Compositions and methods for preparing vaccines

Abstract

Highly specific T cells and T-cell receptors (TCRs) specific to a pathogen associated with an infectious disease can be generated by ex vivo induction or expansion, which can be useful for developing therapeutics such as vaccines for infectious diseases and determining antigen presentation in vitro. The present disclosure provides malaria-specific TCRs and nucleic acid encoding the TCRs, methods of making T cells specific for an infectious disease, methods of identifying TCRs, and methods of using the same for determining whether a vaccine induces T cell specific immune response, whether an epitope sequence is presented, and whether an antigen is recognizable by TCRs.

Description

COMPOSITIONS AND METHODS FOR PREPARING VACCINESCROSS-REFERENCE

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 596,728, filed on November 07, 2023, which is incorporated herein by reference in its entirety.BACKGROUND

[0002] Infectious disease is a leading cause of death globally. In 2019, nearly 14 million people succumbed to infectious disease and related syndromes. Malaria, a disease caused by infection with protozoan Plasmodium falciparum, is a persistent threat to global health. There is a need for methods and compositions to identify protective vaccines and treatments for infectious diseases.SUMMARY

[0003] Provided herein is a method of determining whether an infectious disease vaccine comprising a therapeutic polypeptide or a polynucleotide encoding the therapeutic polypeptide is capable of inducing T cell specific immune response in a subject, the method comprising: (a) contacting a population of cells comprising antigen-presenting cells (APCs) comprising the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide with a population of T cells expressing a T-cell receptor (TCR) specific to a peptide :MHC complex, wherein the therapeutic polypeptide comprises a polypeptide sequence from a protein encoded by a genome of a pathogen associated with an infectious disease, wherein the peptide:MHC complex comprises: (i) an epitope sequence from the therapeutic polypeptide, and (ii) an MHC molecule expressed by the population of cells comprising APCs; (b) assaying for activation of the T cells using an activation assay or an activation marker; and (c) determining the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide as being capable of inducing a T cell specific immune response in a subject when the T cells are activated according to the activation assay or the activation marker of (b); wherein: (A) the epitope sequence of the peptide :MHC complex is present at a level in the population of cells comprising APCs that is undetectable by mass spectrometry, (B) the pathogen is a pathogen that only infects human cells, and / or (C) the protein encoded by the genome of the pathogen associated with the infectious disease is expressed by human cell infected with the pathogen, but is not expressed by non-human cell infected with the pathogen.

[0004] In some embodiments, the infectious disease vaccine comprises a ribonucleic acid (RNA) sequence encodingthe therapeutic polypeptide. In some embodiments, the therapeutic polypeptide comprises two or more polypeptide sequences each from a different protein encoded by the genome of the pathogen associated with the infectious disease. In some embodiments, thetherapeutic polypeptide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polypeptide sequences each from a different protein encoded by the genome of the pathogen associated with the infectious disease. In some embodiments, the therapeutic polypeptide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different epitope sequences from two or more different proteins encoded by the genome of a pathogen associated with an infectious disease. In some embodiments, contacting comprises contacting the population of T cells to the population of cells comprising (i) APCs pulsed with the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide and (ii) APCs pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the protein encoded by the genome of the pathogen associated with an infectious disease. In some embodiments, the ratio of (i) APCs pulsed with the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide and (ii) APCs pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the protein encoded by the genome of the pathogen associated with an infectious disease is from 99:1 to 1 :99, from 90: 10 to 10:90, or from 70:30 to 30:70.

[0005] In some embodiments, the APCs comprise a cell line, optionally wherein the cell line is a A375 cell line. In some embodiments, contacting comprises contacting the population of T cells to the population of cells comprising APCs incubated with from 0.01 nM- 100 pM, from 0.1 nM - 10 pM, or from 1 nM - 1 pM of the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide. In some embodiments, the method further comprises, prior to (a), identifying the TCR specific to the peptide :MHC complex in an ex vivo assay. In some embodiments, the population of T cells expressing the TCR specific to thepeptide:MHC complex are primary T cells or a cell line, optionally wherein the cell line is a Jurkat cell line. In some embodiments, the population of T cells expressing the TCR specific to thepeptide:MHC complex is from a peripheral blood mononuclear cell (PBMC) sample. In some embodiments, the population of cells is from a PBMC sample. In some embodiments, contacting comprises contacting the population of T cells with the population of cells at a ratio of from 20:1 to 1 :20, 10: 1 to 1 : 10, or 5 :1 to 1 :5. In some embodiments, the activation assay comprises detecting the activation marker by flow cytometry. In some embodiments, the activation assay comprises measuring a secreted cytokine or chemokine via an immunoassay. In some embodiments, the activation assay comprises measuring a secreted cytokine or chemokine via Meso Scale Discovery (MSD).

[0006] In some embodiments, the activation marker is a cell surface marker. In some embodiments, the cell surface marker is selected from the group consisting of CD69, CD25, CD40L, CD38, OX-40, 4-1BB, CD27, and ICOS. In some embodiments, secreted cytokine or chemokine is selected from the group consisting of IL-2, IFN-y, TNF-a, IL-6, IL-12, IL-17A, IL- 17B, IL-17C, IL-17D, IL-17E, and IL-17F. In some embodiments, the RNA sequence furthercomprises an RNA sequence encoding (i) an MHC class I trafficking signal (MITD) sequence, (ii) a linker, and / or (iii) a signal peptide. In some embodiments, the pathogen does not infect a non-human cell. In some embodiments, the MHC molecule is an MHC class I molecule or an MHC class II molecule. In some embodiments, the MHC molecule is encoded by an HLA allele selected from the group consisting of HLA-A02 allele, HLA- AO 1 allele, HLA-A03 allele, HLA- A24 allele, HLA-A26 allele, HLA-A31 allele, HLA-A68 allele, HLA-A69 allele, HLA-B07 allele, HLA-B08 allele, HLA-B12 allele, HLA-B35 allele, HLA-B46 allele, HL A-B 50 allele, HLA-B51 allele, HLA-C04 allele, HLA-C06 allele, HLA-C07 allele, and HLA-C12 allele. In some embodiments, the MHC molecule is encoded by an HLA-A02 allele.

[0007] In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence has a binding affinity of an IC50 of 500 nM or less for the MHC molecule. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from 8 to 12 amino acids in length. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from 15 to 25 amino acids in length. In some embodiments, the infectious disease is selected from the group consisting of malaria, Epstein-Barr Virus (EBV), Human Papillomavirus (HPV), Cytomegalovirus (CMV), CO VID- 19, Middle Eastern Respiratory Syndrome (MERS), Measles, Rubella, Chickenpox, Poliomyelitis, Pertussis, Chlamydia, Gonorrhea, Spirochete infections (optionally, Lyme, syphilis, or leptospirosis), Tuberculosis, Toxoplasmosis, Giardia, Chagas Disease, and Helminth infections (optionally, hookworm, ascaris, whipworm, or tapeworm). In some embodiments, the pathogen is selected from the group consisting of Plasmodium falciparum, EBV, HPV, CMV, SARS-CoV-2, SARS-CoV-1, Human Immunodeficiency Virus (HIV), Varicella-zoster Virus (VZV), measles virus (MV), Poliovirus, Rubella Virus, Bordetella pertussis, Chlamydia trachomatis, Neisseria gonorrhoeae , Borrelia burgdorferi, Treponema pallidum, Leptospira, Mycobacterium tuberculosis, Toxoplasma gondii, Giardia duodenalsis, Trypanosoma cruzi, Anky lo stoma duodenale , Ascaris lumbricoides, Trichuris, and Taenia. In some embodiments, the infectious disease is malaria. In some embodiments, the pathogen is Plasmodium falciparum. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from a protein encoded by the genome of Plasmodium falciparum. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from TRAP. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is selected from the group consisting of FLIFFDLFLV (SEQ ID NO: 1), NLTDALLQV (SEQ ID NO: 2), and LLMDCSGSI (SEQ ID NO: 3). In some embodiments, the epitope(s), the epitope sequence(s), orthe candidate epitope sequence is from CSP, LISP1, LSAlb, or LSAP2. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from LISP1 and is selected from one ormore of KIFGCITNK (SEQ ID NO: 75), KQLSLIPSI (SEQ ID NO: 69), and TVGDVLRYV (SEQ ID NO: 71). In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from LSAlb and is SLYDEHIKK (SEQ ID NO: 76). In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is selected from the amino acid sequence set forth in any one of SEQ ID NOs: 60-88. In some embodiments, the different protein(s) are encoded by the genome of Plasmodium falciparum. In some embodiments, the protein or the different protein(s) encoded by the genome of Plasmodium falciparum is selected from one or more of CSP, TRAP, UIS3, UIS4, LSAP2, LSA-l(a), LSA-1 (b), LISP-2, and LISP-1.

[0008] Provided herein is a method of determining whether an epitope sequence from a protein encoded by a genome of a pathogen associated with an infectious disease is presented by an MHC molecule expressed by a cell infected by the pathogen, the method comprising: (a) contacting a population of cells comprising cells infected by the pathogen with a population of T cells expressing a T-cell receptor (TCR) specific to a peptide:MHC complex comprising: (i) an epitope sequence from a protein encoded by the genome of the pathogen associated with the infectious disease, and (ii) an MHC molecule expressed by the cells infected by the pathogen; (b) assaying for activation of the T cells using an activation assay or an activation marker; and (c) determining the epitope sequence from the protein encoded by the genome of the pathogen associated with an infectious disease to be presented by the MHC molecule expressed by the cell infected by the pathogen when the T cells are activated according to the activation assay or the activation marker of (b); wherein: (A) the epitope sequence of the peptide:MHC complex is present at a level in the population of cells comprising APCs that is undetectable by mass spectrometry, (B) the pathogen is a pathogen that only infects human cells, and / or (C) the protein encoded by the genome of the pathogen associated with the infectious disease is expressed by human cell infected with the pathogen, but is not expressed by non-human cell infected with the pathogen.

[0009] In some embodiments, the population of cells comprises primary cells infected by the pathogen, optionally wherein the population of cells comprises hepatocytes infected by the pathogen. In some embodiments, contacting comprises contacting the population of T cells to a population of cells comprising (i) cells infected by the pathogen and (ii) cells not infected by the pathogen. In some embodiments, the ratio of (i) cells infected by the pathogen and (ii) cells not infected by the pathogen is from 99: 1 to 1 :99, from 90:10 to 10:90, or from 70:30 to 30:70. In some embodiments, the method further comprises, prior to (a), identifying the TCR specific to the peptide:MHC complex in an ex vivo assay. In some embodiments, the population of T cells expressing the TCR specific to the peptide:MHC complex are primary T cells or a cell line, optionally wherein the cell line is a Jurkat cell line. In some embodiments, the population of Tcells expressing the TCR specific to the peptide :MHC complex is from a peripheral blood mononuclear cell (PBMC) sample. In some embodiments, the population of cells is from a PBMC sample.

[0010] In some embodiments, contacting comprises contacting the population of T cells with the population of cells at a ratio of from 20:1 to 1 :20, 10:1 to 1 :10, or 5 :1 to 1 :5. In some embodiments, the activation assay comprises detecting the activation marker by flow cytometry. In some embodiments, the activation assay comprises measuring a secreted cytokine or chemokine via an immunoassay. In some embodiments, the activation assay comprises measuring a secreted cytokine or chemokine via MesoScale Discovery (MSD). In some embodiments, the activation marker is a cell surface marker. In some embodiments, the cell surface marker is selected from the group consisting of CD69, CD25, CD40L, CD38, OX-40, 4-1BB, CD27, andICOS. In some embodiments, secreted cytokine or chemokine is selected from the group consisting of IL-2, IFN- y, TNF-a, IL-6, IL-12, IL-17A, IL-17B, IL-17C, IL-17D, IL-17E, and IL-17F. In some embodiments, the pathogen does not infect a non-human cell. In some embodiments, the MHC molecule is an MHC class I molecule or an MHC class II molecule. In some embodiments, the MHC molecule is encoded by an HLA allele selected from the group consisting of HLA-A02 allele, HLA- A01 allele, HLA-A03 allele, HLA-A24 allele, HLA-A26 allele, HLA-A31 allele, HLA-A68 allele, HLA-A69 allele, HLA-B07 allele, HLA-B08 allele, HLA-B 12 allele, HLA-B35 allele, HLA-B46 allele, HLA-B50 allele, HLA-B51 allele, HLA-C04 allele, HLA-C06 allele, HLA-C07 allele, and HLA-C12 allele. In some embodiments, the MHC molecule is encoded by an HLA-A02 allele. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence has a binding affinity of an IC50 of 500 nM or less for the MHC molecule. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from 8 to 12 amino acids in length. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from 15 to 25 amino acids in length.

[0011] In some embodiments, the infectious disease is selected from the group consisting of malaria, Epstein-Barr Virus (EBV), Human Papillomavirus (HPV), Cytomegalovirus (CMV), CO VID-19, Middle Eastern Respiratory Syndrome (MERS), Measles, Rubella, Chickenpox, Poliomyelitis, Pertussis, Chlamydia, Gonorrhea, Spirochete infections (optionally, Lyme, syphilis, or leptospirosis), Tuberculosis, Toxoplasmosis, Giardia, Chagas Disease, and Helminth infections (optionally, hookworm, ascaris, whipworm, or tapeworm). In some embodiments, the pathogen is selected from the group consisting of Plasmodium falciparum, EBV, HPV, CMV, SARS-CoV-2, SARS-CoV-1, Human Immunodeficiency Virus (HIV), Varicella-zoster Virus (VZV), measles virus (MV), Poliovirus, Rubella Virus, Bordetella pertussis, Chlamydia trachomatis, Neisseria gonorrhoeae, Borrelia burgdorferi, Treponema pallidum, Leptospira,Mycobacterium tuberculosis, Toxoplasma gondii, Giardia duodenalsis, Trypanosoma cruzi, Ankylostoma duodenale ,Ascaris lumbricoides, Trichuris, and Taenia. In some embodiments, the infectious disease is malaria. In some embodiments, the pathogen is Plasmodium falciparum.

[0012] In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from a protein encoded by the genome of Plasmodium falciparum. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from TRAP. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is selected from the group consisting of FLIFFDLFLV (SEQ ID NO: 1), NLTDALLQV (SEQ ID NO: 2), and LLMDCSGSI (SEQ ID NO: 3). In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from CSP, LISP1, LSAlb, or LSAP2. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from LISP1 and is selected from one or more of KIFGCITNK (SEQ ID NO: 75), KQLSLIPSI (SEQ ID NO: 69), and TVGDVLRYV (SEQ ID NO: 71). In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from LSAlb and is SLYDEHIKK (SEQ ID NO: 76). In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is selected from the amino acid sequence set forth in any one of SEQ ID NOs: 60-88. In some embodiments, the different protein(s) are encoded by the genome of Plasmodium falciparum. In some embodiments, the protein or the different protein(s) encoded by the genome of Plasmodium falciparum is selected from one or more of CSP, TRAP, UIS3, UIS4, LSAP2, LSA-l(a), LSA-l(b), LISP-2, and LISP-1.

[0013] Provided herein is a method of determining whether a polypeptide sequence from a protein encoded by the genome of a pathogen associated with an infectious disease contains an epitope sequence that is presented by an MHC molecule expressed by antigen-presenting cells (APCs ), the method comprising: (a) contacting to a plurality of APCs (i) a polypeptide comprising the polypeptide sequence from the protein encoded by the genome of the pathogen associated with the infectious disease, or (ii) a polynucleotide encoding the polypeptide comprising the polypeptide sequence from the protein encoded by the genome of the pathogen associated with the infectious disease; (b) contacting the plurality of APCs from (a) to a population of immune cells comprising T cells, thereby forming a stimulated population of immune cells; (c) enriching T cells expressing a TCR that binds to an MHC multimer in complex with a candidate epitope sequence from the stimulated population of immune cells comprising T cells; (d) sequencing the TCR from the enriched T cells; (e) expressing the TCR in a population of T cells and assaying for activation of T cells in the population of T cells using an activation assay or an activation marker, wherein assaying comprises contacting the population of T cells expressing the TCR to APCs comprising a polypeptide comprising the candidate epitope sequence; and (f) identifying thecandidate epitope sequence as being an epitope presented by an MHC molecule corresponding to the MHC multimer expressed by APCs when the T cells are activated according to the activation assay or the activation marker of (e).

[0014] In some embodiments, the method further comprises preparing a vaccine using the polypeptide sequence from the protein encoded by the genome of the pathogen associated with the infectious disease. In some embodiments, the vaccine comprises a ribonucleic acid (RNA) sequence encoding the polypeptide. In some embodiments, the RNA sequence encodes two or more polypeptide sequences each from a different protein encoded by the genome of the pathogen associated with the infectious disease. In some embodiments, the RNA sequence encodes 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polypeptide sequences each from a different protein encoded by the genome of the pathogen associated with the infectious disease. In some embodiments, the RNA sequence encodes 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different epitope sequences from two or more different proteins encoded by the genome of a pathogen associated with an infectious disease. In some embodiments, the RNA sequence further comprises an RNA sequence encoding (i) an MHC class I trafficking signal (MITD) sequence, (ii) a linker, and / or (iii) a signal peptide. In some embodiments, the activation assay comprises detecting the activation marker by flow cytometry. In some embodiments, the activation assay comprises measuring a secreted cytokine or chemokine via an immunoassay. In some embodiments, the activation assay comprises measuring a secreted cytokine or chemokine via MesoScale Discovery (MSD).

[0015] In some embodiments, the activation marker is a cell surface marker. In some embodiments, the cell surface marker is selected from the group consisting of CD69, CD25, CD40L, CD38, OX-40, 4-1BB, CD27, and ICOS. In some embodiments, secreted cytokine or chemokine is selected from the group consisting of IL-2, IFN-y, TNF-a, IL-6, IL-12, IL-17A, IL- 17B, IL-17C, IL-17D, IL-17E, and IL-17F. In some embodiments, the epitope sequence of the peptide:MHC complex is present at a level in the population of cells comprising APCs that is undetectable by mass spectrometry. In some embodiments, the epitope sequence that is presented by an MHC molecule expressed by APCs is present in the APCs at a level that is undetectable by mass spectrometry. In some embodiments, the pathogen is a pathogen that only infects human cells. In some embodiments, the protein encoded by the genome of the pathogen associated with the infectious disease is expressed by human cell infected with the pathogen, but is not expressed by non-human cell infected with the pathogen. In some embodiments, expressing the TCR in a population of T cells comprises expressingthe TCR in PBMCs. In some embodiments, expressing the TCR in a population of T cells comprises expressing the TCR in a cell line. In some embodiments, expressingthe TCR in a population of T cells comprises expressingthe TCR in a Jurkat cell line. In some embodiments, assaying comprises contacting the population of T cellsexpressingthe TCR to APCs that express an MHC molecule correspondingto the MHC multimer. In some embodiments, the APCs from (e) are a cell line. In some embodiments, the cell line comprises A375 cells. In some embodiments, the APCs from (e) are primary cells. In some embodiments, the primary cells comprise primary hepatocytes.

[0016] In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to APCs infected with the pathogen. In some embodiments, assaying comprises contactingthe population of T cells expressingthe TCR to the APCs that are hepatocytes infected with the pathogen. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs comprising a polypeptide comprising the candidate epitope sequence at a ratio of from 20:1 to 1 :20. In some embodiments, assaying comprises contactingthe population of T cells expressingthe TCR to the APCs comprising a polypeptide comprising the candidate epitope sequence at a ratio of from 10:1 to 1 : 10. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs comprising a polypeptide comprising the candidate epitope sequence at a ratio of from 5 :1 to 1 :5. In some embodiments, assaying comprises contactingthe population of T cells expressingthe TCR to the APCs incubated with from 0.0 I nM- 100 pMofthe polypeptide comprisingthe candidate epitope sequence. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs incubated with from 0.1 nM - 10 pM of the polypeptide comprisingthe candidate epitope sequence. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs incubated with from 1 nM - 1 pM of the polypeptide comprising the candidate epitope sequence. In some embodiments, assaying comprises contactingthe population of T cells expressingthe TCR to the APCs comprising (i) APCs pulsed with the polypeptide comprising the candidate epitope sequence and (ii) APCs pulsed with an irrelevant polypeptide or a polypeptidethat does not comprise the candidate epitope sequence. In some embodiments, the ratio of (i) the APCs pulsed with the polypeptide comprising the candidate epitope sequence to (ii) the APCs pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence is from 99: 1 to 1 :99. In some embodiments, the ratio of (i) the APCs pulsed with the polypeptide comprising the candidate epitope to (ii) the APCs pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence is from 90: 10 to 10:90. In some embodiments, the ratio of (i) the APCs pulsed with the polypeptide comprisingthe candidate epitope sequence to (ii) the APCs pulsed with an irrelevant polypeptide or a polypeptidethat does not comprise the candidate epitope sequence is from 70:30 to 30:70.

[0017] In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs comprising (i) APCs that express an MHC molecule corresponding to theMHC multimer and that have been pulsed with the polypeptide comprising the candidate epitope sequence and (ii) APCs that do notexpress an MHC molecule corresponding to the MHC multimer and that have been pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence. In some embodiments, the ratio of (i) the APCs that express an MHC molecule corresponding to the MHC multimer and that have been pulsed with the polypeptide comprising the candidate epitope sequence to (ii) the APCs that do not express an MHC molecule corresponding to the MHC multimer and that have been pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence is from 99:1 to 1 :99 In some embodiments, the ratio of (i) the APCs that express an MHC molecule corresponding to the MHC multimer and that have been pulsed with the polypeptide comprising the candidate epitope sequence to (ii) the APCs that do not express an MHC molecule corresponding to the MHC multimer and that have been pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence is from 90:10 to 10:90. In some embodiments, the ratio of (i) the APCs that express an MHC molecule corresponding to the MHC multimer and that have been pulsed with the polypeptide comprising the candidate epitope sequence to (ii) the APCs that do not express an MHC molecule corresponding to the MHC multimer and that have been pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence is from 70:30 to 30:70 . In some embodiments, the population of immune cells are from a PBMC sample or is a cell line. In some embodiments, the population of immune cells are isolated from a healthy subject. In some embodiments, the pathogen does not infect a non-human cell.

[0018] In some embodiments, the MHC molecule is an MHC class I molecule or an MHC class II molecule. In some embodiments, the MHC molecule is encoded by an HLA allele selected from the group consisting of HLA-A02 allele, HLA- A01 allele, HLA-A03 allele, HLA-A24 allele, HLA-A26 allele, HLA- A31 allele, HLA-A68 allele, HLA-A69 allele, HLA-B07 allele, HLA-B08 allele, HLA-B12 allele, HLA-B35 allele, HLA-B46 allele, HLA-B50 allele, HLA-B51 allele, HLA-C04 allele, HLA-C06 allele, HLA-C07 allele, and HLA-C12 allele. In some embodiments, the MHC molecule is encoded by an HLA-A02 allele. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence has a binding affinity of an IC50 of 500 nM or less for the MHC molecule. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from 8 to 12 amino acids in length. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from 15 to 25 amino acids in length. In some embodiments, the infectious diseaseis selected from the group consisting of malaria, Epstein-Barr Virus (EBV), Human Papillomavirus (HPV), Cytomegalovirus (CMV), CO VID-19, Middle Eastern Respiratory Syndrome (MERS), Measles, Rubella, Chickenpox,Poliomyelitis, Pertussis, Chlamydia, Gonorrhea, Spirochete infections (optionally, Lyme, syphilis, or leptospirosis), Tuberculosis, Toxoplasmosis, Giardia, Chagas Disease, and Helminth infections (optionally, hookworm, ascaris, whipworm, or tapeworm). In some embodiments, the pathogen is selected from the group consisting of Plasmodium falciparum, EBV, HPV, CMV, SARS-CoV-2, SARS-CoV-1, Human Immunodeficiency Virus (HIV), Varicella-zoster Virus (VZV), measles virus (MV), Poliovirus, Rubella Virus, Bordetella pertussis, Chlamydia trachomatis, Neisseria gonorrhoeae, Borrelia burgdorferi, Treponema pallidum, Leptospira, Mycobacterium tuberculosis, Toxoplasma gondii, Giardia duodenalsis, Trypanosoma cruzi, Ankylostoma duodenale , Ascaris lumbricoides, Trichuris, and Taenia. In some embodiments, the infectious disease is malaria. In some embodiments, the pathogen is Plasmodium falciparum. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from a protein encoded by the genome of Plasmodium falciparum.

[0019] In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from TRAP. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is selected from the group consisting of FLIFFDLFLV (SEQ ID NO: 1), NLTDALLQV (SEQ ID NO: 2), and LLMDCSGSI (SEQ ID NO: 3). In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from CSP, LISP1, LSAlb, orLSAP2. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from LISP1 and is selected from one or more of KIFGCITNK (SEQ ID NO: 75), KQLSLIPSI (SEQ ID NO: 69), and TVGD VLRYV (SEQ ID NO: 71). In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from LSAlb and is SLYDEHIKK (SEQ ID NO: 76). In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is selected from the amino acid sequence set forth in any one of SEQ ID NOs: 60-88. In some embodiments, the different protein(s) are encodedby the genome of Plasmodium falciparum. In some embodiments, the protein or the different protein(s) encoded by the genome of Plasmodium falciparum is selected from one or more of CSP, TRAP, UIS3, UIS4, LSAP2, LSA-l(a), LSA-l(b), LISP-2, and LISP-1.

[0020] Provided herein is an ex vivo method of preparing antigen-specific T cells, the method comprising: (a) depleting CD14+ cells and / or CD25+ cells from a population of immune cells comprising antigen-presenting cells (APCs) and T cells, thereby forming a CD14 and / or CD25 depleted population of immune cells comprising a first population of APCs and T cells, wherein the population of immune cells is from a biological sample from a human subject; (b) incubating the first population of APCs and T cells from (a) for a firsttime period in the presence of : (i) FMS- like tyrosine kinase 3 receptor ligand (FLT3L), and (ii) (A) a polypeptide comprising an epitope sequence, wherein the epitope sequence is from a protein encodedby the genome of a pathogenassociated with an infectious disease, or (B) a polynucleotide encoding the polypeptide; thereby forming a population of cells comprising stimulated T cells; (c) expanding the stimulated T cells from (b), thereby forming an expanded population of cells comprising antigen-specific T cells, wherein the antigen-specific T cells express a T-cell receptor (TCR) specific to a peptide:MHC complex comprising: (i) a peptide consisting of the epitope sequence from the protein encoded by the genome of the pathogen associated with the infectious disease, and (ii) an MHC molecule expressed by the APCs of the population of immune cells of (a).

[0021] In some embodiments, the expanded population of cells comprises at least lxlOA6 total cells. In some embodiments, the expanded population of cells comprises at least 1x10A7 total cells. In some embodiments, the expanded population of cells comprises at least 1x10A8 total cells. In some embodiments, the expanded population of cells comprises from lxl0A8 to lxlOAl l total cells. In some embodiments, the expanded population of cells comprises from 0.75xl0A8 to 1.25xl0A10 total cells. In some embodiments, the expanded population of cells comprises from 5xl0A8 to lxl0A10total cells, 5xl0A8 to 1x10A9 total cells, or from 5xl0A8 to 2xlOA9 total cells. In some embodiments, the depleting comprises depleting CD 14+ cells and / or CD25+ cells directly from a washed and / or cryopreserved peripheral blood mononuclear cell (PBMC) sample from a human subject. In some embodiments, the incubating comprises incubating the CD14 and / or CD25 depleted population of immune cells comprising a first population of APCs and T cells for a first time period in the presence of: (i) FMS-like tyrosine kinase 3 receptor ligand (FLT3L), and (ii) a polypeptide comprising at least two different epitope sequences, wherein each of the least two different epitope sequences is from the same protein encoded by the genome of a pathogen associated with an infectious disease. In some embodiments, the incubating comprises incubating the CD 14 and / or CD25 depleted population of immune cells comprising a first population of APCs and T cells for a first time period in the presence of: (i) FMS-like tyrosine kinase 3 receptor ligand (FLT3L), and (ii) a polypeptide comprising at least two different epitope sequences, wherein each of the least two different epitope sequencesis from a different protein encoded by the genome of a pathogen associated with an infectious disease. In some embodiments, the incubating comprises incubating the CD14 and / or CD25 depleted population of immune cells comprising a first population of APCs and T cells for a first time period in the presence of: (i) FMS-like tyrosine kinase 3 receptor ligand (FLT3L), and (ii) an mRNA encoding a polypeptide comprising at least two different epitope sequences, wherein each of the least two different epitope sequences is from the same protein encoded by the genome of a pathogen associated with an infectious disease. In some embodiments, the incubating comprises incubating the CD14 and / or CD25 depleted population of immune cells comprising a first population of APCs and T cells for a first time period in the presence of: (i) FMS-like tyrosine kinase 3 receptor ligand (FLT3L), and (ii) anmRNA encoding a polypeptide comprising at least two different epitope sequences, wherein each of the least two different epitope sequencesis from a different protein encoded by the genome of a pathogen associated with an infectious disease.

