Vesicular stomatitis virus lassa virus vaccine
Patent Information
- Application Number
- PCT/US2024/054348
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-29
- Filing Date
- 2024-11-04
- Publication Date
- 2025-07-24
AI Technical Summary
Current prophylactic vaccines for Lassa fever are not available, and existing experimental vaccines based on chemically inactivated Lassa virus particles failed to protect animals from disease, highlighting the need for an effective vaccine that can induce neutralizing antibodies targeting the Lassa virus glycoprotein complex.
Development of a recombinant vesicular stomatitis virus (VSV) vaccine vector (VSVAG-LASV-GPC) that encodes a glycoprotein complex (GPC) from Lassa virus, which is designed to mimic the native viral glycoproteins and stimulate an immune response.
The VSVAG-LASV-GPC vaccine has shown high efficacy in cynomolgus macaques, providing 100% protection against Lassa virus disease and inducing neutralizing antibodies that can neutralize both homologous and divergent Lassa virus strains.
Smart Images

Figure US2024054348_24072025_PF_FP_ABST
Abstract
Description
VESICULAR STOMATITIS VIRUS LASSA VIRUS VACCINERELATED APPLICATIONS AND INCORPORATION BY REFERENCE
[0001] This application claims priority to U.S. provisional patent application Serial No. 63 / 652,870, filed May 29, 2024, and U.S. provisional patent application Serial No. 63 / 596,076, filed November 3, 2023, the contents of which are hereby incorporated by reference in their entirety. All documents cited or referenced herein (“herein cited documents”), and all documents cited or referenced in herein cited documents, together with any manufacturer’s instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference, and may be employed in the practice of the invention. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.FIELD OF THE INVENTION
[0002] The present invention relates to a recombinant vesicular stomatitis virus (VSV) vaccine vector (VSVAG-LASV-GPC) encoding a glycoprotein complex (GPC) from Lassa virus (LASV).BACKGROUND OF THE INVENTION
[0003] Lassa fever is a zoonotic hemorrhagic disease caused by Lassa virus (LASV), which is an enveloped RNA virus in the Arenaviridae family. LASV is endemic in multiple western African countries, including Nigeria, Sierra Leone, Liberia, and Guinea, where its primary reservoir is the multimammate rat, but other rodents also can carry the virus. The geographic range of the animal hosts places large populations at risk of LASV infection with some estimations being 1-2 million infections per year. Although most infections are mild, symptoms of acute hemorrhagic fever are estimated to occur in about 20% of cases. It is important to emphasize that mortality is high for hospitalized patients and pregnant women and their fetuses, and that mild to severe infection can cause permanent hearing loss. In addition to being a very serious and persistent public health problem in parts of Africa, there is increasing risk of importing LASV into other regions as populations become increasingly connected by transportation. Moreover, there is the threat of LASV as well as other hemorrhagic fever viruses like Ebola virus (EBOV) and Marburg virus(MARV) being used for bioterrorism. Because of its pandemic potential, LASV is included in the WHO’s R&D Blueprint for development of diagnostics, vaccines, and treatments.
[0004] Currently, a prophylactic vaccine for use in humans is not available. Research is being conducted on LASV vaccines based on multiple technologies including plasmid DNA, virus-like particles, virus replicons, live-attenuated viruses, and various types of viral vector. Notably, experimental vaccines based on chemically inactivated LASV particles were shown to elicit immune responses in macaques but failed to protect the animals from disease following subsequent exposure to LASV indicating that the characteristics of the delivered viral immunogens play a prominent role in the development of protective anti-LASV immune responses.
[0005] A principal target of the immune response is the viral glycoprotein complex (GPC), which spans the LASV lipid envelope and is the only virion protein exposed on the surface of the intact virus particle. Functional native GPC is composed of three heterotrimers. Each heterotrimer is derived from a precursor glycoprotein that is proteolytically processed at two sites during biosynthesis (Fig. 1C) to produce the long stable signal peptide (SSP) that is incorporated in the virion envelope, the cellular receptor binding subunit GP1, and the GP2 subunit that contains the transmembrane domain and sequences that drive membrane fusion during virus entry. Importantly, multiple anti-GPC monoclonal antibodies (mAbs) that can directly neutralize LASV infectivity (nAbs) in vitro have been isolated from people that have recovered from LASV infection, and cocktails of these nAbs have been developed that can prevent disease in animals when they are infused prior to or soon after infection with a lethal dose of LASV. The preclinical efficacy of these nAbs indicate that a prophylactic vaccine capable of inducing similar antibodies will be able to prevent LASV disease.
[0006] A common feature of many of the anti-GPC nAbs is that they bind structural epitopes unique to the functional prefusion form of trimeric GPC; therefore, eliciting antibodies with similar functional properties through vaccination will require a LASV vaccine that effectively presents native viral glycoprotein structures to the immune system. Historically, vaccines based on live attenuated enveloped viruses like measles virus, mumps virus, and yellow fever virus have reliably induced nAbs because they expose the immune system to native viral glycoproteins in the context of a mild but immunostimulatory viral infection. Unfortunately, applying this proven vaccine approach to LASV presents difficult practical challenges associated with developing a safe andeffective live vaccine from highly virulent LASV; thus, multiple alternative strategies need to be pursued.
[0007] The EBOV vaccine marketed as ERVEBO® provides valuable direction for the development of a live viral vaccine against LASV GPC. ERVEBO is based on a recombinant vesicular stomatitis virus (VSV) in which the gene encoding the single natural VSV glycoprotein (VSV G; Fig. 1A) was deleted and replaced with a gene that codes for the native EBOV glycoprotein (GP). This chimeric virus (called rVSVAG-ZEBOV-GP) depends on EBOV GP to functionally substitute for VSV G and provide the cell attachment and entry functions needed for infection and propagation. Although substitution of VSV G with the heterologous EBOV glycoprotein changes cellular receptor usage and attenuates VSV replication, multiple preclinical studies showed that a single intramuscular injection with live rVSVAG-ZEBOV-GP was very efficacious as well as safe when tested in macaques. Subsequent clinical trials demonstrated that the live vaccine was highly effective when used during the large Ebola virus outbreak in 2014- 2016. Interestingly, rVSVAG-ZEBOV-GP vaccination appeared to stimulate two important elements of protective immunity that contributed to prevention of disease during the EBOV outbreak. These comprised adaptive immunity, including anti-GP serum immunoglobulin G (IgG) and nAbs that have been correlated with efficacy, and a fast-acting innate antiviral response that seemed to provide protection from disease during the period soon after vaccination when adaptive immunity was still developing. Overall, the cumulative data generated during preclinical and clinical studies with rVSVAG-ZEBOV-GP indicate that the live VSVAG chimeric virus design is an effective vaccine technology for eliciting protective antibodies targeting complex viral glycoproteins and that it will be applicable to the development of a similar vaccine against LASV GPC (Fig. 1A-C; VSVAG-LASV-GPC). In fact, considerable preclinical research has shown that VSVAG-LASV-GPC is highly efficacious in macaques, providing a compelling rationale to advance this approach for a prophylactic LASV vaccine product.
[0008] Citation or identification of any document in this application is not an admission that such document is available as prior art to the present invention.SUMMARY OF THE INVENTION
[0009] The present invention relates to a vesicular stomatitis vector (VSV) excluding a glycoprotein G gene (VSVAG) comprising and expressing a nucleic acid encoding a Lassa virus(LASV) glycoprotein complex (GPC), or a nucleic acid comprising SEQ ID NO: 1, or a nucleic acid comprising a sequence having at least 95%, or 96%, or 97% or 98% or 99% sequence identity to SEQ ID NO: 1, or a nucleic acid comprising SEQ ID NO: 2, or a nucleic acid comprising a sequence having at least 95%, or 96%, or 97% or 98% or 99% sequence identity to SEQ ID NO: 2.
[0010] In one embodiment, the nucleic acid comprises SEQ ID NO: 1, or the nucleic acid comprises a sequence having at least 95%, or 96%, or 97% or 98% or 99% sequence identity to SEQ ID NO: 1.
[0011] In one embodiments, the nucleic acid comprises SEQ ID NO: 2, or the nucleic acid comprises a sequence having at least 95%, or 96%, or 97% or 98% or 99% sequence identity to SEQ ID NO: 2.
[0012] In one embodiment, the Lassa virus serotype strain is selected from the group consisting of Lineage I, Lineage, II, Lineage III, Lineage, IV, Lineage V, Lineage VI, and Lineage VII.
[0013] In one embodiment, the LASV serotype strain comprises Lineage IV.
[0014] According to another aspect of the present invention, the present invention relates to recombinant vaccine or immunogenic composition comprising a vesicular stomatitis vector (VSV) excluding a glycoprotein G gene (VSVAG) comprising and expressing a nucleic acid encoding a Lassa virus (LASV) glycoprotein complex (GPC), or a nucleic acid comprising SEQ ID NO: 1, or a nucleic acid comprising a sequence having at least 95%, or 96%, or 97% or 98% or 99% sequence identity to SEQ ID NO: 1, or a nucleic acid comprising SEQ ID NO: 2, or a nucleic acid comprising a sequence having at least 95%, or 96%, or 97% or 98% or 99% sequence identity to SEQ ID NO: 2, and a pharmaceutically or veterinarily acceptable carrier or diluent and optionally an adjuvant.
[0015] In one embodiment, the vector of the vaccine or immunogenic composition expresses the nucleic acid comprising SEQ ID NO: 1, or the nucleic acid comprising a sequence having at least 95%, or 96%, or 97% or 98% or 99% sequence identity to SEQ ID NO: 1.
[0016] In one embodiment, the vector of the vaccine or immunogenic composition expresses the nucleic acid comprising SEQ ID NO: 2, or the nucleic acid comprising a sequence having at least 95%, or 96%, or 97% or 98% or 99% sequence identity to SEQ ID NO: 2.
[0017] According to another aspect of the present invention, the present invention relates to a cell comprising a vesicular stomatitis vector (VSV) excluding a glycoprotein G gene (VSVAG)comprising and expressing a nucleic acid encoding a Lassa virus (LASV) glycoprotein complex (GPC), or anucleic acid comprising SEQ ID NO: 1, or anucleic acid comprising a sequence having at least 95%, or 96%, or 97% or 98% or 99% sequence identity to SEQ ID NO: 1, or a nucleic acid comprising SEQ ID NO: 2, or a nucleic acid comprising a sequence having at least 95%, or 96%, or 97% or 98% or 99% sequence identity to SEQ ID NO: 2.
[0018] In one embodiment, the cell is a mammalian cell. In one embodiment, the cell is a Vero cell.
[0019] According to another aspect of the present invention, the present invention relates to a method for vaccinating or immunizing a mammal, optionally a mammal in need thereof, with the vaccine or immunogenic composition comprising the vector, comprising administering about 102- 107plaque-forming units (PFU) of the vaccine or immunogenic composition to the mammal.
[0020] In one embodiment, the method comprises administering about 102-107PFU of the vaccine or immunogenic composition comprising the vector to the mammal, wherein the vector expresses the nucleic acid comprising SEQ ID NO: 1, or the nucleic acid comprising a sequence having at least 95%, or 96%, or 97% or 98% or 99% sequence identity to SEQ ID NO: 1.
[0021] In one embodiment, the method comprises administering about 102-107PFU of the vaccine or immunogenic composition comprising the vector to the mammal, wherein the vector expresses the nucleic acid comprising SEQ ID NO: 2, or the nucleic acid comprising a sequence having at least 95%, or 96%, or 97% or 98% or 99% sequence identity to SEQ ID NO: 2.
[0022] The present invention also relates to a method for vaccinating a mammal in need thereof with the vaccine of any one of the preceding claims comprising administering about 102- 107PFU of the vaccine to the mammal.
[0023] In one embodiment, the administering step comprises administering about 104PFU of the vaccine or immunogenic composition.
[0024] In one embodiment, the administering step comprises administering about 105PFU of the vaccine or immunogenic composition.
[0025] In one embodiment, the administering step comprises administering about 106PFU of the vaccine or immunogenic composition.
[0026] In one embodiment, the mammal is a rodent or primate.
[0027] In one embodiment, the primate is a bonobo, chimpanzee, gibbon, gorilla, human, monkey, or orangutan.
[0028] In one embodiment, the primate is a human.
[0029] In one embodiment, the vaccine or immunogenic composition of the present invention is administered sequentially or simultaneously with an Ebola virus vaccine, a Marburg virus vaccine, or a Sudan virus vaccine.
[0030] According to another aspect of the present invention, the present invention relates to a method for enhancing an immune response to an infectious disease comprising; i) administering a priming vaccine or immunological composition comprising an immunologically effective amount of a viral vector that encodes and expresses one or more antigens; ii) administering a boosting vaccine or immunological composition comprising an immunologically effective amount of a viral vector that encodes and expresses one or more antigens; wherein the boosting and / or priming vaccine or immunological composition comprises the vaccine or immunogenic composition as described herein.
[0031] In one embodiment, the one or more antigens is the same in the priming vaccine or immunological composition and boosting vaccine or immunological composition.
[0032] In one embodiment, the administration is intramuscular.
[0033] In one embodiment, the administration is intranasal.
[0034] In one embodiment, the administration is intradermal.
[0035] In one embodiment, the administration is by an oral bait drop.
[0036] According to another aspect of the present invention, the present invention relates to a pharmaceutical composition comprising the vector as described herein, and a pharmaceutically or veterinarily acceptable carrier or diluent and optionally an adjuvant.
[0037] Accordingly, it is an object of the invention not to encompass within the invention any previously known product, process of making the product, or method of using the product such that Applicants reserve the right and hereby disclose a disclaimer of any previously known product, process, or method. It is further noted that the invention does not intend to encompass within the scope of the invention any product, process, or making of the product or method of using the product, which does not meet the written description and enablement requirements of the USPTO (35 U.S.C. §112(a)) or the EPO (Article 83 of the EPC), such that Applicants reserve the right and hereby disclose a disclaimer of any previously described product, process of making the product,or method of using the product. It may be advantageous in the practice of the invention to be in compliance with Art. 53(c) EPC and Rule 28(b) and (c) EPC. All rights to explicitly disclaim any embodiments that are the subject of any granted patent(s) of applicant in the lineage of this application or in any other lineage or in any prior filed application of any third party is explicitly reserved. Nothing herein is to be construed as a promise.
[0038] It is noted that in this disclosure and particularly in the claims and / or paragraphs, terms such as “comprises”, “comprised”, “comprising” and the like can have the meaning attributed to it in U.S. Patent law; e.g., they can mean “includes”, “included”, “including”, and the like; and that terms such as “consisting essentially of’ and “consists essentially of’ have the meaning ascribed to them in U. S. Patent law, e.g., they allow for elements not explicitly recited, but exclude elements that are found in the prior art or that affect a basic or novel characteristic of the invention.
[0039] These and other embodiments are disclosed or are obvious from and encompassed by, the following Detailed Description.BRIEF DESCRIPTION OF THE DRAWINGS
[0040] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0041] The following detailed description, given by way of example, but not intended to limit the invention solely to the specific embodiments described, may best be understood in conjunction with the accompanying drawings.
[0042] FIG. 1A-1H. VSVAG-LASV-GPC chimeric virus vaccine generated for vaccinating humans. (A) Illustration showing the enveloped VSV particle and its negative-sense singled- stranded RNA genome. Genes are expressed from a single promoter at the 3’ end of the genome. Genes closest to the promoter are transcribed more abundantly. (B) Schematic of the replication- competent VSVAG-LASV-GPC vaccine used in these studies. The VSV G gene is replaced by the sequence encoding for the LASV GPC. (C) Map of the GPC precursor protein and its proteolytic processing during biosynthesis. SSP, stable signal peptide. (D) Nanoflow cytometry was used to analyze purified VSVAG-LASV-GPC vaccine material. Particle counts (Y axis) and large-angle light scatter (X-axis) are shown. (E) Expression and antigenicity of GPC on the cell surface was evaluated by flow cytometry using infected Vero cells and three different GPC-specificmonoclonal antibodies (mAbs) or a negative control antibody specific for HIV Env (PGT-145). Intracellular VSV nucleoprotein (N) was stained with mAb 10G4. (F) Purified vaccine material was analyzed by Western blot to detect GP1 (mAb 3.3B, lanes 1-2) and GP2 (mAb 22.5D, lanes 3-4). VSV N was detected in lanes 5 and 6 with a polyclonal rabbit antibody). In lanes 1, 3 and 5, purified VSVAG-MARV-GP was used as a control. (G) Electron micrograph composition of negative-stained VSVAG-LASV-GPC particles and reference-free 2-D class averages of GPC coating the viral surface. This analysis was conducted with the vaccine material used in this study. (H) 3-D reconstruction of GPC on the surface of VSVAG-LASV-GPC with C3 symmetry applied (left panel), and with the full-length atomic model of GPC (PDB: 7PUY) docked into the reconstruction (right panel).
[0043] FIG. 2A-2D. VSVAG-LASV-GPC vaccination and LASV challenge. Cynomolgus macaques were divided into three groups including unvaccinated control macaques that were injected with buffer (n=3; phosphate-buffered saline [PBS] containing 5% trehalose) and animals injected with 2xlO7PFU or 2xl05PFU of VSVAG-LASV-GPC (n=5 per group). Vaccination was performed with a single intramuscular injection, after which samples were collected through day27 for immunological analysis. On day 28, animals were challenged with a single intramuscular injection of 3.5xl03PFU LASV (Josiah strain, Lineage IV) and were monitored for an additional28 days for signs of LASV disease. Animals exhibiting disease symptoms were euthanized based on predetermined health criteria. (A) Timeline of study activities. (B) Group descriptions. (C) Kaplan-Meier survival curves. One control animal was euthanized on day 11 following challenge, the remaining two on day 13. All 10 animals vaccinated with VSVAG-LASV-GPC survived until the completion of the study. **, p < 0.01 by log-rank test. (D) Infectious LASV in blood of challenged animals was quantified by plaque assay. LOD, limit of detection.
[0044] FIG. 3A-3F. Health monitoring and blood chemistry following LASV challenge. (A) Clinical observation scores through day 28 after LASV challenge. (B-F) Key analytes in the blood of animals were quantified from the day of challenge to the end of the study: (B) alanine aminotransferase (ALT); (C) aspartate aminotransferase (AST); (D) albumin (ALB); (E) C- reactive protein (CRP); and (F) calcium (CA).
[0045] FIG. 4A-4D. Quantification of immune responses. (A) Seroconversion was monitored by direct enzyme-linked immunosorbent assay (ELISA) using plates coated with recombinant, covalently linked GPLGP2 subunits of GPC. (B-D) The presence of peripheral blood T cellsspecific for LASV GPC or VSV N was quantified by IFN-y ELISpot assay. Peripheral blood mononuclear cells (PBMCs) from vaccinated animals were stimulated in vitro with (B) overlapping peptides spanning the complete sequence of GPC; (C) a recombinant soluble form of GP1 fused with GP2; or (D) overlapping peptides spanning the complete sequence of VSV N. Results are expressed as spot-forming cells (SFC) per one million PBMCs. Box plots indicate the interquartile range and median. **, p < 0.01; *, p < 0.05 by Kruskal-Wallis test with Dunn’s correction.
[0046] FIG. 5A-5B. Quantification of neutralizing serum antibodies. (A) VSVAG-LASV-GPC chimeras expressing GPC from LASV lineages I-V and VII or Marburg virus glycoprotein (MARV GP) (Musoke; VSVAG-MARV-GP) were used in a plaque-reduction assay to quantify serum neutralizing antibodies (nAbs). Genbank accession numbers for the GPC sequences used in development of the VSVAG-LASV-GPC chimeras are included in Fig. 9. The ability of serum from day 27 after vaccination to neutralize these virions was evaluated. (A) Schematic representing the replication-competent viruses used in this assay. (B) Serum neutralizing titers. Values are plotted for the serum dilutions that reduced the number of plaques by 50%. Boxplots indicate the interquartile range and median.
[0047] FIG. 6A-6E. Non-neutralizing properties of vaccine-elicited antibodies in serum. Serum harvested on day 0, 10 and 27 after vaccination was used to quantify different nonneutralizing functions of vaccine-induced antibodies. (A) Antibody-dependent cellular phagocytosis (ADCP); (B) antibody-dependent neutrophil phagocytosis (ADNP); (C) antibodydependent complement deposition (ADCD); and (D) antibody-dependent NK-cell activation as measured by MIP-ip expression (ADNKA). Assays were performed with Lineage II or Lineage IV GP antigens including a soluble GP that adopts a native-like prefusion conformation (GP prefusion) or a soluble GP1-GP2 fusion protein (GP-link). (E) Polar plots of the median percentile rank of each antibody function, isotype, and crystallizable fragment gamma receptor (FcyR) binding titer against Lineage IV GP-link at day 27.
[0048] FIG. 7A-7E. Profile of serum antibody features. (A) A principal-components analysis (PCA) was built using the antibody features quantified in Fig. 6. Coloring corresponds to the detection of viremia (cf Fig. 2D). (B and C) Bar plots showing the loadings for the 10 most prominent features along (B) principal component 1 (PCI) and (C) principal component 2 (PC2)for the PCA built in (A). (D and E) Polar plots of the median percentile rank for all antibody features for animals binned by segregation along (D) PC2 or (E) PCI .
[0049] FIG. 8A-8G. Effect of intramuscular injection with VSVAG-LASV-GPC on the whole blood transcriptome. Gene expression prior to and on days 1 and 3 after vaccination was analyzed by RNA-seq on whole-blood samples from the high-dose (2xl07PFU) and low-dose (2xl05PFU) groups. (A) Heatmap showing normalized expression values of all differentially expressed genes (DEGs). (B and C) Volcano plots showing changes in expression and the associated statistical significance in the (B) high-dose and (C) low-dose group, respectively, on day 1 after vaccination compared to baseline. Symbol shape indicates whether a given gene was differentially expressed on day 3 after vaccination. (D) Venn diagram showing the overlap of DEGs between the two time points and the two dose groups. (E) Venn diagram of the overlap between VSVAG-LASV-GPC- induced DEGs and a framework of representative genes identified previously as differentially expressed following vaccination with VSVAG-ZEBOV-GP in macaques and humans. (F) Transcription factor motifs enriched in the promoter region of VSVAG-LASV-GPC-induced DEGs, identified by Homer. (G) Heatmap showing mean log2 fold-changes in expression of genes within gene sets enriched for VSVAG-LASV-GPC-induced DEGs. Gene sets in the heatmap include those that showed significant enrichment for DEGs in at least one study group at one or both post-vaccination timepoints. Dots in heatmap cells indicate significant enrichment for DEGs.
[0050] FIG. 9. Genbank accession numbers for LASV GPC and MARV GP sequences used as the source for developing VSVAG chimeras used in the virus neutralization assay.
[0051] FIG. 10. VSVAG-LASV-GPC RNAemia detected by real-time quantitative PCR (RT- qPCR). Samples with cycle threshold (Ct) values > 36 after RT-qPCR are below the limit of detection. Day of vaccination is d 0.
[0052] FIG. 11 A-l IB. Detection of viral genome in blood and weight monitoring of macaques subsequent to LASV challenge. Macaque weights are shown from the day of challenge (0) through day 21. The study was terminated on day 28. Unvaccinated animals were euthanized on days 11 or 13.
