-stranded compound comprising a sense strand and an antisense strand, wherein the sense strand or the antisense strand comprises one or more independent occurrences of: (a) a modified nucleotide component represented by Formula (I): O B1 ;(b) a modified nucleotide component represented by Formula (IIa) or Formula (IIb):(c) a modified nucleotide component represented by Formula (III): orFormula (III) (d) a modified nucleotide component represented by Formula (IV): 73 IPTS / 128755678.3Attorney Docket No. BCR-010WOwherein: each of B1, B2, B3, and B4is a nucleobase; R1and R2are taken together to the carbon to which they are attached to form optionally substituted C3–6 cycloalkyl; and R3is selected from the group consisting of hydrogen and C1–6 alkyl.
2. The double-stranded compound of claim 1, wherein each of B1, B2, B3, and B4is independently selected from the group consisting of adenine, uracil, thymine, cytosine, guanine, and modified analogs thereof.
3. The double-stranded compound of claim 1, wherein each of B1, B2, B3, and B4is independently selected from uracil, cytosine, and modified analogs thereof.
4. The double-stranded compound of claim 1, wherein R1and R2, taken together with the carbon atom to which they are attached, form cyclopropyl.
5. The double-stranded compound of claim 1, wherein R3is C1–6alkyl.
6. The double-stranded compound of claim 1, wherein R3is -CH3.
7. The double-stranded compound of claim 1, wherein only the sense strand comprises the one or more independent occurrences of the modified nucleotide component of Formula (I), the modified nucleotide component of Formula (II), the modified nucleotide component of Formula (III), or the modified nucleotide of Formula (IV).
8. The double-stranded compound of claim 1, wherein only the antisense strand comprises the one or more independent occurrences of the modified nucleotide component of 74 IPTS / 128755678.3Attorney Docket No. BCR-010WO Formula (I), the modified nucleotide component of Formula (II), the modified nucleotide component of Formula (III), or the modified nucleotide component of Formula (IV).
9. The double-stranded compound of claim 1, wherein each of the sense strand and the antisense strand comprises one or more independent occurrences of the modified nucleotide component of Formula (I), the modified nucleotide component of Formula (II), the modified nucleotide component of Formula (III), or the modified nucleotide component of Formula (IV).
10. The double-stranded compound of claim 1, wherein the sense strand comprises at least one modified nucleotide component selected from the group consisting of a 2'-deoxy-2'- fluoro modified nucleotide component, a 2'-deoxy-modified nucleotide component, a locked nucleotide, an abasic nucleotide, a 2’-amino-modified nucleotide component, a 2’-alkyl- modified nucleotide component, a morpholino nucleotide, a phosphoramidate, and a non- natural base comprising nucleotide.
11. The double-stranded compound of claim 1, wherein the antisense strand comprises at least one modified nucleotide component selected from the group consisting of a 2'-deoxy-2'- fluoro modified nucleotide component, a 2'-deoxy-modified nucleotide component, a locked nucleotide, an abasic nucleotide, a 2’-amino-modified nucleotide component, a 2’-alkyl- modified nucleotide component, a morpholino nucleotide, a phosphoramidate, and a non- natural base comprising nucleotide.
12. The double-stranded compound of claim 1, wherein the sense strand comprises at least one internucleoside linkage selected from the group consisting of a phosphorothioate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoromorpholidate linkage, a phosphoropiperazidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage.
13. The double-stranded compound of claim 1, wherein the antisense strand comprises at least one internucleoside linkage selected from the group consisting of a phosphorothioate 75 IPTS / 128755678.3Attorney Docket No. BCR-010WO linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoromorpholidate linkage, a phosphoropiperazidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage.
14. The double-stranded compound of claim 1, wherein the sense strand comprises a sequence of at least 15 contiguous nucleotides comprising the one or more independent occurrences of the modified nucleotide component of Formula (I), the modified nucleotide component of Formula (II), the modified nucleotide component of Formula (III), or the modified nucleotide component of Formula (IV).
15. The double-stranded compound of claim 1, wherein the sense strand comprises a sequence of 21 contiguous nucleotides comprising the one or more independent occurrences of the modified nucleotide component of Formula (I), the modified nucleotide component of Formula (II), the modified nucleotide component of Formula (III), or the modified nucleotide component of Formula (IV).
16. The double-stranded compound of claim 1, wherein the antisense strand comprises a sequence of at least 15 contiguous nucleotides comprising the one or more independent occurrences of the modified nucleotide component of Formula (I), the modified nucleotide component of Formula (II), the modified nucleotide component of Formula (III), or the modified nucleotide component of Formula (IV).