[0022] In some embodiments, a first epitope sequence of the at least two different epitope sequences is connectedto a second epitope sequence ofthe atleasttwo different epitopesequences via a linker sequence. In some embodiments, the at least two different epitope sequences are expressed as a single polypeptide chain. In some embodiments, the polypeptide comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different epitope sequences from two or more different proteins encoded by the genome of a pathogen associated with an infectious disease. In some embodiments, (b) comprises introducing the polynucleotide encoding the polypeptide or the mRNA encoding the polypeptide into the APCs of the first population of APCs and T cells from (a). In some embodiments, the introducing comprises electroporating or nucleofecting, optionally wherein the electroporating or nucleofecting is carried out without separating the T cells from the APCs of the first population of APCs and T cells from (a). In some embodiments, (b) and (c) are performed in less than 28 days. In some embodiments, the fraction of CD8+ antigen-specific T cells of the total number of CD8+ T cells in the expanded population of cells is at least two-fold higher than the fraction of CD8+ antigen-specific T cells of the total number of CD8+ T cells in the CD 14 and / or CD25 depleted population of immune cells. In some embodiments, the fraction of CD4+ antigenspecific T cells of the total number of CD4+ T cells in the expanded population of cells is at least two-fold higher than the fraction of CD4+ antigen-specific T cells of the total number of CD4+ T cells in the CD14 and / or CD25 depleted population of immune cells. In some embodiments, at least 0.1% of the CD8+ T cells in the expanded population of cells are CD8+ antigen-specific T cells derived from naive CD8+ T cells. In some embodiments, at least 0.1% of the CD4+ T cells in the expanded population of cells are CD4+ antigen-specific T cells derived from naive CD4+ T cells. In some embodiments, expanding comprises (A) contacting the population of cells comprising stimulated T cells with a second population of mature APCs, wherein the second population of mature APCs (i) have been incubated with FLT3L and (ii) present the peptide consisting of the epitope sequence from the protein encoded by the genome of the pathogen associated with the infectious disease; and (B) expanding the population of cells comprising stimulated T cells for a second time period, thereby forming an expanded population of T cells.

[0023] In some embodiments, the second population of mature APCs have been incubated with FLT3L for at least 1 day prior to contacting the population of cells comprising stimulated T cells with the second population of mature APCs. In some embodiments, depleting CD 14+ cells and / or CD25+ cells from the population of immune cells comprising a first population of APCs and T cells comprises contacting the population of immune cells comprising a first population of APCsand T cells with a CD 14 binding agent and / or a CD25 binding agent. In some embodiments, the population of immune cells is from a biological sample from a human subject. In some embodiments, the pathogen does not infect a non-human cell. In some embodiments, the MHC molecule is an MHC class I molecule or an MHC class II molecule. In some embodiments, the MHC molecule is encoded by an HLA allele selected from the group consisting of HLA-A02 allele, HLA- AO 1 allele, HLA-A03 allele, HLA-A24 allele, HLA-A26 allele, HLA-A31 allele, HLA-A68 allele, HLA-A69 allele, HLA-B07 allele, HLA-B08 allele, HLA-B 12 allele, HLA-B35 allele, HLA-B46 allele, HLA-B50 allele, HLA-B51 allele, HLA-C04 allele, HLA-C06 allele, HLA-C07 allele, and HLA-C12 allele. In some embodiments, the MHC molecule is encoded by an HLA-A02 allele. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence has a binding affinity of an IC50 of 500 nM or less for the MHC molecule. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from 8 to 12 amino acids in length. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from 15 to 25 amino acids in length.

[0024] In some embodiments, the infectious disease is selected from the group consisting of malaria, Epstein-Barr Virus (EBV), Human Papillomavirus (HPV), Cytomegalovirus (CMV), CO VID-19, Middle Eastern Respiratory Syndrome (MERS), Measles, Rubella, Chickenpox, Poliomyelitis, Pertussis, Chlamydia, Gonorrhea, Spirochete infections (optionally, Lyme, syphilis, or leptospirosis), Tuberculosis, Toxoplasmosis, Giardia, Chagas Disease, and Helminth infections (optionally, hookworm, ascaris, whipworm, or tapeworm). In some embodiments, the pathogen is selected from the group consisting of Plasmodium falciparum, EBV, HPV, CMV, SARS-CoV-2, SARS-CoV-1, Human Immunodeficiency Virus (HIV), Varicella-zoster Virus (VZV), measles virus (MV), Poliovirus, Rubella Virus, Bordetella pertussis, Chlamydia trachomatis, Neisseria gonorrhoeae, Borrelia burgdorferi, Treponema pallidum, Leptospira, Mycobacterium tuberculosis, Toxoplasma gondii, Giardia duodenalsis, Trypanosoma cruzi, Ankylostoma duodenale , Ascaris lumbricoides, Trichuris, and Taenia. In some embodiments, the infectious disease is malaria. In some embodiments, the pathogen is Plasmodium falciparum. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from a protein encoded by the genome of Plasmodium falciparum. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from TRAP.

[0025] In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is selected from the group consisting of FLIFFDLFLV (SEQ ID NO: 1), NLTDALLQV (SEQ ID NO: 2), and LLMDCSGSI (SEQ ID NO: 3). In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from CSP, LISP1, LSAlb, or LSAP2. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequenceis from LISP1 and is selected from one or more of KIFGCITNK (SEQ ID NO: 75), KQLSLIPSI (SEQ ID NO: 69), and TVGDVLRYV (SEQ ID NO: 71). In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from LSAlb and is SLYDEHIKK (SEQ ID NO: 76). In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is selected from the amino acid sequence set forth in any one of SEQ ID NOs: 60-88. In some embodiments, the different protein(s) are encoded by the genome of Plasmodium falciparum. In some embodiments, the protein or the different protein(s) encoded by the genome of Plasmodium falciparum is selected from one or more of CSP, TRAP, UIS3, UIS4, LSAP2, LSA-l(a), LSA-l(b), LISP-2, and LISP-1.

[0026] Provided herein is a method of identifying an antigen from an infectious disease caused by a pathogen that is recognizable by a T-cell receptor (TCR) from a subject, the method comprising: (a) contacting a population of T cells expressing TCRs with a plurality of antigen- presenting cells (APCs) presenting a candidate antigen from the pathogen, wherein a subset of T cells expressing a subset of TCRs recognizing the antigen are activated; (b) contacting one or more TCRs from the sub set of TCRs with a cell infected by the pathogen, wherein the cell presents an epitope in complex with a major histocompatibility complex (MHC) molecule from an antigen of the pathogen naturally processed within the cell, and wherein the one or more TCRs recognize the epitope; and (c) identifying the candidate antigen as an antigen capable of being recognized by a T-cell receptor (TCR) from a subject.

[0027] In some embodiments, the method further comprises, prior to (b), identifying the one or more TCRs from the subset of T cells expressing the subset of TCRs. In some embodiments, identifying comprises identifying the one or more TCRs by sequencing. In some embodiments, the method further comprises, prior to (b), selectingthe one ormore TCRs. In some embodiments, the method further comprises, prior to (b), expressing the one or more TCRs recombinantly in one or more cells. In some embodiments, one or more cells comprise PMBCs or a cell line, optionally wherein the cell line is a Jurkat cell line. In some embodiments, the one or more TCRs comprise the TCR that is expressed by the subject. In some embodiments, the method further comprises preparing a vaccine, wherein the vaccine comprises a polypeptide comprising the candidate antigen or a polynucleotide encoding the polypeptide comprising the candidate antigen. In some embodiments, the vaccine comprisesa ribonucleic acid (RNA) sequence encodingthe polypeptide comprising the candidate antigen. In some embodiments, the polypeptide comprises two or more polypeptide sequences each from a different protein encoded by the genome of the pathogen associated with the infectious disease. In some embodiments, the polypeptide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polypeptide sequences each from a different protein encoded by the genome of the pathogen associated with the infectious disease. In some embodiments, thepolypeptide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different epitope sequencesfrom two or more different proteins encoded by the genome of a pathogen associated with an infectious disease.

[0028] In some embodiments, the RNA sequence or the mRNA sequence further comprises an RNA sequence encoding (i) an MHC class I trafficking signal (MITD) sequence, (ii) a linker, and / or (iii) a signal peptide. In some embodiments, the pathogen does not infect anon-human cell. In some embodiments, the MHC molecule is an MHC class I molecule or an MHC class II molecule. In some embodiments, the MHC molecule is encoded by an HLA allele selected from the group consisting of HLA-A02 allele, HLA- AO 1 allele, HLA-A03 allele, HLA-A24 allele, HLA-A26 allele, HLA-A31 allele, HLA-A68 allele, HLA-A69 allele, HLA-B07 allele, HLA-B08 allele, HLA-B12 allele, HLA-B35 allele, HLA-B46 allele, HLA-B50 allele, HLA-B51 allele, HLA-C04 allele, HLA-C06 allele, HLA-C07 allele, and HLA-C12 allele. In some embodiments, the MHC molecule is encoded by an HLA-A02 allele. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence has a binding affinity of an IC50 of 500 nM or less for the MHC molecule. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from 8 to 12 amino acids in length. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from 15 to 25 amino acids in length. In some embodiments, the infectious diseaseis selected from the group consisting of malaria, Epstein-Barr Virus (EBV), Human Papillomavirus (HPV), Cytomegalovirus (CMV), CO VID-19, Middle Eastern Respiratory Syndrome (MERS), Measles, Rubella, Chickenpox, Poliomyelitis, Pertussis, Chlamydia, Gonorrhea, Spirochete infections (optionally, Lyme, syphilis, or leptospirosis), Tuberculosis, Toxoplasmosis, Giardia, Chagas Disease, and Helminth infections (optionally, hookworm, ascaris, whipworm, or tapeworm). In some embodiments, the pathogen is selected from the group consisting of Plasmodium falciparum, EBV, HPV, CMV, SARS-CoV-2, SARS-CoV-1, Human Immunodeficiency Virus (HIV), Varicella-zoster Virus (VZV), measles virus (MV), Poliovirus, Rubella Virus, Bordetella pertussis, Chlamydia trachomatis, Neisseria gonorrhoeae, Borrelia burgdorferi, Treponema pallidum, Leptospira, Mycobacterium tuberculosis, Toxoplasma gondii, Giardia duodenalsis, Trypanosoma cruzi, Ankylostoma duodenale , Ascaris lumbricoides, Trichuris, and Taenia. In some embodiments, the infectious disease is malaria. In some embodiments, the pathogen is Plasmodium falciparum. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from a protein encoded by the genome of Plasmodium falciparum.

[0029] In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from TRAP. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is selected from the group consisting of FLIFFDLFLV (SEQ ID NO:1), NLTDALLQV (SEQ ID NO: 2), and LLMDCSGSI (SEQ ID NO: 3). In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from CSP, LISP1, LSAlb, orLSAP2. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from LISP1 and is selected from one or more of KIFGCITNK (SEQ ID NO: 75), KQLSLIPSI (SEQ ID NO: 69), and TVGDVLRYV (SEQ ID NO: 71). In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from LSAlb and is SLYDEHIKK (SEQ ID NO: 76). In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is selected from the amino acid sequence set forth in any one of SEQ ID NOs: 60-88. In some embodiments, the different protein(s) are encodedby the genome of Plasmodium falciparum. In some embodiments, the protein or the different protein(s) encoded by the genome of Plasmodium falciparum is selected from one or more of CSP, TRAP, UIS3, UIS4, LSAP2, LSA-l(a), LSA-l(b), LISP-2, and LISP-1.

[0030] Presented herein is a method of identifying an antigen from an infectious disease caused by a pathogen that is recognizable by a T-cell receptor (TCR) from a subject, the method comprising: (a) identifying in an in vitro assay one or more TCRs that recognize a candidate antigen from the pathogen; (b) contacting the one or more TCRs with a cell infected by the pathogen, wherein the cell presents an epitope in complex with a major histocompatibility complex (MHC) molecule from an antigen of the pathogen naturally processed within the cell, and wherein the one or more TCRs recognize the epitope; and (c) identifyingthe candidate antigen as an antigen capable of being recognized by a T-cell receptor (TCR) from a subject.

[0031] In some embodiments, identifying comprises identifying the one or more TCRs by sequencing. In some embodiments, the method further comprises, prior to (b), selecting the one or more TCRs. In some embodiments, the method further comprises, prior to (b), expressing the one or more TCRs recombinantly in one or more cells. In some embodiments, one or more cells comprise PMBCs or a cell line, optionally wherein the cell line is a Jurkat cell line. In some embodiments, the one or more TCRs comprise the TCR that is expressed by the subject. In some embodiments, the method further comprises preparing a vaccine, wherein the vaccine comprises a polypeptide comprising the candidate antigen or a polynucleotide encoding the polypeptide comprisingthe candidate antigen. In some embodiments, the vaccine comprises a ribonucleic acid (RNA) sequence encoding the polypeptide comprising the candidate antigen. In some embodiments, the polypeptide comprisestwo or more polypeptide sequences each from a different protein encoded by the genome of the pathogen associated with the infectious disease. In some embodiments, the polypeptide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polypeptide sequences each from a different protein encoded by the genome of the pathogen associated with the infectious disease. In some embodiments, the polypeptide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10 or more differentepitope sequences from two or more different proteins encoded by the genome of a pathogen associated with an infectious disease.

[0032] In some embodiments, the RNA sequence further comprises an RNA sequence encoding (i) an MHC class I trafficking signal (MITD) sequence, (ii) a linker, and / or (iii) a signal peptide. In some embodiments, the pathogen does not infect a non-human cell. In some embodiments, the MHC molecule is an MHC class I molecule or an MHC class II molecule. In some embodiments, the MHC molecule is encoded by an HLA allele selected from the group consisting of HLA-A02 allele, HLA- AO 1 allele, HLA-A03 allele, HLA-A24 allele, HLA-A26 allele, HLA-A31 allele, HLA-A68 allele, HLA-A69 allele, HLA-B07 allele, HLA-B08 allele, HLA-B 12 allele, HLA-B35 allele, HLA-B46 allele, HLA-B50 allele, HLA-B51 allele, HLA-C04 allele, HLA-C06 allele, HLA-C07 allele, and HLA-C12 allele. In some embodiments, the MHC molecule is encoded by an HLA-A02 allele. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence has a binding affinity of an IC50 of 500 nM or less for the MHC molecule.

[0033] In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from 8 to 12 amino acids in length. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from 15 to 25 amino acids in length. In some embodiments, the infectious disease is selected from the group consisting of malaria, Epstein-Barr Virus (EBV), Human Papillomavirus (HPV), Cytomegalovirus (CMV), COVID-19, Middle Eastern Respiratory Syndrome (MERS), Measles, Rubella, Chickenpox, Poliomyelitis, Pertussis, Chlamydia, Gonorrhea, Spirochete infections (optionally, Lyme, syphilis, or leptospirosis), Tuberculosis, Toxoplasmosis, Giardia, Chagas Disease, and Helminth infections (optionally, hookworm, ascaris, whipworm, or tapeworm). In some embodiments, the pathogen is selected from the group consisting of Plasmodium falciparum, EBV, HPV, CMV, SARS-CoV-2, SARS- CoV-1, Human Immunodeficiency Virus (HIV), Varicella-zoster Virus (VZV), measles virus (MV), Poliovirus, Rubella Virus, Bordetella pertussis, Chlamydia trachomatis, Neisseria gonorrhoeae, Borrelia burgdorferi, Treponema pallidum, Leptospira, Mycobacterium tuberculosis, Toxoplasma gondii, Giardia duodenalsis, Trypanosoma cruzi, Ankylostoma duodenale, Ascaris lumbricoides, Trichuris, and Taenia. In some embodiments, the infectious disease is malaria. In some embodiments, the pathogen is Plasmodium falciparum . In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from a protein encoded by the genome of Plasmodium falciparum. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from TRAP. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is selected from the group consisting of FLIFFDLFLV (SEQ ID NO: 1), NLTDALLQV (SEQ ID NO: 2), andLLMDCSGSI (SEQ ID NO: 3). In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from CSP, LISP1, LSAlb, or LSAP2. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from LISP1 and is selected from one or more of KIFGCITNK (SEQ ID NO: 75), KQLSLIPSI (SEQ ID NO: 69), and TVGDVLRYV (SEQ ID NO: 71). In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from LSAlb and is SLYDEHIKK (SEQ ID NO: 76). In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is selected from the amino acid sequence set forth in any one of SEQ ID NOs: 60-88. In some embodiments, the different protein(s) are encoded by the genome of Plasmodium falciparum. In some embodiments, the protein or the different protein(s) encoded by the genome of Plasmodium falciparum is selected from one or more of CSP, TRAP, UIS3, UIS4, LSAP2, LSA-l(a), LSA- 1(b), LISP-2, and LISP-1.

[0034] Presented herein is a method of identifying a T-cell receptor (TCR) that recognizes an antigen from an infectious disease caused by a pathogen in complex with a major histocompatibility complex (MHC) molecule, the method comprising: (a) contacting a population of T cells expressing candidate TCRs with a plurality of antigen-presenting cells (APCs) presenting antigens from the infectious disease, wherein a subset of T cells expressing a subset of candidate TCRs recognizing the antigens are activated; (b) identifying one or more TCRs from the sub set of T cells expressingthe subset of candidate TCRs; (c) contactingthe one ormore TCRs with a cell infected by the pathogen, wherein at least one TCR of the one or more TCRs recognizing an antigen presented by an MHC molecule of the cell is activated; and (d) selecting the at least one TCR recognizing the antigen presented by the MHC molecule of the cell, thereby identifying the TCR.

[0035] In some embodiments, the cell infected by the pathogen is a cell that is infected naturally by the pathogen. In some embodiments, the antigen comprises an epitope that is naturally processed by the cell. In some embodiments, the antigens in (a) comprises a sequence of the antigen presented by the MHC molecule of the cell. In some embodiments, the pathogen infects a human subject but lacks ability to infect a non-human subject. In some embodiments, the method further comprises, prior to (b), expandingthe subset of T cells expressingthe subset of candidate TCRs recognizing the antigens. In some embodiments, the method further comprises, prior to (b), sequencingthe subsetof T cells expressingthe subsetof candidate TCRs recognizingthe antigens. In some embodiments, identifying in (b) comprises identifying the one or more TCRs from the sequencing. In some embodiments, contactingin (c) comprises contacting cells expressingthe one or more TCRs with the cell infected by the pathogen.

[0036] In some embodiments, the subset of T cells activated or the at least one TCR activated (i) expresses an activation marker selectedfrom the group consisting of CD69, CD25, CD40L, CD38, OX-40, 4-1BB, CD27, and ICOS and / or (ii) secretes a cytokine or chemokine selected from the group consisting of IL-2, IFN-y, TNF-a, IL-6, IL-12, IL-17A, IL-17B, IL-17C, IL-17D, IL-17E, and IL-17F. In some embodiments, the pathogen does not infect a non-human cell. In some embodiments, the MHC molecule is an MHC class I molecule or an MHC class II molecule. In some embodiments, the MHC molecule is encoded by an HLA allele selected from the group consisting of HLA-A02 allele, HLA- AO 1 allele, HLA-A03 allele, HLA-A24 allele, HLA-A26 allele, HLA-A31 allele, HLA-A68 allele, HLA-A69 allele, HLA-B07 allele, HLA-B08 allele, HLA-B12 allele, HLA-B35 allele, HLA-B46 allele, HLA-B50 allele, HL A-B 51 allele, HLA-C04 allele, HLA-C06 allele, HLA-C07 allele, and HLA-C12 allele. In some embodiments, the MHC molecule is encoded by an HLA-A02 allele.

[0037] In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence has a binding affinity of an IC50 of 500 nM or less for the MHC molecule. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from 8 to 12 amino acids in length. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from 15 to 25 amino acids in length. In some embodiments, the infectious disease is selected from the group consisting of malaria, Epstein-Barr Virus (EBV), Human Papillomavirus (HPV), Cytomegalovirus (CMV), CO VID- 19, Middle Eastern Respiratory Syndrome (MERS), Measles, Rubella, Chickenpox, Poliomyelitis, Pertussis, Chlamydia, Gonorrhea, Spirochete infections (optionally, Lyme, syphilis, or leptospirosis), Tuberculosis, Toxoplasmosis, Giardia, Chagas Disease, and Helminth infections (optionally, hookworm, ascaris, whipworm, or tapeworm). In some embodiments, the pathogen is selectedfrom the group consisting of Plasmodium falciparum, EBV, HPV, CMV, SARS-CoV-2, SARS-CoV-1, Human Immunodeficiency Virus (HIV), Varicella-zoster Virus (VZV), measles virus (MV), Poliovirus, Rubella Virus, Bordetella pertussis, Chlamydia trachomatis, Neisseria gonorrhoeae , Borrelia burgdorferi, Treponema pallidum, Leptospira, Mycobacterium tuberculosis, Toxoplasma gondii, Giardia duodenalsis, Trypanosoma cruzi, Anky lo stoma duodenale , Ascaris lumbricoides, Trichuris, and Taenia. In some embodiments, the infectious disease is malaria. In some embodiments, the pathogen is Plasmodium falciparum. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from a protein encoded by the genome of Plasmodium falciparum. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from TRAP. In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is selected from the group consisting of FLIFFDLFLV (SEQ ID NO: 1), NLTDALLQV (SEQ ID NO: 2), and LLMDCSGSI (SEQ IDNO: 3). In some embodiments, the epitope(s), the epitope sequence(s), orthe candidate epitope sequence is from CSP, LISP1, LSAlb, or LSAP2. In some embodiments, the epitope(s), the epitope sequence(s), orthe candidate epitope sequence is from LISP1 and is selected from one or more of KIFGCITNK (SEQ ID NO: 75), KQLSLIPSI (SEQ ID NO: 69), and TVGDVLRYV (SEQ ID NO: 71). In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from LSAlb and is SLYDEHIKK (SEQ ID NO: 76). In some embodiments, the epitope(s), the epitope sequence(s), or the candidate epitope sequence is selected from the amino acid sequence set forth in any one of SEQ ID NOs: 60-88. In some embodiments, the different protein(s) are encoded by the genome of Plasmodium falciparum. In some embodiments, the protein or the different protein(s) encoded by the genome of Plasmodium falciparum is selected from one or more of CSP, TRAP, UIS3, UIS4, LSAP2, LSA-l(a), LSA-1 (b), LISP-2, and LISP-1.

[0038] Provided herein is a recombinant nucleic acid encoding a T-cell receptor (TCR) comprising a TCR beta chain construct and a TCR alpha chain construct, wherein the TCR beta chain construct comprises a complementarity determining region 3 (CDR3) having an amino acid sequence CASSQGKGNTIYF (SEQ ID NO: 10). In some embodiments, the TCR beta chain construct comprises a variable region having an amino acid sequence with at least 80% sequence identity to an amino acid sequence as set forth in SEQ ID NO: 13. In some embodiments, the TCR beta chain construct comprises a complementarity determining region 1 (CDR1) having an amino acid sequence set forth in SEQ ID NO: 8 and a complementarity determining region 2 (CDR2) having an amino acid sequence set forth in SEQ ID NO: 9. In some embodiments, the TCR alpha chain construct comprises a CDR1, a CDR2, and a CDR3, wherein the CDR1 has an amino acid sequence set forth in SEQ ID NO: 5, the CDR2 has an amino acid sequence set forth in SEQ ID NO: 6, and the CDR3 has an amino acid sequence CAVGTPSNSNSGYALNF (SEQ ID NO: 7). In some embodiments, the TCR alpha chain construct comprises a variable region having an amino acid sequence having at least 80% sequence identity to an amino acid sequence set forth in SEQ ID NO: 11. In some embodiments, the TCR comprises: (a) a beta chain having an amino acid sequence set forth in SEQ ID NO: 14, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 14, and (b) an alpha chain having an amino acid sequence set forth in SEQ ID NO: 12, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 12. In some embodiments, the TCR is a soluble TCR or a membrane-bound TCR. In some embodiments, the soluble TCR does not comprise a transmembrane domain. In some embodiments, the soluble TCR does not comprise a constant domain. In some embodiments, the soluble TCR consists of a beta chain variable region and an alpha chain variable region.

[0039] Provided herein is a recombinant nucleic acid encoding a T cell receptor (TCR) comprising a TCR beta chain construct and a TCR alpha chain construct, wherein the TCR beta chain construct comprises a complementarity determining region 3 (CDR3) having an amino acid sequence CASSYAPTGLTEAFF (SEQ ID NO: 20). In some embodiments, the TCRbeta chain construct comprises a variable region having an amino acid sequence with at least 80% sequence identity to an amino acid sequence as setforthin SEQ ID NO: 23. In some embodiments, the TCR beta chain construct comprises a complementarity determining region 1 (CDR1) having an amino acid sequence set forth in SEQ ID NO: 18 and a complementarity determining region 2 (CDR2) having an amino acid sequence set forth in SEQ ID NO: 19. In some embodiments, the TCR alpha chain construct comprises a CDR1, a CDR2, and a CDR3, wherein the CDR1 has an amino acid sequence set forth in SEQ ID NO: 15, the CDR2 has an amino acid sequence set forth in SEQ ID NO: 16, andthe CDR3 has an amino acid sequence CAGLNNARLMF (SEQ ID NO: 17). In some embodiments, the TCR alpha chain construct comprises a variable region having an amino acid sequence having at least 80% sequence identity to an amino acid sequence set forth in SEQ ID NO: 21. In some embodiments, the TCR comprises: (a) a beta chain having an amino acid sequence set forth in SEQ ID NO: 24, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 24, and (b) an alpha chain having an amino acid sequence set forth in SEQ ID NO: 22, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 22. In some embodiments, the TCR is a soluble TCR or a membrane-bound TCR. In some embodiments, the soluble TCR does not comprise a transmembrane domain. In some embodiments, the soluble TCR does not comprise a constant domain. In some embodiments, the soluble TCR consists of a beta chain variable region and an alpha chain variable region.

[0040] Provided herein is a recombinant nucleic acid encoding a T cell receptor (TCR) comprising a TCR beta chain construct and a TCR alpha chain construct, wherein the TCR beta chain construct comprises a complementarity determining region 3 (CDR3) having an amino acid sequence CASSPPFSGEQFF (SEQ ID NO: 30). In some embodiments, the TCR beta chain construct comprises a variable region having an amino acid sequence with at least 80% sequence identity to an amino acid sequence as set forth in SEQ ID NO: 33. In some embodiments, the TCR beta chain construct comprises a complementarity determining region 1 (CDR1 ) having an amino acid sequence set forth in SEQ ID NO: 28 and a complementarity determining region 2 (CDR2) havingan amino acid sequence setforthin SEQ ID NO: 29. In some embodiments, the TCR alpha chain construct comprises a CDR1, a CDR2, and a CDR3, wherein the CDR1 has an amino acid sequence set forth in SEQ ID NO: 25, the CDR2 has an amino acid sequence set forth in SEQ ID NO: 26, and the CDR3 has an amino acid sequence CAIRSGGGADGLTF (SEQ ID NO: 27). In some embodiments, the TCR alpha chain construct comprises a variable region having an aminoacid sequence having at least 80% sequence identity to an amino acid sequence set forth in SEQ ID NO: 31. In some embodiments, the TCR comprises: (a) a beta chain having an amino acid sequence set forth in SEQ ID NO: 34, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 34, and (b) an alpha chain having an amino acid sequence set forth in SEQ ID NO: 32, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 32. In some embodiments, the TCR is a soluble TCR or a membrane-bound TCR. In some embodiments, the soluble TCR does not comprise a transmembrane domain. In some embodiments, the soluble TCR does not comprise a constant domain. In some embodiments, the soluble TCR consists of a beta chain variable region and an alpha chain variable region.