[0053] FIG. 12A-12D. Individual components of the Clinical Score. The Clinical Score shown in Fig. 3A incorporates data on (A) neurological assessment, (B) animal respiration, (C) appetite, and (D) activity and appearance.
[0054] FIG. 13A-13J. Profile of immunoglobulin (Ig) isotypes and FcgR binding by anti-GPC serum antibodies. Serum samples from days 0, 10 and 27 were analyzed. (A-E) Titers of (A) IgGl, (B) IgG2, (C) IgG3, (D) IgA, and (E) IgM that bound to either the Lineage II or IV prefusion GP or the GP1-GP2 fusion protein (GP-link). The lines connect data points from the same animal. (F- J) FcyR-binding titer for antibodies that bound to Lineage II or IV prefusion GP or GP-link. Lines connect data points from the same animal.
[0055] FIG. 14A-14C. Effect of intramuscular injection with VSVAG-LASV-GPC on the whole-blood transcriptome. Gene expression in whole blood samples from the high-dose (2xl07PFU), low-dose (2xl05PFU) and control groups were analyzed by RNA-seq prior to and on days 1 and 3 after vaccination. (A) Heatmap showing normalized expression values of all expressed genes. (B) Interactome of DEGs identified after VSVAG-LASV-GPC. Interaction network identified by STRING. (C) Venn diagram showing the overlap in gene sets enriched for DEGs after vaccination with VSVAG-LASV-GPC and VSVAG-ZEBOV-GP.
[0056] FIG. 15A-15D. VSVAG-LASV-GPC vaccination promotes lasting immunogenicity and efficacy in non-human primates (NHPs). (A) Schematic of NHP vaccination schedule and study activities. In brief, cohorts of NHPs (n=5) were administered either a single intramuscular vaccination with either 2xl05or 2xl07PFUs or a prime-boost intramuscular vaccination of 2xl07PFUs at an 8-week interval. A control group (n=3) received a single intramuscular vaccination with a control vaccine encoding MARV GP (VSVAG-MARV-GP, 2xl07PFUs). Samples were collected post vaccination to measure immunogenicity. At 6 or 12 months after vaccination, macaques were challenged with a lethal dose of LASV (Lineage IV, Josiah, 1000 PFUs) and sample collection and monitoring for clinical signs of disease was completed. (B) Animals exhibiting disease symptoms based on their clinical observation score were humanely euthanized as indicated in the survival curve. (C) Viremia at the indicated timepoints following LASV challenge was quantified by plaque assay. (D) To illustrate the durability of serum antibodies elicited by vaccination, end-point anti-GPC IgG titers measured by ELISA are shown for the group of macaques that was vaccinated with 2xl07PFUs and protected from challenge 12 months later.DETAILED DESCRIPTION OF THE INVENTION
[0057] A Lassa virus (LASV) vaccine candidate (VSVAG-LASV-GPC) based on the recombinant VSV technology used for ERVEBO® is being developed for use in humans. AVSVAG-LASV-GPC research vaccine has been shown to be safe and efficacious in multiple preclinical studies. To advance VSVAG-LASV-GPC as a globally-accessible vaccine candidate for human use, Applicants regenerated a recombinant vaccine strain using conditions that would support future human vaccine development and tested it across a range of doses for immunogenicity and efficacy against LASV challenge in a cynomolgus macaque animal model for LASV disease. The VSVAG-LASV-GPC vaccine was 100% efficacious against LASV disease and protected against development of LASV viremia after a single intramuscular injection at doses of 2xl07and 2xl05plaque-forming units (PFU). VSVAG-LASV-GPC vaccination induced LASV GPC-specific humoral responses that can be further interrogated to better understand correlates of protection and this data will provide an important bridge to future human safety and immunogenicity studies.
[0058] The present invention relates to a recombinant LASV vaccine encoding a LASV protein or a non-naturally occurring mutant thereof. Advantageously, the LASV protein is a LASV glycoprotein complex (GPC) or a non-naturally occurring mutant thereof.
[0059] The LASV is a member of the species Lassa mammarenavirus, which is included in the genus Mammarenavirus, family Arenaviridae, and order Bunyavirales . Lassa viruses are enveloped, single- stranded, bisegmented, ambisense RNA viruses. Their genome is contained in two RNA segments that code for two proteins each, one in each sense, for a total of four viral proteins. The large segment encodes a zinc finger protein (Z) that regulates transcription and replication, and the RNA polymerase (L). The small segment encodes the nucleoprotein (NP) and the surface glycoprotein precursor (GP, also known as the viral spike), which is proteolytically cleaved into the envelope glycoproteins GP1 and GP2 that bind to the alpha-dystroglycan receptor and mediate host cell entry. Advantageously, the structural protein contemplated for a vaccine is the glycoprotein complex (GPC).
[0060] LASV isolates include Pinneo-NIG-1969 (LASV I), LASV237-NIG-2010 (LASV II), Nig08-A19 (LASV III), Josiah (LASV IV), Soromba-R (LASV V), and TGO / 2016 / 812939 (LASV VII). The Lassa viruses have highly similar genomic sequences.
[0061] The invention encompasses eliciting an immune response which may comprise systemically administering to an animal in need thereof an effective amount of any one of the non- naturally occurring protein(s) or any one of the nucleic acids encoding the non-naturally occurring protein(s) of the present invention, including nucleic acids that may have at least 80% or 85% or90% or 95% homology or identity with a nucleotide encoding the sequence of the non-naturally occurring protein(s) of the invention. The animal may be a mammal, advantageously a primate, advantageously a human.
[0062] An “immunological response” or “immune response” to an antigen, or vector or vaccine or composition comprising the antigen, is the development in a mammalian subject of a humoral and / or a cellular immune response to an antigen or antigens present in a vector set. A “cellular immune response” is one mediated by T-lymphocytes and / or other white blood cells, including without limitation natural killer (NK) cells and macrophages. T lymphocytes of the present invention include T cells expressing alpha beta T cell receptor subunits or gamma delta receptor expressing T cells and may be either effector or suppressor T cells. “T lymphocytes” or “T cells” are non-antibody producing lymphocytes that constitute a part of the cell-mediated arm of the immune system. T cells arise from immature lymphocytes that migrate from the bone marrow to the thymus, where they undergo a maturation process under the direction of thymic hormones. Maturing T cells become immunocompetent based on their ability to recognize and bind a specific antigen. Activation of immunocompetent T cells is triggered when an antigen binds to the lymphocyte's surface receptors. It is known that in order to generate T cell responses, antigen must be synthesized within or introduced into cells, subsequently processed into small peptides by the proteasome complex, and translocated into the endoplasmic reticulum / Golgi complex secretory pathway for eventual association with major histocompatibility complex (MHC) class I proteins. Functionally cellular immunity includes antigen specific cytotoxic T cells (CTL). The terms “antigen specific T cells”, “CTL”, or “cytotoxic T cells” as used herein refer to cells which have specificity for peptide antigens presented in association with proteins encoded by the MHC or human leukocyte antigens (HLA) as the proteins are referred to in humans. CTLs of the present invention include activated CTL which have become triggered by specific antigen in the context of MHC; and memory CTL or recall CTL to refer to T cells that have become reactivated as a result of re-exposure to antigen as well as cross-reactive CTL. CTLs of the present invention include CD4+ and CD8+ T cells. Activated antigen specific CTLs of the present invention promote the destruction and / or lysis of cells of the subject infected with the pathogen or cancer cell to which the CTL are specific via amongst other things, secretion of chemokines and cytokines including without limitation macrophage inflammatory protein 1 a (MIP-la), MIP-1B, and RANTES; and secretion of soluble factors that suppress the disease state. Cellular immunity of the presentinvention also refers to antigen specific response produced by the T helper subset of T cells. Helper T cells act to help stimulate the function, and focus the activity of nonspecific effector cells against cells displaying peptide in association with MHC molecules on their surface. A cellular immune response also refers to the production of cytokines, chemokines and other such molecules produced by activated T cells and / or other white blood cells including those derived from CD4+ and CD8+ T cells and NK cells. A prime dose or boost dose, or a composition or vaccine comprising a prime dose or a boost dose, that elicits a cellular immune response may serve to sensitize a mammalian subject by the presentation of antigen in association with MHC molecules at the cell surface. The cell-mediated immune response is directed at, or near, cells presenting antigen at their surface. In addition, antigen-specific T-lymphocytes can be generated to allow for the future protection of an immunized host. The ability of a particular antigen to stimulate a cell-mediated immunological response may be determined by a number of assays known in the art, such as by lymphoproliferation (lymphocyte activation) assays, CTL cytotoxic cell assays, or by assaying for T-lymphocytes specific for the antigen in a sensitized subject. Such assays are well known in the art. See, e.g., Erickson et al., J. Immunol. (1993) 151 :4189-4199; Doe et al., Eur. J. Immunol. (1994) 24:2369-2376. Methods of measuring cell -mediated immune response include measurement of intracellular cytokines or cytokine secretion by T-cell populations, or by measurement of epitope specific T-cells (e.g., by the tetramer technique) (reviewed by McMichael, A. J., and O'Callaghan, C. A., J. Exp. Med. 187(9)1367-1371, 1998; Mcheyzer-Williams, M. G., et al, Immunol. Rev. 150:5-21, 1996; Lalvani, A., et al, J. Exp. Med. 186:859-865, 1997). An immunological response, or immune response, as used herein encompasses one which stimulates the production of CTLs, and / or the production or activation of helper T-cells and / or an antibody- mediated immune response.
[0063] An “immunological response” or “immune response” as used herein encompasses at least one or more of the following effects: the production of antibodies by B-cells; and / or the activation of suppressor T-cells and / or T-cells directed specifically to an antigen or antigens present in the vectors, composition or vaccine of interest. In some embodiments, the “immunological response” or “immune response” encompasses the inactivation of suppressor T- cells. As used herein, an “enhanced boost immune response” refers to administration of boost dose by a vaccine that elicits a greater measurable immune response as compared to the response elicited by a single administration of the prime dose.
[0064] ‘Effective amount” as used in treatment encompasses, without limitation, an amount that can ameliorate, reverse, mitigate, or prevent a symptom or sign of a medical condition or disorder. Unless dictated otherwise, explicitly or otherwise, an “effective amount” is not limited to a minimal amount sufficient to ameliorate a condition, or to an amount that results in an optimal or a maximal amelioration of the condition. “Effective amount” within the context of administration of a prime and / or boost is that which causes an immune response in the mammal.
[0065] An “effective amount” of a “prime dose” or “prime dosage” refers to the amount of target antigen which elicits a measurable immune response in a mammalian subject as compared to the immune response in the mammalian subject in the absence of administration of the antigen.
[0066] A “vaccine” as used herein refers to a composition that is comprised of an immunogen, or that is comprised of an agent encoding the immunogen such that when the vaccine is administered to a mammal the immunogen is expressed in the mammal.
[0067] A “priming vaccine” as used herein refers to a vaccine comprising an agent(s) that encodes the target antigen to which an immune response is to be generated. Priming vaccines of the invention are administered to the subject or host in an amount effective to elicit an immune response to the target antigen.
[0068] An “effective amount” of a “boost dose” or “boost dosage” refers to the amount of antigen which elicits an immune response to the target antigen upon administration to a mammal which previously has been administered a prime dose of the target antigen.
[0069] A “boosting vaccine” as used herein refers to a vaccine comprising an agent that encodes an antigen that has an immunologically active portion of the target antigen, and may include the target antigen, be a fragment thereof, and / or be a fusion polypeptide containing at least an immunologically active portion of the target antigen joined to a region that is not normally present in the target antigen.
[0070] A “vector set” or “vaccine set” as used herein comprises a priming vector or priming vaccine and a boosting vector or boosting vaccine wherein each encode at least one of a shared immunogenic determinant, a cross reaction immunogenic determinant, a shared antigen, immunogenic protein or peptide, or fragment thereof.
[0071] The invention pertains to the identification, design, synthesis and isolation of LASV proteins disclosed herein as well as nucleic acids encoding the same. The present invention also relates to homologues, derivatives and variants of the sequences of a LASV protein and nucleicacids encoding the same, wherein it is preferred that the homologue, derivative or variant have at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 98% or at least 99% homology or identity with the sequence of the LASV proteins or nucleic acids encoding the same. It is noted that within this specification, homology to sequences of the mutant proteins and nucleic acids encoding the same refers to the homology of the homologue, derivative or variant to the binding site of the mutant proteins and nucleic acids encoding the same.
[0072] The invention still further relates to nucleic acid sequences expressing the LASV proteins disclosed herein, or homologues, variants or derivatives thereof. One of skill in the art will know, recognize and understand techniques used to create such. Additionally, one of skill in the art will be able to incorporate such a nucleic acid sequence into an appropriate vector, allowing for production of the amino acid sequence of mutant proteins and nucleic acids encoding the same or a homologue, variant or derivative thereof.
[0073] In some embodiments, the nucleic acid may comprise a nucleic acid encoding an open reading frame of the LASV GPC, such as SEQ ID NO: 1 or the nucleic acid may comprise a nucleic acid encoding an open reading from of the LASV GPC in a VSVAG such as SEQ ID NO: 2 as provided in Table 1 below.Table 1 - Nucleic Acid Sequences
[0074] Where used herein and unless specifically indicated otherwise, the following terms are intended to have the following meanings in addition to any broader (or narrower) meanings the terms might enjoy in the art:
[0075] The term “isolated” or “non-naturally occurring” is used herein to indicate that the isolated moiety (e.g. peptide or compound) exists in a physical milieu distinct from that in which it occurs in nature. For example, the isolated peptide may be substantially isolated with respect to the complex cellular milieu in which it naturally occurs. The absolute level of purity is not critical,and those skilled in the art may readily determine appropriate levels of purity according to the use to which the peptide is to be put. The term “isolating” when used a step in a process is to be interpreted accordingly.
[0076] In many circumstances, the isolated moiety will form part of a composition (for example a more or less crude extract containing many other molecules and substances), buffer system, matrix or excipient, which may for example contain other components (including proteins, such as albumin).
[0077] In other circumstances, the isolated moiety may be purified to essential homogeneity, for example as determined by polyacrylamide gel electrophoresis (PAGE) or column chromatography (for example high performance liquid chromatography [HPLC] or mass spectrometry). In preferred embodiments, the isolated peptide or nucleic acid of the invention is essentially the sole peptide or nucleic acid in a given composition.
[0078] In an advantageous embodiment, a tag may be utilized for purification or biotinylation. The tag for purification may be a his tag. In another embodiment, the tag for biotinylation may be an avi-tag. Other tags are contemplated for purification, however, purification may be accomplished without a tag. In another embodiment, antibody (such as, not limited to, a broadly neutralizing antibody) affinity columns are contemplated. In another embodiment, lectin columns are contemplated.
[0079] The term “pharmaceutical composition” is used herein to define a solid or liquid composition in a form, concentration and level of purity suitable for administration to a patient (e g. a human patient) upon which administration it may elicit the desired physiological changes. The terms “immunogenic composition” and “immunological composition” and “immunogenic or immunological composition” cover any composition that elicits an immune response against the targeted pathogen, Lassa viruses. Terms such as “vaccinal composition” and “vaccine” and “vaccine composition” cover any composition that induces a protective immune response against the targeted pathogen or which efficaciously protects against the pathogen; for instance, after administration or injection, elicits a protective immune response against the targeted pathogen or provides efficacious protection against the pathogen. Accordingly, an immunogenic or immunological composition induces an immune response, which may, but need not, be a protective immune response. An immunogenic or immunological composition may be used in the treatment of individuals infected with the pathogen, e.g., to stimulate an immune response against thepathogen, such as by stimulating antibodies against the pathogen. Thus, an immunogenic or immunological composition may be a pharmaceutical composition. Furthermore, when the text speaks of “immunogen, antigen or epitope”, an immunogen may be an antigen or an epitope of an antigen. A diagnostic composition is a composition containing a compound or antibody, e.g., a labeled compound or antibody, that is used for detecting the presence in a sample, such as a biological sample, e.g., blood, semen, vaginal fluid, etc., of an antibody that binds to the compound or an immunogen, antigen or epitope that binds to the antibody; for instance, an anti-LASV antibody or an LASV immunogen, antigen or epitope.
[0080] A “conservative amino acid change” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g. lysine, arginine and histidine), acidic side chains (e.g. aspartic acid and glutamic acid), non-charged amino acids or polar side chains (e.g. glycine, asparagine, glutamine, serine, threonine, tyrosine and cysteine), non-polar side chains (e.g. alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine and tryptophan), beta-branched side chains (e.g. threonine, valine and isoleucine), and aromatic side chains (e.g. tyrosine, phenylalanine, tryptophan and histidine).
[0081] The terms “protein”, “peptide”, “polypeptide”, and “amino acid sequence” are used interchangeably herein to refer to polymers of amino acid residues of any length. The polymer may be linear or branched, it may comprise modified amino acids or amino acid analogs, and it may be interrupted by chemical moieties other than amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling or bioactive component.
[0082] As used herein, the terms “antigen” or “immunogen” are used interchangeably to refer to a substance, typically a protein, which is capable of inducing an immune response in a subject. The term also refers to proteins that are immunologically active in the sense that once administered to a subject (either directly or by administering to the subject a nucleotide sequence or vector that encodes the protein) is able to evoke an immune response of the humoral and / or cellular type directed against that protein.
[0083] As used herein the terms “nucleotide sequences” and “nucleic acid sequences” refer to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) sequences, including, without limitation, messenger RNA (mRNA), DNA / RNA hybrids, or synthetic nucleic acids. The nucleic acid may be single-stranded, or partially or completely double-stranded (duplex). Duplex nucleic acids may be homoduplex or heteroduplex.
[0084] As used herein the term “transgene” may be used to refer to “recombinant” nucleotide sequences that may be derived from any of the nucleotide sequences encoding the proteins of the present invention. The term “recombinant” means a nucleotide sequence that has been manipulated “by man” and which does not occur in nature, or is linked to another nucleotide sequence or found in a different arrangement in nature. It is understood that manipulated “by man” means manipulated by some artificial means, including by use of machines, codon optimization, restriction enzymes, etc.
[0085] For example, in one embodiment the nucleotide sequences may be mutated such that the activity of the encoded proteins in vivo is abrogated. In another embodiment the nucleotide sequences may be codon optimized, for example the codons may be optimized for human use. In preferred embodiments the nucleotide sequences of the invention are both mutated to abrogate the normal in vivo function of the encoded proteins, and codon optimized for human use. For example, each of the sequences of the invention, such as the LASV proteins, may be altered in these ways.
[0086] As regards codon optimization, the nucleic acid molecules of the invention have a nucleotide sequence that encodes the antigens of the invention and may be designed to employ codons that are used in the genes of the subject in which the antigen is to be produced. Many viruses use a large number of rare codons and, by altering these codons to correspond to codons commonly used in the desired subject, enhanced expression of the antigens may be achieved. In a preferred embodiment, the codons used are “humanized” codons, i.e., the codons are those that appear frequently in highly expressed human genes (Andre et al., J. Virol. 72: 1497-1503, 1998) instead of those codons that are frequently used by LASV. Such codon usage provides for efficient expression of the transgenic LASV proteins in human cells. Any suitable method of codon optimization may be used. Such methods, and the selection of such methods, are well known to those of skill in the art. In addition, there are several companies that will optimize codons of sequences, such as Geneart (geneart.com). Thus, the nucleotide sequences of the invention may readily be codon optimized.
[0087] The invention further encompasses nucleotide sequences encoding functionally and / or antigenically equivalent variants and derivatives of the antigens of the invention and functionally equivalent fragments thereof. These functionally equivalent variants, derivatives, and fragments display the ability to retain antigenic activity. For instance, changes in a DNA sequence that do not change the encoded amino acid sequence, as well as those that result in conservative substitutions of amino acid residues, one or a few amino acid deletions or additions, and substitution of amino acid residues by amino acid analogs are those which will not significantly affect properties of the encoded polypeptide. Conservative amino acid substitutions are glycine / alanine; valine / isoleucine / leucine; asparagine / glutamine; aspartic acid / glutamic acid; serine / threonine / methionine; lysine / arginine; and phenylalanine / tyrosine / tryptophan. In one embodiment, the variants have at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology or identity to the antigen, epitope, immunogen, peptide or polypeptide or a nucleotide sequence encoding the same of interest.
[0088] For the purposes of the present invention, sequence identity or homology is determined by comparing the sequences when aligned so as to maximize overlap and identity while minimizing sequence gaps. In particular, sequence identity may be determined using any of a number of mathematical algorithms. A nonlimiting example of a mathematical algorithm used for comparison of two sequences is the algorithm of Karlin & Altschul, Proc. Natl. Acad. Sci. USA 1990; 87: 2264-2268, modified as in Karlin & Altschul, Proc. Natl. Acad. Sci. USA 1993;90: 5873-5877.
[0089] Another example of a mathematical algorithm used for comparison of sequences is the algorithm of Myers & Miller, CABIOS 1988;4: 11-17. Such an algorithm is incorporated into the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM 120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 may be used. Yet another useful algorithm for identifying regions of local sequence similarity and alignment is the FASTA algorithm as described in Pearson & Lipman, Proc. Natl. Acad. Sci. USA 1988; 85: 2444-2448.
[0090] Advantageous for use according to the present invention is the WU-BLAST (Washington University BLAST) version 2.0 software. WU-BLAST version 2.0 executableprograms for several UNIX platforms may be downloaded from ftp: / / blast.wustl.edu / blast / executables. This program is based on WU-BLAST version 1.4, which in turn is based on the public domain NCBI-BLAST version 1.4 (Altschul & Gish, 1996, Local alignment statistics, Doolittle ed., Methods in Enzymology 266: 460-480; Altschul et al., Journal of Molecular Biology 1990, 215: 403-410; Gish & States, 1993, Nature Genetics 3: 266-272; and Karlin & Altschul, 1993, Proc. Natl. Acad. Sci. USA 90: 5873-5877; all of which are incorporated by reference herein).
[0091] The various recombinant nucleotide sequences and immunogens of the invention are made using standard recombinant DNA and cloning techniques. Such techniques are well known to those of skill in the art. See for example, “Molecular Cloning: A Laboratory Manual”, second edition (Sambrook et al. 1989).
[0092] The nucleotide sequences of the present invention may be inserted into “vectors.” The term “vector” is widely used and understood by those of skill in the art, and as used herein the term “vector” is used consistent with its meaning to those of skill in the art. For example, the term “vector” is commonly used by those skilled in the art to refer to a vehicle that allows or facilitates the transfer of nucleic acid molecules from one environment to another or that allows or facilitates the manipulation of a nucleic acid molecule.
[0093] Any vector that allows expression of the immunogen of the present invention may be used in accordance with the present invention. In certain embodiments, the immunogen of the present invention may be used in vitro (such as using cell-free expression systems) and / or in cultured cells grown in vitro in order to produce the encoded immunogens, which may then be used for various applications such as in the production of proteinaceous vaccines. For such applications, any vector that allows expression of the immunogens in vitro and / or in cultured cells may be used.
[0094] Non-limiting examples of suitable cells in culture include Vero cells, A549 cells, Jurkat cells, HepG2 cells, NIH3T3 cells, Renka cells, CT26 cells, PC-12 cells, Cos-1 cells, Cos-7 cells, and CHO cells.