17. The double-stranded compound of claim 1, wherein the antisense strand comprises a sequence of 23 contiguous nucleotides comprising the one or more independent occurrences of the modified nucleotide component of Formula (I), the modified nucleotide component of Formula (II), the modified nucleotide component of Formula (III), or the modified nucleotide component of Formula (IV).
18. The double-stranded compound of claim 14, wherein the sequence shares at least 80% identity with an equal length portion of SEQ ID NO: 1, SEQ ID NO: 18, SEQ ID NO: 30, SEQ ID NO: 36, SEQ ID NO: 44, SEQ ID NO: 54, SEQ ID NO: 71, SEQ ID NO: 80, SEQ ID NO: 85, SEQ ID NO: 93, or SEQ ID NO:
91. 76 IPTS / 128755678.3Attorney Docket No. BCR-010WO 19. The double-stranded compound of claim 1, wherein the modified nucleotide component is represented by Formula (III-a):wherein n is from 1 to 3.
20. The double-stranded compound of claim 19, wherein n is 1.
21. The double-stranded compound of claim 1, further comprising a ligand or targeting moiety.
22. The double-stranded compound of claim 21, wherein the ligand or targeting moiety is conjugated to the 5’ end, 3’ end or both ends of the dsRNA.
23. The double-stranded compound of claim 21, wherein the ligand or targeting moiety is conjugated to the 3’ end of the sense strand of the dsRNA.
24. The double-stranded compound of claim 21, wherein the ligand or targeting moiety comprises at least one N-Acetyl-Galactosamine (GalNAc).
25. The double-stranded compound of claim 21, wherein the ligand or targeting moiety is L96.
26. The double-stranded compound of claim 21, wherein the ligand or targeting moiety is represented by Formula (A): 77 IPTS / 128755678.3Attorney Docket No. BCR-010WOor a pharmaceutically acceptable salt thereof, wherein: A1is the point of attachment to the double-stranded compound; each occurrence of T1and T2is independently selected from 5-membered heterocyclyl and alkylene; each occurrence of X is selected from the group consisting of -OH and -SH; and each occurrence of L is a linker; LAis absent or a linker; and n is an integer from 1 to 6.
27. The double-stranded compound of claim 21, wherein the ligand or targeting moiety is tri-GalNAc6.
28. A double-stranded compound selected from the group consisting of BCR-0000507, BCR-0000843, BCR-0000844, BCR-0000845, BCR-0000846, BCR-0000847, BCR- 0000848, BCR-0000849, BCR-0000850, BCR-0000851, BCR-0000852, BCR-0000853, 78 IPTS / 128755678.3Attorney Docket No. BCR-010WO BCR-0000854, BCR-0000855, BCR-0000856, BCR-0000857, BCR-0000858, BCR- 0000515, BCR-0000859, BCR-0000860, BCR-0000861, BCR-0000862, BCR-0000863, BCR-0000864, BCR-0000865, BCR-0000542, BCR-0000838, BCR-0000839, BCR- 0000840, BCR-0000841, BCR-0000842, BCR-0001044, BCR-0001045, BCR-0001046, BCR-0001047, BCR-0001048, BCR-0001049, BCR-0001050, BCR-0000515, BCR- 00001051, BCR-00001052, BCR-00001053, BCR-00001054, BCR-00001055, BCR- 00001056, BCR-00001057, BCR-00001058, and BCR-00001059.
29. A pharmaceutical composition comprising the double-stranded compound of claim 1 and a pharmaceutically acceptable excipient.
30. A method of treating a disorder in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of the double-stranded compound of claim 1.
31. The method of claim 31, wherein the disorder is a liver disorder.
32. The method of claim 32, wherein the disorder is selected from the group consisting of non-alcoholic fatty liver disease (NAFLD), obesity, hypertension, and hypercholesteremia.
33. The method of claim 33, wherein the NAFLD is non-alcoholic steatohepatitis (NASH).
34. A method of treating a disease mediated by expression of ANGPTL3 or AGT in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of the double-stranded compound of claim 1.
35. The method of claim 30, comprising administering to the patient one or more additional therapeutic agents. 79 IPTS / 128755678.3
Citation Information
Patent Citations
RNAi Agents And Compositions for Inhibiting Expression of Angiopoietin-Like 3 (ANGPTL3), And Methods Of Use
US20210238602A1
Modified Short Interfering Nucleic Acid (siNA) Molecules and Uses Thereof
US20220177888A1
Double stranded RNA targeting angiopoietin-like 3 (angptl-3) and methods of use thereof
US20230159930A1
Compositions and methods for inhibiting angptl3 expression
US20230287425A1
Modified double stranded RNA agents
WO2024173593A1