[0041] Provided herein is a recombinant nucleic acid encoding a T cell receptor (TCR) comprising a TCR beta chain construct and a TCR alpha chain construct, wherein the TCR beta chain construct comprises a complementarity determining region 3 (CDR3) having an amino acid sequence CASSLPFGNTIYF (SEQ ID NO: 40). In some embodiments, the TCR beta chain construct comprises a variable region having an amino acid sequence with at least 80% sequence identity to an amino acid sequence as set forth in SEQ ID NO: 43. In some embodiments, the TCR beta chain construct comprises a complementarity determining region 1 (CDR1) having an amino acid sequence set forth in SEQ ID NO: 28 and a complementarity determining region 2 (CDR2) havingan amino acid sequence setforthin SEQ ID NO: 29. In some embodiments, the TCR alpha chain construct comprises a CDR1, a CDR2, and a CDR3, wherein the CDR1 has an amino acid sequence set forth in SEQ ID NO: 35, the CDR2 has an amino acid sequence set forth in SEQ ID NO: 36, and the CDR3 has an amino acid sequence CALTGGGADGLTF (SEQ ID NO: 37). In some embodiments, the TCR alpha chain construct comprises a variable region having an amino acid sequence having at least 80% sequence identity to an amino acid sequence set forth in SEQ ID NO: 41. In some embodiments, the TCR comprises: (a) a beta chain having an amino acid sequence set forth in SEQ ID NO: 44, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 44, and (b) an alpha chain having an amino acid sequence set forth in SEQ ID NO: 42, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 42. In some embodiments, the TCR alpha chain construct comprises a CDR1, a CDR2, and a CDR3, wherein the CDR1 has an amino acid sequence set forth in SEQ ID NO: 45, the CDR2 has an amino acid sequence set forth in SEQ ID NO: 46, and the CDR3 has an amino acid sequence CALTGRGYCGSARQLTF (SEQ ID NO: 47). In some embodiments, the TCR alpha chain construct comprises a variable region having an amino acid sequence having at least 80% sequence identity to an amino acid sequence set forth in SEQ ID NO: 48. In some embodiments, the TCR comprises: (a) a beta chain having an amino acid sequence setforthin SEQ ID NO: 44, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 44, and (b) an alpha chainhaving an amino acid sequence set forth in SEQ ID NO: 49, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 49. In some embodiments, the TCR is a soluble TCR or a membrane-bound TCR. In some embodiments, the soluble TCR does not comprise a transmembrane domain. In some embodiments, the soluble TCR does not comprise a constant domain. In some embodiments, the soluble TCR consists of a beta chain variable region and an alpha chain variable region.

[0042] Provided herein is a recombinant nucleic acid encoding a T cell receptor (TCR) comprising a TCR beta chain construct and a TCR alpha chain construct, wherein the TCR beta chain construct comprises a complementarity determining region 3 (CDR3) having an amino acid sequence CASSPGTGAGNTIYF (SEQ ID NO: 55). In some embodiments, the TCRbeta chain construct comprises a variable region having an amino acid sequence with at least 80% sequence identity to an amino acid sequence as set forth in SEQ ID NO: 58. In some embodiments, the TCR beta chain construct comprises a complementarity determining region 1 (CDR1) having an amino acid sequence set forth in SEQ ID NO: 53 and a complementarity determining region 2 (CDR2) havingan amino acid sequence setforthin SEQ ID NO: 54. In some embodiments, the TCR alpha chain construct comprises a CDR1, a CDR2, and a CDR3, wherein the CDR1 has an amino acid sequence set forth in SEQ ID NO: 50, the CDR2 has an amino acid sequence set forth in SEQ ID NO: 51 , and the CDR3 has an amino acid sequence CAPYRYSGAGSYQLTF (SEQ ID NO: 52). In some embodiments, the TCR alpha chain construct comprises a variable region havingan amino acid sequence having at least 80% sequence identity to an amino acid sequence set forth in SEQ ID NO: 56. In some embodiments, the TCR comprises: (a) a beta chain having an amino acid sequence set forth in SEQ ID NO: 59, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 59, and (b) an alpha chain having an amino acid sequence set forth in SEQ ID NO: 57, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 57. In some embodiments, the TCR is a soluble TCR or a membrane-bound TCR. In some embodiments, the soluble TCR does not comprise a transmembrane domain. In some embodiments, the soluble TCR does not comprise a constant domain. In some embodiments, the soluble TCR consists of a beta chain variable region and an alpha chain variable region.

[0043] Provided herein is a recombinant nucleic acid encoding a T cell receptor (TCR) comprising a TCR beta chain construct and a TCR alpha chain construct, wherein the TCR beta chain construct comprises a complementarity determining region 3 (CDR3) having an amino acid sequence CASSVQAANSPLHF (SEQ ID NO: 993). In some embodiments, the TCRbeta chain construct comprises a variable region having an amino acid sequence with at least 80% sequence identity to an amino acid sequence as set forth in SEQ ID NO: 996. In some embodiments, the TCR beta chain construct comprises a complementarity determining region 1 (CDR1) having anamino acid sequence set forth in SEQ ID NO: 991 and a complementarity determining region 2 (CDR2) having an amino acid sequence set forth in SEQ ID NO: 992. In some embodiments, the TCR alpha chain construct comprises a CDR1, a CDR2, and a CDR3, wherein the CDR1 has an amino acid sequence set forth in SEQ ID NO: 988, the CDR2 has an amino acid sequence set forth in SEQ ID NO: 989, and the CDR3 has an amino acid sequence CAMREGPLMDSSYKLIF (SEQ ID NO: 990). In some embodiments, the TCR alpha chain construct comprises a variable region having an amino acid sequence having at least 80% sequence identity to an amino acid sequence set forth in SEQ ID NO: 994. In some embodiments, the TCR comprises: (a) a beta chain having an amino acid sequence set forth in SEQ ID NO: 997, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 997, and (b) an alpha chain having an amino acid sequence set forth in SEQ ID NO: 995, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 995. In some embodiments, the TCR is a soluble TCR or a membrane-bound TCR. In some embodiments, the soluble TCR does not comprise a transmembrane domain. In some embodiments, the soluble TCR does not comprise a constant domain. In some embodiments, the soluble TCR consists of a beta chain variable region and an alpha chain variable region.

[0044] Provided herein is a recombinant nucleic acid encoding a T cell receptor (TCR) comprising a TCR beta chain construct and a TCR alpha chain construct, wherein the TCR beta chain construct comprises a complementarity determining region 3 (CDR3) having an amino acid sequence CAISSMEDEKLFF (SEQ ID NO: 1001). In some embodiments, the TCR beta chain construct comprises a variable region having an amino acid sequence with at least 80% sequence identity to an amino acid sequence as set forth in SEQ ID NO: 1004. In some embodiments, the TCR beta chain construct comprises a complementarity determining region 1 (CDR1) having an amino acid sequence set forth in SEQ ID NO: 999 and a complementarity determining region 2 (CDR2) having an amino acid sequence set forth in SEQ ID NO: 1000. In some embodiments, the TCR alpha chain construct comprises a CDR1, a CDR2, and a CDR3, wherein the CDR1 has an amino acid sequence set forth in SEQ ID NO: 50, the CDR2 has an amino acid sequence set forth in SEQ ID NO: 51, and the CDR3 has an amino acid sequence CAV AL YNNNDMRF (SEQ ID NO: 998). In some embodiments, the TCR alpha chain construct comprises a variable region having an amino acid sequence having at least 80% sequence identity to an amino acid sequence setforth in SEQ ID NO: 1002. In some embodiments, the TCR comprises (a) a beta chain having an amino acid sequence set forth in SEQ ID NO: 1005, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 1005, and (b) an alpha chain having an amino acid sequence set forth in SEQ ID NO: 1003, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 1003. In some embodiments, the TCR is a soluble TCR or a membrane-bound TCR. In some embodiments, the soluble TCR does not comprise a transmembrane domain. In someembodiments, the soluble TCR does not comprise a constant domain. In some embodiments, the soluble TCR consists of a beta chain variable region and an alpha chain variable region.

[0045] Provided herein is a recombinant nucleic acid encoding a T cell receptor (TCR) comprising a TCR beta chain construct and a TCR alpha chain construct, wherein the TCR beta chain construct comprises a complementarity determining region 3 (CDR3) having an amino acid sequence CATRESSNQPQHF (SEQ ID NO: 1009). In some embodiments, the TCR beta chain construct comprises a variable region having an amino acid sequence with at least 80% sequence identity to an amino acid sequence as set forth in SEQ ID NO: 1012. In some embodiments, the TCR beta chain construct comprises a complementarity determining region 1 (CDR1) having an amino acid sequence set forth in SEQ ID NO: 1007 and a complementarity determining region 2 (CDR2) having an amino acid sequence set forth in SEQ ID NO: 1008. In some embodiments, the TCR alpha chain construct comprises a CDR1, a CDR2, and a CDR3, wherein the CDR1 has an amino acid sequence set forth in SEQ ID NO: 50, the CDR2 has an amino acid sequence set forth in SEQ ID NO : 51 , and the CDR3 has an amino acid sequence C AVRSNNNDMRF (SEQ ID NO : 1006). In some embodiments, the TCR alpha chain construct comprises a variable region having an amino acid sequence having at least 80% sequence identity to an amino acid sequence set forth in SEQ ID NO: 1010. In some embodiments, the TCR comprises (a) a beta chain having an amino acid sequence set forth in SEQ ID NO: 1013, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 1013, and (b) an alpha chain having an amino acid sequence set forth in SEQ ID NO: 1011, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 1011. In some embodiments, the soluble TCR does not comprise a constant domain. In some embodiments, the soluble TCR consists of abeta chain variable region and an alpha chain variable region.

[0046] Provided herein is a kit comprising (i) any therapeutic polypeptide described herein or a polynucleotide encoding any therapeutic polypeptide described herein, (ii) any epitope sequence(s) described herein, (iii) any candidate epitope sequence described herein (iv) any candidate antigen described herein, or (v) any antigen described herein.

[0047] Provided herein is a kit comprising (i) the TCR specific to a peptide:MHC complex described herein, (2) any TCRthatbinds to an MHC multimer in complex with a candidate epitope sequence described herein, (iii) one or more TCRs described herein, or (iv) any TCR(s) described herein.

[0048] Provided herein is a T-cell receptor (TCR) identified by any method described herein. In some embodiments, the TCRis a soluble TCR or a membrane-bound TCR. In some embodiments, the soluble TCR does not comprise a transmembrane domain. In some embodiments, the solubleTCR does not comprise a constant domain. In some embodiments, the soluble TCR consists of a beta chain variable region and an alpha chain variable region.

[0049] Provided herein is a use of any TCR described herein in the manufacture of a medicament.

[0050] Provided herein is a use of any TCR described herein for the treatment or prevention of an infectious disease.

[0051] Provided herein is a use of any TCR described herein for determining whether an infectious disease therapy or vaccine comprising a therapeutic polypeptide or a polynucleotide encoding the therapeutic polypeptide is capable of inducing T cell specific immune response in a subject.

[0052] Provided herein is a use of any TCR described herein for determining whether an epitope sequence from a protein encoded by a genome of a pathogen associated with an infectious disease is presented by an MHC molecule expressed by a cell infected by the pathogen. In some embodiments, the use comprises determining whetherthe TCRbinds to (i) peptide:MHC complex, (ii) the cell infected by the pathogen, or (iii) the APC. In some embodiments, determining comprises detecting the peptide:MHC complex, the cell infected by the pathogen, or the APC to which the TCR is bound. In some embodiments, the TCR is conjugated to a detection marker. In some embodiments, detecting comprises staining.

[0053] Provided herein is a use of any TCR described herein for determining whether a polypeptide sequence from a protein encoded by the genome of a pathogen associated with an infectious disease contains an epitope sequence that is presented by an MHC molecule expressed by an antigen-presenting cell (APC). In some embodiments, the use comprises determining whetherthe TCRbinds to (i) peptide:MHC complex, (ii) the cell infectedby the pathogen, or (iii) the APC. In some embodiments, determining comprises detecting the peptide:MHC complex, the cell infected by the pathogen, or the APC to which the TCR is bound. In some embodiments, the TCR is conjugated to a detection marker. In some embodiments, detecting comprises staining.

[0054] Provided herein is a use of any TCR described herein for identifying an antigen from an infectious disease caused by a pathogen that is recognizable by the TCR.INCORPORATION BY REFERENCE

[0055] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.BRIEF DESCRIPTION OF THE DRAWINGS

[0056] The novel features of the present disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will beobtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings (also “Figure” and “FIG.” herein), of which:

[0057] FIG. 1A depicts the structures of two mRNA constructs, Construct 1 (upper) and Construct 2 (lower) that can be used to elicit anti-malaria immune responses.

[0058] FIG. IB depicts results from an ELISPOT assay detecting IFN-y production by splenocytes from mice immunized with 2.5 pg each of Construct 1 and Construct 2 following incubation with antigenic peptides shown along the X-axis.

[0059] FIG. 1C depicts the NEO-STIM process to generate malaria-specific enriched populations of T cells using peripheral blood mononuclear cells (PBMCs) from healthy donors. “Pf” refers to Plasmodium falciparum.

[0060] FIG. 2 is a schematic depicting the experimental procedures used to identify specific T cell receptor (TCR) clones that are predicted to recognize particular cognate epitopes derived from the malaria antigen thrombospondin-related adhesion protein (TRAP).

[0061] FIGs. 3A-3E depict representative flow cytometry results from the multimer analysis to identify TRAP-specific T cells. Cells were gated on CD8 positive cells. Cells were stained with fluorescently tagged A02 HLA class I multimers bearing TRAP epitopes as indicated by the sequences in the top left corners of the flow cytometry plots. Multimer A and B bear the same epitope according to the sequence indicated in the top left corners of plots, but are tagged with different fluorophores to ensure any positive populations are not a result of background fluorescence. FIGs. 3A-3B depict results obtained from cells enriched using the peptide-based NEO-STIM process. FIG. 3A depicts results using multimers bearing epitope LLMDCSGSI (SEQ ID NO: 3). FIG. 3B depicts results using multimers bearing epitope FLIFFDLFLV (SEQ ID NO: 1). FIGs. 3C-3E depict results obtained from cells enriched using the RNA-based NEO-STIM process. FIG. 3C depicts results using multimers bearing epitope LPYGKTNL (SEQ ID NO: 1019). FIG. 3D depicts results using multimers bearing epitope NLTDALLQV (SEQ ID NO: 2). FIG. 3E depicts results using multimers bearing epitope FLIFFDLFLV (SEQ ID NO: 1)

[0062] FIG. 4 is a schematic depicting the experimental outline and number of cells obtained through the multimer enrichment and sorting procedures for isolating multimer-positive cells to be used for TCR sequencing.

[0063] FIGs. 5A-5B depict results from single cell TCR sequencing performed on multimer- positive T cells (and multimer-negative T cells for a negative control). At left, the named TCRs identified are listed and the epitopes they are predicted to recognize. Pie charts depict the frequency of the identified clone among all T cells sorted from the multimer enrichment processusing multimers bearing the identified epitope. At right, the amino acid sequences for the CDR3 region of the TCRs are given. FIG. 5A depicts results for TCR1 and TCR2. FIG. 5B depicts results for TCR3, TCR4, TCR5, and TCR6.

[0064] FIG. 6 depicts the experimental procedure used to transduce TCRB KO Jurkat T cells or human PBMCs using retroviral vectors to generate cells expressing the identified TCRs.

[0065] FIG. 7A depicts the construct delivered to a packaging cell line (HEK298 VecGalV) to generate retroviral vectors bearing sequences encoding one of the identified TCRs. Construct comprises, from 5’ to 3 ’, a MP71 promoter sequence, a Kozak translation start sequence, a beta chain sequence derived from an identified TCR clone, mouse TCRB constant region sequence, a F2A sequence, an alpha chain sequence derived from an identified TCR clone (corresponding pair to the beta chain sequence), a mouse TCRA constant region sequence, and a stop sequence.

[0066] FIGs. 7B-7C depict representative flow cytometry results measuring transduction efficiency in TCRB KO Jurkat T cells (FIG. 7B) or healthy donor PBMCs (FIG. 7C). Cells were initially gated on CD3+ and then gated on mouse TCR expression, identifying the population of T cells expressing the constructs bearing the identified TCR clones.

[0067] FIGs. 8A-8B depict the experimental outline for a recognition assay testing the ability of the transduced Jurkat T cells to recognize A375 target cells which have been incubated with either relevant or irrelevant peptides at a concentration of 1 OOnM for 1 hour. Different effector- to-target ratios were tested during an overnight (O / N) incubation, as indicated in the right panel (FIG. 8A). Then cells were assessed for CD69 expression and IL-2 was measured in the culture supernatant (FIG. 8B).

[0068] FIGs. 9A-9G depict results of CD69 expression by the Jurkat T cells transduced with each of TCRs 1-6 that are predicted to bind their respective cognate epitopes from TRAP. CD69 expression was measured using flow cytometry following incubation with A375 target cells pulsed with their respective predicted cognate epitope (relevant), a different epitope within TRAP (irrelevant) or no peptide. FIG. 9A depicts results of CD69 expression by the Jurkat T cells transduced with TCR 1. FIG. 9B depicts results of CD69 expression by the Jurkat T cells transduced with TCR 2. FIG. 9C depicts results of CD69 expression by the Jurkat T cells transduced with TCR 3. FIG. 9D depicts results of CD69 expression by the Jurkat T cells transduced with TCR 4. FIG. 9E depicts results of CD69 expression by the Jurkat T cells transduced with TCR 5. FIG. 9F depicts results of CD69 expression by the Jurkat T cells transduced with TCR 6. Within each effector-to-target ratio tested, the left set of data points are results obtained when target cells were incubated with relevant peptides, the middle set of data points are results obtained when target cells were incubated with irrelevant peptides, and the right set of data points are results obtained when target cells were not incubated with anypeptides. No TCR (FIG. 9G) refers to results obtained using TCRB KO Jurkat T cells that are not transduced with a TCR.

[0069] FIGs. 10A-10G depict results of IL-2 levels in the culture supernatant of the Jurkat T cells transduced with each of TCRs 1-6 following incubation with A375 target cells that were pulsed with respective cognate epitopes from TRAP. IL-2 was measured using a high-sensitivity kit manufactured by Meso Scale Discovery following incubation with A375 target cells pulsed with their respective predicted cognate epitope (relevant), a different epitope within TRAP (irrelevant) or no peptide. Within each effector-to-target ratio tested, the left set of data points are results obtained when target cells were incubated with relevant peptides, the middle set of data points are results obtained when target cells were incubated with irrelevant peptides, and the right set of data points are results obtained when target cells were not incubated with any peptides. FIG. 10A depicts results of IL-2 levels in the culture supernatant of the Jurkat T cells transduced with TCR 1 . FIG. 10B depicts results of IL-2 levels in the culture supernatant of the Jurkat T cells transduced with TCR 2. FIG. 10C depicts results of IL-2 levels in the culture supernatant of the Jurkat T cells transduced with TCR 3. FIG. 10D depicts results of IL-2 levels in the culture supernatant of the Jurkat T cells transduced with TCR 4. FIG. 10E depicts results of IL-2 levels in the culture supernatant of the Jurkat T cells transduced with TCR 5. FIG. 10F depicts results of IL-2 levels in the culture supernatant of the Jurkat T cells transduced with TCR 6. FIG. 10G depicts results of IL-2 levels obtained using TCRB KO Jurkat T cells that are not transduced with a TCR.

[0070] FIG. 11 depicts the experimental outline for a recognition assay testingthe ability of the transduced Jurkat T cells to recognize A375 target cells which have been incubated with either relevant or irrelevant peptides at various concentrations for 1 hour. An effector-to-target ratio of 5 : 1 was used during an overnight (O / N) incubation, as indicated in the middle panel. Then cells were assessed for CD69 expression and IL-2 was measured in the culture supernatant.

[0071] FIGs. 12A-12G depict results of CD69 expression by the Jurkat T cells transduced with each of TCRs 1 -6 that are predicted to bind their respective cognate epitopes from TRAP. CD69 expression was measured via flow cytometry following incubation with A375 target cells which have been incubated with either relevant or irrelevant peptides at various concentrations. Within each peptide concentration tested, the left set of data points are results obtained when target cells were incubated with relevant peptides and the right set of data points are results obtained when target cells were incubated with irrelevant peptides. The last set of data points are results obtained when target cells were not incubated with any peptides. FIG. 12A depicts results of CD69 expression by the Jurkat T cells transduced with TCR 1. FIG. 12B depicts results of CD69 expression by the Jurkat T cells transduced with TCR 2. FIG. 12C depicts results ofCD69 expression by the Jurkat T cells transduced with TCR 3. FIG. 12D depicts results ofCD69 expression by the Jurkat T cells transduced with TCR 4. FIG. 12E depicts results ofCD69 expression by the Jurkat T cells transduced with TCR 5. FIG. 12F depicts results ofCD69 expression by the Jurkat T cells transduced with TCR 6. No TCR (FIG. 12G) refers to results obtained using TCRB KO Jurkat T cells that are not transduced with a TCR.

[0072] FIGs. 13A-13G depict results of IL-2 levels in the culture supernatant of the Jurkat T cells transduced with each of TCRs 1-6 following incubation with target A375 cells that were pulsed with respective cognate epitopes from TRAP. IL2 was measured using a high-sensitivity kit manufactured by Meso Scale Discovery following incubation with A375 target cells which have been incubated with their respective predicted cognate epitope (relevant), a different epitope within TRAP (irrelevant) or no peptide at various concentrations. Within each peptide concentration tested, the left set of data points are results obtained when target cells were incubated with relevant peptides. The right set of data points are results obtained when target cells were incubated with irrelevant peptides. The last set of data points are results obtained when target cells were not incubated with any peptides. FIG. 13A depicts results of IL-2 levels in the culture supernatant of the Jurkat T cells transduced with TCR 1 . FIG. 13B depicts results of IL-2 levels in the culture supernatant of the Jurkat T cells transduced with TCR 2. FIG. 13C depicts results of IL-2 levels in the culture supernatant of the Jurkat T cells transduced with TCR 3. FIG. 13D depicts results of IL-2 levels in the culture supernatant of the Jurkat T cells transduced with TCR 4. FIG. 13E depicts results of IL-2 levels in the culture supernatant of the Jurkat T cells transduced with TCR 5. FIG. 13F depicts results of IL-2 levels in the culture supernatant of the Jurkat T cells transduced with TCR 6. FIG. 13G refers to results of IL-2 levels obtained using TCRB KO Jurkat T cells that are not transduced with a TCR.

[0073] FIG. 14 depicts the experimental outline for a recognition assay testing the ability of the transduced Jurkat T cells to recognize human donor hepatocytes that have been incubated with relevant or irrelevant peptides at a concentration of 1 OmM. An effector-to-target ratio of 5 : 1 was used during an overnight (O / N) incubation, as indicated in the middle panel. Then cells were assessed for CD69 expression and IL-2 was measured in the culture supernatant. Non-functional TCR 5 was used as a negative control.

[0074] FIGs. 15A-15E depict results of CD69 expression by the Jurkat T cells transduced with each of TCRs 1 -5 after incubating O / N with human donor hepatocytes that have been incubated with relevant or irrelevant peptides, measured via flow cytometry. Within each hepatocyte donor tested, the left set of data points are results obtained when target cells were incubated with relevant peptides, and the right set of data points are results obtained when target cells were incubated with irrelevant peptides. FIG. 15A depicts results of CD69 expression by the Jurkat Tcells transduced with TCR 1. FIG. 15B depicts results of CD69 expression by the Jurkat T cells transduced with TCR 2. FIG. 15C depicts results of CD69 expression by the Jurkat T cells transduced with TCR 3. FIG. 15D depicts results of CD69 expression by the Jurkat T cells transduced with TCR 4. Data for all TCRs tested are combined in FIG. 15E.

[0075] FIG. 16 depicts the experimental outline for a recognition assay testing the ability of the transduced Jurkat T cells to recognize low frequency target cells to mimic infection conditions. One set of A375 target cells were incubated with relevant peptides at a concentration of lOOOOnMfor 1 hour. One set of A375 target cells were incubated with irrelevant peptides at a concentration of lOOOOnM for 1 hour. Then target cells were washed and the two sets of preincubated A375 target cells were mixed at various relevant to irrelevant ratios. Then Jurkat T cells bearing identified TCR clones were added at an effector-to-target ratio of 5 :lduring an overnight (O / N) incubation, as indicated in the middle panel. Then cells were assessed for CD69 expression and IL-2 was measuredin the culture supernatant. Non-functional TCR 5 was used as a negative control.

[0076] FIG. 17A shows CD69 expression data obtained without washing the target cells (preincubated with relevant peptides as shown in the left panel and with irrelevant peptides as shown in the right panel) prior to incubation with Jurkat T cells transduced with TCR 1 .

[0077] FIG. 17B shows CD69 expression data for each of TCRs 1-5 including the wash step following the 1 hour incubation of the two sets of A375 target cells with relevant peptide and irrelevant peptide, respectively. Within each TCR, data points represent, from left to right, 100% of target cells incubated with relevant peptide, 10% of target cells incubated with relevant peptide, 1 % of target cells incubated with relevant peptide, and 0% of target cells incubated with relevant peptide.

[0078] FIG. 17C shows IL-2 levels in the supernatant obtained without washing the target cells (pre-incubated with relevant peptides as shown in the left panel and with irrelevant peptides as shown in the right panel) prior to incubation with Jurkat T cells transduced with TCR 1 .

[0079] FIG. 17D shows IL-2 levels in the supernatant obtained using each of TCRs 1-5 including the wash step following the 1 hour incubation of the two sets of A375 target cells with relevant peptide and irrelevant peptide, respectively. Within each TCR, data points represent, from left to right, 100% of target cells incubated with relevant peptide, 10% of target cells incubated with relevant peptide, 1% of target cells incubated with relevant peptide, and 0% of target cells incubated with relevant peptide.

[0080] FIG. 18 depicts the experimental outline for a recognition assay testing the ability of the transduced Jurkat T cells to recognize low frequency target cells to mimic infection conditions. One set of A375 target cells were incubated with relevant peptides at a concentration oflOOOOnM overnight. One set of A375 target cells were incubated with irrelevant peptides at a concentration of lOOOOnM overnight. Target cells were washed and the two sets of preincubated A375 target cells were mixed at various relevant to irrelevant ratios. Then Jurkat T cells bearing identified TCR clones were added at an effector-to-target ratio of 5 :1 during an overnight (O / N) incubation, as indicated in the middle panel. Then cells were assessed for CD69 expression and IL-2 was measuredin the culture supernatant. Non-functional TCR 5 was used as a negative control.

[0081] FIG. 19A shows CD69 expression data for each of TCRs 1-5 including the wash step following the overnight incubation of the two sets of A375 target cells with relevant peptide and irrelevant peptide, respectively. Within each TCR, data points represent, from left to right, 100% of target cells incubated with relevant peptide, 10% of target cells incubated with relevant peptide, 1 % of target cells incubated with relevant peptide, and 0% of target cells incubated with relevant peptide.

[0082] FIG. 19B shows IL-2 levels in the supernatant obtained using each of TCRs 1-5 including the wash step followingthe overnight incubation of the two sets of A375 target cells with relevant peptide and irrelevant peptide, respectively. Within each TCR, data points represent, from left to right, 100% of target cells incubated with relevant peptide, 10% of target cells incubated with relevant peptide, 1% of target cells incubated with relevant peptide, and 0% of target cells incubated with relevant peptide.

[0083] FIG. 20 depicts the experimental outline for a recognition assay testing the ability of transduced Jurkat T cells to recognize low frequency target cells to mimic infection conditions. Two sets of target cells are used. One set is wild-type (WT) HEK239T target cells, and the other set is Beta-2 microglobulin (B2M) KO HEK239T target cells, which do not express class I HLA. The two sets of target cells are mixed at various ratios as indicated. Then mixtures are incubated with relevant peptides for 1 hour at a concentration of 1 OOOOnM. Then Jurkat T cells bearing identified TCR clones are added at an effector-to-target ratio of 5 : 1 during an overnight (O / N) incubation, as indicated in the middle panel. Then, CD69 expression on transduced Jurkat T cells is assessed via flow cytometry and IL-2 from culture supernatant is measured.

[0084] FIG. 21 depicts the experimental outline for a recognition assay testing the ability of transduced Jurkat T cells to recognize infected primary hepatocytes. Primary hepatocytes are thawed, plated an incubated for one day. Then they are infected with Pf sporozoites and incubated for one day. Then they are cultured with transduced Jurkat T cells which are removed and replaced daily for 4 days to perform a time course of CD69 expression from days 1-4. Alternatively, transduced Jurkat T cells are incubated with infected primary hepatocytes for 5 days, when IL-2 levels are measured in the supernatant.

[0085] FIGs. 22A-22D depict representative flow cytometry results from a multimer enrichment process to identify T cells specific for Pf antigens. FIG. 22A depicts results using Pf antigen CSP. FIG. 22B depicts results using Pf antigen LSAlb. FIG. 22C depicts results using Pf antigen LISP1. FIG. 22D depicts results using Pf antigen LSAP2. Cells were gated on CD8 positive cells. Cells were stained with fluorescently tagged HLA class I multimers bearing epitopes as indicated by the sequences in the top left comers of the flow cytometry plots. Cells were stained with two multimers, which bear the same epitope but conjugated to different fluorophores, to ensure any positive populations are not a result of background fluorescence detected by one particular channel.