[0095] For applications where it is desired that the immunogens be expressed in vivo, for example when the transgenes of the invention are used in DNA or DNA-containing vaccines, any vector that allows for the expression of the antibodies of the present invention and is safe for usein vivo may be used. In preferred embodiments the vectors used are safe for use in humans, mammals and / or laboratory animals.
[0096] For the immunogens of the present invention to be expressed, the protein coding sequence should be “operably linked” to regulatory or nucleic acid control sequences that direct transcription and translation of the protein. As used herein, a coding sequence and a nucleic acid control sequence or promoter are said to be “operably linked” when they are covalently linked in such a way as to place the expression or transcription and / or translation of the coding sequence under the influence or control of the nucleic acid control sequence. The “nucleic acid control sequence” may be any nucleic acid element, such as, but not limited to promoters, enhancers, internal ribosome entry site (IRES), introns, and other elements described herein that direct the expression of a nucleic acid sequence or coding sequence that is operably linked thereto. For vesicular stomatitis virus (VSV), the gene also can be operably linked to intergenic regions that control gene expression.
[0097] The vectors used in accordance with the present invention should typically be chosen such that they contain a suitable gene regulatory region, such as a promoter or intergenic region, such that the immunogen of the invention may be expressed.
[0098] Any suitable vector may be used depending on the application. For example, plasmids, viral vectors, bacterial vectors, protozoal vectors, insect vectors, baculovirus expression vectors, yeast vectors, mammalian cell vectors, and the like, may be used. Suitable vectors may be selected by the skilled artisan taking into consideration the characteristics of the vector and the requirements for expressing the immunogens under the identified circumstances.
[0099] In preferred embodiments of the present invention viral vectors are used. Viral expression vectors are well known to those skilled in the art and include, for example, viruses such as adenoviruses, adeno-associated viruses (AAV), alphaviruses, herpesviruses, retroviruses and poxviruses, including avipox viruses, attenuated poxviruses, vaccinia viruses, and particularly, the modified vaccinia Ankara virus (MVA; ATCC Accession No. VR-1566). Such viruses, when used as expression vectors are innately non-pathogenic in the selected subjects such as humans or have been modified to render them non-pathogenic in the selected subjects. For example, replicationdefective adenoviruses and alphaviruses are well known and may be used as gene delivery vectors.
[0100] Advantageously, the vector is a vesicular stomatitis virus (VSV) vector.
[0101] VSV is a very practical, safe, and immunogenic vector for conducting animal studies, and an attractive candidate for developing vaccines for use in humans, as shown by development of a marketed Ebola virus vaccine (ERVEBO®). VSV is a member of the Rhabdoviridae family of enveloped viruses containing a nonsegmented, negative-sense RNA genome. The genome is composed of 5 genes arranged sequentially 3'-N-P-M-G-L-5', each encoding a polypeptide found in mature virions. Notably, the surface glycoprotein G is a transmembrane polypeptide that is present in the viral envelope as a homotrimer, and like LASV GPC, it mediates cell attachment and infection.
[0102] Advantageously, the VSV vector is replication deficient due to a deletion of the glycoprotein G gene (VSVAG). In one embodiment, the VSV G gene is replaced by a gene encoding a LASV protein or fragments thereof. In a second embodiment, VSV G is a carrier or scaffold for LASV epitopes. The disclosures of US Patent Nos. 9,610,346, 9,802,986 and 10,844,095 and International Application No. PCT / US23 / 73272 are incorporated by reference. In another embodiment, the LASV GPC replacing G is functional.
[0103] The VSV vector may be replication deficient due to a deletion of the glycoprotein G gene (VSVAG). In one embodiment, the VSV G is replaced by a gene encoding LASV protein or fragments thereof. The disclosures of US Patent Nos. 9,610,346, 9,802,986 and 10,844,095 and International Application No. PCT / US23 / 73272 are incorporated by reference. The VSVAG vector of Espeseth et al. (eBioMedicine 2022;00: 104203 Published online at doi.org / 10.1016) is also contemplated.
[0104] In a particularly advantageous embodiment, the vector is a VSVAG-LASV-GPC vector.
[0105] The nucleotide sequences and vectors of the invention may be delivered to cells, for example if the aim is to express the LASV antigens in cells in order to produce and isolate the expressed proteins, such as from cells grown in culture. For expressing the antigen in cells any suitable transfection, transformation, or gene delivery methods may be used. Such methods are well known by those skilled in the art, and one of skill in the art would readily be able to select a suitable method depending on the nature of the nucleotide sequences, vectors, and cell types used. For example, transfection, transformation, microinjection, infection, electroporation, lipofection, or liposome-mediated delivery could be used. Expression of the antigen may be carried out in any suitable type of host cells, such as bacterial cells, yeast, insect cells, and mammalian cells. Theantibodies of the invention may also be expressed using including in vitro transcription / translation systems. All of such methods are well known by those skilled in the art, and one of skill in the art would readily be able to select a suitable method depending on the nature of the nucleotide sequences, vectors, and cell types used.
[0106] Non-limiting examples of suitable host cells include Vero cells, A549 cells, Jurkat cells, HepG2 cells, NIH3T3 cells, Renka cells, CT26 cells, PC-12 cells, Cos-1 cells, Cos-7 cells, and CHO cells.
[0107] Alternatively, methods which are well known to those skilled in the art may be used to construct expression vectors containing nucleic acid molecules that encode the polypeptide or homologs or derivatives thereof under appropriate transcriptional / translational control signals, for expression. These methods include in vitro recombinant DNA techniques, synthetic techniques and in vivo recombination / genetic recombination. See, for example, the techniques described in Maniatis et al., 1989.
[0108] The compounds or compositions may be administered orally, subcutaneously or parenterally including intravenous, intraarterial, intramuscular, intraperitoneally, and intranasal administration as well as intrathecal and infusion techniques. Intramuscular is preferred, but other routes can be used such as subcutaneous or application to mucosal surfaces in the nose or mouth.
[0109] In an advantageous embodiment, the administration is intramuscular. The dosage is measured in PFU. The present invention illustrates that low doses of the vaccine are as effective as higher doses. Applicants have demonstrated that a single vaccination dose of 2xl05or 2xl07PFU of the VSVAG-LASV-GPC vaccine were effective in protecting cynomolgus macaques against LASV infection. The dosage administration may be about 1O2-1O10PFU. In some embodiments, the dosage may be about 102-107PFU. In some embodiments, the dosage may be about 104PFU, about 1 CP PFU, or about 106PFU. In other embodiments, the dosage may be about 109PFU.
[0110] Combination vaccines are also contemplated. The LASV vaccine of the present invention may be combined with another vaccine, such as a vaccine against a virus in the family Filoviridae. Ebola (EBOV), Sudan (SUDV) and Marburg (MARV) viruses are the three filoviruses which have caused the most fatalities in humans. It has been demonstrated that combinations of MARV or SUDV with the EBOV vaccine can be formulated yielding bivalent vaccines retainingfull efficacy (Lehrer et al., Front Immunol. 2021 Aug 18; 12:703986. doi: 10.3389 / fimmu.2021.703986. eCollection 2021).
[0111] It is noted that humans may require higher vaccine dosages than mice or other experimental animals to elicit an effective immune response. The doses may be single doses or multiple doses over a period of time, but single doses are preferred. Thus, one may scale up from animal experiments, e.g., rats, mice, and the like, to humans, by techniques from this disclosure and documents cited herein and the knowledge in the art, without undue experimentation.
[0112] In another embodiment, the immunization of primates is also considered. For the immunization of nonhuman primates, oral administration (such as via bait drop) is contemplated. Non-human primates that may be immunized by the vaccine of the present invention include, but are not limited to, chimpanzees and bonobos, gorillas, orangutans, gibbons and monkeys. The immunization against other animals carrying LASV (such as rodents) is also contemplated. In this instance, a bait drop is contemplated. In one embodiment, the bait drop may comprise a hollow plastic packet. In another embodiment, the composition may be inserted in the hollow polymer cube. For example, the bait drop can comprise an attractant, e.g., animal food product or meal, polymer cube (1.25 inches by 0.75 inches) that is hollow (with the vaccine or immunogenic composition to be inserted therein); and, the attractant or animal food product or meal can be suitable to the animal that one desires to be vaccinated or immunized, e.g., fishmeal as to small animals such as raccoons or fox, and for rodents such as rats or mice the attractant can be or have ingredients that include cheese, bacon, peanut butter, oatmeal, marshmallows, berries, fruit (e.g. banana) and nuts. In one embodiment, the bait drop may comprise a hollow plastic packet. In another embodiment, the composition may be inserted in the hollow polymer cube. For example, the bait drop can comprise a fishmeal polymer cube (1.25 inches by 0.75 inches) that is hollow. A sachet, or plastic packet, containing the vaccine or immunogenic composition can be inserted into the hollow area of the bait and sealed with wax. Vaccination or immunization occurs when the animal bites the bait and the vaccine or immunogenic composition is ingested with the attractant, whereby there is administration including oral administration.
[0113] When administering a therapeutic of the present invention parenterally, it will generally be formulated in a unit dosage injectable form (solution, suspension, emulsion). The pharmaceutical formulations suitable for injection include sterile aqueous solutions or dispersions and sterile powders for reconstitution into sterile injectable solutions or dispersions. The carriermay be a solvent or dispersing medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. A carrier may be present independently of an adjuvant.
[0114] Additionally, various additives that enhance the stability, sterility, and isotonicity of the compositions, including antimicrobial preservatives, antioxidants, chelating agents, and buffers, may be added. Prevention of the action of microorganisms may be ensured by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, sorbic acid, and the like. In many cases, it will be desirable to include isotonic agents, for example, sugars, sodium chloride, and the like. Prolonged absorption of the injectable pharmaceutical form may be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin. According to the present invention, however, any vehicle, diluent, or additive used would have to be compatible with the vaccine preparation. Formulations that stabilize the virus are also contemplated. Additions such as, but not limited to, carbohydrates (such as sucrose or trehalose), gelatin, hydrolyzed gelatin, amino acids, etc. are contemplated.
[0115] Sterile injectable solutions may be prepared by incorporating the compounds utilized in practicing the present invention in the required amount of the appropriate buffered solution with various amounts of the other ingredients, as desired.
[0116] A pharmacological formulation of the present invention, e.g., which may comprise a therapeutic compound or polypeptide of the present invention, may be administered to the patient in an injectable formulation containing any compatible carrier, such as various vehicles, adjuvants, additives, and diluents; or the compounds utilized in the present invention may be administered parenterally to the patient in the form of or polymer matrices, liposomes, and microspheres.
[0117] Adjuvants are any substance whose admixture with an administered antigen increases or otherwise modifies the immune response to said antigen. Adjuvants may for example be selected from the group consisting of A1K(SO4)2, AlNa(SO4)2, AINH4 (SO4), silica, alum, Al(0H)3, Cas (PC>4)2, kaolin, carbon, aluminum hydroxide, muramyl dipeptides, N-acetyl-muramyl-L-threonyl- D-isoglutamine (thr-DMP), N-acetyl-nornuramyl-L-alanyl-D-isoglutamine (CGP 11687, also referred to as nor-MDP), N-acetylmuramyul-L-alanyl-D-isoglutaminyl-L-alanine-2-(r2'- dipalmitoyl-s- n-glycero-3-hydroxphosphoryloxy)-ethylamine (CGP 19835A, also referred to as MTP-PE), RIBI (MPL+TDM+CWS) in a 2% squalene / Tween-80.RTM emulsion, lipopolysaccharides and its various derivatives, including lipid A, Freund's Complete Adjuvant(FCA), Freund's Incomplete Adjuvants, Merck Adjuvant 65, polynucleotides (for example, poly IC and poly AU acids), wax D from Mycobacterium tuberculosis, substances found in Corynebacterium parvum, Bordetella pertussis, and members of the genus Brucella, liposomes or other lipid emulsions, Titermax, ISCOMS, Quil A, ALUN (see U.S. Pat. Nos. 58,767 and 5,554,372), Lipid A derivatives, choleratoxin derivatives, HSP derivatives, LPS derivatives, synthetic peptide matrixes or GMDP, Interleukin 1, Interleukin 2, Montanide ISA-51 and QS-21. Preferred adjuvants to be used with the invention include Freund's Complete Adjuvant (FCA), Freund's Incomplete Adjuvants.
[0118] A pharmacological formulation of the compound and composition which may comprise the vector utilized in the present invention may be administered orally to the patient. Conventional methods such as administering the compounds in tablets, suspensions, solutions, emulsions, capsules, powders, syrups and the like are usable. Known techniques, which deliver the compound orally or intravenously and retain the biological activity, are preferred.
[0119] In one embodiment, a formulation of the present invention may be administered initially, and thereafter maintained by further administration. For instance, a formulation of the invention may be administered in one type of composition and thereafter further administered in a different or the same type of composition. For example, a formulation of the invention may be administered by intravenous injection to bring blood levels to a suitable level. The patient's levels are then maintained by an oral dosage form, although other forms of administration, dependent upon the patient's condition, may be used. In the instance of a vaccine composition, the vaccine may be administered as a single dose, or the vaccine may incorporate set booster doses.
[0120] The quantity to be administered will vary for the patient being treated and whether the administration is for treatment or prevention and will vary from about 102-107PFU of the vaccine. The administering may be about 104PFU, about 1CPPFU, about 106PFU of the vaccine, or about 107PFU of the vaccine.
[0121] Of course, for any composition to be administered to an animal or human, including the components thereof, and for any particular method of administration, it is preferred to determine therefore: toxicity and biodistribution in a suitable animal model e.g., rodent such as mouse; and, the dosage of the composition(s), concentration of components therein and timing of administering the composition(s), which elicit a suitable immunological response, such as by titrations of sera and analysis thereof for antibodies or antigens, e.g., by enzyme linkedimmunosorbent assay (ELISA) and / or Rapid Fluorescent Foci Inhibition Test (REFIT) analysis. Such determinations do not require undue experimentation from the knowledge of the skilled artisan, this disclosure and the documents cited herein. And, the time for sequential administrations may be ascertained without undue experimentation. For instance, dosages may be readily ascertained by those skilled in the art from this disclosure and the knowledge in the art. Thus, the skilled artisan may readily determine the amount of compound and optional additives, vehicles, and / or carrier in compositions and to be administered in methods of the invention. Typically, an adjuvant or additive is commonly used as 0.001 to 50 wt % solution in phosphate buffered saline, and the active ingredient is present in the order of micrograms to milligrams, such as about 0.0001 to about 5 wt %, preferably about 0.0001 to about 1 wt %, most preferably about 0.0001 to about 0.05 wt % or about 0.001 to about 20 wt %, preferably about 0.01 to about 10 wt %, and most preferably about 0.05 to about 5 wt %. Such determinations do not require undue experimentation from the knowledge of the skilled artisan, this disclosure and the documents cited herein. And, the time for sequential administrations may be ascertained without undue experimentation.
[0122] Examples of compositions which may comprise a therapeutic of the invention include liquid preparations for orifice, e.g., oral, nasal, anal, vaginal, peroral, intragastric, mucosal (e.g., perlingual, alveolar, gingival, olfactory or respiratory mucosa) etc., administration such as suspensions, syrups or elixirs; and, preparations for parenteral, subcutaneous, intradermal, intramuscular or intravenous administration (e.g., injectable administration), such as sterile suspensions or emulsions. Such compositions may be in admixture with a suitable carrier, diluent, or excipient such as sterile water, physiological saline, glucose or the like. The compositions may also be lyophilized. The compositions may contain auxiliary substances such as wetting or emulsifying agents, pH buffering agents, gelling or viscosity enhancing additives, preservatives, flavoring agents, colors, and the like, depending upon the route of administration and the preparation desired. Standard texts, such as “REMINGTON'S PHARMACEUTICAL SCIENCE”, 17th edition, 1985, incorporated herein by reference, may be consulted to prepare suitable preparations, without undue experimentation.
[0123] Compositions of the invention, are conveniently provided as liquid preparations, e.g., isotonic aqueous solutions, suspensions, emulsions or viscous compositions which may be buffered to a selected pH. If digestive tract absorption is preferred, compositions of the invention may be in the “solid” form of pills, tablets, capsules, caplets and the like, including “solid”preparations which are time-released or which have a liquid filling, e.g., gelatin covered liquid, whereby the gelatin is dissolved in the stomach for delivery to the gut. If nasal or respiratory (mucosal) administration is desired, compositions may be in a form and dispensed by a squeeze spray dispenser, pump dispenser or aerosol dispenser. Aerosols are usually under pressure by means of a hydrocarbon. Pump dispensers may preferably dispense a metered dose or, a dose having a particular particle size.
[0124] Compositions of the invention may contain pharmaceutically acceptable flavors and / or colors for rendering them more appealing, especially if they are administered orally. The viscous compositions may be in the form of gels, lotions, ointments, creams and the like (e.g., for transdermal administration) and will typically contain a sufficient amount of a thickening agent so that the viscosity is from about 2,500 to 6,500 cps, although more viscous compositions, even up to 10,000 cps may be employed. Viscous compositions have a viscosity preferably of 2,500 to 5,000 cps, since above that range they become more difficult to administer. However, above that range, the compositions may approach solid or gelatin forms, which are then easily administered as a swallowed pill for oral ingestion.
[0125] Liquid preparations are normally easier to prepare than gels, other viscous compositions, and solid compositions. Additionally, liquid compositions are somewhat more convenient to administer, especially by injection or orally. Viscous compositions, on the other hand, may be formulated within the appropriate viscosity range to provide longer contact periods with mucosa, such as the lining of the stomach or nasal mucosa.
[0126] Obviously, the choice of suitable carriers and other additives will depend on the exact route of administration and the nature of the particular dosage form, e.g., liquid dosage form (e.g., whether the composition is to be formulated into a solution, a suspension, gel or another liquid form), or solid dosage form (e.g., whether the composition is to be formulated into a pill, tablet, capsule, caplet, time release form or liquid-filled form).
[0127] Solutions, suspensions, and gels normally contain a major amount of water (preferably purified water) in addition to the active compound. Minor amounts of other ingredients such as pH adjusters (e.g., a base such as sodium hydroxide), emulsifiers or dispersing agents, buffering agents, preservatives, wetting agents, jelling agents (e.g., methylcellulose), colors and / or flavors may also be present. The compositions may be isotonic, i.e., it may have the same osmotic pressure as blood and lacrimal fluid.
[0128] The desired isotonicity of the compositions of this invention may be accomplished using sodium chloride, or other pharmaceutically acceptable agents such as dextrose, boric acid, sodium tartrate, propylene glycol or other inorganic or organic solutes. Sodium chloride is preferred particularly for buffers containing sodium ions.
[0129] Viscosity of the compositions may be maintained at the selected level using a pharmaceutically acceptable thickening agent. Methylcellulose is preferred because it is readily and economically available and is easy to work with. Other suitable thickening agents include, for example, xanthan gum, carboxymethyl cellulose, hydroxypropyl cellulose, carbomer, and the like. The preferred concentration of the thickener will depend upon the agent selected. The important point is to use an amount that will achieve the selected viscosity. Viscous compositions are normally prepared from solutions by the addition of such thickening agents.
[0130] A pharmaceutically acceptable preservative may be employed to increase the shelf-life of the compositions. Benzyl alcohol may be suitable, although a variety of preservatives including, for example, parabens, thimerosal, chlorobutanol, or benzalkonium chloride may also be employed. A suitable concentration of the preservative will be from 0.02% to 2% based on the total weight although there may be appreciable variation depending upon the agent selected.
[0131] Those skilled in the art will recognize that the components of the compositions should be selected to be chemically inert with respect to the active compound. This will present no problem to those skilled in chemical and pharmaceutical principles, or problems may be readily avoided by reference to standard texts or by simple experiments (not involving undue experimentation), from this disclosure and the documents cited herein.
[0132] It is generally envisaged that compounds and compositions of the invention will be administered by injection, as such compounds are to elicit anti-LASV antibodies, and the skilled artisan may, from this disclosure and the knowledge in the art, formulate compounds and compositions identified by herein methods for administration by injection and administer such compounds and compositions by injection.
[0133] The inventive compositions of this invention are prepared by mixing the ingredients following generally accepted procedures. For example, the selected components may be simply mixed in a blender, or other standard device to produce a concentrated mixture which may then be adjusted to the final concentration and viscosity by the addition of water or thickening agent and possibly a buffer to control pH or an additional solute to control tonicity. Generally, the pH maybe from about 3 to 8.5. Compositions may be administered in dosages and by techniques well known to those skilled in the medical arts taking into consideration such factors as the age, sex, weight, and condition of the particular patient, and the composition form used for administration (e.g., solid vs. liquid). Dosages for humans or other mammals may be determined without undue experimentation by the skilled artisan, from this disclosure, the documents cited herein, and the knowledge in the art.
[0134] Suitable regimes for initial administration and further doses or for sequential administrations also are variable, and may include an initial administration followed by subsequent administrations; but nonetheless, may be ascertained by the skilled artisan, from this disclosure, the documents cited herein, and the knowledge in the art.
[0135] In some embodiments, the present invention provides methods for eliciting a boost immune response, including an enhanced boost immune response in a mammal to a target antigen. The prime dose elicits an immune response to the target antigen, and the boost dose elicits an equal or greater measurable immune response compared to the response elicited by administration of the prime dose.
[0136] In some embodiments, the present invention encompasses methods for eliciting an immune response and in particular encompasses methods for eliciting a boost immune response, including an enhanced boost response to a target antigen present in a priming vaccine administered to a mammal. In some embodiments, the prime and boost may be administered with the same vaccine. In some embodiments, the prime and boost may be administered with two different vaccines that target the same antigen. In some embodiments, the prime and boost may be administered with two different vaccines that target different antigens on the same pathogen. In some embodiments, the boost may be the same VSV-LASV. In some embodiments, the boost may be a VSV-LASV that expresses a genetically divergent GPC.
[0137] The prime vaccine and the boost vaccine can be administered by any one or combination of the following routes. In one aspect, the prime vaccine and boost vaccine are administered by the same route. In another aspect, the prime vaccine and boost vaccine are administered by different routes. The term “different routes” encompasses, but is not limited to, different sites on the body, for example, a site that is oral, non-oral, enteral, parenteral, rectal, intranode (lymph node), intravenous, arterial, subcutaneous, intramuscular, intratumor, peritumor,intratumor, infusion, mucosal, nasal, in the cerebrospinal space or cerebrospinal fluid, and so on, as well as by different modes, for example, oral, intravenous, and intramuscular.
[0138] An effective amount of a prime or boost vaccine may be given in one dose, but is not restricted to one dose. Thus, the administration can be two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more, administrations of the vaccine. Where there is more than one administration of a vaccine the administrations can be spaced by time intervals of 1 minute, 2 minutes, 3, 4, 5, 6, 7, 8, 9, 10, or more minutes, by intervals of about 1 hour, 2 hours, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 hours, and so on. In the context of hours, the term “about” means plus or minus any time interval within 30 minutes. The administrations can also be spaced by time intervals of 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, and combinations thereof. The invention is not limited to dosing intervals that are spaced equally in time, but encompass doses at non-equal intervals, such as a priming schedule consisting of administration at 1 day, 4 days, 7 days, and 25 days, just to provide a non-limiting example.
[0139] The following may be taken into consideration in determining the relative timing of the prime vaccine and boost vaccine. It has been found that administration of an antigen, or nucleic acid encoding an antigen, can stimulate expansion of antigen-specific immune cells, resulting in a peak, followed by contraction of the number of antigen specific immune cells (see, e.g., Badovinac, et al. (2002) Nature Immunol. 3:619-626). Initiation of the boost vaccination can be administered before the peak is reached, coincident with the peak, or after the peak.