[0086] FIG. 23 depicts an experimental design for a recognition assay testing the ability of transduced Jurkat T cells or PBMCs to recognize infected hepatocytes in vitro.

[0087] FIG. 24A depicts quantification of CD69 expression obtained with Jurkat cells expressing TCR7 when cultured with A375 cells expressing HLA- A03.01 (also referred to as “A*03” in FIGs. 24A-24F) after incubating with KIFGCITNK (SEQ ID NO: 75) peptide or an irrelevant peptide at different concentrations. Within each peptide concentration, the left bar represents results using relevant peptide (SEQ ID NO: 75) and the right bar represents results using irrelevant peptide.

[0088] FIG. 24B depicts quantification of IL-2 secretion obtained with Jurkat cells expressing TCR7 when cultured with A375 cells expressing HLA- A03. after incubating with KIFGCITNK (SEQ ID NO: 75) peptide or an irrelevant peptide at different concentrations. Within each peptide concentration, the left bar represents results using relevant peptide (SEQ ID NO: 75) and the right bar represents results using irrelevant peptide.

[0089] FIG. 24C depicts quantification of CD69 expression obtained with Jurkat cells expressing TCR8 when cultured with A375 cells expressing HLA- A02.01 (also referred to as “A*02” in FIGs. 24A-24F) after incubating with either KQLSLIPSI (SEQ ID NO: 69) or TVGDVLRYV (SEQ ID NO: 71) as target peptides or an irrelevant peptide at different concentrations. Within each peptide concentration, the left bar represents results using KQLSLIPSI (SEQ ID NO: 69) peptide, the middle bar represents results using irrelevant peptide, and the right bar represents results using TVGDVLRYV (SEQ ID NO: 71) peptide.

[0090] FIG. 24D depicts quantification of CD69 expression obtained with Jurkat cells expressing TCR8 when cultured with A375 cells expressing HLA-A02.01 (lower panel) or HLA-A03.01 (upper panel) after incubating with 10 pM of various identified peptides derived from LSAlb, LISP1, LSAP2, or CSP as shown along the x-axis, some of which are selected from Table 7 with only the first three or four amino acids shown. “SLY YK” stands forSLYDEHIKKYK (SEQ ID NO: 1020), “KLRK L” stands for KLRKPKHKKL (SEQ ID NO: 1021), and “GLK V” stands for GLKPSDLNRKV (SEQ ID NO: 1022).

[0091] FIG. 24E depicts quantification of CD69 expression obtained with Jurkat cells expressing TCR9 when cultured with A375 cells expressing HLA A-03.01 after incubating with SLYDEHIKK (SEQ ID NO: 76) peptide (also referred to as “SLY” in FIGs. 24E-24F), SLYDEHIKKYK (SEQ ID NO: 1020) peptide, or an irrelevant peptide at different concentrations. Within each peptide concentration, the left bar represents results using relevant peptide (SEQ ID NO: 76), the middle bar represents results using the variant of the relevant peptide including two additional amino acids, and the right bar represents results using irrelevant peptide.

[0092] FIG. 24F depicts quantification of IL-2 secretion obtained with Jurkat cells expressing TCR9 when cultured with A375 cells expressing HLA A-03.01 after incubating with SLYDEHIKK (SEQ ID NO: 76) peptide, SLYDEHIKKYK (SEQ ID NO: 1020) peptide, or an irrelevant peptide at different concentrations. Within each peptide concentration, the left bar represents results using relevant peptide (SEQ ID NO: 76), the middle bar represents results using the variant of the relevant peptide including two additional amino acids, and the right bar represents results using irrelevant peptide.DETAILED DESCRIPTIONIntroduction

[0093] Vaccines can be composed of antigens derived from a given pathogen and an immunostimulatory agent (e.g., adjuvant). Vaccines can function by inducing expansion and activation of T cells that can recognize and kill cells infected by the pathogen and clear the pathogen from the body. Vaccine development can be reliant on animal models of a given pathogen to identify immunogenic antigens and epitopes thereof that can be effectively presented in complex with major histocompatibility complex (MHC) in order to induce a robust expansion and effective killing response in a T cell specific for that pathogen. These can be factors that inform how a vaccine is to be designed and to assess how efficacious it is. However, many prevalentpathogens, suchas / f / a / cv / wz / / ??, the protozoan that causes malaria, may not infectnon- human animals or may need complex transgenic animals to allow for infection that may not effectively model a typical human infection. Additionally, when a certain infectious disease has a low rate of infection, the level of a given pathogen-related antigen or epitope in infected cells can be undetectable by mass spectrometry. Vaccine development for these diseases can be hindered by these limitations. A human cell based in vitro system to (1) identify human T-cell receptors (TCRs) that can recognize known epitopes of a given pathogen, (2) determine the ability ofantigen-presenting cells (APCs) to effectively present epitopes, and (3) measure T cell responses to candidate epitopes that can be included in a vaccine can be of use to address these limitations. The present disclosure provides compositions and meth odsby whichvaccinedevelopmentagainst these infectious diseases can be improved by determining the protection conferred by candidate antigens to be included as a part of a vaccine. The presentation disclosure also provides compositions and methods for identifying TCRs that can recognize epitopes of the pathogens. The identified TCRs can be used in various applications such as in the production of therapeutic agent for treating an infectious disease and in the detection of an epitope presented by an MHC of an infected cell.Definition

[0094] To facilitate an understanding of the present disclosure, a number of terms and phrases are defined below. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0095] The term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in parton how the value is measured or determined, e.g. , the limitations of the measurement system. For example, “about” can mean within 1 or more than 1 standard deviation, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2- fold, of a value. Where particular values are described in the application and claims, unless otherwise stated the term “about” meaning within an acceptable error range for the particularvalue should be assumed.

[0096] An antigen is a foreign substance to the body that induces an immune response. A “antigen” refers to a protein or fragment thereof that is encoded by a gene in a pathogen.

[0097] “Antigen processing” or “processing” refers to the degradation of a polypeptide or antigen into procession products, which are fragments of said polypeptideor antigen (e.g. , the degradation of a polypeptide into peptides) and the association of one or more of these fragments (e.g., via binding) with MHC molecules for presentation by cells, for example, antigen-presenting cells, to specific T cells.

[0098] An “antigen-presenting cell” (APC) refers to a cell that expresses an MHC molecule and can present an epitope in complex with the MHC molecule. The cell can present peptide fragments of protein antigens in association with MHC molecules on its cell surface. The term includes professional antigen-presenting cells (e.g., B lymphocytes, monocytes, dendritic cells, Langerhanscells) as well as any other cells that express an MHC and can present an epitope in complex with the MHC (e.g., keratinocytes, endothelial cells, astrocytes, fibroblasts, oligodendrocytes). The APC can be a cell that is engineered to express an MHC molecule or a cell that expresses an endogenous MHC molecule.

[0099] The term “affinity” refers to a measure of the strength of binding between two members of a binding pair (e.g. , a human leukocyte antigen (HLA)-binding peptide and a class I or II HLA, or a peptide-HLA complex and a T-cell receptor (TCR)). KDrefers to the dissociation constant between two memb ers of a binding pair and has units of molarity . KAref ers to the affinity constant between two members of a binding pair is the inverse of the dissociation constant. Affinity can be determined experimentally, for exam pie by surface plasmon resonance (SPR) using commercially available Biacore SPR units. Koff refers to the off-rate constant of two members of a binding pair, (e.g. , the off-rate constant of an HLA-binding peptide and a class I or II HLA, or a peptide-HLA complex and a TCR). Konrefers to the on-rate constant of two members of a binding pair, (e.g., the on-rate constant of anHLA-bindingpeptideand aclassIorlIHLA, ora peptide-HLA complex and a TCR).

[0100] Throughout this disclosure, “binding data” results can be expressed in terms of an “IC5o” Affinity can also be expressed as the inhibitory concentration 50 (IC50), or the concentration at which 50% of a first member of a binding pair (e.g. , a peptide) is displaced. Likewise, ln(IC50) refers to the natural log of the IC50. For example, an IC50can be the concentration of a tested peptide in a binding assay at which 50% inhibition of binding of a labeled reference peptide is observed. Given the conditions in which the assays are run (e.g., limiting HLA protein concentrations and / or labeled reference peptide concentrations), these values can approximate KDvalues. Assays for determining binding are well known in the art and are described in detail, for example, in PCT publications WO 94 / 20127 and WO 94 / 03205, and other publications such Sidney et al., Current Protocols in Immunology 18.3.1 (1998); Sidney, et al., J. Immunol. 154:247 (1995); and Sette, et al., Mol. Immunol. 31 :813 (1994). Alternatively, binding can be expressed relative to bindingby a reference standard peptide. Binding can also be determined using other assay systems including those using live cells (e.g., Ceppellini et al., Nature 339:392 (1989); Christnick et al., Nature 352:67 (1991); Busch et al., Int. Immunol. 2:443 (1990); Hill et al., J. Immunol. 147:189 (1991); del Guercio etal., J. Immunol. 154:685 (1995)), cell free systems using detergentlysates (e.g. , Cerundolo et al., J. Immunol. 21 :2069 (1991)), immobilizedpurified MHC (e.g., Hill et al., J. Immunol. 152, 2890 (1994); Marshall et al., J. Immunol. 152:4946 (1994)), ELISA systems (e.g., Reay et al., EMBO J. 11 :2829 (1992)), surface plasmon resonance (e.g., Khilko et al., J. Biol. Chem. 268:15425 (1993)); high flux soluble phase assays (Hammer et al., J. Exp. Med. 180:2353 (1994)), and measurement of class I MHC stabilization or assembly (e.g.,Ljunggren et al., Nature 346:476 (1990); Schumacher et al., Cell 62:563 (1990); Townsend et al., Cell 62:285 (1990); Parker et al., J. Immunol. 149:1896 (1992)).

[0101] The term “derived” when used to discuss an epitope is a synonym for “prepared.” A derived epitope can be isolated from a natural source, or it can be synthesized according to standard protocols in the art. Synthetic epitopes can comprise artificial amino acid residues “amino acid mimetics,” such as D isomers of natural occurringL amino acid residues or non-natural amino acid residues such as cyclohexylalanine. A derived or prepared epitope can be an analog of a native epitope. The term “derived from” refers to the origin or source, and can include naturally occurring, recombinant, unpurified, purified or differentiated molecules or cells. For example, an expanded or induced antigen specific T cell can be derived from a T cell. For example, an expanded or induced antigen specific T cell can be derived from an antigen specific T cell in a biological sample. For example, a matured APC (e.g., a professional APC) can be derived from a non-matured APC (e.g. , an immature APC). For example, an APC can be derived from a monocyte (e.g., a CD 14+ monocyte). For example, a dendritic cell can be derived from a monocyte (e.g., a CD14+ monocyte). For example, an APC can be derived from a bone marrow cell.

[0102] An “epitope” is the collective features of a molecule (e.g., a peptide’s charge and primary, secondary and tertiary structure) that together form a site recognized by another molecule (e.g., an immunoglobulin, T-cell receptor, HLA molecule, or chimeric antigen receptor). For example, an epitope can be a set of amino acid residues involved in recognition by a particular immunoglobulin; a Major Histocompatibility Complex (MHC) receptor; or in the context of T cells, those residues recognized by a T-cell receptor protein and / or a chimeric antigen receptor. Epitopes can be prepared by isolation from a natural source, or they can be synthesized according to standard protocols in the art. Synthetic epitopes can comprise artificial amino acid residues, amino acid mimetics, (such as D isomers of naturally-occurring L amino acid residues or non- naturally-occurring amino acid residues). Throughout this disclosure, epitopes can be referred to in some cases as peptides or peptide epitopes. In certain embodiments, there is a limitation on the length of a peptide of the present disclosure. The embodiment that is length-limited occurs when the protein or peptide comprising an epitope described herein comprises a region (i.e., a contiguous series of amino acid residues) having 100% identity with a native sequence. In order to avoid the definition of epitope from reading, e.g., on whole natural molecules, there is a limitation on the length of any region that has 100% identity with a native peptide sequence. Thus, fora peptide comprising an epitope describ ed herein and a region with 100% identity with a native peptide sequence, the region with 100% identity to a native sequence generally has a length of: less than or equal to 600 amino acid residues, less than or equal to 500 amino acid residues, less than or equal to 400 amino acid residues, less than or equal to 250 amino acid residues, less thanor equal to 100 amino acid residues, less than or equal to 85 amino acid residues, less than or equal to 75 amino acid residues, less than or equal to 65 amino acid residues, and less than or equal to 50 amino acid residues. In certain embodiments, an “epitope” described herein is comprised by a peptide having a region with less than 51 amino acid residues that has 100% identity to a native peptide sequence, in any increment down to 5 amino acid residues; for example 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid residues.

[0103] A “T cell epitope” refers to a peptide sequence bound by an MHC molecule in the form of a peptide:MHC (pMHC) complex. A peptide-MHC complex can be recognized and bound by a TCR of a T cell (e.g., a cytotoxic T-lymphocyte or a T-helper cell).

[0104] A “T cell” includes CD4+ T cells and CD8+ T cells. The term T cell also includes both T helper 1 type T cells and T helper 2 type T cells. T cells can be generated by the method described in the application, for a clinical application. T cells or adoptive T cells referred to here, such as for a clinical application are cells isolated from a biological source, manipulated and cultured ex vivo and prepared into a drug candidate for a specific therapy such as an infectious disease. When candidate cells pass specific qualitative and quantitative criteria for fitness for a clinical application, the drug candidate can be designated a drug product. In some cases, a drug product is selected from a number of drug candidates. An antigen from a pathogen can be selected as a candidate for developing a vaccine against such pathogen. When candidate vaccines comprising candidate antigens pass specific qualitative and quantitative criteria for fitness for a clinical application, such candidate vaccines can be designated a drug product. In the context of this application, a drug product can be a vaccine, such as an mRNA-based vaccine, a T cell, more specifically, a population of T cells, or more specifically a population of T cells with heterogeneous characteristics and subtypes. For example, a drug product, as disclosed herein can have a population of T cells comprising CD8+ T cells, CD4+ T cells, with cells at least above a certain exhibiting antigen specificity, a certain percentage of each exhibiting a memory phenotype, among others.

[0105] An “immune cell” refers to a cell that plays a role in the immune response. Immune cells are of hematopoietic origin, and include lymphocytes, such as B cells and T cells; natural killer cells; myeloid cells, such as monocytes, macrophages, eosinophils, mast cells, basophils, and granulocytes.

[0106] An “immunogenic” peptide or an “immunogenic” epitope or an “immunogenic” peptide epitope is a peptide that binds to an HLA molecule and induces a cell-mediated or humoral response, for example, a cytotoxic T lymphocyte (CTL) response, a helper T lymphocyte (HTL) response and / or a B lymphocyte response. Immunogenic peptides described herein are capable ofbinding to an HLA molecule and thereafter induce a cell-mediated or humoral response e.g., a CTL (cytotoxic) response, or a HTL response) to the peptide.

[0107] A “protective immune response” or “therapeutic immune response” refers to a CTL and / or an HTL response to an antigen derived from a pathogenic antigen, which in some way prevents or at least partially arrests disease symptoms, side effects or progression. The immune response can also include an antibody response which has been facilitated by the stimulation of helper T cells.

[0108] A “T-cell receptor” (“TCR”) refers to a molecule, whether natural or partly or wholly synthetically produced, found on the surface of T lymphocytes (T cells)thatrecognizes an antigen bound to a major histocompatibility complex (MHC) molecule. The ability of a T cells to recognize an antigen associated with various diseases (e.g., infectious diseases such as malaria) or infectious organisms is conferred by its TCR, which is made up of both an alpha (a) chain and a beta (0) chain or a gamma (y) and a delta (5) chain. The proteins which make up these chains are encoded by DNA, which employs a unique mechanism for generatingthe tremendous diversity of the TCR. This multi-subunit immune recognition receptor associates with the CD3 complex and binds peptides presented by the MHC class I and II proteins on the surface of antigen- presenting cells (APCs). Binding of a TCR to a peptide on an APC is a central event in T cell activation.

[0109] “Major Histocompatibility Complex” or “MHC” is a cluster of genes or the protein products thereof that plays a role in control of the cellular interactions responsible for physiologic immune responses. The terms “major histocompatibility complex” and the abbreviation “MHC” can include any class of MHC molecule, such as MHC class I and MHC class II molecules, and relate to a complex of genes which occurs in all vertebrates. In humans, the MHC complex is also known as the human leukocyte antigen (HLA) complex. Thus, a “Human Leukocyte Antigen” or “HLA” refers to a human Major Histocompatibility Complex (MHC) protein (see, e.g., Stites, et al., Immunology, 8THEd., Lange Publishing, Los Altos, Calif. (1994). For a detailed description of the MHC and HLA complexes, see, Paul, Fundamental Immunology, 3rdEd., Raven Press, New York (1993).

[0110] The major histocompatibility complex in the genome comprises the genetic region whose gene products expressed on the cell surface are important for binding and presenting endogenous and / or foreign antigens and thus for regulating immunological processes. MHC proteins or molecules are important for signaling between lymphocytes and antigen-presenting cells or diseased cells in immune reactions. MHC proteins or molecules bind peptides and present them for recognition by T-cell receptors. The proteins encoded by the MHC can be expressed on the surface of cells, and display both self-antigens (peptide fragments from the cell itself) and non-self-antigens (e.g. , fragments of invading microorganisms) to a T-cell. MHC binding peptides can result from the proteolytic cleavage of protein antigens and represent potential lymphocyte epitopes, (e.g., T cell epitope and B cell epitope). MHCs can transport the peptides to the cell surface and present them there to specific cells, such as cytotoxic T-lymphocytes, T-helper cells, or B cells. The MHC region can be divided into three subgroups, class I, class II, and class III. MHC class I proteins can contain an a-chain and p2-microglobulin (not part of the MHC encoded by chromosome 15). They can present antigen fragments to cytotoxic T-cells. MHC class II proteins can contain a- and P-chains and they can present antigen fragments to T-helper cells. MHC class III region can encode for other immunecomponents, such as complement components and cytokines. The MHC can be both polygenic (there are several MHC class I and MHC class II genes) and polymorphic (there are multiple alleles of each gene).

[0111] A “receptor” refers to a biological molecule or a molecule grouping capable of binding a ligand. A receptor can serve, to transmit information in a cell, a cell formation or an organism. A receptor comprises at least one receptor unit, for example, where each receptor unit can consist of a protein molecule. A receptor has a structure which complements that of a ligand and can complex the ligand as a binding partner. The information is transmitted in particular by conformational changes of the receptor following complexation of the ligand on the surface of a cell. In some embodiments, a receptor is to be understood as meaning in particular proteins of MHC classes I and II capable of forming a receptor / ligand complex with a ligand, in particular a peptide or peptide fragment of suitable length. A “ligand” refers to a molecule which has a structure complementary to that of a receptor and is capable of forming a complex with this receptor. In some embodiments, a ligand is to be understood as meaning a peptide or peptide fragment which has a suitable length and suitable binding motifs in its amino acid sequence, so that the peptide or peptide fragment is capable of forming a complex with MHC proteins such as MHC class I or MHC class II proteins. In some embodiments, a “receptor / ligand complex” is also to be understood as meaning a “receptor / peptide complex” or “receptor / peptide fragment complex”, including a peptide- or peptide fragment-presenting MHC molecule such as MHC class I or MHC class II molecules.

[0112] A “native” or a “wild type” sequence refers to a sequence found in nature. The term “naturally occurring” as used herein refers to the fact that an object can be found in nature. For example, a peptide or nucleic acid that is present in an organism (including viruses) and can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally occurring. The term “naturally processed” as used herein in the context of antigen processing or presentation, refers to the factthatthe antigen is not pulsed or overexpressed in a cell by man in the laboratory but is presented by the cell as a product of endogenous pathwaysof antigen processing and presentation (e.g. , via the transporter associated with antigen processing (TAP) pathway to present intracellular antigen on MHC I).

[0113] The term “motif’ refers to a pattern of residues in an amino acid sequence of defined length, for example, a peptide of less than about 15 amino acid residues in length, or less than about 13 amino acid residues in length, for example, from about 8 to about 13 amino acid residues (e.g., 8, 9, 10, 11, 12, or 13) for a class I HLA motif and from about 6 to about 25 amino acid residues (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) for a class II HLA motif, which is recognized by a particular HLA molecule. Motifs are typically different for each HLA protein encoded by a given human HLA allele. These motifs differ in their pattern of the primary and secondary anchor residues. In some embodiments, an MHC class I motif identifies a peptide of 7, 89, 10, 11, 12 or 13 amino acid residues in length. In some embodiments, an MHC class II motif identifies a peptide of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 amino acid residues in length. A “cross-reactive binding” peptide refers to a peptide that binds to more than one member of a class of a binding pair members (e.g., a peptide bound by both a class I HLA molecule and a class II HLA molecule).

[0114] The term “residue” refers to an amino acid residue or amino acid mimetic residue incorporated into a peptide or protein by an amide bond or amide bond mimetic, or that is encoded by a nucleic acid (DNA or RNA). The nomenclature used to describe peptides or proteins follows the conventional practice. The amino group is presented to the left (the amino- orN-terminus) and the carboxyl group to the right (the carboxy- or C-terminus) of each amino acid residue. When amino acid residue positions are referred to in a peptide epitope, they are numbered in an amino to carboxyl direction with the first position being the residue located at the amino terminal end of the epitope, or the peptide or protein of which it can be a part. In the formulae representing selected specific embodiments of the present invention, the amino- and carboxyl-terminal groups, although not specifically shown, are in the form they would assume at physiologic pH values, unless otherwise specified. In the amino acid structure formulae, each residue is generally represented by standard three letter or single letter designations. The L-form of an amino acid residue is represented by a capital single letter or a capital first letter of a three-letter symbol, and the D- form forthose amino acid residues having D-forms is represented by a lower case single letter or a lower case three letter symbol. However, when three letter symbols or full names are used without capitals, they can refer to L amino acid residues. Glycine has no asymmetric carbon atom and is simply referred to as “Gly” or “G”. The amino acid sequences of peptides set forth herein are generally designated using the standard single letter symbol. (A, Alanine; C, Cysteine; D, Aspartic Acid; E, Glutamic Acid; F, Phenylalanine; G, Glycine; H, Histidine; I, Isoleucine; K,Lysine; L, Leucine; M, Methionine; N, Asparagine; P, Proline; Q, Glutamine; R, Arginine; S, Serine; T, Threonine; V, Valine; W, Tryptophan; and Y, Tyrosine.)

[0115] The terms “peptide” and “peptide epitope” are used interchangeably with “oligopeptide” in the present specification to designate a series of residues connected one to the other, typically by peptide bonds between the a-amino and carboxyl groups of adjacent amino acid residues. A “synthetic peptide” refers to a peptide that is obtained from a non-natural source, e.g., is manmade. Such peptides can be produced using such methods as chemical synthesis or recombinant DNA technology. “Synthetic peptides” include “fusion proteins.”

[0116] “Prevention” or “preventing” when usedin the context of vaccines or therapeutics, refers to prophylaxis, prevention of onset of symptoms, prevention of progression of a disease or disorder, such as diseases associated with excess levels of protein or correlated with protein activity, for example, an antigen associated with an infectious disease.

[0117] A “conservative amino acid substitution” is one in which one amino acid residue is replaced with another amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). For example, substitution of a phenylalanine for a tyrosine is a conservative substitution. Methods of identifying nucleotide and amino acid conservative substitutions which do not eliminate peptide function are well-known in the art.

[0118] “Pharmaceutically acceptable” refers to a generally non-toxic, inert, and / or physiologically compatible composition or component of a composition. A “pharmaceutical excipient” or “excipient” comprises a material such as an adjuvant, a carrier, pH-adjusting and buffering agents, tonicity adjusting agents, wetting agents, preservatives, and the like. A “pharmaceutical excipient” is an excipient which is pharmaceutically acceptable.

[0119] According to the present disclosure, the term “vaccine” relates to a pharmaceutical preparation (pharmaceutical composition) or product thatupon administration induces an immune response, for example, a cellular or humoral immune response, which recognizes and attacks a pathogen or a diseased cell such as a cell infected by a pathogen associated with an infectious disease (e.g., malaria). A vaccine can be used for the prevention or treatment of a disease.

[0120] The terms “polynucleotide” and “nucleic acid” are used interchangeably herein and refer to polymers of nucleotides of any length, and include DNA and RNA, for example, mRNA. Thenucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and / or their analogs, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase. In some embodiments, the polynucleotide and nucleic acid can be in vitro transcribed mRNA. In some embodiments, the polynucleotide that is administered using the methods of the invention is mRNA.

[0121] The terms “isolated” or “biologically pure” refer to material which is substantially or essentially free from components which normally accompany the material as it is found in its native state. Thus, isolated peptides described herein do not contain some or all of the materials normally associated with the peptides in their in situ environment. For example, an “isolated” epitope can be an epitope that does not include the whole sequence of the protein from which the epitope was derived. For example, a naturally-occurring polynucleotide or peptide present in a living animal is not isolated, but the same polynucleotide or peptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such a polynucleotide could be part of a vector, and / or such a polynucleotide or peptide could be part of a composition, and still be “isolated” in that such vector or composition is not part of its natural environment. Isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA molecules described herein, and further include such molecules produced synthetically. In some embodiments, a polypeptide, antibody, polynucleotide, vector, cell, or composition which is isolated is substantially pure. The term “substantially pure” as used herein refers to material which is at least 50% pure (i.e., free from contaminants), at least 90% pure, at least 95% pure, at least 98% pure, or at least 99% pure.

[0122] The terms “identical” or percent “identity” in the context of two or more nucleic acids or polypeptides, refer to two or more sequences or sub sequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned (introducing gaps, if necessary) for maximum correspondence, not considering any conservative amino acid substitutions as part of the sequence identity. The percent identity can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software that can be used to obtain alignments of amino acid or nucleotide sequences are well- known in the art. These include, for example, BLAST, ALIGN, Megalign, BestFit, GCG Wisconsin Package, and variations thereof. In some embodiments, two nucleic acids or polypeptides described herein are substantially identical, meaningthey have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, and in some embodiments at least 95%, 96%, 97%, 98%, 99% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using a sequence comparison algorithm or by visual inspection. In some embodiments, identity exists over a region of the sequences that is at least about 10, at least about20, atleast about40-60 residues, atleastabout60-80 residues in length or any integral valuethere between. In some embodiments, identity exists over a longer region than 60-80 residues, such as at least about 80-100 residues, and in some embodiments the sequences are substantially identical over the full length of the sequences being compared, such as an amino acid sequence of a peptide or a coding region of a nucleotide sequence.

[0123] The term “subject” refers to any animal (e.g., a mammal), including, for example, humans, non-human primates, canines, felines, rodents, and the like, which is to be the recipient of a particular treatment. In some embodiments, the terms “subject” and “patient” are used interchangeably herein in reference to a human subject.

[0124] The terms “effective amount” or “therapeutically effective amount” or “therapeutic effect’ refer to an amount of a therapeutic effective to “treat” a disease or disorder in a subject or mammal. The therapeutically effective amount of a drug has a therapeutic effect and as such can prevent the development of a disease or disorder; slow down the development of a disease or disorder; slow down the progression of a disease or disorder; relieve to some extent one or more of the symptoms associated with a disease or disorder; reduce morbidity and mortality; improve quality of life; or a combination of such effects.

[0125] The terms “treating” or “treatment” or “to treat” or “alleviating” or “to alleviate” refer to both (1) therapeutic measures that cure, slow down, lessen symptoms of, and / or halt progression of a diagnosed pathologic condition or disorder and (2) prophylactic or preventative measures that prevent er slow the development of a targeted pathologic condition or disorder. Thus, those in need of treatment include those already with the disorder; those prone to have the disorder; and those in whom the disorder is to be prevented.

[0126] The term “depleted” when used to describe a cell sample (e.g., a peripheral blood mononuclear cell (PBMC) sample) refers to a cell sample in which a subpopulation of cells has been removed or depleted. For example, an immune cell sample depleted of CD25 expressing cells refers to an immune cell sample in which CD25 expressing cells have been removed or depleted. For example, one or more binding agents can be used to remove or deplete one or more cells or cell types from a sample. For example, CD14+ cells can be depleted or removed from a PBMC sample, such as by using an antibody that binds to CD 14.

[0127] The “stimulation” refers to a response induced by binding of a stimulatory molecule with its cognate ligand thereby mediating a signal transduction event. For example, stimulation of a T cell can refer to binding of a TCR of a T cell to a peptide-MHC complex. For example, stimulation of a T cell can refer to a step in which PBMCs are cultured together with peptide loaded APCs.

[0128] The term “enriched” refers to a composition or fraction wherein an object species has been partially purified such that the concentration of the object species is substantially higher than the naturally occurring level of the species in a finished product without enrichment. The term“induced cell” refers to a cell that has been treated with an inducing compound, cell, or population of cells that affects the cell’s protein expression, gene expression, differentiation status, shape, morphology, viability, and the like.Methods

[0129] In some aspects, provided herein are methods of determining whether a vaccine induces T cell specific immune response. Also provided herein are methods of determining whether an epitope sequence is presented by a cell. Also provided herein are methods of making T cells. Also provided herein are methods of identifying an antigen recognizable by a TCR. Also provided herein are methods of identifying TCRs. The methods described herein can be used as a release assay for determining whether a vaccine product manufactured can induce T cell specific immune responses as intended. The methods described herein can be useful for validating whether a candidate antigen from a pathogen is suitable to be used for making a vaccine against such pathogen. The methods described herein can also be useful in performing assays to confirm epitope presentation by a cell of interest, such as a cell infected by a pathogen.Determining Whether Vaccine Induces T cell specific immune response

[0130] In some aspects, provided herein is a method of determining whether an infectious disease vaccine comprising a therapeutic polypeptide described herein or a polynucleotide encoding the therapeutic polypeptide is capable of inducing T cell specific immune response in a subject. In some embodiments, the subject is a human.

[0131] In some embodiments, the method comprises contacting a population of cells comprising antigen-presenting cells (APCs) comprising the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide with a population of T cells expressing a T-cell receptor (TCR) specific to a peptide:MHC complex. In some embodiments, the APC expresses an MHC molecule (e.g., HLA-A02, HLA-A02.01, HLA-A03, orHLA-A03.01). In some embodiments, the APCs are professional APCs. In some embodiments, the APCs are not professional APCs. The APC canbe a cell line. The APC can be any cell that expresses an MHC and can present an epitope in complex with the MHC. In some cases, the APC can be engineered to express an exogenous MHC. In some embodiments, the therapeutic polypeptide comprises a polypeptide sequence from a protein encoded by a genome of a pathogen associated with an infectious disease (e.g., TRAP of Plasmodium falciparum). In some embodiments, the peptide:MHC complex comprise an epitope sequence from the therapeutic polypeptide (e.g., an epitope selected from Table 7 or Table 8) In some embodiments, the peptide:MHC complex comprise the same MHC molecule expressed by the population of cells comprising APCs. In some embodiments, the method comprises assaying for the activation of T cells using an activation assay or an activation marker as described herein. In some embodiments, the method comprises determining the therapeuticpolypeptide or the polynucleotide encoding the therapeutic polypeptide as being capable of inducing a T cell specific immune response in a subject when the T cells are activated according to the activation assay or activation marker described herein. In some embodiments, the epitope sequence of the peptide:MHC complex is present at a level in the population of cells comprising APCs that is undetectable by mass spectrometry. In some embodiments, the pathogen is a pathogen that only infects human cells. In some embodiments, the protein encoded by the genome of the pathogen associated with the infectious disease is expressed by human cell infected with the pathogen, but is not expressed by non-human cell infected with the pathogen. In some embodiments, the epitope sequence of the peptide:MHC complex is present at a level in the population of cells comprising APCs that is undetectable by mass spectrometry and the pathogen is a pathogen that only infects human cells. In some embodiments, the epitope sequence of the peptide:MHC complex is present at a level in the population of cells comprising APCs that is undetectable by mass spectrometry and the protein encoded by the genome of the pathogen associated with the infectious disease is expressed by human cell infected with the pathogen, but is not expressed by non-human cell infected with the pathogen. In some embodiments, the pathogen is a pathogen that only infects human cells and the protein encoded by the genome of the pathogen associated with the infectious disease is expressed by human cell infected with the pathogen, but is not expressed by non-human cell infected with the pathogen. In some embodiments, the epitope sequence of the peptide:MHC complex is present at a level in the population of cells comprising APCs that is undetectable by mass spectrometry, the pathogen is a pathogen that only infects human cells, and the protein encoded by the genome of the pathogen associated with the infectious disease is expressed by human cell infected with the pathogen, but is not expressed by non-human cell infected with the pathogen.

[0132] In some embodiments, the infectious disease vaccine comprises a ribonucleic acid (RNA) sequence encoding the therapeutic polypeptide described herein. In some embodiments, the therapeutic polypeptide comprises one or more polypeptide sequences. In some embodiments, the therapeutic polypeptide comprises two or more polypeptide sequences each from a different protein encoded by the genome of the pathogen associated with the infectious disease. In some embodiments, the therapeutic polypeptide comprises two or more polypeptide sequences each from the same protein encoded by the genome of the pathogen associated with the infectious disease. In some embodiments, the therapeutic polypeptide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polypeptide sequences each from a different protein encoded by the genome of the pathogen associated with the infectious disease. In some embodiments, wherein the therapeutic polypeptide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10 ormore different epitope sequences from two ormore different proteins encoded by the genome of a pathogen associated with an infectious disease. In someembodiments, the therapeutic polypeptide comprises 2 polypeptide sequences. In some embodiments, the therapeutic polypeptide comprises 3 polypeptide sequences. In some embodiments, the therapeutic polypeptide comprises 4 polypeptide sequences. In some embodiments, the therapeutic polypeptide comprises 5 polypeptide sequences. In some embodiments, the therapeutic polypeptide comprises 6 or more polypeptide sequences. In some embodiments, the RNA sequence comprises a sequence encoding an MHC class I trafficking signal (MITD) sequence. In some embodiments, the RNA sequence comprises a sequence encoding a linker. In some embodiments, the RNA sequence comprises a sequence encoding a signal peptide. In some embodiments, the RNA sequence comprises a sequence encoding comprises a sequence encoding an MHC class I trafficking signal (MITD) sequence and a linker. In some embodiments, the RNA sequence comprises a sequence encoding an MHC class I trafficking signal (MITD) sequence and a signal peptide. In some embodiments, the RNA sequence comprises a sequence encoding a linker and a signal peptide. In some embodiments, the RNA sequence comprises a sequence encoding an MHC class I trafficking signal (MITD) sequence, a linker, and a signal peptide. In some cases, the infectious disease vaccine is malaria vaccine. In some cases, the infectious disease is HPV vaccine. In some cases, the infectious disease is EBV vaccine.

[0133] In some embodiments, contacting comprises contacting the population of T cells to the population of cells comprising APCs pulsed with the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide and APCs pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the protein encoded by the genome of the pathogen associated with an infectious disease. In some embodiments, the ratio of APCs pulsed with the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide and APCs pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the protein encoded by the genome of the pathogen associated with an infectious disease is from 99.9:0.1 to 0.1 :99.9. In some embodiments, the ratio of APCs pulsed with the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide and APCs pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the protein encoded by the genome of the pathogen associated with an infectious diseaseis from 99:1 to 1 :99. In some embodiments, the ratio of APCs pulsed with the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide and APCs pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the protein encoded by the genome of the pathogen associated with an infectious disease is from 95:5 to 5:95. In some embodiments, the ratio is from 90:10 to 10:90. In some embodiments, the ratio is from 80:20 to 20:80. In some embodiments, the ratio is from 70:30 to 30:70. In some embodiments the ratio is from 60:40 to 40:60. In some embodiments, the ratio is 50:50. In some embodiments, theAPCs comprise a cell line. In some embodiments, the cell line is a A375 cell line. In some embodiments, the cell line is an HEK293 cell line. In some embodiments, the cell line is a hepatocyte cell line. In some embodiments, contacting comprises contacting the population of T cells to the population of cells comprising APCs incubated with at least 0.001 nM of the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide. In some embodiments, contacting comprises contacting the population of T cells to the population of cells comprising APCs incubated with at least 0.01 nM of the therapeutic polypeptide or the polynucleotide encodingthe therapeutic polypeptide. In some embodiments, contacting comprises contacting the population of T cells to the population of cells comprising APCs incubated with at least 0.1 nM of the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide. In some embodiments, contacting comprises contacting the population of T cells to the population of cells comprising APCs incubated with at least 1 nM of the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide. In some embodiments, contacting comprises contacting the population of T cells to the population of cells comprising APCs incubated with at least 10 nM of the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide. In some embodiments, contacting comprises contacting the population of T cells to the population of cells comprising APCs incubated with at least 20 nM of the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide. In some embodiments, contacting comprises contacting the population of T cells to the population of cells comprising APCs incubated with at least 50 nM of the therapeutic polypeptide or the polynucleotide encodingthe therapeutic polypeptide. In some embodiments, contacting comprises contacting the population of T cells to the population of cells comprising APCs incubated with at least 100 nM of the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide. In some embodiments, contacting comprises contacting the population of T cells to the population of cells comprising APCs incubated with atmost 1 Mof the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide. In some embodiments, contacting comprises contacting the population of T cells to the population of cells comprising APCs incubated with at most 500 pM of the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide. In some embodiments, contacting comprises contacting the population of T cells to the population of cells comprising APCs incubated with at most 400 pM of the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide. In some embodiments, contacting comprises contacting the population of T cells to the population of cells comprising APCs incubated with at most 200 pM of the therapeutic polypeptide or the polynucleotide encodingthe therapeutic polypeptide. In some embodiments, contacting comprises contacting the population of T cells to the population of cells comprising APCs incubated with atmost 100 pM of the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide. In some embodiments, contacting comprises contacting the population of T cells to the population of cells comprising APCs incubated with at most 50 pM of the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide. In some embodiments, contacting comprises contacting the population of T cells to the population of cells comprising APCs incubated with atmost20 pM of the therapeutic polypeptideor the polynucleotide encoding the therapeutic polypeptide. In some embodiments, contacting comprises contacting the population of T cells to the population of cells comprising APCs incubated with from 0.001 nM -500 pM of the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide. In some embodiments, contacting comprises contacting the population of T cells to the population of cells comprising APCs incubated with from 0.01 nM-100 pMof the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide. In some embodiments, contacting comprises contacting the population of T cells to the population of cells comprising APCs incubated with from 0.1 nM -10 pM of the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide. In some embodiments, contacting comprises contacting the population of T cells to the population of cells comprising APCs incubated with from 1 nM -1 pM of the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide. In some embodiments, the method comprises identifying the TCR specific to the peptide:MHC complex in an ex vivo assay. In some embodiments, the method comprises identifying the TCR specific to the peptide :MHC complex in an ex vivo assay prior to contacting the population of cells with a population of T cells. In some embodiments, the population of T cells expressing the TCR specific to the peptide :MHC complex are primary T cells. In some embodiments, the population of T cells expressingthe TCR specific to the peptide:MHC complex is a cell line. In some embodiments, the cell line is a Jurkat cell line. In some embodiments the population of T cells expressing the TCR specific to the peptide:MHC complex is from a peripheral blood mononuclear cell (PBMC) sample. In some embodiments, contacting comprises contacting the population of T cells with the population of cells comprising APCs at a ratio of from 1 :90 to 90:1. In some embodiments, contacting comprises contacting the population of T cells with the population of cells comprising APCs at a ratio of from 1 :80 to 80:1. In some embodiments, contacting comprises contacting the population of T cells with the population of cells comprising APCs at a ratio of from 1 :70 to 70: 1. In some embodiments, contacting comprises contacting the population of T cells with the population of cells comprising APCs at a ratio of from 1 :60to 60:1. In some embodiments, contacting comprises contacting the population of T cells with the population of cells at a ratio of from 1 :50 to 50:1. In some embodiments, contacting comprises contacting the population of T cells with the population of cells at a ratio of from 1 :40to 40:1. Insome embodiments, contacting comprises contactingthe population of T cells with the population of cells at a ratio of from 1 :30 to 30:1. In some embodiments, contacting comprises contactingthe population of T cells with the population of cells at a ratio of from 1 :25 to 25: 1. In some embodiments, the ratio is 20:1 to 1 :20. In some embodiments, the ratio is 16:1 to 1 : 16. In some embodiments, the ratio is 12:1 to 1 : 120. In some embodiments, the ratio is 10:1 to 1 : 10. In some embodiments, the ratio is 9: 1 to 1 :9. In some embodiments, the ratio is 8:1 to 1 :8. In some embodiments, the ratio is 6:1 to 1 :6. In some embodiments, the ratio is from 5: 1 to 1 :5. In some embodiments, the ratio is 4: 1 to 1 :4. In some embodiments, the ratio is 3 :1 to 1 :3. In some embodiments, the ratio is 2:1 to 1 :2.Determining Epitope Presentation

[0134] In some aspects, provided herein is a method of determining whether an epitope sequence from a protein encoded by a genome of a pathogen associated with an infectious disease (e.g., malaria, EB V, HPV, or other ones described herein) is presented by an MHC molecule expressed by a cell or population of cells. In some embodiments, the cell is a cell infected by the pathogen. In some embodiments, the population of cell is the population of cells comprising APCs described herein. In some embodiments, the cell infected by the pathogen is a cell that is infected naturally by the pathogen. In some embodiments, the cell is isolated from a human subject infected by the pathogen. In some embodiments, the cell is infected by the pathogen in vitro. In some embodiments, the cell is a hepatocyte infected by Plasmodium falciparum.

[0135] In some embodiments, the method comprises contacting a population of cells comprising cells infected by the pathogen with a population of T cells expressing a T-cell receptor (TCR) specific to a peptide:MHC complex. In some embodiments, the peptide:MHC complex comprises an epitope sequence from a protein encoded by the genome of the pathogen associated with the infectious disease and an MHC molecule expressed by the cells infected by the pathogen. In some embodiments, the method comprises assaying for activation of the T cells using an activation assay or an activation marker as described herein. In some embodiments, the method comprises determining the epitope sequence from the protein encoded by the genome of the pathogen associated with an infectious disease to be presented by the MHC molecule expressed by the cell infected by the pathogen when the T cells are activated according to the activation assay or activation marker. In some embodiments, the epitope sequence is from a TRAP protein of Plasmodium falciparum An some embodiments, the epitope sequence is one selected from Table 7. In some embodiments, the epitope sequence is one selected from Table 8. In some embodiments, the epitope sequence of the peptide:MHC complex is present at a level in the population of cells comprising APCs that is undetectable by mass spectrometry. In some embodiments, the pathogen is a pathogen that only infects human cells. In some embodiments,the protein encoded by the genome of the pathogen associated with the infectious disease is expressed by human cell infected with the pathogen, but is not expressed by non-human cell infected with the pathogen. In some embodiments, the epitope sequence of the peptide:MHC complex is present at a level in the population of cells comprising APCs that is undetectable by mass spectrometry and the pathogen is a pathogen that only infects human cells. In some embodiments, the epitope sequence of the peptide:MHC complex is present at a level in the population of cells comprising APCs that is undetectable by mass spectrometry and the protein encoded by the genome of the pathogen associated with the infectious disease is expressed by human cell infected with the pathogen, but is not expressed by non-human cell infected with the pathogen. In some embodiments, the pathogen is a pathogenthat only infects human cells and the protein encoded by the genome of the pathogen associated with the infectious disease is expressed by human cell infected with the pathogen, but is not expressed by non-human cell infected with the pathogen. In some embodiments, the epitope sequence of the peptide:MHC complex is present at a level in the population of cells comprising APCs that is undetectable by mass spectrometry, the pathogen is a pathogen that only infects human cells, and the protein encoded by the genome of the pathogen associated with the infectious disease is expressed by human cell infected with the pathogen, but is not expressed by non-human cell infected with the pathogen. In some embodiments, the population of cells comprises primary cells infected by the pathogen. In some embodiments, the population of cells comprises hepatocytes infected by the pathogen. In some embodiments, the population of cells comprises hepatocytes notinfected by the pathogen. In some embodiments, the pathogen is Plasmodium falciparum . In some embodiments, the pathogen is HPV. In some embodiments, the pathogen is EBV.

[0136] In some embodiments, contacting comprises contacting the population of T cells to a population of cells comprising cells infected by the pathogen and cells not infected by the pathogen. In some embodiments, the ratio of cells infected by the pathogen and cells notinfected by the pathogen is from 99.9:0. 1 to 0.1 :99.9. In some embodiments, the ratio of cells infected by the pathogen and cells notinfected by the pathogen is from 99:1 to 1 :99. In some embodiments, the ratio of cells infected by the pathogen and cells not infected by the pathogen is from 95 :5 to 5:95. In some embodiments, the ratio is from 90:10 to 10:90. In some embodiments, the ratio is from 80:20 to 20: 80. In some embodiments, the ratio is from 70:3 Oto 30:70. In some embodiments the ratio is from 60:40 to 40:60. In some embodiments, the ratio is 50:50. In some embodiments, the method comprises identifying the TCR specific to the peptide :MHC complex in an ex vivo assay. In some embodiments, the method comprises identifying the TCR specific to the peptide:MHC complex in an ex vivo assay prior to contacting the population of cells with a population of T cells. In some embodiments, the population of T cells expressingthe TCR specificto the peptide:MHC complex are primary T cells. In some embodiments, the population of T cells expressing the TCR specific to the peptide:MHC complex is a cell line. In some embodiments, the cell line is a Jurkat cell line. In some embodiments the population of T cells expressingthe TCR specific to the peptide :MHC complexis from a peripheral blood mononuclear cell (PBMC) sample. In some embodiments, contacting comprises contacting the population of T cells with the population of cells comprising APCs at a ratio of from 1 :90 to 90:1. In some embodiments, contacting comprises contacting the population of T cells with the population of cells comprising APCs at a ratio of from 1 :80 to 80:1. In some embodiments, contacting comprises contacting the population of T cells with the population of cells comprising APCs at a ratio of from 1 :70 to 70:1. In some embodiments, contacting comprises contacting the population of T cells with the population of cells comprising APCs at a ratio of from 1 :60 to 60:1. In some embodiments, contacting comprises contacting the population of T cells with the population of cells at a ratio of from 1 :50 to 50:1. In some embodiments, contacting comprises contacting the population of T cells with the population of cells at a ratio of from 1 :40 to 40 : 1. In some embodiments, contacting comprises contacting the population of T cells with the population of cells at a ratio of from 1:30 to 30:1. In some embodiments, contacting comprises contacting the population of T cells with the population of cells at a ratio of from 1 :25 to 25:1. In some embodiments, the ratio is 20:1 to 1:20. In some embodiments, the ratio is 16:1 to 1 : 16. In some embodiments, the ratio is 12:1 to 1 : 120. In some embodiments, the ratio is 10: 1 to 1 : 10. In some embodiments, the ratio is 9:1 to 1 :9. In some embodiments, the ratio is 8:1 to 1 :8. In some embodiments, the ratio is 6:1 to 1 :6. In some embodiments, the ratio is from 5 :1 to 1 :5. In some embodiments, the ratio is 4:1 to 1 :4. In some embodiments, the ratio is 3 :1 to 1 :3. In some embodiments, the ratio is 2: 1 to 1 :2.Determining an Antigen Contains a Presented Epitope

[0137] Also provided herein is a method of determining whether a polypeptide sequence from a protein encoded by the genome of a pathogen associated with an infectious disease (e.g., malaria, HPV, EBV, or other ones described herein) contains an epitope sequence that is presented by an MHC molecule expressed by antigen-presenting cells (APCs).

[0138] In some embodiments, the method comprises contacting to a plurality of APCs a polypeptide comprising the polypeptide sequence from the protein encoded by the genome of the pathogen associated with the infectious disease. In some embodiments, the method comprises contacting to a plurality of APCs a polynucleotide encoding the polypeptide comprising the polypeptide sequence from the protein encoded by the genome of the pathogen associated with the infectious disease. In some embodiments, the method comprises contacting the plurality of APCs to a population of immune cells, thereby forming a stimulated population of immune cells. In some embodiments, the method comprises enriching T cells expressing a TCR that binds to anMHC multimer in complex with a candidate epitope sequence described herein from the stimulated population of immune cells. In some embodiments, the method comprises sequencing the TCR from the enriched T cells. Any suitable sequencing methods can be used, for example, single-cell sequencing. The single-cell sequencing can be any commercially available methods such as 10X single-cell sequencing method. The single-cell sequencing can comprise measuring genetic materials of a single cell, such as the genome, the transcriptome or the methylome of this single cell. For example, a droplet-based single cell sequencing method comprises isolating single cells into droplets containing reagents for sequencing, which generate a barcoded library that can be pooled and sequenced. In some embodiments, the single-cell sequencing method comprises the use of microfluidic partitioning to capture single cells. In some embodiments, the single-cell sequencing method comprises using next-generation sequencing cDNA libraries. In some embodiments, the single-cell sequencing method comprises measuring RNA molecules within each cell of a given sample. The complementarity determining regions (CDRs) of any given variable domain sequences of the TCRs can be determined using IMGT numbering scheme. For example, the CDRs can be determined using any available tools such as the Loupe V(D)JBrowser from 10X Genomics. In some embodiments, the complementarity determining region (CDR) 1, CDR2, and / or CDR3 are determined. In some embodiments, the CDR3 region is determined. In some embodiments, the method comprises expressing the TCR in a population of T cells. In some cases, expressing the TCR in a population of T cells comprises expressing the TCRin PBMCs. In some cases, expressing the TCR in a population of T cells comprises expressing the TCR in a cell line. In some cases, expressing the TCR in a population of T cells comprises expressing the TCR in a Jurkat cell line. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to APCs that express an MHC molecule corresponding to the MHC multimer. In some embodiments, the APCs are a cell line. In some embodiments, the cell line comprises A375 cells. In some embodiments, the APCs are from primary cells. In some embodiments, the primary cells comprise primary hepatocytes. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to APCs infected with the pathogen. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs that are hepatocytes infected with the pathogen. In some embodiments, the method comprises expressing a portion of the TCR in a population of T cells, such as the alpha variable region and / or the beta variable region. In some embodiments, the method comprises assayingfor activation of T cells in the population of T cells using an activation assay or an activation marker as described herein. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to APCs comprising a polypeptide comprising the candidate epitope sequence. In some embodiments, the method comprisesidentifying the candidate epitope sequence as being an epitope presented by an MHC molecule corresponding to the MHC multimer expressed by APCs when the T cells are activated according to the activation assay or activation marker.

[0139] In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs comprising a polypeptide comprising the candidate epitope sequence at a ratio of from 50:1 to 1 :50. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs comprising a polypeptide comprising the candidate epitope sequence at a ratio of from 40: 1 to 1 :40. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs comprising a polypeptide comprising the candidate epitope sequence at a ratio of from 30: 1 to 1 :30. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs comprising a polypeptide comprisingthe candidate epitope sequence at a ratio of from 20: 1 to 1 :20. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs comprising a polypeptide comprisingthe candidate epitope sequence at a ratio of from 10:1 to 1 :10. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs comprising a polypeptide comprisingthe candidate epitope sequence at a ratio of from 5 :1 to 1 :5. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs comprising a polypeptide comprising the candidate epitope sequence at a ratio of 1 : 1.

[0140] In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs comprising a polypeptide comprisingthe candidate epitope sequence at a ratio of from 50:1 to 1 :50. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs comprising a polypeptide comprisingthe candidate epitope sequence at a ratio of from 40: 1 to 1 :40. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs comprising a polypeptide comprisingthe candidate epitope sequence at a ratio of from 30: 1 to 1 :30. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs comprising a polypeptide comprisingthe candidate epitope sequence at a ratio of from 20:1 to 1 :20. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs comprising a polypeptide comprisingthe candidate epitope sequence at a ratio of from 10:1 to 1 :10. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs comprising a polypeptide comprisingthe candidate epitope sequence at a ratio of from 5 :1 to 1 :5. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs comprising a polypeptide comprising the candidate epitope sequence at a ratio of 1 : 1.

[0141] In some embodiments, assaying comprises contactingthe population of T cells expressing the TCRto the APCs incubated with atleast 0.001 nMof the polypeptide comprisingthe candidate epitope sequence. In some embodiments, assaying comprises contactingthe population of T cells expressing the TCR to the APCs incubated with at least 0.01 nM of the polypeptide comprising the candidate epitope sequence. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs incubated with at least 0.1 nM of the polypeptide comprising the candidate epitope sequence. In some embodiments, assaying comprises contactingthe population of T cells expressing the TCRto the APCs incubated with at least 1 nM of the polypeptide comprisingthe candidate epitope sequence. In some embodiments, assaying comprises contactingthe population of T cells expressingthe TCRto the APCs incubated with at least 10 nM of the polypeptide comprising the candidate epitope sequence. In some embodiments, assaying comprises contactingthe population of T cells expressingthe TCRto the APCs incubated with atleast20 nMof the polypeptide comprisingthe candidate epitope sequence. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs incubated with at least 50 nM of the polypeptide comprising the candidate epitope sequence. In some embodiments, assaying comprises contactingthe population of T cells expressingthe TCR to the APCs incubated with at least 100 nM of the polypeptide comprising the candidate epitope sequence. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs incubated with at most 1 M of the polypeptide comprising the candidate epitope sequence. In some embodiments, assaying comprises contactingthe population of T cells expressingthe TCRto the APCs incubated with at most 500 pM of the polypeptide comprising the candidate epitope sequence. In some embodiments, assaying comprises contactingthe population of T cells expressingthe TCRto the APCs incubated with at most 400 pM of the polypeptide comprising the candidate epitope sequence. In some embodiments, assaying comprises contacting the population of T cells expressingthe TCR to the APCs incubated with at most 200 pM of the polypeptide comprising the candidate epitope sequence. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs incubated with at most 100 pM of the polypeptide comprising the candidate epitope sequence. In some embodiments, assaying comprises contactingthe population of T cells expressingthe TCRto the APCs incubated with at most 50 pM of the polypeptide comprisingthe candidate epitope sequence. In some embodiments, assaying comprises contactingthe population of T cells expressingthe TCR to the APCs incubated with at most 20 pM of the polypeptide comprising the candidate epitope sequence. In some embodiments, assaying comprises contactingthe population of T cells expressingthe TCRto the APCs incubated with from 0.001 nM - 500 pM of the polypeptide comprising the candidateepitope sequence. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs incubated with from 0.01 nM -100 pM of the polypeptide comprisingthe candidate epitope sequence. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs incubated with from 0.1 nM - 10 pM of the polypeptide comprising the candidate epitope sequence. In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs incubated with from 1 nM - 1 pM of the polypeptide comprising the candidate epitope sequence.

[0142] In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs comprising APCs pulsed with the polypeptide comprising the candidate epitope sequence and APCs pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence. In some embodiments the ratio of the APCs pulsed with the polypeptide comprising the candidate epitope sequence to the APCs pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence is from 99: 1 to 1 :99. In some embodiments the ratio of the APCs pulsed with the polypeptide comprising the candidate epitope sequence to the APCs pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence is from 95 :5 to 5 :95. In some embodiments the ratio of the APCs pulsed with the polypeptide comprisingthe candidate epitope sequence to the APCs pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence is from 90: 10 to 10:90. In some embodiments the ratio of the APCs pulsed with the polypeptide comprising the candidate epitope sequence to the APCs pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence is from 70:30 to 30:70. In some embodiments the ratio of the APCs pulsed with the polypeptide comprisingthe candidate epitope sequence to the APCs pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence is from 60:40 to 40:60. In some embodiments the ratio of the APCs pulsed with the polypeptide comprising the candidate epitope sequence to the APCs pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence is about 50:50.

[0143] In some embodiments, assaying comprises contacting the population of T cells expressing the TCR to the APCs comprising APCs that express an MHC molecule corresponding to the MHC multimer and that have been pulsed with the polypeptide comprising the candidate epitope sequence and APCs that do not express an MHC molecule corresponding to the MHC multimer and that have been pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence. In some embodiments, the ratio of the APCs that express an MHC molecule corresponding to the MHC multimer and that have beenpulsed with the polypeptide comprising the candidate epitope sequence to the APCs that do not express an MHC molecule corresponding to the MHC multimer and that have been pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence is from 99: 1 to 1 :99. In some embodiments, the ratio of the APCs that express an MHC molecule corresponding to the MHC multimer and that have been pulsed with the polypeptide comprising the candidate epitope sequence to the APCs that do not express an MHC molecule corresponding to the MHC multimer and that have been pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence is from 95:5 to 5 :95. In some embodiments, the ratio is from 90:10 to 10:90. In some embodiments, the ratio of the APCs that express an MHC molecule corresponding to the MHC multimer and that have been pulsed with the polypeptide comprising the candidate epitope sequence to the APCs that do not express an MHC molecule corresponding to the MHC multimer and that have been pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence is from 80:20 to 20:80. In some embodiments, the ratio of the APCs that express an MHC molecule corresponding to the MHC multimer and that have been pulsed with the polypeptide comprising the candidate epitope sequence to the APCs that do not express an MHC molecule corresponding to the MHC multimer and that have been pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence is from 70:30 to 30:70. In some embodiments, the ratio of the APCs that express an MHC molecule corresponding to the MHC multimer and that have been pulsed with the polypeptide comprising the candidate epitope sequence to the APCs that do not express an MHC molecule corresponding to the MHC multimer and that have been pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence is from 60:40 to 40:60. In some embodiments, the ratio of the APCs that express an MHC molecule corresponding to the MHC multimer and that have been pulsed with the polypeptide comprising the candidate epitope sequence to the APCs that do not express an MHC molecule corresponding to the MHC multimer and that have been pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence is about 50:50. In some embodiments, the MHC molecule is an MHC molecule described herein, such as an HLA-A02 (e.g., HLA-A02.01) or an HLA-A03 (e.g., HLA- A03.01).