[0140] Administration of the boost vaccination can be initiated when a population of antigenspecific immune cells has expanded (increased in number) to at least 20% the maximal number of antigen-specific immune cells that is eventually attained; to at least 30%; to at least 40%; to at least 50%; to at least 60%; to at least 70%; to at least 80%; to at least 90%; to at least 95%; to at least 99% the maximal number of antigen-specific immune cells that is eventually attained. Additional schedules of prime-boost vaccines are available, for example, the boost vaccination can be initiated when the population of antigen-specific cells has contracted to under 90% the maximal number of antigen-specific cells; under 80%; under 70%; under 60%; under 50%; under 40%; under 30%; under 20%; under 10%; under 5%; under 1.0%; under 0.5%; under 0.1%; under 0.05%; or under 0.01% the maximal number of antigen-specific immune cells. The antigen-specific cells can be identified as specific for a vector-specific antigen (specific for empty vector), or specific for a heterologous antigen expressed by a nucleic acid contained in the vector.
[0141] In other aspects, administration of the boost vaccination can be initiated at about 5 days after the prime vaccination is initiated; about 10 days after the prime vaccination is initiated; about 15 days; about 20 days; about 25 days; about 30 days; about 35 days; about 40 days; about 45 days; about 50 days; about 55 days; about 60 days; about 65 days; about 70 days; about 75 days; about 80 days, about 6 months, and about 1 year after administration of the prime vaccination is initiated.
[0142] The boost vaccination can be administered 5-10 days after the prime vaccination; 10- 15 days after the prime vaccination; 15-20 days after the prime vaccination; 20-25 days after the prime vaccination; 25-30 days after the prime vaccination; 30-40 days after the prime vaccination; 40-50 days after the prime vaccination; 50-60 days after the prime vaccination; 60-70 days after the prime vaccination; and so on.
[0143] The period of time between initiation of the prime vaccination and initiating the boost vaccination can be determined by one of skill in the art. For example, it can be based on an algorithm that is sensitive to physiologic parameters measured after the prime immunization has occurred.
[0144] In some embodiments of the invention the boost dose of VSVAG-LASV-GPC will enhance the prime dose immune response by at least two-fold, at times between about three- and five-fold or five-fold to ten-fold, or from ten-fold to 100-fold or greater. In some embodiments of the invention the prime dose and boost dose will have a synergistic effect on the immune response. In some embodiments of the invention the enhanced immune response will include a T-cell response, and in some embodiments the T-cell response will be a CD8+T-cell response. In some embodiments, the T-cell response will be a CD4+T-cell response. In some embodiments of the invention the prime dose and boost dose will break the mammal's tolerogenic state towards the target antigen. Examples of all of these embodiments are provided below.
[0145] Cancers and infections can be treated and / or inhibited by administering reagents that modulate the immune system. The prime-boost methods encompassed within the invention give rise to immune responses that are upregulated, and include breaking tolerance to self-antigens. Thus, it is expected that these prime-boost methods will be useful in inhibiting the growth of cancers and / or ameliorating one or more symptoms associated with a cancer. It is also expectedthat the prime-boost methods will be useful in the prophylaxis and / or treatment of a disease caused by a pathogenic agent.
[0146] The present disclosure also contemplates administration of the vector by an oral bait drop, e.g., as described in U.S. Patent No. 5,747,063. The vaccine or immunogenic composition of the present invention may be packaged inside of an edible bait for the target species and distributed into habitats of the target species for consumption. For example, the vaccine or immunogenic composition comprising the vector of the present invention may be administered to rodents that serve as a host for the Lassa virus, to reduce and mitigate the spread of the virus. In contemplation of vaccinating or immunizing a population of rodent host animals for the virus, any suitable bait that attracts the rodents may be used, which include but are not limited to, nuts, fruits, grains, granola, peanut butter, chocolate, bacon, cheese, and jams. The bait comprising the vaccine or immunogenic composition comprising the vector of the present invention may be contained in a container such as a sachet, capsule, tablet, or other suitable form that permits the target species free access to consume the bait and ultimately, the vector. The vaccine or immunogenic composition of the present invention may be in solid or liquid form, depending on the form of the bait used to attract, vaccinate, or immunize the target species.
[0147] Although the present invention and its advantages have been described in detail, it should be understood that various changes, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined in the appended claims.
[0148] The present invention will be further illustrated in the following Examples which are given for illustration purposes only and are not intended to limit the invention in any way.Example: Preclinical efficacy of a live vesicular stomatitis virus-based Lassa virus vaccine candidate advanced for human clinical trials
[0149] Lassa fever is a zoonotic viral hemorrhagic disease caused by Lassa virus (LASV), an enveloped RNA virus in the Arenaviridae family, which is endemic in multiple west African countries including Nigeria, Sierra Leone, Liberia, and Guinea, where its primary reservoir is the multimammate rat, but other rodents also can carry the virus. The geographic range of the rodent host places large parts of the African population at risk of LASV infection, with some estimations being 1-2 million infections per year, which may lead to serious illness. Although most infections are mild, symptoms of acute hemorrhagic fever are estimated to occur in about 20% of cases. Mortality is high for hospitalized patients and pregnant women and their fetuses, and mild to severeinfection can cause permanent hearing loss. In addition to being a very serious and persistent public health problem in parts of Africa, there is increasing risk of importing LASV into other regions as populations become increasingly connected by transportation as observed in the United Kingdom and United States. Moreover, there is the threat of using LASV as well as other hemorrhagic fever viruses like EBOV and MARV for bioterrorism. Because of its pandemic potential, LASV is included in the WHO’s R&D Blueprint for development of diagnostics, vaccines, and treatments. Because a LASV vaccine is a key unmet need, Applicants advanced a promising experimental vaccine for immunizing against the LASV surface glycoprotein as a candidate for human trials. Preclinical evaluation of the vaccine candidate based on a live vesicular stomatitis virus (VSV) vector showed that it was highly efficacious in cynomolgus macaques consistent with earlier research studies, and that the animals developed serum antibodies that could mediate antiviral effector functions including direct neutralization of virus infectivity. These protective immune response features provide valuable data for comparison to an ongoing phase 1 clinical trial.
[0150] Currently, a prophylactic vaccine for use in people is not available. Research is being conducted on LASV vaccines based on multiple technologies including plasmid DNA, virus-like particles, virus replicons, live-attenuated viruses, and various types of viral vector. Notably, experimental vaccines based on chemically inactivated LASV particles were shown to elicit immune responses in macaques but failed to protect the animals from disease following subsequent exposure to LASV indicating that the characteristics of the delivered viral immunogens play a prominent role in the development of protective anti-LASV immune responses.
[0151] A principal target of the immune response is the viral glycoprotein complex (GPC), which spans the LASV lipid envelope and is the only virion protein exposed on the surface of the intact virus particle. Functional native GPC is composed of three heterotrimers. Each heterotrimer is derived from a precursor glycoprotein that is proteolytically processed at two sites during biosynthesis (Fig. 1C) to produce the long stable signal peptide (SSP) that is incorporated in the virion envelope, the cellular receptor binding subunit GP1, and the GP2 subunit that contains the transmembrane domain and sequences that drive membrane fusion during virus entry. Importantly, multiple anti-GPC monoclonal antibodies (mAbs) that can directly neutralize LASV infectivity (nAbs) in vitro have been isolated from people that have recovered from LASV infection, and cocktails of these nAbs have been developed that can prevent disease in animals when they areinfused prior to or soon after infection with a lethal dose of LASV. The preclinical efficacy of these nAbs indicate that a prophylactic vaccine capable of inducing similar antibodies will be able to prevent LASV disease.
[0152] A common feature of many of the anti-GPC nAbs is that they bind structural epitopes unique to the functional prefusion form of trimeric GPC; therefore, eliciting antibodies with similar functional properties through vaccination will require a LASV vaccine that effectively presents native viral glycoprotein structures to the immune system. Historically, vaccines based on live attenuated enveloped viruses like measles virus, mumps virus, and yellow fever virus have reliably induced nAbs because they expose the immune system to native viral glycoproteins in the context of a mild but immunostimulatory viral infection. Unfortunately, applying this proven vaccine approach to LASV presents difficult practical challenges associated with developing a safe and effective live vaccine from highly virulent LASV; thus, multiple alternative strategies need to be pursued.
[0153] The EBOV vaccine marketed as ERVEBO® provides valuable direction for the development of a live viral vaccine against LASV GPC. ERVEBO® is based on a recombinant VSV in which the gene encoding the single natural VSV glycoprotein (VSV G; Fig. 1A) was deleted and replaced with a gene that codes for the native EBOV glycoprotein (GP). This chimeric virus (called rVSVAG-ZEBOV-GP) depends on EBOV GP to functionally substitute for VSV G and provide the cell attachment and entry functions needed for infection and propagation. Although substitution of VSV G with the heterologous EBOV glycoprotein changes cellular receptor usage and attenuates VSV replication, multiple preclinical studies showed that a single intramuscular injection with live rVSVAG-ZEBOV-GP was very efficacious as well as safe when tested in macaques. Subsequent clinical trials demonstrated that the live vaccine was highly effective when used during the large Ebola virus outbreak in 2014-2016. Interestingly, rVSVAG- ZEBOV-GP vaccination appeared to stimulate two important elements of protective immunity that contributed to prevention of disease during the EBOV outbreak. These comprised adaptive immunity, including anti-GP serum immunoglobulin G (IgG) and nAbs that have been correlated with efficacy, and a fast-acting innate antiviral response that seemed to provide protection from disease during the period soon after vaccination when adaptive immunity was still developing. Overall, the cumulative data generated during preclinical and clinical studies with rVSVAG-ZEBOV-GP indicate that the live VSVAG chimeric virus design is an effective vaccine technology for eliciting protective antibodies targeting complex viral glycoproteins and that it will be applicable to the development of a similar vaccine against LASV GPC (Fig. 1A-C; VSVAG- LASV-GPC). In fact, considerable preclinical research has shown that VSVAG-LASV-GPC is highly efficacious in macaques, providing a compelling rationale to advance this approach for a prophylactic LASV vaccine product.
[0154] In this report, Applicants describe the development of VSVAG-LASV-GPC as a candidate vaccine for use in people. This vaccine candidate is currently being evaluated in a multicenter phase 1 clinical trial (ClinicalTrials.gov: NCT04794218) with follow up phase 2b / 3 clinical studies being planned (ClinicalTrials.gov: NCT05868733), and the preclinical data described below showed that it was efficacious when macaques were vaccinated by intramuscular injection with a typical dose of ~2xl07plaque-forming units (PFU) or a 100-fold lower dose. Moreover, analysis of peripheral blood samples from vaccinated animals has provided useful biomarkers that can be assessed further during clinical research. Notably, vaccination induced LASV GPC-binding antibodies and functional antibodies and, importantly, serum was found to neutralize the homologous VSVAG-LASV-GPC vaccine virus as well as chimeric viruses expressing divergent GPCs from LASV strains circulating in various west African regions. Additionally, the macaque blood transcriptome was analyzed early after vaccination. This identified modules of differentially expressed genes (DEGs), many of which were associated with the innate immune response including pathogen-sensing pathways and the type-I interferon response. Interestingly, some of the DEGs modulated by VSVAG-LASV-GPC vaccination have been noted in studies with VSVAG-ZEBOV-GP, and these might provide valuable biomarkers for studying immunity associated with efficacy of multiple VSVAG-based vaccines.
[0155] Cell culture. Vero cells qualified for vaccine production were used to generate and propagate VSVAG-LASV-GPC. The qualified cell bank that was used was developed from the World Health Organization (WHO) working cell bank (WHO 10-87) deposited at the European Collection of Authenticated Cell Cultures (Vero[WHO], ECACC 88020401). Applicants have used the same cells previously to develop other VSV-based clinical trial candidates. Cell monolayers were cultured in Dulbecco’s modified Eagle medium (DMEM) supplemented with 4 mM L-glutamine and 10% gamma-irradiated fetal bovine serum (FBS) (all from MilliporeSigma).Cells were incubated at 37°C, 5% CO2, and 85% humidity. Monolayers were dissociated for subculturing by treatment with TrypLE™ Select (Gibco, ThermoFisher Scientific).
[0156] Recombinant VSV. A VSVAG-LASV-GPC strain encoding GPC from LASV Lineage IV (Josiah) suitable for producing a human vaccine was generated from plasmid DNA. The VSVAG-LASV-GPC genomic clone used to develop a well -documented recombinant virus was kindly provided by the Public Health Agency of Canada. Recovery of VSVAG-LASV-GPC from plasmid DNA was executed using Vero cells and an electroporation method described earlier (41, 42). Virus released into the medium 3 days after electroporation was then used to infect fresh Vero cell monolayers, cultured in DMEM containing additives described above, to amplify the new recombinant virus. Two days later, medium containing virus was collected and divided for storage at less than -60°C and extraction of RNA for genomic sequencing. After confirming that the recovered virus population had the expected genomic consensus sequence, three rounds of plaque isolation were performed. Isolated virus plaques were picked from infected Vero cell monolayers overlaid with DMEM containing 4 mM L-glutamine, 2% FBS, and 0.5% agarose (Lonza). Virus from multiple individual plaques was amplified in Vero cells after which genomic sequence analysis was used to identify lead candidates with the expected genome sequence. Lead candidates were then subjected to two additional rounds of plaque isolation before they were used to infect Vero cells cultured in 5-layer Cell Stacks (Corning). About 40 h after infection, when cytopathic effects were evident throughout most of the monolayer, medium was harvested and clarified by low-speed centrifugation. The clarified medium was aliquoted and stored at less than -60°C, and these virus stocks were tested further using multiple assays to confirm that the viruses had the expected genomic sequence, expressed GPC, and were free of bacterial and mycoplasma contamination. A selected candidate was then designated as the pre-master virus seed (preMVS) and was used in the preclinical efficacy study described here and to support manufacturing of phase 1 clinical trial material (ClinicalTrials.gov: NCT04794218).
[0157] VSVAG-LASV-GPC recombinants also were developed for use in plaque reduction assays described in the corresponding section below. GPC-coding sequences representing LASV lineages I-V and VII from different western African geographic regions (Genbank IDs in Fig. 9) were optimized using a codon frequency consistent with VSV and then using synonymous codons to disrupt any nucleotide sequence that might interfere with VSV transcription or replication. Theoptimized GPC genes were synthesized by GenScript and inserted between the VSV M and L genes of a VSV Indiana genomic clone described before. Recovery, propagation, and characterization of recombinant virus was performed as described above. A VSVAG chimera expressing the MARV Musoke GP was prepared analogously and was utilized as a vector control across described assays.
[0158] Plaque assays. Infectious VSVAG-LASV-GPC was quantified by plaque assay. Plaque assays were performed using Vero cells that were cultured in six-well culture plates (Falcon) containing DMEM supplemented with 10% FBS as described above. Ten-fold dilutions of the viral stock were prepared in DMEM containing 2% FBS and 0.5 ml of each dilution were used to infect the Vero cell monolayers. After infection proceeded for 1 h, the virus inoculum was removed, and cells were overlaid with Minimal Essential Medium (MEM; Gibco ThermoFisher Scientific) containing 0.8% agarose and 2% FBS. After plaques developed for about 48 h, the infected monolayers were fixed with 7% formaldehyde and then stained with 0.3% crystal violet prepared in Milli-Q® ultrapure water (both from MilliporeSigma).
[0159] VSVAG-LASV-GPC genomic sequencing was performed by generating cDNA from purified RNA (RNeasy, Qiagen) using the SuperScript III one-step RT-PCR System (Invitrogen, ThermoFisher Scientific). PCR was used to amplify seven overlapping cDNA fragments covering the complete VSVAG-LASV-GPC genome. Sequencing was conducted using an ABI 3500 Genetic Analyzer (Applied Biosystems).
[0160] Western blot. GPC expression by infected Vero cells was evaluated by Western blot as described before. LASV GPC and its subunits were detected by incubating membranes with human mAb 3.3B specific for GP1 or mAb 22.5D specific for GP2 (both from Zalgen). VSV nucleoprotein (N) was detected using a rabbit polyclonal serum developed at IAVI. Secondary antibodies linked to horseradish peroxidase (Jackson ImmunoResearch) and the Enhanced Chemiluminescence System (ECL Plus; Amersham Biosciences) were used to produce a signal detected with a ChemiDoc imager (BioRad).
[0161] Flow cytometry. Flow cytometry was used to assess cell-surface expression of GPC and intracellular expression of VSV N using methods analogous to those previously described to analyze a MARV vaccine candidate. Adherent infected cells were detached from plates at about 48 h after infection with VSVAG-LASV-GP by scraping them into a wash solution containingphosphate-buffered saline (PBS; Gibco ThermoFisher Scientific) supplemented with 0.5% bovine serum albumin (BSA; MilliporeSigma) (PBS / BSA). The cell suspensions were then distributed into a 96-deep-well tissue culture plate (Nunc) before collection by low-speed centrifugation for 5 min at 860 x g. For staining of GPC on the cell surface, the cell pellets were resuspended PBS / BSA containing human mAbs (Zalgen) specific for LASV GPC at a final concentration of 1 pg / ml before incubation at room temperature for 25 min. Next, the cells were collected by centrifugation, resuspended in PBS / BSA, and centrifugation was repeated. The pelleted cells then were resuspended in Cytofix / Cytoperm Solution (BD Biosciences) and incubated for 20 min at 4°C in the dark per the manufacturers recommendations to prepare cells for intracellular staining. The permeabilized cells were collected by centrifugation and resuspended in Perm / Wash Buffer (BD Biosciences) before repeating centrifugation. To stain intracellular VSV N, the cells were resuspended in Perm / Wash Buffer containing anti -VSV N mouse mAb (10G4, Kerafast) at a final concentration of 1 pg / ml and were then incubated in the dark at room temperature for 25 min. Following incubation, the cells were collected and washed with Perm / Wash Solution as described above, after which the cells were resuspended with Perm / Wash Solution containing labeled secondary antibodies including goat anti-human Alexa555 and goat anti-mouse Alexa647 (Invitrogen, ThermoFisher Scientific). Cells were incubated in the dark at room temperature for 25 min before the free antibodies were removed by collecting cells by centrifugation and executing a wash step with Perm / Wash Buffer. Cells were resuspended in Perm / Wash Buffer and flow cytometry was performed with a BD SORP LSRII flow cytometer (BD Biosciences). Flow Cytometry Standard (FCS) files were exported and analyzed for co-expression of labelled LASV glycoprotein and VSV N using FlowJo software (BD Biosciences / Treestar, version 10.6.2).
[0162] Production of VSVAG-LASV-GP vaccine material. Preclinical vaccine material used in the preclinical efficacy study was produced in Vero cell cultures, concentrated and purified with a process based on tangential flow filtration (TFF) (Repligen) using methods like those described previously. Briefly, Vero cells were seeded in a 5-layer Cell Stack (Corning) with high glucose DMEM (ThermoFisher) supplemented with 2 mM L-glutamine and 10% FBS (both from MilliporeSigma, Burlington, MA), after which they were incubated for 48-72 h to achieve a monolayer that was near-confluent. Before infection with preMVS, the cell monolayer was washed three times with DMEM before adding 375 ml of Virus-Production Serum-Free Medium (VP- SFM; ThermoFisher Scientific), supplemented with 4 mM L-glutamine, containing virus toachieve a multiplicity of infection (MOI) of 0.001. At 44 hr after infection, medium containing virus was harvested and subsequently clarified by sequential filtration with a 1.2-pm filter (Sartorius Sartopure), followed by a 0.8- / 0.45-pm depth filter (Pall Corporation). TFF was used to concentrate and further purify the virus using a 750-kD hollow fiber membrane (GE Healthcare). Benzonase treatment (200 U / ml; MilliporeSigma) in the presence of 1.5 mM of MgCh (Invitrogen, ThermoFisher Scientific) was performed for 30 min at room temperature to digest any contaminating nucleic acid. Diafiltration was performed with Hank’s balanced salt solution (HBSS, pH 7.2; Invitrogen, ThermoFisher) containing 15% trehalose (MilliporeSigma). The final product was filtered with a 0.2-pM Steripak-GP 10 filter unit (MilliporeSigma), aliquoted, and stored at less than -60°C.
[0163] The vaccine material was analyzed for titer by plaque assay as described above. VSV genome copies were quantified by real-time quantitative PCR (RT-qPCR) specific for the VSV N gene. Briefly, duplicate reverse transcriptase reactions were performed using 15 pl of purified RNA per reaction (standards and unknown samples); 10 pl of a cocktail composed of reagents from the Sensi script Reverse Transcriptase kit (Qiagen) including lx reverse transcription buffer, 0.5 mM of each dNTP, 10 U / reaction RNase Inhibitor (Invitrogen, Thermofisher Scientific), and 10 U Sensiscript reverse transcriptase; and a VSV N-specific forward primer (400 nM, 5’- CGGAGGATTGACGACTAATGC -3’ [Integrated DNA Technologies]) that anneals to the negative-sense genomic RNA. Reverse transcription was performed at 50°C for 45 min and terminated by heat inactivation (95°C for 2 min). The heat-inactivated 25 pl reaction was adjusted for qPCR by adding 25 pl of a reagent mix composed of lx QuantiTect Multiplex PCR Master Mix (Qiagen), 400 nM each of VSV N-specific reverse primer (5’- ACCATCCGAGCCATTCGA -3’) and VSV N-specific forward primer, and 200 nM 6-carboxyfluorescein (FAM)-labeled minor groove binder (MGB) probe (5’-6FAM- CGCCACAAGGCAG -MGB-3’; ThermoFisher Scientific). An AriaMx Real-Time PCR Instrument (Agilent) was used for amplification and detection with the following conditions: 15 min at 95°C followed by 45 cycles of 15 s at 94°C and 60 s at 60°C. Results from duplicate test samples were averaged and genome copy numbers were interpolated from a curve generated with known RNA standards.
[0164] Analysis of the integrity of the GPC gene was performed by RT-PCR with primers flanking the GPC coding region and Superscript IV One-Step RT-PCR System (Invitrogen). RT-PCR was performed at 60°C for 10 min and 98°C for 2 min, followed by 40 cycles of 98°C for 10 s, 70°C for 10 s, and 72°C for 1.5 min with final extension at 72°C for 5 min. A unique 2.5 Kbp band was detected as expected in an 0.8% agarose gel after which the 2.5 Kbp band was excised and DNA was extracted (QIAquick gel extraction Kit; Qiagen). Sanger sequencing was performed with BigDye Terminator v3.1 Cycle Sequencing Kit (ThermoFisher Scientific) and BigDye XTerminator™ Purification Kit (ThermoFisher Scientific) with ABI 3500XL Genetic Analyzer (ThermoFisher Scientific).[00165J Viral particles in the purified vaccine material were quantified with an A60- MicroPLUS flow cytometer (Apogee Flow Systems Ltd) using highly purified Milli-Q water as sheath fluid. Briefly, the sample was diluted 1:300 in sterile HBSS buffer and ran at 1.5 L / minute with the autocycler set to 200,000 total events. A 405 nm violet laser was set to 150 mW and a Large-Angle Light Scatter detector was used to resolve virus peak profile.
[0166] Further quality control evaluations were performed including a qPCR assay for Mycoplasma spp. using MycoSEQ™ Mycoplasma Detection Kits (Applied Biosystems), quantification of cell host DNA with qPCR conducted with resDNASEQ™ Quantitative Vero DNA Kits (Applied Biosystems) and total protein by Bradford protein assay. Sterility testing was conducted with Luria-Bertani (LB) agar, malt extract agar, blood agar, and chocolate agar plates (Teknova) incubated at 37°C for 7 days.
[0167] Electron microscopy of virus particles from purified vaccine material. Three pl of purified VSVAG-LASV-GPC was adsorbed onto a continuous carbon film on 400 mesh copper grids that were glow discharged for 15 s. Excess solution was manually flicked off the grid and then washed three times with 50 mM HEPES with 50 mM NaCl. Next, adsorbed VSVAG-LASV- GPC was fixed with 2.3% glutaraldehyde for 20 min. Excess solution was manually flicked off and subsequent staining of the grid was performed using 2% methylamine tungstate pH 6.8 (VitroEase, ThermoFisher). Excess stain solution was flicked off and the grid was air dried before imaging on a FEI Titan Halo electron microscope with a K3 direct electron detector. All steps in the negative stain grid preparation were done with the tweezers holding the grid resting on ice. All 2-D and 3-D image processing was performed using cryoSPARC v.4.0. CTF correction of negative stain electron micrographs was done using Patch CTF in cryoSPARC. Particle projections were manually picked and then sorted into reference-free 2-D class averages. Selected particleprojections were then used to generate ab-initio reconstructions that underwent several rounds of 3-D refinement, first without symmetry and then using C3 symmetry. Visualization and coloring of negative 3-D reconstructions was performed using ChimeraX.
[0168] VSVAG-LASV-GPC vaccination. Vaccination was performed in ABSL-2 suites and LASV challenge was conducted in ABSL-4 suites at the University of Texas Medical Branch (UTMB). The study design was approved by the UTMB Institutional Animal Care and Use Committee (IACUC), and all animal research was conducted in compliance with the UTMB IACUC, Animal Welfare Act, and other federal statutes and regulations relating to animal care. The UTMB animal research facility is fully accredited by the Association for Assessment and Accreditation of Laboratory Animal Care International and adheres to principles specified in the eighth edition of the Guide for the Care and Use of Laboratory Animals, National Research Council.
[0169] Ten Chinese-origin cynomolgus macaques (Macaca fascicularis) were assigned to two vaccine groups of five animals each. Each group of vaccinated animals was composed of two males and three females. One group was administered a single dose of 2xl07plaque-forming units (PFU) VSVAG-LASV-GPC, the other group received a lower dose of 2xl05PFU, both by intramuscular injection. Animals were vaccinated once with 1 ml of virus injected into the caudal thigh. A control group of three animals (one female and two males) received an equivalent volume of vaccine diluent (PBS, 5% trehalose) delivered intramuscularly. Titers from diluted unused vaccine virus were determined by plaque assay to confirm the expected formulation dose for each vaccination.
[0170] Blood was drawn by femoral venipuncture and collected into sodium heparin vacutainer tubes (BD Biosciences) prior to and on days 1, 3, 10 and 27 after vaccination. Blood tubes were centrifuged at -800 * g for 10 minutes to remove plasma before peripheral blood mononuclear cell (PBMC) isolation by density gradient centrifugation on Ficoll Hypaque (GE Healthcare) using Accuspin tubes (MilliporeSigma) according to the manufacturer’s instructions. The tubes were centrifuged at -800 x g and room temperature for 15 min and the resulting buffy coat was collected. Cells were washed once in Roswell Park Memorial Institute (RPMI) medium supplemented with 10% fetal bovine serum (FBS), lOO U / ml penicillin, 100 pg / ml streptomycin, and 1% L-glutamine (R10; all from Gibco, ThermoFisher Scientific) and treated briefly withammonium chloride potassium red cell lysis buffer (ACK; Gibco, Thermo Fisher Scientific) to remove any contaminating erythrocytes. PBMC were then centrifuged at -250 x g for 10 minutes to eliminate residual platelets, washed twice with RIO media, and enumerated with a TC20 Automated Cell Counter (Bio-Rad Laboratories). PBMCs were cryopreserved in FBS containing 10% dimethyl sulfoxide (DMSO; MilliporeSigma) and stored in a liquid nitrogen freezer. Serum used in enzyme linked immunosorbent assay (ELISA) and virus neutralization assays was isolated from blood collected in serum separator tubes (SSTs; BD Biosciences) by centrifugation at 800 x g for 10 min. Serum and plasma aliquots were stored at -20°C until needed.
[0171] Detection of RNAemia. VSVAG-LASV-GPC RNAemia was assessed by RT-qPCR based on VSV N as described above. RNA was purified from plasma derived from blood collected on days 1, 3 and 10 post-vaccination. Briefly, virus from 1.0 ml of plasma was collected by centrifugation at 61,973 x g (Allegra 64R; Beckman Coulter) for 60 min at 4°C. The virus pellet was then processed using the RNeasy Mini kit (Qiagen) by suspending virus in a solution containing 300 pl of lysis buffer from the kit, 3 pl of 14.2 M 2-mercaptoethanol (Bio-Rad Laboratories), and 16 pl of 20 mg / ml proteinase K (ThermoFisher Scientific). Samples were digested at 56°C for 1 h, after which RNA was purified using spin columns and the QIAvac 24 Plus vacuum system (Qiagen) following the RNeasy Mini kit protocol. RNA was eluted in 50 pl of RNase-free water supplemented with 1 mM dithiothreitol (MilliporeSigma) and 1 U / ml RNAseOUT (Invitrogen, Thermofisher Scientific). Positive samples were defined as >200 genome copies / ml of plasma.
[0172] GPC-binding ELISA. Anti-GPC serum IgG binding titers were quantified by ELISA using a soluble GP1-GP2 fusion protein (Linked LASV-GP, Lineage IV; Zalgen) expressed from Drosophila S2 cells. Corning 96 well half-area microplates were coated with 1 pg / ml protein in ELISA Coating Buffer (Biolegend) overnight at 4°C after which the plates were washed three times with ELISA wash buffer (PBST; PBS [Corning] plus 1% Tween-20 (VWR Chemicals) before being blocked with PBS containing 3% BSA for 2 h at 37°C. After blocking, the plates were washed with ELISA wash buffer and were then incubated with serial dilutions of macaque sera prepared in dilution buffer (PBS plus 1% BSA) for 1 h at 37°C. Following incubation, plates were washed with PBST and were then incubated for 1 h at 37°C with 1 :4,000 dilution of horseradish peroxidase (HRP) conjugated anti-monkey IgG secondary antibody (JacksonImmunoResearch) prepared in dilution buffer. After removing the secondary antibody and washing the plates with ELISA wash buffer, signal was developed using 1-Step Ultra Tetramethylbenzidine (TMB) Substrate (Thermofisher Scientific) for 10 min at room temperature before the reaction was stopped with 2N sulfuric acid (VWR Chemicals). Plates were read at 450 nm using a SpectraMax Plus Microplate Reader (Molecular Devices). Binding antibody endpoint titers were calculated using GraphPad Prism 8 software (GraphPad Software) using 4-parameter non-linear curve fitting.[00173J Plaque-reduction assay. Virus-neutralizing anti-GPC serum antibodies (nAbs) were quantified using VSVAG-LASV-GPC recombinants expressing GPCs from different LASV lineages (Fig. 9). Serum collected 27 days after vaccination was heat-inactivated at 56°C for 30 min after which it was clarified by centrifugation at 9,300 x g for 10 min. Clarified serum diluted serially from 1 :20 to 1:2,560 was incubated 1 h at 37°C with VSVAG-LASV-GPC encoding different GPCs to produce a target of approximately 100 plaques as input before the serum-virus mixture was used to infect Vero cell monolayers in 96-well plates. Following a 2 h incubation at 37°C, the cells were overlaid with DMEM (ThermoFisher Scientific) containing 1% FBS and 0.5% methylcellulose (ThermoFisher Scientific). Plaques were allowed to develop for 24 h at 37°C before the methylcellulose overlay was removed and the monolayer was washed once with PBS in preparation for fixation with ice-cold methanol for 1 h at room temperature. After removing the methanol, the plates were air dried before being rehydrated for 10 min with PBS containing 1% BSA and 1% goat serum (GS; MilliporeSigma) followed by blocking with PBS containing 5% BSA and 5% GS for 1 h at room temperature. The blocking buffer was removed and then a VSV N rabbit polyclonal antisera (43) diluted in PBS (containing 1% BSA and 1% GS) was applied to each well and incubated for 1 h at 37°C. Plates were then washed three times with PBS (1% BSA and 1% GS) before incubating for 1 h with PBS (1% BSA and 1% GS) containing a goat antirabbit secondary antibody labeled with Alexa 488 (Invitrogen, ThermoFisher Scientific). Wells then were washed three times with PBS (1% BSA and 1% GS) and stained plaques were visualized and counted using a Gen5 3.08 imager (Agilent). Serum samples starting at a dilution of 1 :20 were analyzed and the lowest serum dilution that decreased plaques by 50% or more was reported.
[0174] Systems serology. Systems Serology performed to assess the potential for serum antibodies to mediate antibody-directed effector functions was conducted as described earlier. To capture anti-GPC antibodies from serum for analysis, beads were linked to several different solubleGPCs such as GP1-GP2 fusion protein (GP-link) or GP1-GP2 complex stabilized in native-like prefusion form by a cysteine linkage, along with control antigens (influenza hemagglutinin and EBOV GP). Luminex beads were coupled with antigens through NHS-ester linkages through Sulfo-NHS and EDC (ThermoFisher Scientific) and incubated with sera at specific dilutions at 4°C overnight with continuous shaking. The formed immune complexes were washed 3X on a 384-well HydroSpeed plate washer (Tecan) using Assay buffer (IX PBS pH 7.4, 0.1% w / v BSA, 0.05% Tween-20). Beads were then incubated with phycoerythrin (PE)-conjugated detection antibodies directed against nonhuman primate (NHP) antibody subclasses and isotypes diluted in Assay buffer at room temperature for 1 h with continuous shaking. Beads were washed 3X with Assay buffer and then resuspended in 40 pL of QSOL buffer (Intellicyt, Sartorius) and then run on an Intellicyt iQue Screener Plus Flow Cytometer (Intellicyt, Sartorius). Gating was performed according to a previously validated SOP using iQue Forecyt V. 10.0.8341 software.
[0175] Binding of antigen-specific antibodies to custom produced and purified Fc receptors (Duke Human Vaccine Institute) was done similarly to antibody profiling and according to a previously validated SOP. Purified Fc receptors were biotinylated using the BirA ligase (Avidity) and then incubated with streptavidin-PE (Prozyme). Complexes were then added to Luminex beads that had been previously incubated with sera and washed. Binding was determined through flow cytometry.
[0176] For antibody-dependent cellular phagocytosis (ADCP), fluorescent neutravidin microspheres (ThermoFisher) were conjugated with target antigen and then blocked using 5% BSA in IX PBS. Beads were washed with PBS and then incubated with diluted serum from subjects to allow for the formation of pre-immune complexes at 37°C for 2 h. Beads were then washed to remove non-specific binding. To the pre-immune complexed beads, 25,000 THP-1 cells (ATCC) per well were added into a 96-well plate. Plates were incubated at 37°C overnight to allow for uptake. Cells were then fixed and phagocytosis was determined by gating for fluorescent-bead positive cells on an Intellicyt iQue Screener Plus. Phagocytic score was defined as: (% bead positive cells) * (gMFI of bead positive cells) / (10X gMFI of the first bead positive peak).
[0177] For antibody-dependent neutrophil phagocytosis (ADNP), antigen was coupled to fluorescent neutravidin microspheres similar to ADCP and pre-immune complexes were allowed to form using the sera from subjects as above. Neutrophils were obtained from primary leukocytes from freshly drawn blood into citrate dextrose tubes. ACK (ThermoFisher) was added to themixture. Leukocytes were added to a concentration of 50,000 cells / well into a 96-well plate and incubated at 37°C for 1 h. Cells were then fixed and surface stained for CD66b, CD14, and CD3 (all from BD-Biosciences). Single fluorescent cells were quantified using an Intellicyt iQue Screen Plus and phagocytic score was calculated.
[0178] Antibody-dependent complement deposition (ADCD) was performed using antigen- coated beads incubated with sera for 2 h at 37°C to allow for the formation of pre-immune complexes. Guinea pig complement (CedarLane) was diluted in veronal buffer (Boston Bioproducts) and incubated with the beads for 20 min at 37°C. Beads were then washed with PBS + 5 mM EDTA and stained with anti-C3 FITC (MP Biomed). Complement deposition was quantified through fluorescence using an Intellicyt iQue Screener Plus.
[0179] Antibody-dependent natural killer cell activation (ADNKA) was performed on 96-well ELISA plates (ThermoFisher) containing immobilized target antigen(s). Serum samples were diluted in 5% BSA in PBS and added to the plates and incubated at 37°C for 2 h to allow for the formation of pre-immune complexes. Primary natural killer (NK) cells were obtained from buffy coats taken from healthy donors. Buffy coats were treated with RosetteSep human NK cell enrichment cocktail (StemCell) and then resuspended in RPMI + 10% FBS and 10 pg / ml of brefeldin A (Sigma), 1: 10 dilution of Golgi Stop (BD Biosciences). The cell suspension was added to the ELISA plates at a concentration of 25,000 cells / well and incubated at 37°C for 5 h. Cells were fixed and permeabilized using Fix and Perm Cell Permeabilization Kit (ThermoFisher), and then stained using anti-CD56, anti-CD3, anti-MIP-ip, and anti-IFN-y (BD Biosciences). Cells were run on an Intellicyt iQue Screener Plus and gates were drawn on singlet CD56+ / CD3- cells. Results were reported as the percentage of cells that were MIP-ip, and / or IFN-y positive relative to mock-treated controls.
[0180] For all statistical calculations for systems serology experiments, measurements were log-transformed and groupings were determined using the Benjamini -Hochberg procedure (R p. adjust) and Mann-Whitney U tests. All subjects were analyzed in technical duplicates, and correlations between replicates was assessed prior to any subsequent analyses. Significant differences were reported as having a p<0.05. All calculations were done using R Studio version 4.0.2. Analysis pipeline for systems serology is available on the publicly accessible systemsseRology on GitHub.
[0181] ELISpot. LASV GPC-specific T-cells in peripheral blood were quantified by IFN-y enzyme-linked immunospot (ELISpot) assay using the MabTech Monkey IFN-gamma ELISPOT Basic kit (Mabtech). Ninety-six-well multiscreen ELISpot plates (MilliporeSigma) were coated overnight at 4°C with anti-IFN-y antibody. The following day, plates were washed with PBS containing 0.05% Tween-20 (Invitrogen, ThermoFisher Scientific) and were then incubated in RIO medium (RPMI 1640 from Gibco, ThermoFisher Scientific supplemented with 10% FBS) for 1 h at 37°C then rinsed again with R10 medium before adding 200,000 PBMCs in R10 media and one of several different stimulator proteins, which were either recombinant LASV-GPC protein (Zalgen) or LASV-GPC or VSV N peptide pools (Genscript). PBMCs incubated with DMSO or Staphylococcal enterotoxin B (SEB; MilliporeSigma) served as negative and positive controls, respectively. Plates were incubated for 18-20 h at 37°C in 5% CO2, after which they were washed and developed according to the manufacturer’s instructions using a HRP labelled secondary antibody and TMB substrate. IFN-y positive spots were counted using an automated ELISpot reader (Cellular Technology Limited, CTL). Antigen-specific responses were determined by subtracting the number of spots in DMSO-treated from peptide-treated wells. Results are shown for average spot-forming units (SFU) per 106PBMCs obtained from duplicate wells.
[0182] RNA-seq. Blood transcriptome analysis after vaccination was conducted by Next- Generation Sequencing (NGS). Whole-blood (250 pl) collected 18 days prior to vaccination and at 1 and 3 days after vaccination were stored at -80°C in DNA / RNA Shield (Zymo Research). Total RNA was isolated from whole blood samples using the Zymo Research Quick RNA Whole Blood Kit according to the manufacturer’s protocol. Sample libraries were globin-depleted and prepared using the SMART-Seq® stranded kit (Takara Bio) which includes poly(A) selection. Paired-end reads of 150 bp were sequenced using an Illumina HiSeq 4000.
[0183] For transcriptomics analyses, raw RNA-seq sequencing data were aligned to the Macaca fascicularis reference genome (Ensembl version 5.0) using STAR version 2.6. Id and gene counts were computed using featureCounts version 1.5.2. Differential expression analyses comparing post-vaccination transcript abundance to pre-vaccination abundance were performed using DESeq2 version 1.28.0. Principal Component Analysis (PC A) was used to identify outliers among transcriptomic samples: if a sample’s first or second principal component value was more than three standard deviations from the corresponding principal component’s mean across samples, it was excluded from downstream analyses. Two samples were identified as outliersbased on PCA: one from the control group collected 3 days after vaccination and one from the low-dose vaccinated group collected at the same timepoint.
[0184] Gene sets used to functionally profde groups of differentially-expressed transcripts were obtained through the tmod R package version 0.46.2 and the MSigDB Hallmark gene set. A total of 656 gene sets were used in the analysis. Hypergeometric tests were used to assess gene-set enrichment for differentially-expressed genes. For all statistical tests, FDR-adjusted P-values [Benjamini -Hochberg method] less than 0.05 were considered significant. Homer Motif Analysis was used to identify known transcription factor binding motifs enriched in the promoter sequences of the human orthologs of genes determined to be differentially expressed (DEGs). STRING was used to identify known protein-protein interactions among DEGs using the high-confidence setting.
[0185] Vaccine efficacy and LASV challenge. On day 28 post-vaccination all animals were challenged by intramuscular injection with 3.5xl03PFU of LASV (Lineage IV, Josiah strain). Viral stocks were prepared at UTMB using material originally derived from a 1976 Sierra Leone viral isolate collected from human serum of a 40-year-old male. Macaques were monitored daily and scored for LASV disease progression using a humane endpoint arenavirus disease scoring sheet approved by the UTMB IACUC. The scoring changes measured from baseline included posture and activity level, attitude and behavior, food intake, respiration, and disease manifestations, such as visible rash, hemorrhage, ecchymosis, or flushed skin. Animals were also monitored for central nervous system abnormalities. A score of >10 indicated that an animal met the criteria for euthanasia. Blood was collected on days 4, 7, 10, 11, 13, 15, 21 and 28 after LASV challenge for evaluation of blood chemistries and quantification of infectious LASV.
[0186] To monitor LASV genomes in blood by RT-qPCR, RNA was isolated from whole blood using the viral RNA mini -kit (Qiagen) using 100 pl of blood into 600 pl of viral lysis buffer. Primers / probe targeting the N gene (Genbank HQ688672) of LASV were used for real-time RT- qPCR, with the probe used here being 6-carboxyfluorescein (6FAM)-5' CCC TCA CTG TGC ACT AAT GGA CTG C3'-6 carboxy tetramethyl rhodamine (TAMRA) (Life Technologies) LASV RNA was detected using the CFX96 detection system (BioRad Laboratories) in one-step probe RT-qPCR kits (Qiagen) with the following cycle conditions: 50°C for 10 minutes, 95°C for 10 seconds, and 40 cycles of 95°C for 10 seconds and 59°C for 30 seconds. Threshold cycle (CT) values representing LASV small (S) genomes were analyzed with CFX Manager Software, anddata are shewn as genome equivalents (GEq). To create the GEq standard, RNA from LASV stocks was extracted, and the number of LASV S genomes was calculated using Avogadro's number, the molecular weight of the LASV genome, and the percentage of the S genome segment to total viral RNA genomes present in the standard sample The limit of detection was 1 x 104GEq / rnl.
[0187] Infectious LASV in blood was quantified by plaque assay using serum collected from macaques. Briefly, increasing 10-fold dilutions of serum samples were allowed to infect Vero 76 monolayers in duplicate wells (200 pl per well). The limit of detection from serum was 15 PFU / ml. All cells were verified as mycoplasma free using eMyco-plus mycoplasma detection kit from Boca Scientific.
[0188] Blood was collected via peripheral venipuncture using serum separator tubes and processed to serum. Blood chemistry analyzed included: alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), gamma-glutamyltransferase (GGT), amylase (AMY), calcium (CA), blood urea nitrogen (BUN), creatinine (CRE), total protein (TP), albumin (ALB), ureic acid (UA), glucose (GLU), and C-reactive protein (CRP) by using a Piccolo point-of-care analyzer and Biochemistry Panel Plus analyzer discs (Abaxis / Zoetis). Values were analyzed and plotted using R version 3.6.3 and RStudio version 1.2.1335 (rstudio.com).
[0189] Development of VSVAG-LASV-GPC for human clinical trials. The VSVAG-ZEBOV- GP vaccine (ERVEBO®) has proven to be safe and very effective preventing ebolavirus disease, and research studies have shown that a LASV vaccine based on the same VSVAG chimeric virus design (VSVAG-LASV-GPC, Fig. 1A-C) was highly efficacious in macaques. Therefore, Applicant’s goal was to prepare a VSVAG-LASV-GPC vaccine candidate that could be evaluated in a phase 1 clinical trial.
[0190] To generate a new recombinant virus with the documented history needed to support development of a human vaccine, VSVAG-LASV-GPC expressing the Josiah Lineage IV GPC was recovered from plasmid DNA and multiple clonal virus isolates were prepared over three rounds of plaque isolation (see above). During clonal virus isolation, all relevant properties were monitored, including virus growth, GPC expression, and genomic nucleotide sequence. A lead candidate was selected whose genomic sequence was identical to the original genomic clone. Thislead candidate was then amplified to produce a preMVS that could be used to support future manufacturing.
[0191] The VSVAG-LASV-GPC preMVS subsequently was analyzed by multiple methods to ensure that it had the properties needed to be advanced for human vaccination. Preclinical vaccine material, produced by infecting Vero cell cultures with the preMVS, was purified and concentrated by a process based on TFF. Analysis by nanoflow cytometry showed that the purified virus preparation used for vaccinating macaques (Fig. 2) was composed of one predominant population of particles (Fig. ID). The particle count for the vaccine material was approximately 5.OxlO10particles / ml with the predominant peak accounting for 76% of counts. Assuming that the predominant peak was primarily composed of virion particles, there were approximately 20 particles per PFU in the vaccine material used in the preclinical efficacy study.
[0192] To investigate expression and antigenicity of GPC on the cell surface, infected Vero cells were analyzed by flow cytometry (Fig. IE). About 48 h after infection with 0.001 PFU per cell, cells were harvested and incubated first with anti-GPC mAbs or a negative control mAb specific for HIV-1 Env (PGT145). The cells were then fixed and permeabilized for detection of intracellular VSV N. Over 90% of the cells expressed both intracellular VSV N and cell-surface LASV glycoprotein. The GP2 subunit was detected by non-neutralizing mAbs 8.4F and 24.6C. The anti-GPC mAb 25.10C, a potent nAb that binds to a structural epitope formed by the interaction of the GP1 and GP2 subunits assembled in a mature GPC, also produced a strong signal indicating that native GPC was expressed on the infected-cell surface.