[0144] In some embodiments, the population of immune cells are from a PBMC sample. In some embodiments, the population of immune cells is a cell line. In some embodiments, the population of immune cells are isolated from a healthy subject.

[0145] In some embodiments, the method comprises preparing a vaccine using the polypeptide sequence from the protein encoded by the genome of the pathogen associated with the infectiousdisease. In some embodiments, the vaccine comprises a ribonucleic acid (RNA) sequence encoding the polypeptide. In some embodiments, the RNA sequence encodes two or more polypeptide sequences. In some embodiments, the RNA sequence encodes 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polypeptide sequences each from a different protein encoded by the genome of the pathogen associated with the infectious disease. In some embodiments, the RNA sequence encodes 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polypeptide sequences each from a different epitope encoded by the genome of the pathogen associated with the infectious disease. In some embodiments, the two or more polypeptide sequences are from the same protein. In some embodiments, the two or more polypeptide sequences are each from different proteins. In some embodiments, the RNA sequence encodes 2 polypeptide sequences. In some embodiments, the RNA sequence encodes 3 polypeptide sequences. In some embodiments, the RNA sequence encodes 4 polypeptide sequences. In some embodiments, the RNA sequence encodes 5 polypeptide sequences. In some embodiments, the RNA sequence encodes 6 or more polypeptide sequences. In some embodiments, the RNA sequence comprises a sequence encoding an MHC class I trafficking signal (MITD) sequence. In some embodiments, the RNA sequence comprises a sequence encoding a linker. In some embodiments, the RNA sequence comprises a sequence encoding a signal peptide. In some embodiments, the RNA sequence comprises a sequence encoding an MHC class I trafficking signal (MITD) sequence and a linker. In some embodiments, the RNA sequence comprises a sequence encoding an MHC class I trafficking signal (MITD) sequence and a signal peptide. In some embodiments, the RNA sequence comprises a sequence encoding a linker and a signal peptide. In some embodiments, the RNA sequence comprises a sequence encoding an MHC class I trafficking signal (MITD) sequence, a linker, and a signal peptide.

[0146] In some embodiments, the epitope sequence of the peptide :MHC complex is present at a level in the population of cells comprising APCs that is undetectable by mass spectrometry. In some embodiments, the pathogen is a pathogen that only infects human cells. In some embodiments, the protein encoded by the genome of the pathogen associated with the infectious disease is expressed by human cell infected with the pathogen, but is not expressed by non-human cell infected with the pathogen. In some embodiments, the epitope sequence of the peptideMHC complex is present at a level in the population of cells comprising APCs that is undetectable by mass spectrometry and the pathogen is a pathogen that only infects human cells. In some embodiments, the epitope sequence of the peptide:MHC complex is present at a level in the population of cells comprising APCs that is undetectable by mass spectrometry and the protein encoded by the genome of the pathogen associated with the infectious disease is expressed by human cell infected with the pathogen, but is not expressed by non-human cell infected with thepathogen. In some embodiments, the pathogen is a pathogen that only infects human cells and the protein encoded by the genome of the pathogen associated with the infectious disease is expressed by human cell infected with the pathogen, but is not expressed by non-human cell infected with the pathogen. In some embodiments, the epitope sequence of the peptide:MHC complex is present at a level in the population of cells comprising APCs that is undetectable by mass spectrometry, the pathogen is a pathogen that only infects human cells, and the protein encoded by the genome of the pathogen associated with the infectious disease is expressed by human cell infected with the pathogen, but is not expressed by non-human cell infected with the pathogen.Identifying an Antigen Recognizable by a TCR

[0147] Provided herein is a method of identifying an antigen from an infectious disease caused by a pathogen that is recognizable by a T-cell receptor (TCR) from a subject. In some cases, the subject is a human.

[0148] In some emb odiments, the method comprises contacting a population of T cells expressing TCRs with a plurality of antigen-presenting cells (APCs) presenting a candidate antigen from the pathogen, wherein a subset of T cells expressing a subset of TCRs recognizing the antigen are activated. In some embodiments, the method comprises contacting one or more TCRs from the subset of TCRs with a cell infected by the pathogen. In some cases, the cell presents an epitope in complex with a major histocompatibility complex (MHC) molecule from an antigen of the pathogen naturally processed within the cell. In some embodiments, the one or more TCRs recognize the epitope. In some embodiments, the method comprises identifying the candidate antigen as an antigen capable of being recognized by a T-cell receptor (TCR) from a subject. In some embodiments, the method comprises identifying the one or more TCRs from the subset of T cells expressing the subset of TCRs. In some embodiments, the method comprises identifying the one or more TCRs from the subset of T cells expressingthe subset of TCRs prior to contacting one or more TCRs from the subset of TCRs with a cell infected by the pathogen.

[0149] In some embodiments, the method comprises identifying in an in vitro assay one or more TCRs that recognize a candidate antigen from the pathogen. In some embodiments, identifying comprises identifying the one or more TCRs by sequencing. Any suitable sequencing methods can be used, for example, 1 OX single cell sequencing and 1 OX software to identify the CDRs. In some embodiments, sequencing identifies the CDR1, CDR2, and CDR3 regions of the one or more TCRs. In some embodiments, sequencing identifies the CDR3 regions of the one or more TCRs. In some embodiments, the method comprises selecting the one or more TCRs. In some embodiments, the method comprises selectingthe one or more TCRs prior to contacting one or more TCRs from the subset of TCRs with a cell infected by the pathogen. In some embodiments, the method comprises expressingthe one or more TCRs recombinantly in one or more cells. Insome embodiments, the method comprises expressingthe one or more TCRs recombinantly in one or more cells prior to contacting one or more TCRs from the subset of TCRs with a cell infected by the pathogen. In some embodiments, the one or more cells comprise PBMCs. In some embodiments, the one or more cells comprise a cell line. In some embodiments, the cell line is a Jurkat cell line. In some embodiments, the one or more TCRs comprise the TCRthat is expressed by the subject.

[0150] In some embodiments, the method comprises preparing a vaccine. In some embodiments, the vaccine comprises a polypeptide comprising the candidate antigen. In some embodiments, the vaccine comprises a polynucleotide encoding the polypeptide comprising the candidate antigen. In some embodiments, the vaccine comprises a ribonucleic acid (RNA) sequence encoding the polypeptide. In some embodiments, the RNA sequence encodes two or more polypeptide sequences. In some embodiments, the RNA sequence encodes 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polypeptide sequences each from a different protein encoded by the genome of the pathogen associated with the infectious disease. In some embodiments, the RNA sequence encodes 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polypeptide sequences each from a different protein encoded by the genome of the pathogen associated with the infectious disease. In some embodiments, the two or more polypeptide sequences are from the same protein. In some embodiments, the two or more polypeptide sequences are each fromdifferentproteins. In some embodiments, the RNA sequence encodes 2 polypeptide sequences. In some embodiments, the RNA sequence encodes 3 polypeptide sequences. In some embodiments, the RNA sequence encodes 4 polypeptide sequences. In some embodiments, the RNA sequence encodes 5 polypeptide sequences. In some embodiments, the RNA sequence encodes 6 or more polypeptide sequences. In some embodiments, the RNA sequence comprises a sequence encoding an MHC class I trafficking signal (MITD) sequence. In some embodiments, the RNA sequence comprises a sequence encoding a linker. In some embodiments, the RNA sequence comprises a sequence encoding a signal peptide. In some emb odiments, the RNA sequence comprises a sequence encoding an MHC class I trafficking signal (MITD) sequence and a linker. In some embodiments, the RNA sequence comprises a sequence encoding an MHC class I trafficking signal (MITD) sequence and a signal peptide. In some embodiments, the RNA sequence comprises a sequence encoding a linker and a signal peptide. In some emb odiments, the RNA sequence comprises a sequence encoding an MHC class I trafficking signal (MITD) sequence, a linker, and a signal peptide.Identifying a TCR

[0151] Provided herein is a method of identifying a T-cell receptor (TCR) that recognizes an antigen from an infectious disease caused by a pathogen in complex with a major histocompatibility complex (MHC) molecule.

[0152] In some embodiments, the method comprises, contacting a population ofT cells expressing candidate TCRs with a plurality of antigen-presenting cells (APCs) presenting antigens from the infectious disease. In some embodiments, the population of T cells comprises a subset of T cells that is activated. In some embodiments, the sub set of T cells expresses a sub set of candidate TCRs recognizing the antigens from the infectious disease are activated. In some embodiments, the method comprises identifying one or more TCRs from the sub set of T cells expressing the subset of candidate TCRs. In some embodiments, the method comprisescontactingthe one or more TCRs with a cell infected by the pathogen. In some embodiments, at least one TCR of the one or more TCRs recognizing an antigen presented by an MHC molecule of the cell is activated. In some embodiments, activation is determined using an activation assay or an activation marker as described herein. In some embodiments, the method comprises selecting the at least one TCR recognizing the antigen presented by the MHC molecule of the cell, thereby identifying the TCR In some embodiments, the cell infected by the pathogen is a cell that is infected naturally by the pathogen. In some embodiments, the cell is isolated from a human subject infected by the pathogen. In some embodiments, the cell is infected by the pathogen in vitro. In some embodiments, the cell is a hepatocyte infected by Plasmodium falciparum. In some embodiments, the antigen comprises an epitope that is naturally processed by the cell. In some embodiments, the antigens comprise a sequence of the antigen presented by the MHC molecule of the cell. In some embodiments, the pathogen infects a human subject but lacks ability to infect a non-human subject. In some embodiments, the method comprises expanding the subset of T cells expressing the subset of candidate TCRs recognizing the antigens. In some embodiments, the method comprises expandingthe subset of T cells expressingthe subset of candidate TCRs recognizing the antigens prior to identifying one or more TCRs from the sub set of T cells expressingthe subset of candidate TCRs. In some embodiments, the method comprises sequencing the subset of T cells expressing the subset of candidate TCRs recognizing the antigens. In some embodiments, the method comprises sequencing the subset of T cells expressing the subset of candidate TCRs recognizing the antigens prior to identifying one or more TCRs from the subset of T cells expressingthe subset of candidate TCRs. In some embodiments, identifying comprisesidentifying the one or more TCRs from the sequencing. Any suitable sequencing methods can be used, for example, 10X single cell sequencing and 10X software to identify the CDRs. In some embodiments, contacting comprises contacting cells expressingthe one or more TCRs with the cell infected by the pathogen.Activation Assay

[0153] Assays testing activation of the T cells can be used in the methods described herein.

[0154] In some embodiments, an activation assay comprises detecting an activation marker. The activation marker can be a cell surface marker. The activation marker can be a T cell activation marker. In some embodiments, an activation assay comprises detecting a T cell activation marker by flow cytometry . A flow cytometry experiment can include contacting a population of cells with a plurality of marker-specific antibodies bound to fluorophores (each antibody being bound to a fluorophore with a different excitation / emission profile) and detecting the fluorescence using a flow cytometer which excites using various lasers and detects the fluorophore emissions. In some embodiments, an activation assay comprises detecting a T cell activation marker by an immunoassay. An immunoassay can include contacting a sample containing an analyte of interest (e.g. , an in vitro supernatant) with a plate coated with a capture antibody specific to the analyte of interest and then contacting the sample / capture antibody complex with a secondary antibody conjugated to a moiety that can yield a detectable signal in response to a stimulus, such as electricity, light, or a specific reagent. In some embodiments, the T cell activation marker comprises CD69. In some embodiments, the T cell activation marker comprises CD25. In some embodiments, the T cell activation marker comprises CD40L. In some embodiments, the T cell activation marker comprises CD38. In some embodiments, the T cell activation marker comprises OX-40. In some embodiments, the T cell activation marker comprises 4-1BB. In some embodiments, the T cell activation marker comprises ICOS. In some embodiments, two or more activation markers are detected.

[0155] In some embodiments, an activation assay comprises measuring a secreted cytokine or chemokine via an immunoassay. In some embodiments, the secreted cytokine or chemokine comprises IL-2. In some embodiments, the secreted cytokine or chemokine comprises IFN-y. In some embodiments, the secreted cytokine or chemokine comprises TNF-a. In some embodiments, the secreted cytokine or chemokine comprises IL-6. In some embodiments, the secreted cytokine or chemokine comprises IL-12. In some embodiments, the secreted cytokine or chemokine comprises IL-17A. In some embodiments, the secreted cytokine or chemokine comprises IL-17B. In some embodiments, the secreted cytokine or chemokine comprises IL-17C. In some embodiments, the secreted cytokine or chemokine comprises IL-17D. In some embodiments, the secreted cytokine or chemokine comprises IL-17E. In some embodiments, the secreted cytokine or chemokine comprises IL-17F. In some embodiments, two or more secreted cytokines or chemokines are measured. In some embodiments, a combination of activation markers and secreted cytokines or chemokines are measured.

[0156] In some embodiments, the immunoassay comprises enzyme-linked immunosorbent assay (ELISA). An ELISA assay can include incubating a sample containing an analyte of interest with a primary antibody specific for the analyte of interest and a secondary antibody conjugated to amoiety that can yield a detectable signal in response to exposure to a reagent. In some embodiments, the immunoassay comprises Cytometric Bead Array (CBA). A CBA assay can include incubating a sample containing an analyte of interest with beads coated with antibodies specific for the analyte of interest and a secondary detection antibody specific to the analyte of interest conjugated to a fluorophore and subsequently analyzing the sample using a flow cytometer. In some embodiments, the immunoassay comprises MesoScale Discovery (MSD). A MesoScale Discovery assay caninclude contacting a sample containingan analyte of interest (e.g., an in vitro supernatant) with a plate coated with a capture antibody specific to the analyte of interest and then contacting the sample / capture antibody complex with a secondary antibody conjugated to a moiety that can yield a detectable signal in response an electric current.T cell and TCR Manufacturing

[0157] Generating antigen specific T cells by controlled ex vivo induction or expansion of T cells (e.g., autologous T cells) can provide highly specific and beneficial T cell and T-cell receptors (TCRs). The present disclosure provides T cell manufacturing methods, TCRs, therapeutic T cell compositions which can be used for treating or preventing infectious diseases, for example, the TCRs can be used for validating a whether its cognate epitope sequence is presented by a cell of interest and can be used for validating whether a candidate antigen is suitable for use as a part of a vaccine design. To obtain such TCRs, the first step is to expand and induce antigen specific T cells with a favorable phenotype and function. The present disclosure provides compositions and methods for manufacturing of T cells which can be used for antigen specific T cell therapy (e.g., personal or personalized T cell therapies for treating infectious diseases). The T cell compositions provided herein can be personal antigen specific T cell therapies. The process includes on one hand, identification of the pathogen-specific antigens based on the life cycle of how a particular pathogen infects human body, leading to the production of antigenic peptides or mRN As encoding such antigenic peptides; and on the other hand, preparing activated, antigen specific cells for immunotherapy and identification of functional TCRs that can be used in TCR recognition assays as described herein.Preparing Activated, Antigen-specific T Cells

[0158] Provided herein are methods for stimulating T cells. For example, the methods provided herein can be used to stimulate antigen specific T cells. The methods provided herein can be used to induce or activate T cells. For example, the methods provided herein can be used to expand activated T cells. For example, the methods provided herein can be used to induce naive T cells. For example, the methods provided herein can be used to expand antigen specific CD8+ T cells. For example, the methods provided herein can be used to expand antigen specific CD4+ T cells.For example, the methods provided herein can be used to expand antigen specific CD8+T cells having memory phenotype. For example, the therapeutic compositions can comprise antigen specific CD8+ T cells. For example, the therapeutic compositions can comprise antigen specific memory T cells.

[0159] T cells can be activated ex vivo with a composition comprising antigenic peptides or polynucleotides encoding the antigenic peptides.

[0160] T cells can be activated ex vivo with a composition comprising antigen loaded antigen- presenting cells.

[0161] In some embodiments, the APCs and / or T cells are derived from a biological sample which is obtained from a subject.

[0162] In some embodiments, the APCs and / or T cells are derived from a biological sample which is peripheral blood mononuclear cells (PBMC).

[0163] In some embodiments, the subjectis administered FLT3L prior to obtainingthe biological sample for preparing the APCs and / or T cells.

[0164] In some embodiments, the APCs and / or T cells are derived from a biological sample, for example, from healthy human donors.

[0165] In some embodiments antigen-presenting cells are first loaded with antigenic peptides ex vivo and used to prepare antigen activated T cells. In some embodiments, the compositions provided herein comprise T cells that are stimulated by APCs, such as APCs pre-loaded with antigen peptides. The compositions can comprise a population of immune cells comprising T cells from a sample (e.g., a biological sample), wherein the T cells comprise APC-stimulated T cells. In some embodiments, mRNA encoding one or more antigenic peptides are introduced into APCs for expression of the antigenic peptides. In some embodiments, the mRNA comprises an RNA sequence encoding an MHC class I trafficking signal (MITD) sequence. In some embodiments, the mRNA comprises an RNA sequence encoding a linker. In some embodiments, the mRNA comprises an RNA sequence encoding a signal peptide. In some embodiments, the mRNA comprises an RNA sequence encoding an MHC class I trafficking signal (MITD) sequence and a linker. In some embodiments, mRNA comprises an RNA sequence encoding an MHC class I trafficking signal (MITD) sequence and a signal peptide. In some embodiments, the mRNA comprises an RNA sequence encoding a linker and a signal peptide. In some embodiments, the mRNA comprises an RNA sequence encoding an MHC class I trafficking signal (MITD) sequence, a linker, and a signal peptide. Such APCs are used for stimulating or activating T cells.

[0166] In some embodiments, the biological sample comprises a percentage of the at least one antigen specific T cell in the composition is at least about 0.00001%, 0.00002%, 0.00005%, 0.0001%, 0.0005%, 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%. In some embodiments, thebiological sample comprises less than 0.0001%, 0.0005%, 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%. 1%, 2%, 3%, 4%, 5%, or less than 10% antigen activated T cells of the total cell count in the biological sample that is derived from peripheral blood or leukapheresis. In some embodiments, thebiological sample comprises less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30% antigen activated T cells of the total cell count in the biological sample that is derived from peripheral blood.

[0167] In some embodiments, the biological sample comprises antigen naive T cells. In some embodiments, the biological sample comprises greater than about 0.00001%, 0.00002%, 0.00005%, 0.0001%, 0.0005%, 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% antigen naive cells of the total cell count in the biological sample that is derived from peripheral blood or leukapheresis.

[0168] In some embodiments, a percentage of at least one antigen specific CD8+ T cell in the composition is less than about 0.00001%, 0.00002%, 0.00005%, 0.0001%, 0.0005%, 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5% in the biological sample derived from peripheral blood or leukapheresis. In some embodiments, a percentage of at least one antigen specific CD4+T cell in the composition is at least about 0.00001%, 0.00002%, 0.00005%, 0.0001%, 0.0005%, 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, of in the biological sample derived from peripheral blood or leukapheresis.

[0169] In some embodiments, a percentage of the at least one antigen specific T cell in the biological sample is at most about 0.00001%, 0.00005%, 0.0001%, 0.0005%, 0.001%, 0.005%, 0.01%, 0.05%, 0.1% or 0.5% of the total immune cells. In some embodiments, a percentage of at least one antigen specific CD8+ T cell in the biological sample is at most about 0.00001%, 0.00005%, 0.0001%, 0.0005%, 0.001%, 0.005%, 0.01%, 0.05%, 0.1% or 0.5% of the total immune cells. In some embodiments, a percentage of at least one antigen specific CD4+ T cell in the biological sample is at most about 0.00001%, 0.00005%, 0.0001%, 0.0005%, 0.001%, 0.005%, 0.01%, 0.05%, 0.1% or 0.5% of the total immune cells. In some embodiments, a percentage of antigen specific T cells in the biological sample is at most about 0.5%. In some embodiments, a percentage of antigen specific CD8+ T cells in the biological sample is at most about 0.5%. In some embodiments, a percentage of antigen specific CD4+ T cells in the biological sample is at most about 0.5% in the biological sample.Preparing antigen loaded APCs

[0170] In some embodiments, a composition comprises a population of immune cells that has been incubated with one or more cytokines, growth factors or ligands, such as a ligand that bindsto a cell surface receptor of an APC or a T cell. Examples of such cytokines, growth factors and ligands include, for example, GM-CSF, IL-4, IL-7, FLT3L, TNF-a, IL-1 p, IL-15, PGE1, IL-6, IFN-a, INF-y, R848, LPS, ss-rna40, and poly(LC). In some embodiments, a composition comprises a population of immune cells that has been incubated with one or more APCs or APC preparations. For example, a composition can comprise a population of immune cells thathas been incubated with one or more cytokine, growth factor and / or ligand stimulated APCs or cytokine, growth factor and / or ligand stimulated APC preparations. For example, a composition can comprise a population of immune cells that has been incubated with one or more cytokine stimulated APCs or cytokine stimulated APC preparations. For example, a composition can comprise a population of immune cells that have been incubated with one or more growth factor stimulated APCs or growth factor stimulated APC preparations. For example, a composition can comprise a population of immune cells thathas been incubated with one or more ligand stimulated APCs or ligand stimulated APC preparations.

[0171] In some embodiments, the APC is an autologous APC, an allogenic APC, or an artificial APC. In some embodiments, the APC is an artificial APC.

[0172] Immune cells can be characterized by cell surface molecules. In some embodiments the immune cells are preferably selected based on the cell surface markers, for example, from the biological sample, by using antibodies that can bind to the cell surface receptors. In some embodiments some cells are negatively selected to enrich one or more cell types that do not express the cell surface molecule that they are negatively selected for.

[0173] In some embodiments, antigen-presenting cells (APCs) are prepared from the biological sample by selecting from APCs or precursor cells that can be cultured in presence of antigenic peptides to generate antigen-loaded APCs, which are used for activating T cells. Some of the related cell surface markers for selecting and / or enriching for a set of cells is described below.

[0174] CD1 (cluster of differentiation 1) is a family of glycoproteins expressed on the surface of various human antigen-presenting cells. They are related to the class I MHC molecules, and are involved in the presentation of lipid antigens to T cells.

[0175] C DI lb or Integrin alpha M (ITGAM) is one protein subunit that forms heterodimeric integrin alpha-M beta-2 (aM2) molecule, also known as macrophage-1 antigen (Mac-1) or complement receptor 3(CR3). ITGAM is also known as CR3 A, and cluster of differentiation molecule l ib (CDl lb). The second chain of aM02 is the common integrin 02 subunit known as CD18, and integrin aM02 thus belongs to the 02subfamily (or leukocyte) integrins. aM02 is expressed on the surface of many leukocytes involved in the innate immune system, including monocytes, granulocytes, macrophages, and natural killer cells. lt mediates inflammation by regulating leukocyte adhesion and migration and has been implicated in severalimmune processes such as phagocytosis, cell-mediated cytotoxicity, chemotaxis and cellular activation. It is involved in the complement system due to its capacity to bind inactivated complement component 3b (iC3b). The ITGAM (alpha) subunit of integrin aM2 is directly involved in causing the adhesion and spreading of cells but cannot mediate cellular migration without the presence of the 2 (CD 18) subunit.

[0176] CD 11c, also known as Integrin, alpha X (complement component 3 receptor 4 subunit) (ITGAX), is a gene that encodes for CD11c. CD11c is an integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties ofthe alphaMbeta 2 integrin in the adherence of neutrophils andmonocytes to stimulated endothelium cells, and in the phagocytosis of complement coatedparticles. CDl lcis a type I transmembrane protein found at high levels on most human dendritic cells, but also on monocytes, macrophages, neutrophils, and some B cells that induces cellular activation and helps trigger neutrophil respiratory burst; expressed in hairy cell leukemias, acute nonlymphocytic leukemias, and some B-cell chronic lymphocytic leukemias.

[0177] CD14 is a surface antigen thatis preferentially expressed on monocytes / macrophages. It cooperates with other proteins to mediate the innate immune response to bacterial lipopolysaccharide. Alternative splicing results in multiple transcript variants encoding the same protein. CD14 exists in two forms, one anchored to the membrane by a glycosylphosphatidylinositol tail (mCD14), the other a soluble form (sCD14). Soluble CD14 either appears after shedding of mCD14(48 kDa) oris directly secreted from intracellular vesicles (56 kDa). CD14 acts as a co-receptor (along with the Toll-like receptor TLR4 and MD-2) for the detection of bacterial lipopolysaccharide (LPS). CD14 can bind LPS only in the presence of lipopolysaccharide-bindingprotein(LBP). Although LPS is consideredits main ligand, CD14 also recognizes other pathogen-associated molecular patterns such as lipoteichoic acid.

[0178] CD25 is expressed by conventional T cells after stimulation, and it has been shown that in human peripheral blood, only the CD4+CD25hiT cells are 'suppressors'.

[0179] In some embodiments, the APC comprises a dendritic cell (DC). In some embodiments, the APC is derived from a CD14+ monocyte. In some embodiments, the APCs can be obtained from skin, spleen, bone marrow, thymus, lymph nodes, peripheral blood, or cord blood. In some embodiments, the CD14+ monocyte is from a biological sample from a subject comprising PBMCs. For example, a CD 14+ monocyte can be isolated from, enriched from, or purified from a biological sample from a subject comprisingPBMCs. In some embodiments, the CD 14+ monocyte is stimulated with one or more cytokines or growth factors. In some embodiments, the one or morecytokines or growth factors comprise GM-CSF, IL-4, FLT3L, TNF-a, IL-1 , PGE1, IL-6, IL-7, IL-15, IFN-y, IFN-a, R848, LPS, ss-ma40, poly I:C, or a combination thereof. In some embodiments, the CD14+ monocyte is from a second biological sample comprising PBMCs.

[0180] In some embodiments, an isolated population of APCs can be enriched or substantially enriched. In some embodiments, the isolated population of APCs is at least 30%, at least 50%, at least 75%, or at least 90% homogeneous. In some embodiments, the isolated population of APCs is at least 60%, at least 75%, or at least 90% homogeneous. APCs, such as APCs can include, for example, APCs derived in culture from monocytic dendritic precursors as well as endogenously- derived APCs present in tissues such as, for example, peripheral blood, cord blood, skin, spleen, bone marrow, thymus, and lymph nodes.

[0181] APCs and cell populations substantially enriched for APCs can be isolated by methods also provided by the present invention. The methods generally include obtaining a population of cells that includes APC precursors, differentiation of the APC precursors into immature or mature APCs, and can also include the isolation of APCs from the population of differentiated immature or mature APCs.

[0182] APC precursor cells can be obtained by methods known in the art. APC precursors can be isolated, for example, by density gradient separation, fluorescence activated cell sorting (FACS), immunological cell separation techniques such as panning, complement lysis, resetting, magnetic cell separation techniques, nylon wool separation, and combinations of such methods. Methods for immuno-selecting APCs include, for example, using antibodies to cell surface markers associated with APC precursors, such as anti-CD34 and / or anti-CD14 antibodies coupled to a substrate.

[0183] Enriched populations of APC precursors can also be obtained. Methods for obtaining such enriched precursor populations are known in the art. For example, enriched populations of APC precursors can be isolated from a tissue source by selective removal of cells that adhere to a substrate. Using a tissue source such as, e.g., bone marrow or peripheral blood, adherent monocytes can be removed from cell preparations using a commercially-treated plastic substrate (e.g. , beads or magnetic beads) to obtain a population enriched for nonadherent APC precursors.

[0184] Monocyte APC precursors can also be obtained from a tissue source by using an APC precursor-adhering substrate. For example, peripheral blood leukocytes isolated by, e.g., leukapheresis, are contacted with a monocytic APC precursor-adhering substrate having a high surface area to volume ratio and the adherent monocytic APC precursors are separated. In additional embodiments, the substrate coupled can be a particulate or fibrous substrate having a high surface-to-volume ratio, such as, for example, microbeads, microcarrier beads, pellets, granules, powder, capillary tubes, microvillous membrane, and the like. Further, the particulate orfibrous substrate can be glass, polystyrene, plastic, glass-coated polystyrene microbeads, and the like.