[0193] Western blot analysis (Fig. IF) also was conducted with purified VSVAG-LASV-GPC (lanes 2, 4 and 6) and compared to purified VSVAG-MARV-GP (lanes 1, 3 and 5). As expected, VSV N protein was detected in both samples (lanes 5 and 6), while LASV glycoprotein subunits GP1 and GP2 were only detected in lanes containing samples of VSVAG-LASV-GPC (lanes 2 and 4, respectively). The GP1 band intensity (lane 2) was lower compared to GP2 (lane 4), likely because mAb 3.3B is sensitive to the conformation of a disulfide loop in GP1 that was disrupted by the denaturing conditions of the SDS-PAGE whereas binding of mAb 22.5D (lane 4) to GP2 is contingent on a linear epitope in GP2 (21). Thus, the Western blot analysis confirmed the presence of the expected LASV GP1 and GP2 (lanes 2 and 4, respectively).
[0194] Virus particles from the purified vaccine material also were analyzed by cryo-electron microscopy to visualize GPC incorporated on the virion surface. The images of the bullet-shapedVSVAG-LASV-GPC particles (Fig. 1G) show that the virions have abundant GPC arrayed on their surface. The 3D reconstructions provide evidence that GPC peplomers exist in a prefusion conformation (Fig 1. G-H), which is a key B-cell target. The presence of considerable quantities of GPC on the VSVAG-LASV-GPC particles is important, as glycoproteins arrayed on progeny virions produced by replication in vivo are likely a potent B-cell immunogen.
[0195] VSVAG-LASV-GPC efficacy in cynomolgus macaques after a single vaccination. Features of human LASV disease are observed in infected cynomolgus macaques. Thus, macaques are a valuable model for evaluating LASV vaccine candidates and were used here to assess VSVAG-LASV-GPC efficacy. Two groups of five cynomolgus macaques (two males and three females per group) were vaccinated once by intramuscular injection with 2xl07or 2xl05PFU of VSVAG-LASV-GPC (Lineage IV, Josiah), while three control animals (one female and two males) were injected with vaccine diluent. The higher vaccine dose of 2xl07PFU was selected because similar doses have been used before to vaccinate macaques and people with VSVAG chimeras. No observable adverse reactions were produced by either the low or the high dose. Blood samples collected at 1, 3 and 10 days after vaccination were analyzed by RT-qPCR specific for the VSV N gene and vaccine virus genome was undetectable (Fig. 10). This result was consistent with data from an earlier study in which VSVAG-LASV-GPC did not produce detectable viremia.
[0196] Animals were challenged by intramuscular injection at 28 days after vaccination with 3.5xl03PFUs of a low-passage LASV stock (Lineage IV, Josiah strain). The three mock- vaccinated control animals developed symptoms of LASV disease that mandated euthanasia at 11 - 13 days after challenge, whereas all vaccinated animals survived to the end of the study at day 28 (Fig. 2C). When LASV viremia was evaluated by plaque assay, unvaccinated control macaques were found to progressively develop substantial titers of infectious LASV exceeding IxlO6PFU per ml of plasma. Conversely, no live LASV was detectable in macaques vaccinated with 2xl05PFU, while a single animal vaccinated with 2xl07PFU developed a low-level (-300 PFU per ml) transient viremia detected on day 7, which resolved by day 10 post-infection (Fig. 2D). Analysis of LASV RNA in whole blood showed that genome copies were detectable on day 7 and 10 in the same animal, but not on later days 15, 21 or 28. Genome copies were also detected in one animal in the low-dose group on day 7, although this animal did not develop detectable viremia (Fig. 11 A).
[0197] Development of viremia was mirrored in clinical parameters. As expected, control animals began to develop clinical signs within 9 days after challenge, which escalated rapidly in severity (Fig. 3A). In addition to weight loss, control animal exhibited neurological symptoms, changes in respiration, loss of appetite, and change in general activity and appearance (Fig. 12A- D). Blood chemistry values indicated abnormal liver (increased ALT and AST) and kidney function (decreased ALB), as well as increased acute phase inflammatory responses (increased CRP) and electrolyte imbalance (decreased CA) in the unvaccinated animals (Fig. 3B-F) as seen before in animals that develop LASV disease. All 10 vaccinated animals were fully protected and did not develop any clinical signs of disease.
[0198] VSVAG-LASV-GPC immunogenicity. To develop a profde of immune responses associated with efficacy, humoral immunity was first evaluated by quantification of anti-GPC IgG. Blood samples collected on the day of vaccination and on days 10 and 27 after vaccination were processed and analyzed by ELISA. A soluble form of a covalently linked GP1-GP2 (Josiah, Lineage IV) was used as antigen. Animals vaccinated with 2xl07PFU began to develop detectable anti-GPC IgG as early as day 10 after vaccination, at which point anti-GPC antibodies were not yet detected in animals vaccinated with the lower dose. By day 27, Applicants observed 100% seroconversion in groups vaccinated with 2xl07or 2x105PFUs with median endpoint titers of 718 (range 496-3,482) and 679 (range 356-1,430), respectively (Fig. 4A). Thus, all animals in the two vaccine groups seroconverted by day 27, but the higher vaccine dose promoted more rapid development of detectable serum IgG. These findings may be an important consideration for a potential use in reactive vaccination during an outbreak.
[0199] To quantify the induction of cellular immunity, Applicants adapted a highly sensitive ELISpot assay developed for analysis of clinical trial samples for use with PBMCs from macaques. PBMCs were stimulated overnight with either overlapping peptides spanning GPC (Fig. 4B), a soluble recombinant GP1-GP2 fusion protein (Fig. 4C), or overlapping VSVN peptides (Fig. 4D), after which interferon (IFN)-y-secreting cells were quantified. Vaccination with either dose induced GPC-specific responses in most animals, but antigen-specific T cell frequencies varied considerably within each group (Fig. 4B-C). IFN-y responses to the VSV N peptide pool were of comparable magnitude and variability (Fig. 4D). Variable N-specific T-cell frequencies also have been reported in peripheral blood of people vaccinated with VSVAG-ZEBOV-GP.
[0200] Evaluation of neutralizing antibodies. To further investigate immune responses that might contribute to protection from LASV disease, serum from vaccinated and control animals for its ability to directly neutralize virus were assessed. Based on results from human trials with the VSVAG-ZEBOV-GP vaccine, Applicants expected that VSVAG-LASV-GPC would induce nAbs. To quantify nAb serum titers, Applicants used a plaque-reduction assay based on neutralization of VSVAG-LASV-GPC. Using replication-competent VSVAG chimeras to quantify serum nAbs specific for a variety of viral glycoproteins has been shown to be a reliable method and it eliminates the need to conduct plaque assays with LASV in high-containment BSL4 laboratories. VSVAG- LASV-GPC chimeras were generated that expressed GPCs from LASV lineages I-V and VII (Fig. 9) for the purpose of assessing cross-neutralization activity against LASV GPCs derived from diverse geographic regions. The plaque-reduction assay was conducted using serum collected on day 27, at which point all vaccinated animals were seropositive (Fig. 4A and 5). nAb titers were analyzed using VSVAG-LASV-GPC representing the different LASV lineages or a negative control chimeric virus (VSVAG-MARV-GP; Fig. 5A) that expressed Marburg virus GP. Serum from all animals vaccinated with either dose of VSVAG-LASV-GPC exhibited detectable neutralization activity against homologous Lineage IV GPC (Fig. 5B). Animals vaccinated with 2xl07PFU displayed a median NT50 of 320 (range 40-320), while samples from the 2xl05PFU group trended lower at a median NT of 80 (range 80-320). Intriguingly, when neutralization activity against VSVAG-LASV-GPC encoding GPC from Lineage I, II, III, V and VII was assessed, neutralization titers were generally similar to those detected with homologous Lineage IV (Fig. 5B). Taken together, these neutralizing responses indicate that a single dose of the VSVAG-LASV-GPC Lineage IV vaccine induces nAbs effective against GPC from a broad range of LASV lineages.
[0201] Evaluation of non-neutralizing antibody responses. In addition to direct neutralization, other antibody-mediated functions can contribute to protective immunity. These non-neutralizing antibody effector functions are typically mediated by interactions of the antibody constant domain (also known as Fragment crystallizable domain, Fc domain) with innate immunologic effector cells through Fc gamma receptors (FcyRs or C-type lectin receptors) or with complement proteins. Fc-directed effector functions also are an important contributor to the in vivo potency of nAbs. Therefore, Applicants evaluated the potential for anti-GPC serum antibodies to promote Fc- directed functions.
[0202] Antibody isotypes and subclasses are important determinants of Fc-directed effector functions. Therefore, Applicants first analyzed the isotype and Fc profile of GPC-specific serum antibodies (Fig. 13). The antigens used in the assay included the GP1-GP2 fusion protein (GP- link) identical to the ELISA antigen shown in Fig. 4A and a GP1-GP2 protein complex (GP- prefusion) containing strategic disulfide bonds to stabilize a more native-like prefusion trimeric structure. Lineage IV GPC homologous to the vaccine was used as well as Lineage II GPC to represent a divergent LASV that circulates in parts of Western Africa where phase 2 clinical trials are being planned (ClinicalTrials.gov NCT05868733). When sera from day 10 and day 28 were analyzed, 3-5 animals per vaccine group (out of 5) had increased signals for IgGl binding to both forms of Lineage II and IV antigens compared to baseline mean fluorescent intensity (MFI) values produced with sera from day 0. Fewer animals in both vaccine groups had detectable IgG2, IgG3, or IgM specific for GPC. Furthermore, because IgGl is bound by Fc receptors FcyR2A and FcyR3 found on innate immune cells like monocytes, macrophages, dendritic cells, neutrophils, and NK cells it is a likely contributor to the binding with soluble FcgR2A-l, FcyR2A-2, FcyR2A-3, FcyR2A-4, and FcyR3A that is plotted in Fig. 13 F-J.
[0203] Serum IgA from 3-5 animals per vaccine group also bound to Lineage II and IV antigens, although minimal binding against the prefusion form of LASV GPC was observed. IgA has a short half-life in serum, but it is abundant and can bind the FcyRI receptor found on a variety of innate immune cells including monocytes, eosinophils, neutrophils, and some macrophages. Thus, anti-GPC serum IgA may participate in antiviral activity, but less is known about potential Fc-directed effector functions it might direct.
[0204] Because the Fc domain of IgGl can bind FcyR2 and FcyR3 to activate innate immune cell functions like phagocytosis and antibody-dependent cell cytotoxicity as well as initiate cell lysis through binding complement, Applicants conducted assays to analyze antibody-dependent cellular phagocytosis (ADCP; Fig. 6A), neutrophil phagocytosis (ADNP; Fig. 6B), complement deposition (ADCD; Fig. 6C) and NK cell activation (ADNKA; Fig. 6D). Consistent with anti-GPC binding titers (Fig. 4A), signals in these effector function assays were generally low at day 10. However, serum from day 27 directed at least some ADCP, ADNP, ADCD and / or ADNKA activity (Fig. 6A-D) above the baseline serum from day 0. ADCP scores (Fig. 6A) were positive in 4-5 animals in the high- and low-dose vaccine groups for antibodies binding to both forms of the Lineage II and IV glycoproteins used in this assay. ADNP (Fig. 6B) also scored positive in 3-5 macaques in both the low- or high-dose groups, but values were greater when the Lineage IV antigens were used. All animals in both vaccine groups were positive for ADCD (Fig. 6C) when using the Lineage IV antigens, while 3-4 animals per group were also positive when using Lineage II glycoprotein. ADNKA (Fig. 6D) also was measured by in vitro stimulation and expression of MIP-la, a chemokine released by NK cells upon activation. The ability of anti-GPC polyclonal antibodies to stimulate expression of MIP-ip (Fig. 6D) compared to pre-immune sera (day 0) was variable. Sera from vaccinated macaques moderately stimulated expression of MIP-ip, although baseline levels differed substantially between animals. Despite these limitations, GP-link from both Lineage II and IV induced increases in MIP-ip expression in several of the animals, with the higher-dose group showing stimulation at 10 days after immunization (Fig. 6D). Notably, NK responses were largely muted to the prefusion forms of both Lineage II and IV GP.
[0205] To better visualize the extent of these non-neutralizing antibody activities, results with the Lineage IV GP1-GP2 (GP-link) fusion protein for serum from day 27 were displayed using polar plots of the mean percentile rank for each antibody feature (Fig. 6E). Individual antibody isotypes, subclasses, Fc-binding antibodies, and antibody-effector functions were standardized via z-scoring to enable cross-methodology comparisons as described previously. These plots emphasized the robustness of the observed responses relative to background activity of serum from control animals, as well as the high similarity in the nature and quality of the non -neutralizing antibody functions between the two dose groups. Together, these results indicated that VSVAG- LASV-GPC vaccination elicited anti-GPC polyclonal antibodies that bound Fey receptors found on innate immunologic effector cells, could direct cellular phagocytosis and limited NK-cell activation, and were capable of mediating complement deposition, all of which may contribute to protection.
[0206] To evaluate which features of the humoral response were most strongly associated with protection from LASV disease, Applicants’ collective antibody data were integrated and assessed with a PC A. For the PCA, Applicants focused on antibody data because GPC-specific IFN-y- producing cells were detectable but low in peripheral blood perhaps suggesting that GPC-specific T cells may be localized in tissues (Fig. 4B-C), whereas anti-GPC serum antibodies and nAbs were detected in all animals (Fig. 4A and 5). The three non-vaccinated control animals clustered tightly together and with macaque #4, which was the only vaccinated macaque that had developed transient, low-level viremia but no clinical signs of disease. This cluster of animals also includedone macaque from the low-dose group, macaque #10, that had not exhibited viremia or clinical signs of disease (Fig. 2D and 7 A). In general, most vaccinated animals separated from the control cluster along either principal component (PC) 1 or PC2, with only one animal from the high-dose group, macaque #6, displaying an intermediate phenotype with features of both PCI and PC2. The 10 highest-scoring antibody features from PCI and PC2 were plotted (Fig. 7B, C) and it was found that titers of anti-GPC IgG2, as well as Fc-dependent functions including ADNP, ADCD, and FcyR binding, featured prominently in PCI. In contrast, the most-enriched features in PC2 included nAb titers as measured by plaque-reduction assay.
[0207] The segregation of different animals along PCI or PC2 implied that polyclonal antibody responses might protect primarily through two non-exclusive mechanisms, either nAbs (PC2) or opsinophagocytic antibody activity (PCI). To further explore this hypothesis, Applicants binned the animals from PCI or PC2 and plotted all the analyzed antibody features on polar plots (Fig. 7D, E). The graphs illustrated that nAb titers active against the GP from different lineages were the most prominent feature in animals that segregated along PC2, while Fc-dependent functions and titers of anti-GPC antibodies of different IgG subtypes were more predominant in the profile in PCI -segregated animals. This analysis is consistent with VSVAG-LASV-GPC inducing polyclonal antibodies that may contribute to protection through virus-neutralizing Abs or through Fc-directed effector functions and that the more prominent contributor to efficacy may vary between animals.
[0208] Early immune response to vaccination. Applicants investigated the blood transcriptome early after vaccination because VSV infection and replication is expected to play a prominent role in inducing early innate immune responses that provide the self-adjuvanting properties required to drive development of protective adaptive immunity. Furthermore, the early innate immune response triggered by VSVAG-ZEBOV-GP infection and replication appears to be directly involved in a fast-acting component of protection from Ebola virus disease observed in the ring vaccination trial. In addition, this unique feature may be more generalizable to VSVAG-based vaccines, as this protective effect can be observed in macaques vaccinated soon before or after exposure to EBOV, SUDV, or MARV. Finally, identifying the innate responses associated with the development of serum antibodies, nAbs, and protective adaptive immunity in preclinical studies and clinical trials would 1) provide data that might inform VSV vaccine modifications to enhance the relevant innate immune responses and 2) provide host gene expression and cytokinebiomarkers that would be valuable for the development of preclinical and clinical assays to accelerate development of new VSVAG-based vaccines.
[0209] RNA extracted from blood prior to and at days 1 and 3 after vaccination was analyzed using RNA sequencing (RNA-seq) to assess the host transcriptional response to VSVAG-LASV- GPC vaccination. There were no major perturbations to the overall transcriptome, suggesting that vaccination, as expected, did not result in a large-scale change in the composition of blood cell populations (Fig. 14A). Instead, high- and low-dose vaccination both resulted in a strong response that was focused on 238 genes, with expression changes for some genes exceeding 400-fold compared to pre-vaccination samples (Fig. 8A). The vast majority of these DEGs were up- regulated upon vaccination, an effect that was markedly diminished by day 3 (Fig. 8B-C). Importantly, there was a high degree of overlap between genes whose expression was altered by high-dose and low-dose vaccination (Fig. 8D). ISG15, USP18, IFIT2 and MX1 were among the six most significantly altered genes in each dose group (Fig. 8B-C). Interestingly, there was also a marked similarity between the DEGs identified in this study and a framework of representative DEGs previously identified after vaccination with VSVAG-ZEBOV-GP in both humans and macaques (Fig. 8E). This similarity in DEGs suggests that VSVAG-based vaccines may share similar mechanisms of and requirements for immunogenicity. Additional studies will be needed to draw firm conclusions about whether this is indeed the case, and whether these expression changes can be developed into a signature capable of predicting vaccination outcome. Of note, one animal in the low-dose group, macaque #10, did not exhibit the same gene expression changes on day 1 as the other nine vaccinees but was still fully protected from lethal LASV challenge (Fig. 8A). Interestingly, this was the same animal whose integrated antibody responses clustered with the unvaccinated control group in the PCA (Fig. 7A). These data suggested that the full breadth of early responses observed in most animals may not be strictly required for full protection.
[0210] To determine whether the DEGs identified in the study shared common transcriptional control pathways, Applicants used Homer to perform a search for known transcriptional control elements controlling the DEGs. Indeed, the analysis with Homer identified 10 control elements exhibiting significant enrichment across the DEGs that were directly related to type-I interferon (IFN-I) signaling, consistent with a robust innate immune response to a replication-competent RNA virus (Fig. 8F). Similarly, an analysis of known interactions between the proteins encoded by the DEGs using STRING identified a tight, high-confidence network centered around regulatorsand effectors of IFN-I signaling (Fig. 14B). Next, Applicants performed gene-set enrichment analysis and compared the DEGs against previously defined modules of coordinately expressed genes. This approach identified 26 modules enriched in these VSVAG-ZEBOV-GP DEGs, most of which were related to innate viral sensing and interferon responses (Fig. 8G). It was notable that multiple modules defined previously by Li et al. were affected by VSVAG-LASV-GPC early after administration to macaques, and that a sizeable number of these modules were also enriched for the representative DEGs associated with VSVAG-ZEBOV-GP vaccination (Fig. 14C). This provides further evidence that both vaccines elicit similar blood transcriptome responses even though the glycoprotein incorporated into VSV and driving infection with VSV differs. Thus, vaccination with VSVAG-LASV-GPC induces transcriptomic changes in blood cells that are heavily dominated by type-I IFN signaling.
[0211] A single dose of 2xl07or 2xl05PFU of the VSVAG-LASV-GPC vaccine candidate that was developed for an ongoing multicenter phase 1 clinical trial (ClinicalTrials.gov NCT04794218) was shown to provide complete protection in vaccinated cynomolgus macaques when challenged with a high-dose of LASV Lineage IV (Fig. 2). Protection from disease observed in the study agrees with data from earlier preclinical efficacy studies that were conducted with experimental VSVAG-LASV-GPC vaccines and extends these previous results by showing that a lower dose of the human vaccine candidate also was efficacious (Fig. 2). Consistent with the prevention of Lassa fever, no vaccinated animals developed elevated clinical scores, changes in blood chemistry, or loss of body weight typically associated with LASV infection (Fig. 3, 1 IB and 12). Moreover, vaccination prevented the development of detectable viremia in 9 of 10 animals (Fig. 2D), with only one animal from the group vaccinated with 2x107PFU developing a low, transient titer of infectious LASV in peripheral blood (-300 PFU per ml). Immunity that prevents development of substantial titers of infectious LASV in the blood that can seed systemic infection likely is a key factor in efficacy, as control of LASV viremia during natural infection is correlated with improved outcome. Moreover, the importance of immune control of viremia has been well illustrated by a more extensive preclinical dose-range efficacy study that was conducted with a VSVAG-EBOV-GP (Makona) vaccine. In this study, EBOV disease progression was correlated with immunity that prevented infectious EBOV titers from exceeding a threshold value in blood (50% tissue-culture-infectious-dose of 105per ml).
[0212] Immune responses that contribute to protection from LASV disease are not completely understood. In people that recover from LASV infection, strong activation of antigen-specific peripheral blood T cells is a prominent feature, indicating that cellular immunity may play an important role in natural control and clearance of LASV infection. In contrast, nAbs develop slowly in infected patients and may not increase substantially until late during convalescence, indicating that humoral immunity is dysfunctional during acute LASV infection and likely not a substantial contributor to clearing the virus in unvaccinated individuals. Consistent with what is observed in infected people, recovery of macaques from experimental LASV infection has been shown to correlate with development of rapid and potent innate and cellular immunity, provided it did not lead to an excessive inflammatory response. Applicants data shows that prophylactic vaccination with VSVAG-LASV-GPC induces a different profile of protective immunity than immunity that develops during recovery from natural infection. Applicants found that vaccination elicited GPC-specific peripheral blood cells secreting IFN-y at a relatively low but detectable frequency (Fig. 4B-C), whereas all animals vaccinated with either the low or the high dose of VSVAG-LASV-GPC developed anti-GPC serum antibodies (Fig. 4A) including those that can neutralize virus expressing GPC from multiple LASV lineages (Fig. 5). These data suggest that antibodies developed by vaccinated macaques were central to protection from LASV disease, although a more extensive immunologic assessment of cellular immunity including T cells localized in tissues may better define contributing cellular immune responses elicited by the VSV- based vaccine.
[0213] The finding that LASV infection and live VSVAG-LASV-GPC vaccination result in differing immune-response profiles is not altogether unexpected, as the two viruses have substantially different properties. VSV is acutely cytopathic, which favors the development of B- cell responses, while arenavirus infection causes less cytoxicity favoring a T cell response. Furthermore, LASV infection of dendritic cells and macrophages is known to impair their activation and ability to properly execute their roles in cytokine expression and antigen presentation, while VSV infection of these cells leads to immune activation. Thus, impairment of the B cell response by LASV infection interferes with antibody development during the recovery phase of natural infection, while prophylactic vaccination with VSVAG-LASV-GPC stimulates immunity under much different circumstances that allows development of protective innate andhumoral immune in response to the native GPC antigen that is presented in the context of a mild or nonpathogenic VSV infection.
[0214] Applicant’s assessment of serum antibodies demonstrated that vaccination with VSVAG-LASV-GPC expressing Lineage IV GPC elicited cross-neutralizing nAbs (Fig. 5). Plaque-reduction assays were conducted with replication-competent VSVAG-LASV-GPC strains encoding GPC from Lineages I-V and VII to represent LASV found in geographically diverse regions, and the results showed that all were neutralized with comparable efficiency by serum from vaccinated animals. Because nAbs are a prominent surrogate for protective immunity induced by multiple successful viral vaccines, this finding has important implications as it suggests that vaccination with live VSVAG-LASV-GPC based on Lineage IV should provide broad protection against LASV from different regions of Africa. Moreover, it will be valuable to learn if a second vaccination with VSVAG-LASV-GPC can boost titers of nAbs that contribute to crossneutralizing activity. It also will be very informative in the future to compare nAbs induced by VSVAG-LASV-GPC vaccination to the potent monoclonal nAbs that have been isolated from recovered patients and are known to provide protection in animal models. Recent mapping of epitopes bound by serum Abs from vaccinated macaques using cryo-electron microscopy and binding competition with human monoclonal nAbs indicates that the animals did develop antibodies directed against key structures on the LASV GPC trimer consistent with detection of serum neutralization activity (unpublished manuscript).