[0185] The APC precursors can also be cultured in vitro for differentiation and / or expansion. Methods for differentiation / expansion of APC precursors are known in the art. Generally, expansion can be achieved by culturing the precursors in the presence of at least one cytokine that induces APC (e.g., dendritic cell) differentiation / proliferation. Typically, these cytokines are granulocyte colony stimulating factor (G-CSF) or granulocyte / macrophage colony stimulating factor (GM-CSF). In addition, other agents can be used to inhibit proliferation and / or maturation of non-APC cell types in the culture, thereby further enriching the population of APC precursors. Typically, such agents include cytokines such as, e.g., IL-13, IL-4, or IL-15, and the like.

[0186] The isolated populations of APC precursors are cultured and differentiated to obtain immature or mature APCs. Suitable tissue culture media include, for example, AIM-V®, RPMI 1640, DMEM, X-VIVO, and the like. The tissue culture media is typically supplemented with amino acids, vitamins, divalent cations, and cytokines to promote differentiation of the precursors toward the APC phenotype. Typically, the differentiation-promoting cytokines are GM-CSF and / or IL-4.

[0187] Further, cultures of APC precursors during expansion, differentiation, and maturation to the APC phenotype can include plasma to promote the development of APCs. A typical plasma concentration is about 5%. In addition, where, for example, APC precursors are isolated by adherence to a substrate, plasma can be included in the culture media during the adherence step to promote the CD 14+ phenotype early in culture. A typical plasma concentration during adherence is about 1% or more.

[0188] The monocytic APC precursors can be cultured for any suitable time. In certain embodiments, suitable culture times for the differentiation of precursors to immature APCs can be about 1 to about 10 days, e.g., about 4 to about ? days. The differentiation of immature APCs from the precursors can be monitored by methods known to those skilled in the art, such as by the presence or absence of cell surface markers (e.g., CDl lc+, CD83low, CD86_ / low, HLA-DR+). Immature APCs can also be cultured in appropriate tissue culture medium to maintain the immature APCs in a state for further differentiation or antigen uptake, processing and presentation. For example, immature APCs can be maintained in the presence of GM-CSF and IL-4.

[0189] In some embodiments, APC precursors can be isolated prior to differentiation. In some embodiments, the isolated population can be enriched or substantially enriched for APC precursors. In some embodiments, APC precursors are isolated with a CD 14 specific probe. In one exemplary embodiment, CD 14 expressing cells are detected by FACS using a CD 14 specificprobe either directly conjugated to a fluorescent molecule (e.g. , FITC or PE) or with an unlabeled antibody specific for CD14 and a labeled second antibody specific for the first antibody. CD14+ cells can also be separated from CD14lowand CD14- cells by FACS sorting. Gating for CD14hi^ positivity can be determined in reference to CD 14 staining on, e.g. , PBMC-derived monocytes. Typically, the CD14 specific binding agent is, for example, an anti-CD14 antibody (e.g., monoclonal or antigen binding fragments thereof). A number of anti-CD14 antibodies suitable for use in the present invention are well known to the skilled artisan and many can be purchased commercially. Differentiation into immature APCs (CD 14 negative) can take place following isolation.

[0190] In another embodiment, a CD14 specific probe is coupled to a substrate and the CD14+ cells are isolated by affinity selection. A population of cells that includes CD 14+ cells is exposed to the coupled substrate and the CD14+ cells are allowed to specifically adhere. Non-adhering CD14- cells are then washed from the substrate, and the adherent cells are then eluted to obtain an isolated cell population substantially enriched in APC precursors. The CD 14 specific probe can be, for example, an anti-CD14 antibody. The substrate can be, for example, commercially available tissue culture plates or beads (e.g., glass or magnetic beads). Methods for affinity isolation of cell populations using substrate-coupled antibodies specific for surface markers are generally known.

[0191] During culture, immature APCs can optionally be exposed to a predetermined antigen. Suitable predetermined antigens can include any antigen for which T-cell modulation is desired. Antigens can include, for example, bacterial cells, viruses, partially purified or purified bacterial, viral, fungal, protozoan, or helminth antigens, recombinant cells expressing an antigen on its surface, and any other antigen. Any of the antigens can also be presented as a peptide or recombinantly produced protein or portion thereof. Following contact with antigen, the cells can be cultured for any suitable time to allow antigen uptake and processing, to expand the population of antigen-specific APCs, and the like.

[0192] For example, in one embodiment, the immature APCs can be cultured following antigen uptake to promote maturation of the immature APCs into mature APCs that present antigen in the context of MHC molecules. Methods for APC maturation are known. Such maturation can be performed, for example, by culture in the presence of known maturation factors, such as cytokines (e.g., TNF-a, IL-1 , or CD40 ligand), bacterial products (e.g., LPS or BCG), and the like. The maturation of immature APCs to mature APCs can be monitored by methods known in the art, such as, for example by measuring the presence or absence of cell surface markers (e.g., upregulation of CD83, CD86, and MHC molecules) or testing for the expression of mature APC specific mRNA or proteins using, for example, an oligonucleotide array.

[0193] Optionally, the immature APCs can be cultured in an appropriate tissue culture medium to expand the cell population and / or maintain the immature APCs in state for further differentiation or antigen uptake. For example, immature APCs can be maintained and / or expanded in the presence of GM-CSF and IL-4. Also, the immature APCs can be culturedin the presence of antiinflammatory molecules such as, for example, anti-inflammatory cytokines (e.g., IL-10 and TGF- P) to inhibit immature APC maturation.

[0194] In another aspect, the isolated population of APCs is enriched for mature APCs. The isolated population of mature APCs can be obtained by culturing a differentiated population of immature APCs in the presence of maturation factors as described above (e.g., bacterial products, and / or proinflammatory cytokines), thereby inducing maturation. Immature APCs can be isolated by removing CD 14+ cells.

[0195] According to yet another aspect of the invention, APCs can be preserved, e.g., by cryopreservation either before exposure or following exposure to a suitable antigen. Cryopreservation agents which can be used include dimethyl sulfoxide (DMSO), glycerol, polyvinylpyrrolidone, polyethylene glycol, albumin, dextran, sucrose, ethylene glycol, i- erythritol, D-ribitol, D-mannitol, D-sorbitol, i-inositol, D-lactose, choline chloride, amino acids, methanol, acetamide, glycerol monoacetate, and inorganic salts. A controlled slow cooling rate can be critical. Different cryoprotective agents and different cell types may have different optimal cooling rates. The heat of fusion phase where water turns to ice typically can be minimal. The coolingprocedure canbe carriedoutby use of, e.g., a programmable freezingdeviceor a methanol bath procedure. Programmable freezing apparatuses allow determination of optimal cooling rates and facilitate standard reproducible cooling. Programmable controlled-rate freezers such as Cryomed or Planar permit tuning of the freezing regimen to the desired cooling rate curve.

[0196] After thorough freezing, APCs can be rapidly transferred to a long-term cryogenic storage vessel. In a typical embodiment, samples can be cryogenically stored in liquid nitrogen (-196 °C) or its vapor (-165 °C). Considerations and procedures for the manipulation, cry opreservation, and long term storage of hematopoietic stem cells, particularly from bone marrow or peripheral blood, is largely applicable to the APCs of the invention.

[0197] Frozen cells are preferably thawed quickly (e.g., in a water bath maintained at 37-41 °C) and chilled immediately upon thawing. It can be desirable to treat the cells in order to prevent cellular clumping upon thawing. To prevent clumping, various procedures can be used, including the addition before and / or after freezing of DNase, low molecular weight dextran and citrate, hydroxyethyl starch, and the like. The cryoprotective agent, if toxic in humans, can be removed prior to therapeutic use of the thawed APCs. One way in which to remove the cryoprotective agent is by dilution to an insignificant concentration. Once frozen APCs have been thawed andrecovered, they can be used to activate T cells as described herein with respect to non-frozen APCs.

[0198] In one aspect, a composition for T cell activation comprises a population of immune cells that has been depleted of one or more types of immune cells. For example, a composition can comprise a population of immune cells that has been depleted of one or more types of immune cells that express one or more proteins, such as one or more cell surface receptors. In some embodiments, a composition comprises a population of immune cells from a biological sample comprising at least one antigen specific T cells comprising a T-cell receptor (TCR) specific to at least one antigen peptide sequence, wherein an amount of CD 14 and / or CD25 expressing immune cells in the population is proportionally different from an amount of immune cells expressing CD14 and / or CD25 in the biological sample. For example, a composition can comprise a population of immune cells from a biological sample comprising at least one antigen specific T cells comprising a T-cell receptor (TCR) specific to atleast one antigen peptide sequence, wherein an amount of CD 14 expressing immune cells in the population is proportionally different from an amount of immune cells expressing CD 14 in the biological sample. For example, a composition can comprise a population of immune cells from a biological sample comprising at least one antigen specific T cells comprising a T-cell receptor (TCR) specific to at least one antigen peptide sequence, wherein an amount of CD25 expressing immune cells in the population is proportionally differentfrom an amount of immunecellsexpressingCD25 in the biological sample. For example, a composition can comprise a population of immune cells from a biological sample comprising at least one antigen specific T cells comprising a T-cell receptor (TCR) specific to at least one antigen peptide sequence, wherein an amount of CD 14 and CD25 expressing immune cells in the population is proportionally different from an amount of immune cells expressing CD14 and CD25 in the biological sample. For example, a composition can comprise a population of immune cells from a biological sample, wherein an amount of immune cells expressing CD 14 and CD25 in the population is proportionally less than an amount of immune cells expressing CD 14 and CD25 in the biological sample.

[0199] Provided herein is a method of preparing antigen-specific T cells ex vivo, the method comprises (a) depleting CD14+ cells and / or CD25+ cells from a population of immune cells comprising antigen-presenting cells (APCs) and T cells, thereby forming a CD14 and / or CD25 depleted population of immune cells comprising a first population of APCs and T cells, wherein the population of immune cells is from a biological sample from a human subject; (b) incubating the first population of APCs and T cells from (a) for a first time period in the presence of: (i) FMS-like tyrosine kinase 3 receptor ligand (FLT3L), and (ii) (A) a polypeptide comprising an epitope sequence, wherein the epitope sequence is from a protein encoded by the genome of apathogen associated with an infectious disease, or (B) a polynucleotide encoding the polypeptide;; thereby forming a population of cells comprising stimulated T cells; (c) expanding the stimulated T cells from (b), thereby forming an expanded population of cells comprising antigen-specific T cells, wherein the antigen-specific T cells express a T-cell receptor (TCR) specific to a peptide :MHC complex comprising: (i) a peptide consisting of the epitope sequence from the protein encoded by the genome of the pathogen associated with the infectious disease, and (ii) an MHC molecule expressed by the APCs of the population of immune cells of (a).

[0200] In some embodiments, the expanded population of cells comprises from at least 5x105to at least 5x1011total cells. In some embodiments, the expanded population of cells comprises at least 1x106total cells. In some embodiments, the expanded population of cells comprises at least 5xl06total cells. In some embodiments, the expanded population of cells comprises at least IxlO7total cells. In some embodiments, the expanded population of cells comprises at least 5xl07total cells. In some embodiments, the expanded population of cells comprises at least IxlO8total cells. In some embodiments, the expanded population of cells comprises at least 5xl08total cells. In some embodiments, the expanded population of cells comprises at least IxlO9total cells. In some embodiments, the expanded population of cells comprises at least 5xl09total cells. In some embodiments, the expanded population of cells comprises at least IxlO10total cells. In some embodiments, the expanded population of cells comprises at least5xl010total cells. In some embodiments, the expanded population of cells comprises at leastIxlO11total cells. In some embodiments, the expanded population of cells comprises at least5xl0ntotal cells. In some embodiments, the expanded population of cells comprises from IxlO8to IxlO11total cells. In some embodiments, the expanded population of cells comprises from 0.75xl08to 1.25xl010total cells. In some embodiments the expanded population of cells comprises from 5x108to IxlO9total cells. In some embodiments, the expanded population of cells comprises 5xl08to IxlO9total cells. In some embodiments, the expanded population of cells comprises 5xl08to 2xl09total cells.

[0201] In some embodiments, the subject is pretreated with FLT3L at least about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 12 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, or 1 week before isolation of PBMC or leukapheresis. In some embodiments, the subject is pretreated with FLT3L at least about 1 week, 2 weeks, 3 weeks, 4 weeks, or 5 weeks before isolation of PBMC or leukapheresis.

[0202] In some embodiments, the cell population is enriched for CDl lc+ cells. In some embodiments, the antigen loaded APC comprises dendritic cells (DCs). In some embodiments, the antigen loaded APC comprises plasmacytoid dendritic cells (pDCs). In some embodiments, the antigen loaded APC comprises CDlc+DCs. In some embodiments, the antigen loaded APCcomprises CD141 + DCs. In some embodiments, the cell population comprises macrophages. In some embodiments, the method further comprises reducing or depleting CD19+ cells from the cell population for activating or enriching antigen activated T cells. In some embodiments, the method further comprises reducing or depleting both CD1 lb+ and CD19+ cells from the cell population for activating or enriching antigen activated T cells.

[0203] In some embodiments, the method further comprises reducing or depleting CD 14+ cells from the cell population for preparing and enriching antigen activated T cells. In some embodiments, the method further comprises reducing or depleting CD25+ cells from the cell population for preparing and enriching antigen activated T cells. In some embodiments, the method further comprises reducing or depleting one or more of CD19+, CD14+, CD25+ or CD1 lb+ cells from the cell population for activating or enriching antigen activated T cells. In some embodiments, depleting comprises depleting CD 14+ cells directly from a washed peripheral blood mononuclear cell (PBMC) sample from a human subject. In some embodiments, depleting comprises depleting CD25+ cells directly from a washed peripheral blood mononuclear cell (PBMC) sample from a human subject. In some embodiments, depleting comprises depleting CD14+ cells and CD25+ cells directly firom a washed peripheral blood mononuclear cell (PBMC) sample from a human subject. In some embodiments, depleting comprises depleting CD14+ cells directly from a cryopreserved peripheral blood mononuclear cell (PBMC) sample from a human subject. In some embodiments, depleting comprises depleting CD25+ cells directly from a cryopreserved peripheral blood mononuclear cell (PBMC) sample from a human subject. In some embodiments, depleting comprises depleting CD14+ cells and CD25+ cells directly from a cryopreserved peripheral blood mononuclear cell (PBMC) sample from a human subject. In some embodiments, the depleted population of cells is incubated for a first time period in the presence of FLT3L and a polypeptide comprising at least two different epitope sequences. In some embodiments, the depleted population of cells is incubated for a first time period in the presence of FLT3L and a polynucleic acid encoding a polypeptide comprising at least two different epitope sequences. In some embodiments, each of the at least two different epitope sequences is from the same protein encoded by the genome of a pathogen associated with an infectious disease. In some embodiments, each of the at least two different epitope sequences is from a different protein encoded by the genome of a pathogen associated with an infectious disease. In some embodiments, the pathogen is Plasmodium falciparum. In some embodiments, the same protein encoded by the genome of a pathogen associated with an infectious disease is TRAP. In some embodiments, the different protein encoded by the genome of a pathogen associated with an infectious disease comprises TRAP, CSP, LISP1, LSAlb, LSAP2, or a combination thereof. In some embodiments, a first epitope sequence of the at least two different epitope sequences are connected to a secondepitope sequence of the at least 2 different epitope sequences via a linker sequence. In some embodiments, the at least two different epitope sequences are expressed as a single polypeptide chain. In some embodiments, the polypeptide comprises at least 2 to at least 15 or more different epitope sequences from two or more different proteins encoded by the genome of a pathogen associated with an infectious disease. In some embodiments, the polypeptide comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different epitope sequences from two or more different proteins encoded by the genome of a pathogen associated with an infectious disease.

[0204] In some embodiments, the method comprises introducing the polynucleotide encoding the polypeptide or the mRNA encoding the polypeptide into the APCs of the first population of APCs and T cells. In some embodiments, introducing comprises electroporating. In some embodiments, introducing comprises nucleofecting. In some embodiments, introducing is carried out without separating the T cells from the APCs of the first population of APCs and T cells. In some embodiments, the method is performed in less than 35 days. In some embodiments, the method is performed in less than 30 days. In some embodiments, the method is performed in less than 28 days. In some embodiments, the method is performed in less than 25 days. In some embodiments, the method is performed in less than 20 days, in some embodiments, the method is performed in less than 15 days. In some embodiments, the method is performed in less than 10 days. In some embodiments, the method is performed in less than 5 days. In some embodiments, CD8+ antigenspecific T cells are expanded. In some embodiments CD4+ antigen-specific T cells are expanded. In some embodiments, the fraction of CD8+ antigen-specific T cells of the total number of T cells in the expanded population of cells is at least two-fold higher than the fraction of CD8+ antigenspecific T cells of the total number of CD8+T cells in the CD 14 and / or CD25 depleted population of immune cell. In some embodiments, the fraction of CD8+ antigen-specific T cells of the total number of T cells in the expanded population of cells is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3 -fold, atleast4-fold, atleast 5-fold, atleast6-fold, atleast7-fold, atleast 8-fold, at least 9-fold, at least 10-fold higher than the fraction of CD8+ antigen-specific T cells of the total number of CD8+ T cells in the CD 14 and / or CD25 depleted population of immune cell. In some embodiments, the fraction of CD4+ antigen-specific T cells of the total number of T cells in the expanded population of cells is at least two-fold higher than the fraction of CD4+ antigenspecific T cells of the total number of CD4+T cells in the CD 14 and / or CD25 depleted population of immune cell. In some embodiments, the fraction of CD4+ antigen-specific T cells of the total number of T cells in the expanded population of cells is at least 1.5-fold, at least 2-fold, atleast 2.5-fold, at least 3 -fold, atleast4-fold, atleast 5-fold, atleast6-fold, atleast7-fold, atleast 8-fold, at least 9-fold, at least 10-fold higher than the fraction of CD4+ antigen-specific T cells of the total number of CD4+ T cells in the CD 14 and / or CD25 depleted population of immune cell. Insome embodiments, atleast 0.1% of the CD8+ T cells in the expanded population of cells are CD8+ antigen-specific T cells derived from naive CD8+ T cells. In some embodiments, atleast 0.5% of the CD8+ T cells in the expanded population of cells are CD8+ antigen-specific T cells derived from naive CD8+T cells. In some embodiments, atleast 1% of the CD8+ T cells in the expanded population of cells are CD8+ antigen-specific T cells derived from naive CD8+ T cells. In some embodiments, at least 5% of the CD8+ T cells in the expanded population of cells are CD8+ antigen-specific T cells derived from naive CD8+ T cells. In some embodiments, atleast 10% of the CD8+ T cells in the expanded population of cells are CD8+ antigen-specific T cells derived from naive CD8+ T cells. In some embodiments, at least 20% of the CD8+ T cells in the expanded population of cells are CD8+ antigen-specific T cells derived from naive CD8+ T cells. In some embodiments, atleast 30% of the CD8+ T cells in the expanded population of cells are CD8+ antigen-specific T cells derived from naive CD8+ T cells. In some embodiments, atleast 40% of the CD8+ T cells in the expanded population of cells are CD8+ antigen-specific T cells derived from naive CD8+ T cells. In some embodiments, at least 50% of the CD8+ T cells in the expanded population of cells are CD8+ antigen-specific T cells derived from naive CD8+ T cells. In some embodiments, atleast 60% of the CD8+ T cells in the expanded population of cells are CD8+ antigen-specific T cells derived from naive CD8+ T cells. In some embodiments, atleast 70% of the CD8+ T cells in the expanded population of cells are CD8+ antigen-specific T cells derived from naive CD8+ T cells. In some embodiments, at least 80% of the CD8+ T cells in the expanded population of cells are CD8+ antigen-specific T cells derived from naive CD8+ T cells. In some embodiments, atleast 90% of the CD8+ T cells in the expanded population of cells are CD8+ antigen-specific T cells derived from naive CD8+ T cells. In some embodiments, atleast 0.1% of the CD4+ T cells in the expanded population of cells are CD4+ antigen-specific T cells derived from naive CD4+ T cells. In some embodiments, at least 0.5% of the CD4+ T cells in the expanded population of cells are CD4+ antigen-specific T cells derived from naive CD4+ T cells. In some embodiments, at least 1% of the CD4+ T cells in the expanded population of cells are CD4+ antigen-specific T cells derived from naive CD4+ T cells. In some embodiments, atleast 5% of the CD4+ T cells in the expanded population of cells are CD4+ antigen-specific T cells derived from naive CD4+ T cells. In some embodiments, at least 10% of the CD4+ T cells in the expanded population of cells are CD4+ antigen-specific T cells derived from naive CD4+ T cells. In some embodiments, atleast 20% of the CD4+ T cells in the expanded population of cells are CD4+ antigen-specific T cells derived from naive CD4+ T cells. In some embodiments, atleast 30% of the CD4+ T cells in the expanded population of cells are CD4+ antigen-specific T cells derived from naive CD4+ T cells. In some embodiments, at least 40% of the CD4+ T cells in the expanded population of cells are CD4+ antigen-specific T cells derived from naive CD4+ T cells.In some embodiments, at least 50% of the CD4+ T cells in the expanded population of cells are CD4+ antigen-specific T cells derived from naive CD4+ T cells. In some embodiments, at least 60% of the CD4+ T cells in the expanded population of cells are CD4+ antigen-specific T cells derived from naive CD4+ T cells. In some embodiments, at least 70% of the CD4+ T cells in the expanded population of cells are CD4+ antigen-specific T cells derived from naive CD4+ T cells. In some embodiments, at least 80% of the CD4+ T cells in the expanded population of cells are CD4+ antigen-specific T cells derived from naive CD4+ T cells. In some embodiments, at least 90% of the CD4+ T cells in the expanded population of cells are CD4+ antigen-specific T cells derived from naive CD4+ T cells.

[0205] In some embodiments, the expanding comprises contacting the population of cells comprising stimulated T cells with a second population of mature APCs. In some embodiments, the second population of mature APCs have been incubated with FLT3L. In some embodiments, the second population of mature APCs have been incubated with FLT3L for at least 1 day prior to contacting the population of cells comprising stimulated T cells with the second population of mature APCs. In some embodiments, the second population of mature APCs have been incubated with FLT3L for 2 days. In some embodiments, the second population of mature APCs have been incubated with FLT3L for 3 days. In some embodiments, the second population of mature APCs have been incubated with FLT3L for 4 days. In some embodiments, the second population of mature APCs have been incubated with FLT3L for 5 days. In some embodiments, the second population of mature APCs presentthe peptide consisting of the epitope sequence fromthe protein encoded by the genome of the pathogen associated with the infectious disease. In some embodiments, the second population of mature APCs have been incubated with FLT3L and present the peptide consisting of the epitope sequence from the protein encoded by the genome of the pathogen associated with the infectious disease. In some embodiments, expanding comprises expanding the population of cells comprising stimulated T cells for a second time period, thereby forming an expanded population of T cells. In some embodiments, depleting CD 14+ cells from the population of immune cells comprising a first population of APCs and T cells comprises contacting the population of immune cells comprising a first population of APCs and T cells with a CD 14 binding agent. In some embodiments, depleting CD25+ cells from the population of immune cells comprising a first population of APCs and T cells comprises contacting the population of immune cells comprisingafirstpopulation of APCs and T cells with a CD25 binding agent. In some embodiments, depleting CD14+ cells and / or CD25+ cells from the population of immune cells comprising a first population of APCs and T cells comprises contacting the population of immune cells comprisinga first population of APCs and T cells with a CD 14 binding agent and / or a CD25 binding agent.

[0206] In some embodiments the stimulant for activating the cells comprises FL3TL.

[0207] In some embodiments the agent promoting cell growth and maintenance ex vivo comprises a growth factor, a cytokine, an amino acid, a supplement or a combination thereof.

[0208] In some embodiments the antigen loaded APCs can stimulate T cells for 2, 3, 4, 5, 6, or 7 days.

[0209] In some embodiments, the antigenic peptides used to prepare antigen loaded APCs are long peptides comprising at least 20 amino acids, or at least 30 amino acids or at least 40 amino acids or at least 50 amino acids, or any number of amino acids in between. In some embodiments, the antigenic peptides used to prepare antigen loaded APCs comprise the amino acids flanking on either side of the epitope that facilitate endogenous processing of the antigenic peptide for increased rate of presentation to a T cell.

[0210] A longer immunogenic peptide can be designed in several ways. In some embodiments, when HLA-binding peptides are predicted or known, a longer immunogenic peptide could consist of (1) individual binding peptides with extensions of 2-5 amino acids toward the N- and C- terminus of each corresponding gene product; or (2) a concatenation of some or all of the binding peptides with extended sequencesforeach. In other embodiments, when sequencing reveals along (>10 residues) epitope sequence, e.g. , an epitope derived from a protein encoded by a gene in a pathogen (e.g. , due to a frameshift, read-through or intron inclusion that leads to a novel peptide sequence), a longer antigen peptide could consist of the entire stretch of novel antigen-specific amino acids as either a single longer peptide or several overlapping longer peptides. In some embodiments, use of a longer peptide is presumed to allow for endogenous processing by patient cells and can lead to more effective antigen presentation and induction of T cell responses. In some embodiments, two or more peptides can be used, where the peptides overlap and are tiled over the long antigen peptide.

[0211] In some embodiments, each of the plurality of antigenic peptide comprises the same antigenic epitope. In some embodiments the plurality of antigenic peptide comprises more than one antigenic epitope.

[0212] In some embodiments the one or more polynucleotides encoding the plurality of antigen peptides is DNA.

[0213] In some embodiments the one or more polynucleotides encoding the plurality of antigen peptides is inserted in one or more mammalian expression vectors.

[0214] In some embodiments the one or more polynucleotides encoding the plurality of antigen peptides is messenger RNA.

[0215] In some embodiments, the invention provides RNA, oligoribonucleotide, and polyribonucleotide molecules comprising a modified nucleoside.

[0216] In some embodiments, the invention provides gene therapy vectors comprising the RNA, oligoribonucleotide, and polyribonucleotide.

[0217] In some embodiments, the inventionprovides gene therapy methodsandgene transcription silencing methods comprising same.

[0218] In some embodiments the polynucleotide encodes a single antigenic peptide.

[0219] In some embodiments the one polynucleotide encodes more than one antigenic peptide.

[0220] In some embodiments, the polynucleotide is messenger RNA. In some embodiments, each messenger RNA comprises coding sequence for two or more antigenic peptides in tandem.

[0221] In some embodiments each messenger RNA comprises a coding sequence for two, three, four, five, six, seven, eight, nine orten or more antigenic peptides in tandem. Typically, an mRNA comprises a ”-UTR, a protein coding region, and a ”-UTR. mRNA only possesses limited halflife in cells and in vitro. In some embodiments, the mRNA is self-amplifying mRNA. In the context of the present invention, mRNA can be generated by in vitro transcription from a DNA template. The in vitro transcription methodology is known to the skilled person. For example, there is a variety of in vitro transcription kits commercially available.

[0222] The stability and translation efficiency of RNA can be modified. For example, RNA can be stabilized, and its translation increased by one or more modifications having a stabilizing effects and / or increasing translation efficiency of RNA. Such modifications are described, for example, in US Pat. Pub. No. 20230193296 incorporated herein by reference in its entirety. In order to increase expression oftheRNAused accordingto the presentinvention, it can be modified within the coding region, i.e., the sequence encodingthe expressed peptide or protein, without altering the sequence of the expressed peptide or protein, so as to increase the GC-content to increase mRNA stability and to perform a codon optimization and, thus, enhance translation in cells.

[0223] In some embodiments, an mRNA can include multiple antigenic epitopes. In some a mRNA of a large portion of, or even the entire coding region of a gene comprising sequences encoding antigenic peptides are delivered into an immune cell for endogenous processing and presentation of antigens.

[0224] In some embodiments, the coding sequence for each antigenic peptide is 24-120 nucleotides long.

[0225] In some embodiments, the mRNA is 50-10,000 nucleotides long. In some embodiments, the mRNA is 100- 10,000 nucleotides long. In some embodiments, the mRNA is 200-10,000 nucleotides long. In some embodiments, the mRNA is 50-5,000 nucleotides long. In some embodiments, the mRNA is 100-5,000nucleotideslong. In some embodiments, the mRNAis 100- 1,000 nucleotides long. In some embodiments, the mRNA is 300-800 nucleotides long. In someembodiments, the mRNA is 400-700 nucleotides long. In some embodiments, the mRNA is 450- 600 nucleotides long. In some embodiments, the mRNA is at least 200 nucleotides long. In some embodiments the mRNA is greater than 250 nucleotides, greater than 300 nucleotides, greater than 350 nucleotides, greater than 400 nucleotides, greater than 450 nucleotides, greater than 500 nucleotides, greater than 550 nucleotides, greater than 600 nucleotides, greater than 650 nucleotides, greater than 700 nucleotides, greater than 750 nucleotides, greater than 800 nucleotides, greater than 850 nucleotides long, greater than 900 nucleotides long greater than 950 nucleotides long, greater than 1000 nucleotides long, greater than 2000 nucleotides long, greater than 3000 nucleotides long, greater than 4000 nucleotides long or greater than 5000 nucleotides long.