[0215] Two other experimental vaccine candidates also have been shown to induce crossneutralizing anti-GPC antibodies. A vector based on measles virus encoding LASV lineage IV GPC and N protein protected macaques from LASV challenge after a single vaccination. Although the animals failed to develop detectable nAbs after vaccination, cross-neutralizing nAbs developed soon after challenge with LASV, suggesting that vaccination did establish low levels of anti-GPC memory B cells that could produce nAbs in response to LASV exposure. It is possible that the VSVAG-LASV-GPC encoding the same Lineage IV GPC induced a greater magnitude of nAbs because it replicates more vigorously than the measles virus-derived vector, or perhaps because GPC is the only glycoprotein expressed by VSVAG-LASV-GPC while the measles virus vector co-expressed the measles virus fusion and hemagglutinin glycoproteins that may distract from the anti-GPC response. Similarly, a vaccine candidate based on virus-like particles containing LineageIV GPC arrayed on their surface also induced cross-neutralizing nAbs. Sera collected from two rabbits following the 4th immunization with virus-like particles and adjuvant was shown to neutralize pseudovirions based on five different LASV lineages as well as authentic LASV Lineage II and IV. It is conceivable that the regular arrays of GPC displayed by the virus-like particles and VSVAG-based chimeras (Fig. 1) facilitate B-cell stimulation and maturation, thereby promoting the development of broadly active nAbs.
[0216] Two additional sources support the hypothesis that nAbs induced by VSVAG-LASV- GPC vaccination play an important mechanistic role in providing protection. Convalescent serum from a person who had recovered from LASV infection or from recovered macaques was shown to protect naive macaques from disease if the transferred sera had a nAb titer above a protective threshold. Notably, these immune sera also were shown to neutralize LASV from different geographic regions, although they were less potent against heterologous strains. Furthermore, several studies have demonstrated that anti-GPC monoclonal nAbs developed from recovered patients are very effective at preventing disease in guinea pigs and macaques when administered immediately following LASV challenge, and notably, when administered 6-8 days following virus exposure.
[0217] In addition to antibodies that can neutralize virus directly, Applicants’ data indicate that macaques vaccinated with VSVAG-LASV-GPC also developed anti-GPC serum antibodies that can direct Fc-mediated effector functions, which may also contribute to protection (Fig. 13, 6 and 7). A role for non-neutralizing anti-GPC antibody functions in protection has been proposed before for a vaccine based on recombinant rabies virus. In this study, the recombinant rabies virus was designed to co-express the rabies virus glycoprotein (G) and LASV GPC and incorporate both in the rabies virus envelope. Purified virions were used to generate a chemically-inactivated wholevirus vaccine formulated with a TLR4 agonist, which was shown to induce substantial anti-GPC binding antibody titers in rodents. Although serum nAb activity was below detection limits, vaccination protected mice and guinea pigs from LASV disease, and this was potentially correlated with serum antibodies shown to direct antibody-dependent cellular cytotoxicity (ADCC) and ADCP. There also are other examples of viral vectors delivering GPC, such adenovirus or vaccinia virus vectors that elicited protective immunity in the absence of serum nAbs, which provide further indications that antibody Fc-mediated effector activity might contribute to protection. The data presented here suggest that VSVAG-LASV-GPC can elicit both nAbs (Fig. 5) and Abs that directFc-mediated effector functions (Fig. 13, 6 and 7), thus raising the possibility that both might contribute to protection. Interestingly, when Applicants conducted a PCA (Fig. 7) to investigate which combinations of antibody characteristics were associated with protection, they found that the relative contribution of nAbs or Fc-directed effector functions appears to differ between individual animals. It is important to note, however, that neutralizing and non-neutralizing antibody functions are not mutually exclusive and likely work together to prevent progression to a systemic infection and disease. Indeed, it is worth highlighting that all vaccinated animals had detectable nAbs (Fig. 5), and it is known from studies on HIV and ebolavirus nAbs that the Fc regions play an important role in neutralization potency in vivo.
[0218] Analysis of the blood transcriptome also showed that VSVAG-LASV-GPC induced an early innate anti-viral response detected 1 day following vaccination. The early innate immune response elicited by VSVAG-ZEBOV-GP vaccination is thought play two important roles: 1) inducing a fast-acting antiviral effect that can prevent disease progression while adaptive immunity fully develops, and 2) providing the adjuvant properties that drive development of protective adaptive immunity. Notably, the fast-acting component of protection was directly tested recently in a study conducted in macaques with the research VSVAG-LASV-GPC vaccine, and the results showed that vaccination just 3 days or 7 days before LASV challenge protected the animals from lethal disease as shown for VSVAG-ZEBOV-GP vaccination. Thus, it was of interest to compare the early changes in the blood transcriptome after vaccination with VSVAG-ZEBOV-GP and in Applicants’ study with VSVAG-LASV-GPC and to investigate whether there were common signatures of the early innate immune response associated with both of these efficacious VSVAG- based vaccines. Indeed, identifying DEGs that respond similarly to both vaccines might provide a source of valuable biomarkers, which could be used during development of future VSVAG-based vaccines to monitor vaccine performance in preclinical and clinical studies and provide a data bridge between vaccination responses induced in animals and people. When Applicants compared the blood transcriptome data from macaques vaccinated with VSVAG-LASV-GPC to a summary of representative DEGs modulated by VSVAG-ZEBOV-GP vaccination compiled by Pinski and Messaoudi, significant overlap between these data sets was revealed (Fig. 8E). Most of the shared DEGs encoded proteins connected to the early antiviral state, including helicases involved in viral RNA sensing [DDX60, IFIH1], proteins that antagonize viral replication [OAS1, MX1, RSAD2], components of signaling pathways that respond to IFN [STAT1 and STAT2], and proteins thatcontrol the cellular response to IFN [USP18, ISG15, HERC5], Chemotactic factors CCL8 [MCP2] and CXCL10 [IP-10] also were modulated by both VSV-based vaccines. Interestingly, USP18 has been associated with allowing controlled replication of VSV and VSVAG-ZEBOV-GP in infected macrophages as a mechanism to provide sufficient antigen to drive successful vaccination.
[0219] The initial NHP study described above demonstrated that a single vaccination with VSVAG-LASV-GPC provided 100% protection against lethal LASV exposure at 28 days following vaccination. In a second study conducted with vaccine material prepared from the preMVS, persistence of protective immunity in macaques was evaluated out to 1 year post vaccination (Fig. 15A). Two groups (n=5 macaques per group) were vaccinated once with 2xl05or 2xl07PFUs of VSVAG-LASV-GPC and challenged 12 months later with homologous LASV (Lineage IV, Josiah). A third vaccinated group (n=5, 2xl07PFUs) was challenged with LASV 6 months after vaccination while a fourth group (n=5) was vaccinated with a prime-boost regimen with an 8-week interval between doses (2xl07PFU) after which LASV challenge was conducted at 12 months. A final negative control group (n=3) was administered a single intramuscular dose of 2xl07PFUs of a VSVAG-MARV-GP vaccine. Vaccination schedules were staggered to allow LASV challenge to be conducted at the same time across the study.[00220J To assess immunological biomarkers associated with preclinical efficacy and evaluate potential correlates of protection, Applicants conducted temporal analysis of innate, humoral, and cellular responses following vaccination (Fig. 15 A). All macaques were challenged with a lethal dose of LASV Josiah Lineage IV and were monitored for clinical Lassa fever symptoms (Fig. 15B). Control animals vaccinated with the control VSVAG-MARV-GP vaccine rapidly presented with pathologies associated with Lassa fever resulting in clinical scores that required euthanasia at days 9 and 11 post exposure. All VSVAG-LASV-GPC vaccinated macaques were 100% protected against development of viremia and disease (Fig. 15B and C) while LASV viremia increased steadily in the control animals (>106PFU / mL) up to the point of euthanasia (Fig. 15C). Analysis of clinical observations, blood chemistries and hematology data was additionally completed (data not shown) and shown to be consistent with the prior acute protective study described above and is supportive that VSVAG-LASV-GPC vaccine prepared for clinical development protected all macaques from developing clinical signs of Lassa fever.
[0221] Evaluation of serum antibody responses (anti-GPC binding IgG) in animals vaccinated with VSVAG-LASV-GPC showed that all macaques were seropositive and, as shown for the group vaccinated once with 2xl07PFUs (Fig. 15D), anti-GPC IgG antibodies were detectable as early as 10 days post-vaccination and continued to increase with peak end-point titers at approximately 8 weeks following vaccination. Although titers decreased by 20 weeks, it was clear that anti-GPC IgG remained detectable 12 months after vaccination when challenge was conducted, therefore implying that binding IgG may be a candidate correlate of protection as described for ERVEBO®.[00222J Data from the second NHP study demonstrated that VSVAG-LASV-GPC vaccine material prepared from the preMVS elicited robust protective immunity in macaques that prevented development of detectable viremia and disease for at least 1 year after vaccination. Results from the different study groups in Fig. 15 showed: 1) a single vaccination with 2xl07PFUs protected macaques when LASV challenge was conducted 6 months after vaccination; 2) one vaccination with 2xl05or 2xl07PFUs protected macaques when LASV challenge was conducted 1 year later; and 3) a prime-boost regimen (2xl07PFUs, 2-month interval) protected macaques when LASV challenge was conducted 1 year after vaccination.
[0223] The invention is further described by the following numbered paragraphs:1. A vesicular stomatitis vector (VSV) excluding a glycoprotein G gene (VSVAG) comprising and expressing a nucleic acid encoding a Lassa virus (LASV) glycoprotein complex (GPC), or a nucleic acid comprising SEQ ID NO: 1, or a nucleic acid comprising a sequence having at least 95%, or 96%, or 97% or 98% or 99% sequence identity to SEQ ID NO: 1, or a nucleic acid comprising SEQ ID NO: 2, or a nucleic acid comprising a sequence having at least 95%, or 96%, or 97% or 98% or 99% sequence identity to SEQ ID NO: 2.2. The vector of paragraph 1, wherein the nucleic acid comprises SEQ ID NO: 1, or the nucleic acid comprises a sequence having at least 95%, or 96%, or 97% or 98% or 99% sequence identity to SEQ ID NO: 1.3. The vector of paragraph 1, wherein the nucleic acid comprises SEQ ID NO: 2, or the nucleic acid comprises a sequence having at least 95%, or 96%, or 97% or 98% or 99% sequence identity to SEQ ID NO: 2.4. The vector of paragraph 1, wherein the Lassa virus serotype strain is selected from the group consisting of Lineage I, Lineage, II, Lineage III, Lineage, IV, Lineage V, Lineage VI, and Lineage VII.5. The vector of paragraph 4, wherein the Lassa virus serotype strain is Lineage IV.6. A recombinant vaccine or immunogenic composition comprising the vector of paragraph 1, a pharmaceutically or veterinarily acceptable carrier or diluent and optionally an adjuvant.7. A recombinant vaccine or immunogenic composition comprising the vector of paragraph 2, a pharmaceutically or veterinarily acceptable carrier or diluent and optionally an adjuvant.8. A recombinant vaccine or immunogenic composition comprising the vector of paragraph 3, a pharmaceutically or veterinarily acceptable carrier or diluent and optionally an adjuvant.9. A cell comprising the vector of any one of paragraphs 1, 2 or 3.10. The cell of paragraph 9, wherein the cell is a mammalian cell.11. The cell of paragraph 10, wherein the cell is a Vero cell.12. A method for vaccinating or immunizing a mammal, optionally a mammal in need thereof, with the vaccine or immunogenic composition of paragraph 6 comprising administering about 102-107PFU of the vaccine or immunogenic composition to the mammal.13. A method for vaccinating or immunizing a mammal, optionally a mammal in need thereof, with the vaccine or immunogenic composition of paragraph 7 comprising administering about 102-107PFU of the vaccine or immunogenic composition to the mammal.14. A method for vaccinating or immunizing a mammal, optionally a mammal in need thereof, with the vaccine or immunogenic composition of paragraph 8 comprising administering about 102-107PFU of the vaccine or immunogenic composition to the mammal.15. The method of paragraph 12, 13, or 14 comprising administering about 104PFU of the vaccine or immunogenic composition.16. The method of paragraph 12, 13, or 14 comprising administering about 105PFU of the vaccine or immunogenic composition.17. The method of paragraph 12, 13, or 14 comprising administering about 106PFU of the vaccine or immunogenic composition.18. The method of any one of paragraph 12-17, wherein the mammal is a rodent or a primate.19. The method of paragraph 18, wherein the primate is a bonobo, chimpanzee, gibbon, gorilla, human, monkey, or orangutan.20. The method of paragraph 19, wherein the primate is a human.21. The method of paragraph 12, 13, or 14 wherein the vaccine or immunogenic composition is administered sequentially or simultaneously with an Ebola virus vaccine, a Marburg virus vaccine, or a Sudan virus vaccine.22. A method for enhancing an immune response to an infectious disease comprising; i) administering a priming vaccine or immunological composition comprising an immunologically effective amount of a viral vector that encodes and expresses one or more antigens; ii) administering a boosting vaccine or immunological composition comprising an immunologically effective amount of a viral vector that encodes and expresses one or more antigens; wherein the boosting and / or priming vaccine or immunological composition comprises the vaccine or immunogenic composition of paragraph 6, 7 or 8.23. The method of paragraph 22, wherein the one or more antigens is the same in the priming vaccine or immunological composition and boosting vaccine or immunological composition.24. The method of paragraph 22, wherein the one or more antigens is different in the priming vaccine or immunological composition and boosting vaccine or immunological composition.25. The method of paragraph 12, 13, or 14 wherein the administration is intramuscular.26. The method of paragraph 12, 13, or 14 wherein the administration is intranasal.27. The method of paragraph 12, 13, or 14 wherein the administration is intradermal.28. The method of paragraph 12, 13, or 14 wherein the administration is by an oral bait drop.29. A pharmaceutical or veterinary or vaccine or immunological composition comprising the vector of any one of paragraphs 1-5, and a pharmaceutically or veterinarily acceptable carrier or diluent and optionally an adjuvant.References:1. H. L. Murphy, H. Ly, Pathogenicity and virulence mechanisms of Lassa virus and its animal modeling, diagnostic, prophylactic, and therapeutic developments. Virulence 12, 2989-3014 (2021).2. R. F. Garry, Lassa fever - the road ahead. Nat Rev Microbiol, (2022).3. M. Sironi, D. Forni, J. C. de la Torre, Mammarenavirus Genetic Diversity and Its Biological Implications. Curr Top Microbiol 'Immunol 439, 265-303 (2023).4. D. E. Agbonlahor et al., Prevalence of Lassa virus among rodents trapped in three South- South States of Nigeria. J Vector Borne Dis 54, 146-150 (2017).5. A. Olay emi etal., New Hosts of The Lassa Virus. Sci Rep 6. 25280 (2016).6. E. Fichet-Calvet, B. Becker-Ziaja, L. Koivogui, S. Gunther, Lassa serology in natural populations of rodents and horizontal transmission. Vector Borne Zoonotic Dis 14, 665- 674 (2014).7. A. N. Happi et al.. Increased Prevalence of Lassa Fever Virus-Positive Rodents and Diversity of Infected Species Found during Human Lassa Fever Epidemics in Nigeria. Microbiol Spectr 10, e0036622 (2022).8. A. N. Happi, C. T. Happi, R. J. Schoepp, Lassa fever diagnostics: past, present, and future. Curr Opin Virol 37, 132-138 (2019).9. O. O. Balogun, O. W. Akande, D. H. Hamer, Lassa Fever: An Evolving Emergency in West Africa. Am J TropMed Hyg 104, 466-473 (2020).10. WHO. (2022), vol. 2022.11. L. Borio et al., Hemorrhagic fever viruses as biological weapons: medical and public health management. JAMA 287, 2391-2405 (2002).12. WHO, WHO R&D Blueprint. 2016.13. M. S. Mehand, F. ALShorbaji, P. Millett, B. Murgue, The WHO R&D Blueprint: 2018 review of emerging infectious diseases requiring urgent research and development efforts. Antiviral research 159, 63-67 (2018).14. K. Salami, D. Gouglas, C. Schmaljohn, M. Saville, N. Tornieporth, A review of Lassa fever vaccine candidates. Curr Opin Virol 37, 105-111 (2019).15. J. Purushotham, T. Lambe, S. C. Gilbert, Vaccine platforms for the prevention of Lassa fev er. Immunol Lett 215, 1-11 (2019).16. J. B. McCormick, S. W. Mitchell, M. P. Kiley, S. Ruo, S. P. Fisher-Hoch, Inactivated Lassa virus elicits a non protective immune response in rhesus monkeys. J Med Virol 37, 1-7 (1992).17. K. M. Hastie, E. O. Saphire, Lassa virus glycoprotein: stopping a moving target. Curr Opin Virol ' 31, 52-58 (2018).M. Katz et al. , Structure and receptor recognition by the Lassa virus spike complex. Nature 603, 174-179 (2022). R. W. Cross et al., Treatment of Lassa virus infection in outbred guinea pigs with first-in- class human monoclonal antibodies. Antiviral research 133, 218-222 (2016). H. Li et al., A cocktail of protective antibodies subverts the dense glycan shield of Lassa virus. Sci Transl Med 14, eabq0991 (2022). J. E. Robinson et al., Most neutralizing human monoclonal antibodies target novel epitopes requiring both Lassa virus glycoprotein subunits. Nature communications 7, 11544 (2016). I. J. Amanna, M. K. Slifka, Successful Vaccines. Curr Top Microbiol Immunol 428, 1-30 (2020). B. Pulendran, J. Z. Oh, H. I. Nakaya, R. Ravindran, D. A. Kazmin, Immunity to viruses: learning from successful human vaccines. Immunol Rev 255, 243-255 (2013). J. G. Tell et al., Environmental Risk Assessment for rVSVDeltaG-ZEBOV-GP, a Genetically Modified Live Vaccine for Ebola Virus Disease. Vaccines (Basel) 8, 10.3390 / vaccines8040779 (2020). D. N. Wolfe, M. J. Taylor, A. G. Zarrabian, Lessons learned from Zaire ebolavirus to help address urgent needs for vaccines against Sudan ebolavirus and Marburg virus. Human vaccines & immunotherapeutics 16, 2855-2860 (2020). B. G. Coller et al., Clinical development of a recombinant Ebola vaccine in the midst of an unprecedented epidemic. Vaccine 35, 4465-4469 (2017). J. Wolf et al., Development of Pandemic Vaccines: ERVEBO Case Study. Vaccines (Basel) 9, 190 (2021). S. M. Jones et al., Live attenuated recombinant vaccine protects nonhuman primates against Ebola and Marburg viruses. Nature medicine 11, 786-790 (2005). M. Garbutt et al., Properties of replication-competent vesicular stomatitis virus vectors expressing glycoproteins of filoviruses and arenaviruses. J Virol 78, 5458-5465 (2004). L. S. Jones et al., Effects of adsorption to aluminum salt adjuvants on the structure and stability of model protein antigens. J Biol Chem 280, 13406-13414 (2005). C. E. Mire et al., Recombinant vesicular stomatitis virus vaccine vectors expressing filovirus glycoproteins lack neurovirulence in nonhuman primates. PLoS Negl Trap Dis 6, el567 (2012). T. P. Monath et al., rVSVDeltaG-ZEBOV-GP (also designated V920) recombinant vesicular stomatitis virus pseudotyped with Ebola Zaire Glycoprotein: Standardized template with key considerations for a risk / benefit assessment. Vaccine X 1, 100009 (2019). R. F. Grais et al., Estimation of the correlates of protection of the rVSVAG-ZEBOV-GP Zaire ebolavirus vaccine: a post-hoc analysis of data from phase 2 / 3 clinical trials. The Lancet Microbe 2, e70-e78 (2021). J. K. Simon et al., Immunogenicity of rVSVDeltaG-ZEBOV-GP Ebola vaccine (ERVEBO(R)) in African clinical trial participants by age, sex, and baseline GP -ELISA titer: A post hoc analysis of three Phase 2 / 3 trials. Vaccine 40, 6599-6606 (2022). A. M. Henao-Restrepo et al., Efficacy and effectiveness of an rVSV-vectored vaccine in preventing Ebola virus disease: final results from the Guinea ring vaccination, open-label, cluster-randomised trial (Ebola Ca Suffit!). Lancet 389, 505-518 (2017).A. N. Pinski, I. Messaoudi, To B or Not to B: Mechanisms of Protection Conferred by rVSV-EBOV-GP and the Roles of Innate and Adaptive Immunity. Microorganisms 8, (2020). F. Santoro et al., Human Transcriptomic Response to the VSV-Vectored Ebola Vaccine. Vaccines (Basel) 9, (2021). D. Safronetz et al, A recombinant vesicular stomatitis virus-based Lassa fever vaccine protects guinea pigs and macaques against challenge with geographically and genetically distinct Lassa viruses. PLoS Negl Prop Dis 9, e0003736 (2015). A. Marzi, F. Feldmann, T. W. Geisbert, H. Feldmann, D. Safronetz, Vesicular stomatitis virus-based vaccines against Lassa and Ebola viruses. Emerg Infect Dis 21, 305-307 (2015). T. W. Geisbert et al., Development of a new vaccine for the prevention of Lassa fever. PLoS edicine 1, el83 (2005). A. S. Espeseth et al, Preclinical immunogenicity and efficacy of a candidate COVID-19 vaccine based on a vesicular stomatitis virus- SARS-CoV-2 chimera. EBioMedicine 82, 104203 (2022). C. L. Cooper et al., Nonhuman Primates Are Protected against Marburg Virus Disease by Vaccination with a Vesicular Stomatitis Virus Vector-Based Vaccine Prepared under Conditions to Allow Advancement to Human Clinical Trials. Vaccines (Basel) 10, (2022). S. Rabinovich et al., A novel, live-attenuated vesicular stomatitis virus vector displaying conformationally intact, functional HIV-1 envelope trimers that elicits potent cellular and humoral responses in mice. PLoS ONE 9, el06597 (2014). D. S. Lyles, L. Puddington, B. J. McCreedy, Jr., Vesicular stomatitis virus M protein in the nuclei of infected cells. J Virol 62, 4387-4392 (1988). J. W. Coleman etal., Quantitative multiplex assay for simultaneous detection of the Indiana serotype of vesicular stomatitis virus and HIV gag. J Virol Methods 143, 55-64 (2007). K. M. Hastie et al., Structural basis for antibody-mediated neutralization of Lassa virus. Science 356, 923-928 (2017). M. Meyer et al., Ebola vaccine-induced protection in nonhuman primates correlates with antibody specificity and Fc-mediated effects. Sci TranslMed 13, (2021). C. Atyeo et al., Distinct Early Serological Signatures Track with SARS-CoV-2 Survival. Immunity 53, 524-532 e524 (2020). Y. C. Bartsch et al., Humoral signatures of protective and pathological SARS-CoV-2 infection in children. Nature medicine 27, 454-462 (2021). E. P. Brown etal., Multiplexed Fc array for evaluation of antigen-specific antibody effector profiles. J Immunol Methods 443, 33-44 (2017). E. P. Brown et al., High-throughput, multiplexed IgG subclassing of antigen-specific antibodies from clinical samples. J Immunol Methods 386, 1 17-123 (2012). S. M. Siddiqui et al., Serological Markers of SARS-CoV-2 Reinfection. mBio 13, e0214121 (2022). C. Atyeo etal., Compromised SARS-CoV-2-specific placental antibody transfer. Cell 184, 628-642 e610 (2021). Y. C. Bartsch et al., Antibody effector functions are associated with protection from respiratory syncytial virus. Cell 185, 4873-4886 e4810 (2022). M. E. Ackerman et al., A robust, high-throughput assay to determine the phagocytic activity of clinical antibody samples. J Immunol Methods 366, 8-19 (2011).D. K. Gill etal., Equivalence ofELISpot assays demonstrated between major HIV network laboratories. PLoS ONE 5, el4330 (2010). A. Dobin et al., STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21 (2013). Y. Liao, G. K. Smyth, W. Shi, featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923-930 (2014). M. I. Love, W. Huber, S. Anders, Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550 (2014). J. Weiner 3rd, T. Domaszewska, tmod: an R package for general and multivariate enrichment analysis. PeerJ Preprints 4, (2016). A. Liberzon et al., The Molecular Signatures Database (MSigDB) hallmark gene set collection. Cell Syst 1, 417-425 (2015). Y. Benjamini, Y. Hochberg, Controlling the false discovery rate: a practical and powerful approach to multiple testing. Journal of the Royal statistical society: series B (Methodological) 57, 289-300 (1995). S. Heinz et al., Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol Cell 38, 576- 589 (2010). D. Szklarczyk et al., STRING vl l : protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res 47, D607-D613 (2019). A. S. Enriquez et al., Delineating the mechanism of anti-Lassa virus GPC-A neutralizing antibodies. Cell Rep 39, 110841 (2022). M. F. Bachmann, G. T. Jennings, Vaccine delivery: a matter of size, geometry, kinetics and molecular patterns. Nat Rev Immunol 10, 787-796 (2010). L. E. Hensley et al., Pathogenesis of Lassa fever in cynomolgus macaques. Virol .18, 205 (2011). S. T. Agnandji et al., Phase 1 Trials of rVSV Ebola Vaccine in Africa and Europe. The New England journal of medicine 374, 1647-1660 (2016). D. Safronetz etal., A recently isolated Lassa virus from Mali demonstrates atypical clinical disease manifestations and decreased virulence in cynomolgus macaques. J Infect Dis 207, 1316-1327 (2013). S. Baize et al., Early and strong immune responses are associated with control of viral replication and recovery in lassa virus-infected cynomolgus monkeys. J Virol 83, 5890- 5903 (2009). N. Baillet et al. , Systemic viral spreading and defective host responses are associated with fatal Lassa fever in macaques. Commun Biol 4, 27 (2021). M. Mateo et al., A single-shot Lassa vaccine induces long-term immunity and protects cynomolgus monkeys against heterologous strains. Sci Transl Med 13, (2021). M. Mateo et al., Pathogenesis of recent Lassa virus isolates from lineages II and VII in cynomolgus monkeys. Virulence 13, 654-669 (2022). J. H. Poetsch et al., Detectable Vesicular Stomatitis Virus (VSV)-Specific Humoral and Cellular Immune Responses Following VSV-Ebola Virus Vaccination in Humans. J Infect DA 219, 556-561 (2019). N. Wohlgemuth et al., An Assessment of Serological Assays for SARS-CoV-2 as Surrogates for Authentic Virus Neutralization. Microbiol Spectr 9, e0105921 (2021).D. E. Wilkinson etal., Comparison of platform technologies for assaying antibody to Ebola virus. Vaccine 35, 1347-1352 (2017). J. T. Manning, N. Forrester, S. Paessler, Lassa virus isolates from Mali and the Ivory Coast represent an emerging fifth lineage. Front Microbiol 6, 1037 (2015). S. L. M. Whitmer et aL, New Lineage of Lassa Virus, Togo, 2016. Emerg Infect Dis 24, 599-602 (2018). S. Bournazos, J. V. Ravetch, Fcgamma Receptor Function and the Design of Vaccination Strategies. Immunity 47, 224-233 (2017). E. O. Saphire, S. L. Schendel, B. M. Gunn, J. C. Milligan, G. Alter, Antibody-mediated protection against Ebola virus. Nature immunology 19, 1169-1178 (2018). B. M. Gunn, S. Bai, Building a better antibody through the Fc: advances and challenges in harnessing antibody Fc effector functions for antiviral protection. Human vaccines & immunotherapeutics 17, 4328-4344 (2021). L. L. Lu, T. J. Suscovich, S. M. Fortune, G. Alter, Beyond binding: antibody effector functions in infectious diseases. Nat Rev Immunol 18, 46-61 (2018). F. I. Ibukun, Inter-Lineage Variation of Lassa Virus Glycoprotein Epitopes: A Challenge to Lassa Virus Vaccine Development. Viruses 12, (2020). G. Sulis, A. Peebles, N. E. Basta, Lassa fever vaccine candidates: A scoping review of vaccine clinical trials. Trap Med Int Health 28, 420-431 (2023). B. M. Gunn, G. Alter, Modulating Antibody Functionality in Infectious Disease and Vaccination. Trends Mol Med 12, 969-982 (2016). S. K. Davis, K. J. Selva, S. J. Kent, A. W. Chung, Serum IgA Fc effector functions in infectious disease and cancer. Immunol Cell Biol 98, 276-286 (2020). P. Kaplonek etal., mRNA-1273 and BNT162b2 COVID- 19 vaccines elicit antibodies with differences in Fc-mediated effector functions. Sci TranslMed 14, eabm2311 (2022). P. Kaplonek et al, Hybrid immunity expands the functional humoral footprint of both mRNA and vector-based SARS-CoV-2 vaccines. Cell Rep Med 4, 101048 (2023). K. Fink et al., Early type I interferon-mediated signals on B cells specifically enhance antiviral humoral responses. Eur J Immunol 36, 2094-2105 (2006). A. N. Pinski, I. Messaoudi, Therapeutic vaccination strategies against EBOV by rVSV- EBOV-GP: the role of innate immunity. Curr Opin Virol 51, 179-189 (2021). D. Medaglini, F. Santoro, C. A. Si egrist, Correlates of vaccine-induced protective immunity against Ebola virus disease. Seminars in immunology 39, 65-72 (2018). K. M. Daddario-DiCaprio et al., Postexposure protection against Marburg haemorrhagic fever with recombinant vesicular stomatitis virus vectors in non-human primates: an efficacy assessment. Lancet 367, 1399-1404 (2006). C. Woolsey et al., Postexposure Efficacy of Recombinant Vesicular Stomatitis Virus Vectors Against High and Low Doses of Marburg Virus Variant Angola in Nonhuman Primates. J Infect Dis 218, S582-S587 (2018). C. Woolsey et al., Immune correlates of postexposure vaccine protection against Marburg virus. Sci Rep 10, 3071 (2020). T. W. Geisbert et al. , Recombinant vesicular stomatitis virus vector mediates postexposure protection against Sudan Ebola hemorrhagic fever in nonhuman primates. J Virol 82, 5664- 5668 (2008). H. Feldmann et al, Effective post-exposure treatment of Ebola infection. PLoS Pathog 3, e2 (2007).T. W. Geisbert etal., Postexposure treatment of Marburg virus infection. Emerg Infect Dis 16, 1119-1122 (2010). A. Marzi et al., Efficacy of Vesicular Stomatitis Virus-Ebola Virus Postexposure Treatment in Rhesus Macaques Infected With Ebola Virus Makona. J Infect Dis 214, S360- S366 (2016). A. Marzi et al., Single Dose of a VSV-Based Vaccine Rapidly Protects Macaques From Marburg Virus Disease. Front Immunol 12, 774026 (2021). A. Marzi, H. Feldmann, T. W. Geisbert, D. Falzarano, Vesicular Stomatitis Virus-Based Vaccines for Prophylaxis and Treatment of Filovirus Infections. Journal of bioterrorism & biodefense SI, (2011). A. Rechtien etal., Systems Vaccinology Identifies an Early Innate Immune Signature as a Correlate of Antibody Responses to the Ebola Vaccine rVSV-ZEBOV. Cell Rep 20, 2251- 2261 (2017). S. Li et al., Molecular signatures of antibody responses derived from a systems biology study of five human vaccines. Nature immunology 15, 195-204 (2014). N. E. Yun, D. H. Walker, Pathogenesis of Lassa fever. Viruses 4, 2031-2048 (2012). A. Marzi et al., Single low-dose VSV-EBOV vaccination protects cynomolgus macaques from lethal Ebola challenge. EBioMedicine 49, 223-231 (2019). I. B. Prescott etal., Immunobiology of Ebola and Lassa virus infections. Nat Rev Immunol , (2017). A. K. McElroy et al., A Case of Human Lassa Virus Infection With Robust Acute T-Cell Activation and Long-Term Virus-Specific T-Cell Responses. J Infect Dis 215, 1862-1872 (2017). J. ter Meulen etal., Characterization of human CD4(+) T-cell clones recognizing conserved and variable epitopes of the Lassa virus nucleoprotein. J Virol 74, 2186-2192 (2000). A. Marzi et al., Protection Against Marburg Virus Using a Recombinant VSV-Vaccine Depends on T and B Cell Activation. Front Immunol 9, 3071 (2018). A. R. Menicucci, S. Sureshchandra, A. Marzi, H. Feldmann, I. Messaoudi, Transcriptomic analysis reveals a previously unknown role for CD8(+) T-cells in rVSV-EBOV mediated protection. Sci Rep 7, 919 (2017). C. Dahlke et al., Dose-dependent T-cell Dynamics and Cytokine Cascade Following rVSV-ZEBOV Immunization. EBioMedicine 19, 107-118 (2017). D. Masopust, V. Vezys, A. L. Marzo, L. Lefrancois, Preferential localization of effector memory cells in nonlymphoid tissue. Science 291, 2413-2417 (2001). L. Hangartner, R. M. Zinkernagel, H. Hengartner, Antiviral antibody responses: the two extremes of a wide spectrum. Nat Rev Immunol 6, 231-243 (2006). D. Pannetier et al., Human dendritic cells infected with the nonpathogenic Mopeia virus induce stronger T-cell responses than those infected with Lassa virus. J Virol 85, 8293- 8306 (2011). S. Baize et al., Lassa virus infection of human dendritic cells and macrophages is productive but fails to activate cells. J Immunol 172, 2861-2869 (2004). S. Mahanty et al., Cutting edge: impairment of dendritic cells and adaptive immunity by Ebola and Lassa viruses. J Immunol 170, 2797-2801 (2003). J. Schaeffer et al., Lassa virus activates myeloid dendritic cells but suppresses their ability to stimulate T cells. PLoS Pathog 14, el007430 (2018).M. Ahmed, K. L. Brzoza, E. M. Hiltbold, Matrix protein mutant of vesicular stomatitis virus stimulates maturation of myeloid dendritic cells. J Virol 80, 2194-2205 (2006). C. Chiale, A. M. Marchese, Y. Furuya, M. D. Robek, Virus-based vaccine vectors with distinct replication mechanisms differentially infect and activate dendritic cells. NPJ Vaccines 6, 138 (2021 ) . N. Honke et al., Enforced viral replication activates adaptive immunity and is essential for the control of a cytopathic virus. Nature immunology 13, 51-57 (2012). T. Tomczyk et al. , Immune Consequences of in vitro Infection of Human Peripheral Blood Leukocytes with Vesicular Stomatitis Virus. J Innate Immun 10, 131-144 (2018). S. K. Friedrich etal., Uspl8 Expression in CD169(+) Macrophages is Important for Strong Immune Response after Vaccination with VSV-EBOV. Vaccines (Basel) 8, (2020). P. V. Shinde etal., Tumor Necrosis Factor-Mediated Survival of CD169(+) Cells Promotes Immune Activation during Vesicular Stomatitis Virus Infection. J Virol 92, (2018). M. lannacone et al., Subcapsular sinus macrophages prevent CNS invasion on peripheral infection with a neurotropic virus. Nature 465, 1079-1083 (2010). I. E. Boudreau et al. , Recombinant vesicular stomatitis virus transduction of dendritic cells enhances their ability to prime innate and adaptive antitumor immunity. Mol Ther 17, 1465- 1472 (2009). L. Pipperger et al., Differential infection of murine and human dendritic cell subsets by oncolytic vesicular stomatitis virus variants. Oncoimmunology 10, 1959140 (2021). H. Muller et al., Adjuvant formulated virus-like particles expressing native-like forms of the Lassa virus envelope surface glycoprotein are immunogenic and induce antibodies with broadly neutralizing activity. NPJ Vaccines 5, 71 (2020). K. Schlie et al., Viral protein determinants of Lassa virus entry and release from polarized epithelial cells. J Virol 84, 3178-3188 (2010). P. B. Jahrling, C. I. Peters, Passive antibody therapy of Lassa fever in cynomolgus monkeys: importance of neutralizing antibody and Lassa virus strain. Infect Immun 44, 528-533 (1984). C. E. Mire et al, Human-monoclonal -antibody therapy protects nonhuman primates against advanced Lassa fever. Nature medicine 23, 1146-1149 (2017). R. W. Cross et al., Antibody therapy for Lassa fever. Curr Opin Virol 37, 97-104 (2019). T. Abreu-Mota et al., Non-neutralizing antibodies elicited by recombinant Lassa-Rabies vaccine are critical for protection against Lassa fever. Nature communications 9, 4223 (2018). M. Wang et al, Construction and Immunological Evaluation of an Adenoviral Vector- Based Vaccine Candidate for Lassa Fever. Viruses 13, (2021). J. Maruyama et al. , Adenoviral vector-based vaccine is fully protective against lethal Lassa fever challenge in Hartley guinea pigs. Vaccine 37, 6824-6831 (2019). S. P. Fisher-Hoch et al, Protection of rhesus monkeys from fatal Lassa fever by vaccination with a recombinant vaccinia virus containing the Lassa virus glycoprotein gene. Proceedings of the National Academy of Sciences of the United States of America 86, 317-321 (1989).' A. J. Hessell et al, Fc receptor but not complement binding is important in antibody protection against HIV. Nature 449, 101-104 (2007). S. Boumazos et al, Broadly neutralizing anti-HIV-1 antibodies require Fc effector functions for in vivo activity. Cell 158, 1243-1253 (2014).B. M. Gunn et al., Survivors of Ebola Virus Disease Develop Polyfunctional Antibody Responses. J Infect Dis 221, 156-161 (2020). R. W. Cross et al., A recombinant VSV-vectored vaccine rapidly protects nonhuman primates against heterologous lethal Lassa fever. Cell Rep 40, 111094 (2022). M. F. Gruber, S. Rubin, P. R. Krause, Approaches to demonstrating the effectiveness of filovirus vaccines: Lessons from Ebola and COVID-19. Front Immunol 14, 1109486 (2023). M. Miyashita, H. Oshiumi, M. Matsumoto, T. Seya, DDX60, a DEXD / H box helicase, is a novel antiviral factor promoting RIG-I-like receptor-mediated signaling. Mol Cell Biol 31, 3802-3819 (2011). M. Schlee, Master sensors of pathogenic RNA - RIG-I like receptors. Immunobiology 218, 1322-1335 (2013). A. Wickenhagen et al., A prenylated dsRNA sensor protects against severe COVID-19. Science 374, eabj3624 (2021). I. Andersson et al., Human MxA protein inhibits the replication of Crimean-Congo hemorrhagic fever virus. J Virol 78, 4323-4329 (2004). O. Haller, P. Staeheli, M. Schwemmle, G. Kochs, Mx GTPases: dynamin-like antiviral machines of innate immunity. Trends Microbiol 23, 154-163 (2015). A. S. Gizzi et al., A naturally occurring antiviral ribonucleotide encoded by the human genome. Nature 558, 610-614 (2018). L. B. Ivashkiv, L. T. Donlin, Regulation of type I interferon responses. Nat Rev Immunol 14, 36-49 (2014). N. Honke, N. Shaabani, D. E. Zhang, C. Hardt, K. S. Lang, Multiple functions of USP18. Cell Death Dis 7, e2444 (2016). Y. C. Perng, D. J. Lenschow, ISG15 in antiviral immunity and beyond. Nat Rev Microbiol 16, 423-439 (2018). N. A. Mathieu, E. Paparisto, S. D. Barr, D. E. Spratt, HERC5 and the ISGylation Pathway: Critical Modulators of the Antiviral Immune Response. Viruses 13, (2021). P. Proost et al., Posttranslational modifications affect the activity of the human monocyte chemotactic proteins MCP-1 and MCP-2: identification of MCP-2(6-76) as a natural chemokine inhibitor. J Immunol 160, 4034-4041 (1998). M. Liu et al. , CXCL 10 / IP- 10 in infectious diseases pathogenesis and potential therapeutic implications. Cytokine Growth Factor Rev 22, 121-130 (2011). J. N. Barr, S. P. Whelan, G. W. Wertz, Transcriptional control of the RNA-dependent RNA polymerase of vesicular stomatitis virus. Biochim Biophys Acta 1577, 337-353 (2002). H. N. Pennington, J. Lee, Lassa virus glycoprotein complex review: insights into its unique fusion machinery. Biosci Rep, (2022). A. Prout et al., Functional profiling of Covid 19 vaccine candidate by flow virometry. Vaccine 40, 5529-5536 (2022). R. Andrabi et al., Identification of Common Features in Prototype Broadly Neutralizing Antibodies to HIV Envelope V2 Apex to Facilitate Vaccine Design. Immunity 43, 959-973 (2015). A. Olay emi, E. Fichet-Calvet, Systematics, Ecology, and Host Switching: Attributes Affecting Emergence of the Lassa Virus in Rodents across Western Africa. Viruses 12, (2020).
[0224] Having thus described in detail preferred embodiments of the present invention, it is to be understood that the invention defined by the above paragraphs is not to be limited to particular details set forth in the above description as many apparent variations thereof are possible without departing from the spirit or scope of the present invention.
Claims
WHAT IS CLAIMED IS:
1. A vesicular stomatitis vector (VSV) excluding a glycoprotein G gene (VSVAG) comprising and expressing a nucleic acid encoding a Lassa virus (LASV) glycoprotein complex (GPC), or a nucleic acid comprising SEQ ID NO: 1, or a nucleic acid comprising a sequence having at least 95%, or 96%, or 97% or 98% or 99% sequence identity to SEQ ID NO: 1, or a nucleic acid comprising SEQ ID NO: 2, or a nucleic acid comprising a sequence having at least 95%, or 96%, or 97% or 98% or 99% sequence identity to SEQ ID NO: 2.
2. The vector of claim 1, wherein the nucleic acid comprises SEQ ID NO: 1, or the nucleic acid comprises a sequence having at least 95%, or 96%, or 97% or 98% or 99% sequence identity to SEQ ID NO: 1.
3. The vector of claim 1, wherein the nucleic acid comprises SEQ ID NO: 2, or the nucleic acid comprises a sequence having at least 95%, or 96%, or 97% or 98% or 99% sequence identity to SEQ ID NO: 2.
4. The vector of claim 1, wherein the Lassa virus serotype strain is selected from the group consisting of Lineage I, Lineage, II, Lineage III, Lineage, IV, Lineage V, Lineage VI, and Lineage VII.
5. The vector of claim 4, wherein the Lassa virus serotype strain is Lineage IV.
6. A recombinant vaccine or immunogenic composition comprising the vector of claim 1, and a pharmaceutically or veterinarily acceptable carrier or diluent and optionally an adjuvant.
7. A recombinant vaccine or immunogenic composition comprising the vector of claim 2, and a pharmaceutically or veterinarily acceptable carrier or diluent and optionally an adjuvant.
8. A recombinant vaccine or immunogenic composition comprising the vector of claim 3, and a pharmaceutically or veterinarily acceptable carrier or diluent and optionally an adjuvant.
9. A cell comprising the vector of any one of claims 1, 2 or 3.
10. The cell of claim 9, wherein the cell is a mammalian cell.
11. The cell of claim 10, wherein the cell is a Vero cell.
12. A method for vaccinating or immunizing a mammal, optionally a mammal in need thereof, with the vaccine or immunogenic composition of claim 6 comprising administering about 102-107PFU of the vaccine or immunogenic composition to the mammal.
13. A method for vaccinating or immunizing a mammal, optionally a mammal in need thereof, with the vaccine or immunogenic composition of claim 7 comprising administering about 102-107PFU of the vaccine or immunogenic composition to the mammal.
14. A method for vaccinating or immunizing a mammal, optionally a mammal in need thereof, with the vaccine or immunogenic composition of claim 8 comprising administering about 102-107PFU of the vaccine or immunogenic composition to the mammal.
15. The method of claim 12, 13, or 14 comprising administering about 104PFU of the vaccine or immunogenic composition.
16. The method of claim 12, 13, or 14 comprising administering about 105PFU of the vaccine or immunogenic composition.
17. The method of claim 12, 13, or 14 comprising administering about 106PFU of the vaccine or immunogenic composition.
18. The method of any one of claims 12-17, wherein the mammal is a rodent or a primate.
19. The method of claim 18, wherein the primate is a bonobo, chimpanzee, gibbon, gorilla, human, monkey, or orangutan.
20. The method of claim 19, wherein the primate is a human.
21. The method of claim 12, 13, or 14 wherein the vaccine or immunogenic composition is administered sequentially or simultaneously with an Ebola virus vaccine, a Marburg virus vaccine, or a Sudan virus vaccine.
22. A method for enhancing an immune response to an infectious disease comprising; i) administering a priming vaccine or immunological composition comprising an immunologically effective amount of a viral vector that encodes and expresses one or more antigens;ii) administering a boosting vaccine or immunological composition comprising an immunologically effective amount of a viral vector that encodes and expresses one or more antigens; wherein the boosting and / or priming vaccine or immunological composition comprises the vaccine or immunogenic composition of claim 6, 7 or 8.
23. The method of claim 22, wherein the one or more antigens is the same in the priming vaccine or immunological composition and boosting vaccine or immunological composition.
24. The method of claim 22, wherein the one or more antigens is different in the priming vaccine or immunological composition and boosting vaccine or immunological composition.
25. The method of claim 12, 13, or 14 wherein the administration is intramuscular.
26. The method of claim 12, 13, or 14 wherein the administration is intranasal.
27. The method of claim 12, 13, or 14 wherein the administration is intradermal.
28. The method of claim 12, 13, or 14 wherein the administration is by an oral bait drop.
29. A pharmaceutical or veterinary or vaccine or immunological composition comprising the vector of any one of claims 1-5, and a pharmaceutically or veterinarily acceptable carrier or diluent and optionally an adjuvant.
Citation Information
Patent Citations
Chimeric VSV virus compositions and methods of use thereof for treatment of cancer
US20160296572A1
Lassa virus vaccine
US20230181713A1
Armed chimeric oncolytic viruses
WO2022216565A1