[0226] In some embodiments, mRNA encoding one or more antigenic peptide is modified, wherein the modification relates to the 5 ’-UTR. In some embodiments, the modification relates to providing an RNA with a ’’-cap or 5’- cap analog in the 5 ’-UTR. The term “’’-cap” refers to a cap structure found on the ’’-end of an mRNA molecule and generally consists of a guanosine nucleotide connected to the mRNA via an unusual ” to ” triphosphate linkage. In some embodiments, this guanosine is methylated atthe 7-position. The term “conventional ’’-cap” refers to a naturally occurringRNA ’’-cap, to the 7-methylguanosine cap (m G). In the context of the present invention, the term “’’-cap” includes a ’’-cap analog that resembles the RNA cap structure and is modified to possess the ability to stabilize RNA and / or enhance translation of RNA if attached thereto, in vivo and / or in a cell. In some embodiments, mRNA is capped co- transcriptionally.

[0227] In some embodiments, the mRNA encoding one or more antigenic peptides comprise a 3’- UTR comprising a poly A tail. In some embodiments, the poly A tail is 100-200 bp long. In some embodiments, the poly A tail is longer than 20 nucleotides. In some embodiments, the poly A tail is longer than 50 nucleotides. In some embodiments, the poly A tail is longer than 60 nucleotides. In some embodiments, the poly A tail is longer than 70 nucleotides. In some embodiments, the poly A tail is longer than 80 nucleotides. In some embodiments, the poly A tail is longer than 90 nucleotides. In some embodiments, the poly A tail is longer than 100 nucleotides. In some embodiments, the poly A tail is longer than 110 nucleotides. In some embodiments, the poly A tail is longer than 120 nucleotides. In some embodiments, the poly A tail is longer than 130 nucleotides. In some embodiments, the poly A tail is longer than 140 nucleotides. In some embodiments, the poly A tail is longer than 150 nucleotides. In some embodiments, the poly A tail is longer than 160 nucleotides. In some embodiments, the poly A tail is longer than 170 nucleotides. In some embodiments, the poly A tail is longer than 180 nucleotides. In some embodiments, the poly A tail is longer than 190 nucleotides. In some embodiments, the poly Atail is longer than 200 nucleotides. In some embodiments, the poly A tail is longer than 210 nucleotides. In some embodiments, the poly A tail is longer than 220 nucleotides. In some embodiments, the poly A tail is longer than 230 nucleotides. In some embodiments, the poly A tail is longer than 100 nucleotides. In some embodiments, the poly A tail is longer than 240 nucleotides. In some embodiments, the poly A tail is longer than 100 nucleotides. In some embodiments, the poly A tail is about 250 nucleotides.

[0228] In some embodiments, the poly A tail comprises 100-250 adenosine units. In some embodiments, the poly A tail comprises 120-130 adenine units. In some embodiments, the poly A tail comprises 120 adenine units. In some embodiments, the poly A tail comprises 121 adenine units. In some embodiments, the poly A tail comprises 122 adenine units. In some embodiments, the poly A tail comprises 123 adenine units. In some embodiments, the poly A tail comprises 124 adenine units. In some embodiments, the poly A tail comprises 125 adenine units. In some embodiments, the poly A tail as 129 bases.

[0229] In some embodiments, the coding sequence for two consecutive antigenic peptides are separated by a spacer or linker.

[0230] In some embodiments, the spacer or linker comprises up to 5000 nucleotide residues. An exemplary spacer sequence is GGCGGCAGCGGCGGCGGCGGCAGCGGCGGC (SEQ ID NO: 1014). Another exemplary spacer sequence isGGCGGCAGCCTGGGCGGCGGCGGCAGCGGC (SEQ ID NO: 1015). Another exemplaiy spacer sequence is GGCGTCGGC ACC (SEQ ID NO: 1016). Another exemplary spacer sequence is CAGCTGGGCCTG (SEQ ID NO: 1017). Another exemplary spacer is a sequence that encodes a lysine, such as AAA or AAG. Another exemplary spacer sequence is CAACTGGGATTG (SEQ ID NO: 1018).

[0231] In some embodiments, the mRNA comprises one or more additional structures to enhance antigen epitope processing and presentation by APCs.

[0232] In some embodiments, the linker or spacer region can contain cleavage sites. The cleavage sites ensure cleavage of the protein product comprising strings of epitope sequences into separate epitope sequences for presentation. The preferred cleavage sites are placed adjacent to certain epitopes in order to avoid inadvertent cleavage of the epitopes within the sequences. In some embodiments, the design of epitopes and cleavage regions on the mRNA encoding strings of epitopes are non-random.

[0233] In certain embodiments, an mRNA encoding an antigen peptide of the invention is administered to a subject in need thereof. In some embodiments, the mRNA to be administered comprises at least one modified nucleoside-phosphate.

[0234] In some embodiments, T cells are activated with antigenic peptides by artificial antigen- presenting cells. In some embodiments, artificial scaffolds are used to activate a T cell with antigenic peptides, the artificial scaffolds are loaded with antigenic peptides couples with an MHC antigen to which the antigenic peptide can bind with high affinity.

[0235] In some embodiments, the additional structures comprise encoding specific domains from the proteins selected from a group MITD, SP1, and 10th Fibronectin Domain: lOFnIII.

[0236] In some embodiments, the cells derived from peripheral blood or from leukapheresis are contacted with the plurality of antigen peptides, or one or more polynucleotides encoding the plurality of antigen peptides once or more than once to prepare the antigen loaded APCs.

[0237] In some embodiments, the method comprises incubating the APC or one or more of the APC preparations with a first medium comprising at least one cytokine or growth factor for a first time period.

[0238] In some embodiments, the method comprises incubating one or more of the APC preparations with at least one peptide for a second time period.

[0239] In some embodiments, the enriched cells further comprise CDlc+ cells.

[0240] In some embodiments, the cell population is enriched for CD1 lc+ and CD141+ cells.

[0241] In some embodiments, the cell population comprising the antigen loaded APCs comprises greater than 1%, 2%, 3%, 4%, 5%, 6,7%, 8%, 9%, 10%, 15%, 20%, 25%, 30% 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% or more CD1 lc+ cells.

[0242] In some embodiments, the cell population comprising the antigen loaded APCs comprises less than 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 20%, 10%, 8%, 7%, 6%, 5%, 4% or lower CD1 lb+ expressing cells.

[0243] In some embodiments, the cell population comprising the antigen loaded APCs comprises greater than 1%, 2%, 3%, 4%, 5%, 6,7%, 8%, 9%, 10%, 15%, 20%, 25%, 30% 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% antigenic peptide expressing cells that are CD1 lc+.

[0244] In some embodiments, the cell population comprising the antigen loaded APCs comprises greater than 1%, 2%, 3%, 4%, 5%, 6,7%, 8%, 9%, 10%, 15%, 20%, 25%, 30% 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% antigenic peptide expressing cells that are CDl lc+ CDlc+, or CD141+ cells.

[0245] In some embodiments, the antigen loaded APCs comprise mature APCs.

[0246] In some emb odiments, the method comprises obtaining a biological sample from a subject comprising at least one APC and at least one PBMC or at least on T cell.

[0247] In some embodiments, the method comprises depleting cells expressing CD14 and / or CD25 and / or CD 19 from a biological sample, thereby obtaining a CD 14 and / or CD25 and / or CD 19 cell depleted sample.

[0248] In some embodiments, the method comprises incubating a CD14 and / or CD25 and / or CD19 cell depleted sample with FLT3L for a first time period.

[0249] In some embodiments, the method comprises incubating at least one peptide with a CD14 and / or CD25 and / or CD19 cell depleted sample for a second time period, thereby obtaining a first matured APC peptide loaded sample.Preparing antigen activated T cells using antigen loaded APCs

[0250] In some embodiments, the antigen loaded APC (APC) prepared by the methods described above is incubated with T cells to obtain antigen activated T cells. The method can comprise generating at least one antigen specific T cell where the antigen is an antigen derived from a viral, bacterial, protozoan, fungal, or helminth pathogen. In some embodiments, the generating at least one antigen specific T cell comprises generating a plurality of antigen specific T cells.

[0251] In some embodiments, the T cells are obtained from a biological sample from a subject.

[0252] In some embodiments, the T cells are obtained from a biological sample from the same subject from whom the APCs are derived. In some embodiments, the T cells are obtained from a biological sample from a different subject than the subject from whom the APCs are derived.

[0253] In some embodiments, the APCs and / or T cells are derived from a biological sample which is peripheral blood mononuclear cells (PBMC). In some embodiments, the APCs and / or T cells are derived from a biological sample which is a leukapheresis sample.

[0254] In some embodiments, the APC comprises a dendritic cell (DC).

[0255] In some embodiments, the APCis derived from a CD 14+monocyte, oris a CD 14 enriched APC, or is a CD141 enriched APC.

[0256] In some embodiments, the CD14+ monocyte is enriched from a biological sample from a subject comprising peripheral blood mononuclear cells (PBMCs).

[0257] In some embodiments, the APC is a PBMC. In some embodiments, the PBMC is freshly isolated PBMC. In some embodiments the PBMC is frozen PBMC. In some embodiments, the PBMC is autologous PBMC isolated from the subject or the patient.

[0258] In some embodiments, the PBMC is loaded with antigens, where the antigens can be peptides or polypeptides or polynucleotides, such as mRNA, that encode the peptides and polypeptides. PBMCs (monocytes, DCs phagocytic cells) can take up antigens by phagocytosis and process and present them on the surface for T cell activation. Peptides or polypeptides loaded on the PBMCs can be supplemented with adjuvants to increase immunogenicity. In some embodiments, the PBMC is loaded with nucleic acid antigens. Nucleic acid antigens can be in theform of mRNA, comprising sequences encoding one or more antigens. In some embodiments, mRNA antigen loading does not require adjuvant supplementation, because, for example, RNA can act as a self-adjuvant.

[0259] In some embodiments, PBMCs are directly isolated or thawed from a frozen sample, and subjected to incubating with one or more antigens. In some embodiments, the PBMC sample is not further cultured for differentiation or subjected to further maturation of one or more cell components within the PBMC, (for example, maturation of antigen-presenting cells, or differentiation of monocytes to dendritic cells), before exposing the PBMCs to one or more antigens or nucleic acid encoding the one or more antigens. In some embodiments one or more cell types are depleted or removed from the freshly isolated PBMC cell population or a freshly thawed PBMC population before exposing or incubating the cells to one or more antigens or nucleic acid encoding the one ormore antigens. In some embodiments, CD14+ cells are depleted from the PBMC. In some embodiments, CD25+ cells are depleted from the PBMC. In some embodiments, CDllb+ cells are depleted from the PBMC. In some embodiments, the CD 14+ and CD25+ cells are depleted from the PBMCs, before incubating with one or more antigens or one or more nucleic acids encoding the one or more antigens. In some embodiments, the CD1 lb+, and / or the CD 14+ and / or CD25+ cells are depleted from the PBMC. In some embodiments, a method provided herein comprises preparing antigen-specific T cells by depleting CD 14+ cells and / or CD25+ cells from a PBMC sample from a human subject containing about the same percentage of immature dendritic cells (DCs) as the percentage of immature DCs in the peripheral blood of the human subject. In some embodiments, a method provided herein comprises preparing antigen-specific T cells by depleting CD14+ cells and / or CD25+ cells from a PBMC sample from a human subject containing about the same percentage of mature DCs as the percentage of mature DCs in the peripheral blood of the human subject. In some embodiments, a method provided herein comprises preparing antigen-specific T cells by depleting CD14+ cells and / or CD25+ cells from a PBMC sample from a human subject containing about the same ratio of immature DCs to mature DCs as the ratio of immature DCs to mature DCs in the peripheral blood of the human subject. In some embodiments, a method provided herein comprises preparing antigen-specific T cells by depleting CD 14+ cells and / or CD25+ cells from a PBMC sample from a human subject that has not been subject to a step of maturing immature DCs into mature DCs. In some cases, the antigen is from a pathogen associated with an infectious disease.

[0260] In some embodiments, the CD 14+ monocyte is stimulated with one ormore cytokines or growth factors.

[0261] In some embodiments, one or more cytokines or growth factors comprise GM-CSF, IL^4, FLT3L, TNF-a, IL- 10, PGE1, IL-6, IL-7, IL-15, IFN-y, IFN-a, R848, LPS, ss-ma40, poly I:C, or a combination thereof.

[0262] In some embodiments, the CD 14+ monocyte is from a second biological sample comprising PBMCs.

[0263] In some embodiments, the second biological sample is from the same subject.

[0264] In some embodiments, the biological sample comprises peripheral blood mononuclear cells (PBMCs).

[0265] In some embodiments, the at least one antigen-specific T cell is stimulated in a medium comprising IL-7, IL-15, an indoleamine 2,3 -dioxy genase-1 (IDO) inhibitor, an anti-PD-1 antibody, IL-12, or a combination thereof.

[0266] In some embodiments, the IDO inhibitor is epacadostat, navoximod, 1 -methyltryptophan, or a combination thereof.

[0267] In some embodiments, the subjectis administered FLT3L prior to obtainingthe biological sample for preparing the APCs and / or T cells.

[0268] In some embodiments, the T cells are obtained from a biological sample from a subject as described in the previous sections of this disclosure.

[0269] In some embodiments, the biological sample is freshly obtained from a subject or is a frozen sample.

[0270] In some embodiments, the incubating is in presence of at least one cytokine or growth factor, which comprises GM-CSF, IL-4, FLT3L, TNF-a, IL-10, PGE1, IL-6, IL-7, IL-15, IFN-y, IFN-a, IL-15, R848, LPS, ss-ma40, poly I:C, or any combination thereof.

[0271] In some embodiments, a method comprises stimulating T cells with IL-7, IL-15, or a combination thereof. In some embodiments, a method comprises stimulating T cells with IL-7, IL-15, or a combination thereof, in the presence of an IDO inhibitor, a PD-1 antibody or IL-12. In some embodiments, the stimulated T cell is expanded in presence of the one or more antigen epitope sequence or APCs loaded with the one or more antigen or epitope sequence, or APCs loaded with (e.g. expressing) nucleic acid sequences (such as mRNA sequences) encoding the one or more antigen epitope sequence, one or more cytokines or growth factors comprise GM-CSF, IL-4, FLT3L, TNF-a, IL-10, PGE1, IL-6, IL-7, IL-15, IFN-y, IFN-a, R848, LPS, ss-rna40, poly I:C, or a combination thereof, FLT3L, under suitable T cell growth conditions ex vivo. In some embodiments, the methodfurther comprises administering the antigen specific T cells to a subject.

[0272] In some embodiments, the method comprises incubating the APC prepared as described in the previous sections with T cells in presence of a medium comprisingthe at least one cytokines or growth factor to generate antigen activated T cells.

[0273] In some embodiments, the incubating comprises incubating a first APC preparation of the APC preparations to the T cells for more than 7 days. In some embodiments, the incubated T cells are stimulated T cells that expand in vitro on presence of the APC preparation, cytokines and growth factors for more than 7 days.

[0274] In some embodiments, the incubating comprises incubating a first APC preparation of the APC preparations to the T cells for more than 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 days.

[0275] In some embodiments, the first time period of the one or more time periods is about 1, 2 3, 4, 5, 6, 7, 8, or 9 days.

[0276] In some embodiments, a total time period of the separate time periods is less than 28 days. In some embodiments, a total time period of the separate time periods is from 20-27 days. In some embodiments, a total time period of the separate time periods is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, or 39 days.

[0277] In some embodiments, a method comprises incubating a first APC preparation of the APC preparations with the T cells for more than 7 days. In some embodiments, a method comprises incubating a first APC preparation of the APC preparations with the T cells for more than 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 days. In some embodiments, a method comprises incubating a first APC preparation of the APC preparations with the T cells for from 7-20, 8-20, 9-20, 10-20, 11-20, or 12-20 days. In some embodiments, a method comprises incubating a first APC preparation of the APC preparations with the T cells for about 10-15 days.

[0278] In some embodiments, a method comprises incubating a second APC preparation of the APC preparations to the T cells for 5-9 days. In some embodiments, a method comprises incubating a second APC preparation of the APC preparations to the T cells for 5, 6, 7, 8, or 9 days. In some embodiments, the method further comprises removing the one or more cytokines or growth factors of the second medium after the third time period and before a start of the fourth time period.

[0279] In some embodiments, a method comprises incubating a third APC preparation of the APC preparations to the T cells for 5-9 days. In some embodiments, the method comprises incubating a third APC preparation of the APC preparations to the T cells for 5, 6, 7, 8, or 9 days.

[0280] In some embodiments, the method comprises incubating a first APC preparation of the APC preparations with the T cells for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 days, incubating a second APC preparation of the APC preparations to the T cells for about l, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or22 days, and incubating a third APC preparation of the APC preparations to the T cells for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 days.

[0281] In some embodiments, the methodis performed ex vivo. In some embodiments, the T cells are cultured in a medium containing a cytokine. In some embodiments, an example of cytokines includes IL-7. In some embodiments, an example of cytokines includes IL-15. In some embodiments, an example of cytokines includes IL-7 and IL-15. In some embodiments, the T cells are cultured in a medium comprising IL-7, and / or IL-15. In some embodiments, the cytokine in a T cell culture or a medium has a final concentration of at least 0.05 ng / mL, 0.1 ng / mL, 0.2 ng / mL, 0.3 ng / mL, 0.4 ng / mL, 0.5 ng / mL, 0.8 ng / mL, 1 ng / mL, 2 ng / mL, 3 ng / mL, 4 ng / mL, 5 ng / mL, 6 ng / mL, 7 ng / mL, 8 ng / mL, 9 ng / mL, 10 ng / mL, 12 ng / mL, 15 ng / mL, 18 ng / mL, or 20 ng / mL. In some embodiments, the IL-7 in a T cell culture or a medium has a final concentration of at least 0.05 ng / mL, 0.1 ng / mL, 0.2 ng / mL, 0.3 ng / mL, 0.4 ng / mL, 0.5 ng / mL, 0.8 ng / mL, 1 ng / mL, 2 ng / mL, 3 ng / mL, 4 ng / mL, 5 ng / mL, 6 ng / mL, 7 ng / mL, 8 ng / mL, 9 ng / mL, 10 ng / mL, 12 ng / mL, 15 ng / mL, 18 ng / mL, or 20 ng / mL. In some embodiments, the IL-15 in a T cell culture or a medium has a final concentration of at least 0.05 ng / mL, 0.1 ng / mL, 0.2 ng / mL, 0.3 ng / mL, 0.4 ng / mL, 0.5 ng / mL, 0.8 ng / mL, 1 ng / mL, 2 ng / mL, 3 ng / mL, 4 ng / mL, 5 ng / mL, 6 ng / mL, 7 ng / mL, 8 ng / mL, 9 ng / mL, 10 ng / mL, 12 ng / mL, 15 ng / mL, 18 ng / mL, or 20 ng / mL. In some embodiments, the T cells are cultured in a medium further containing FLT3L. In some embodiments, the FLT3L in a T cell culture or a medium has a final concentration of in a T cell culture or a medium has a final concentration of at least 1 ng / mL, 2 ng / mL, 3 ng / mL, 4 ng / mL, 5 ng / mL, 6 ng / mL, 7 ng / mL, 8 ng / mL, 9 ng / mL, 10 ng / mL, 12 ng / mL, 15 ng / mL, 18 ng / mL, 20 ng / mL, 30 ng / mL, 40 ng / mL, 50 ng / mL, 60 ng / mL, 70 ng / mL, 80 ng / mL, 90 ng / mL, 100 ng / mL, or 200 ng / mL. In some embodiments, the T cells are incubated, induced, or stimulated in a medium containingFLT3Lforafirstperiodtime. In some embodiments, the T cells are incubated, induced, or stimulated in a medium containing additionally addedFLT3L for a second period time. In some embodiments, the T cells are incubated, induced, or stimulated in a medium containing additional added FLT3L for a third period time. In some embodiments, the T cells are incubated, induced, or stimulated in a medium containing additional addedFLT3Lfor a fourth, a fifth, ora sixth period time, with freshly added FLT3L in each time period.

[0282] In some embodiments, the T cells are cultured in presence of an antigen, e.g., an antigen presented by an APC, wherein the media comprises high potassium [K]+content. In some embodiments, the T cells are cultured in presence of high [K]+content in the media for at least a period of time during the incubation with APCs or T cells. In some embodiments, the [K]+content in the media is altered for at least a period of time during the incubation with APCs or T cells. In some embodiments, the content in the media is kept constant over the period of T cell ex vivo culture. In some embodiments, the [K]+content in the T cell culture medium is > 5 mM. In some embodiments, the [K]+content in the T cell culture medium is > 6 mM. In some embodiments,the [K]+content in the T cell culture medium is > 7 mM. In some embodiments, the [K]+content in the T cell culture medium is > 8 mM. In some embodiments, the [K]+content in the T cell culture medium is > 9 mM. In some embodiments, the [K]+content in the T cell culture medium is > 10 mM. In some embodiments, the [K]+content in the T cell culture medium is > 11 mM. In some embodiments, the [K]+content in the T cell culture medium is > 12 mM. In some embodiments, the [K]+content in the T cell culture medium is > 13 mM. In some embodiments, the [K]+content in the T cell culture medium is > 14 mM. In some embodiments, the [K]+content in the T cell culture medium is > 15 mM. In some embodiments, the [K]+content in the T cell culture medium is > 16 mM. In some embodiments, the [K]+ content in the T cell culture medium is > 17 mM. In some embodiments, the [K]+content in the T cell culture medium is > 18 mM. In some embodiments, the [K]+content in the T cell culture medium is > 19 mM. In some embodiments, the [K]+content in the T cell culture medium is > 20 mM. In some embodiments, the [K]+content in the T cell culture medium is > 22 mM. In some embodiments, the [K]+content in the T cell culture medium is > 25 mM. In some embodiments, the [K]+content in the T cell culture medium is > 30 mM. In some embodiments, the [K]+content in the T cell culture medium is > 35 mM. In some embodiments, the [K]+content in the T cell culture medium is > 40 mM. In some embodiments, the [K]+content in the T cell culture medium is about 40 mM.

[0283] In some embodiments, the [K]+content in the T cell culture medium is about 40 mM for at least a period of time during the incubation of T cells with antigen. In some embodiments, the antigen can be presented by the antigen loaded APCs. In some embodiments, the T cells in the presence of [K]+are tested for T effector functions, CD8+ cytotoxicity, cytokine production, and for memory phenotype. In some embodiments, T cells are grown in the presence of high [K]+express effector T cell phenotype. In some embodiments, T cells grown in presence of high [K]+express memory cell marker. In some embodiments, T cells grown in presence of high [K]+do not express T cell exhaustion markers.

[0284] In some embodiments, the stimulated T cell is a population of immune cells comprising the activated T cells stimulated with APCs comprising an antigenic peptide-MHC complex. In some embodiments, a method can comprise incubating a population of immune cells from a biological sample with APCs comprising a peptide-MHC complex, thereby obtaining a stimulated immune cell sample; determining expression of one or more cell markers of at least one immune cell of the stimulated immune cell sample; and determining binding of the at least one immune cell of the stimulated immune cell sample to a peptide-MHC complex; wherein determining expression of certain cell surface markers or other determinant markers, such as intracellular factors, or released agents, such as cytokines etc., and determining binding to the antigen-MHC complex are performed simultaneously. In some embodiments, the one or more cell markerscomprise TNF-a, IFN-y, LAMP-1, 4-1BB, IL-2, IL-17A, Granzyme B, PD-1, CD25, CD69, TIM3, LAG3, CTLA-4, CD62L, CD45RA, CD45RO, FoxP3, orany combinationthereof.In some embodiments, the one or more cell markers comprise a cytokine. In some embodiments, the one or more cell markers comprise a degranulation marker. In some embodiments, the one or more cell markers comprise a cell-surface marker. In some embodiments, the one or more cell markers comprise a protein. In some embodiments, determining binding of the at least one immune cell of the stimulated immune cell sample to the peptide-MHC complex comprises determining binding of the at least one immune cell of the stimulated immune cell sample to an MHC tetramer comprising the peptide and the MHC of the peptide-MHC complex. In some embodiments, the MHC is a class I MHC or a class II MHC. In some embodiments, the peptide-MHC complex comprises one or more labels.

[0285] In some embodiments, activation of T cell is verified by detectingthe release of a cytokine by the activated T cell. In some embodiments, the cytokine is one or more of: TNF-a, IFN-y, or IL-2. In some embodiments the activation of T cell is verified by its specific antigen binding and cytokine release. In some embodiments, the activation of T cells is verified by its ability to kill infected cells in vitro. A sample of activated T cells can be used to verify the activation status of the T cells. In some embodiments, a sample from the T cells is withdrawn from the T cell culture to determine the cellular composition and activation state by flow cytometry.

[0286] In some embodiments, a percentage of the at least one antigen specific T cell in the composition is at least about 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of total T cells or total immune cells. In some embodiments, the percentage of the at least one antigen specific T cell in the composition is about 5%. In some embodiments, the percentage of the at least one antigen specific T cell in the composition is about 7%. In some embodiments, the percentage of the at least one antigen specific T cell in the composition is about 10%. In some embodiments, the percentage of the at least one antigen specific T cell in the composition is about 12%. In some embodiments, the percentage of the at least one antigen specific T cell in the composition is about 15%. In some embodiments, the percentage of the at least one antigen specific T cell in the composition is about 20%. In some embodiments, the percentage of the at least one antigen specific T cell in the composition is about 25%. In some embodiments, the percentage of the at least one antigen specific T cell in the composition is about 30%. In some embodiments, the percentage of the at least one antigen specific T cell in the composition is about 40%. In some embodiments, the percentage of the at least one antigen specific T cell in the composition is about 50%. In some embodiments, the percentage of the at least one antigen specific T cell in the composition is about 60%. In someembodiments, the percentage of the at least one antigen specific T cell in the composition is about 70%. In some embodiments, the percentage of the at least one antigen specific T cell in the composition is about 80%. In some embodiments, the percentage of the at least one antigen specific T cell in the composition is about 90%.

[0287] In some embodiments, a percentage of at least one antigen specific CD8+ T cell in the composition is at least about O.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of total CD4+ T cells, total CD8+ T cells, total T cells or total immune cells. In some embodiments, the percentage of the at least one antigen specific CD8+ T cells in the composition is about 5%. In some embodiments, the percentage of the at least one antigen specific CD8+ T cells in the composition is about 7%. In some embodiments, the percentage of the at least one antigen specific CD8+ T cells in the composition is about 10%. In some embodiments, the percentage of the at least one antigen specific CD8+ T cells in the composition is about 12%. In some embodiments, the percentage of the at least one antigen specific CD8+ T cells in the composition is about 15%. In some embodiments, the percentage of the at least one antigen specific CD8+ T cells in the composition is about 20%. In some embodiments, the percentage of the at least one antigen specific CD8+ T cells in the composition is about 25%. In some embodiments, the percentage of the at least one antigen specific CD8+ T cells in the composition is about 30%. In some embodiments, the percentage of the at least one antigen specific CD8+ T cells in the composition is about 40%. In some embodiments, the percentage of the at least one antigen specific CD8+ T cells in the composition is about 50%. In some embodiments, the percentage of the at least one antigen specific CD8+ T cells in the composition is about 60%. In some embodiments, the percentage of the at least one antigen specific CD8+ T cells in the composition is about 70% of total CD4+ T cells, total CD8+ T cells, total T cells or total immune cells.

[0288] In some embodiments, at least about 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of the CD8+ T cells in the expanded population of cells are CD8+ antigen-specific T cells derived from naive CD8+ T cells. In some embodiments, at least about 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of the CD4+ T cells in the expanded population of cells are CD8+ antigen-specific T cells derived from naive CD4+ T cells.

[0289] In some embodiments, a percentage of the at least one antigen specific T cell in the biological sample is at most about O.00001%, 0.00005%, 0.0001%, 0.0005%, 0.001%, 0.005%,0.01%, 0.05%, 0.1% or 0.5% of total CD4+ T cells, total CD8+ T cells, total T cells or total immune cells.

[0290] In some embodiments, a percentage of at least one antigen specific CD8+ T cell in the biological sample is at most about 0.00001%, 0.00005%, 0.0001%, 0.0005%, 0.001%, 0.005%, 0.01%, 0.05%, 0.1% or 0.5% of total CD4+ T cells, total CD8+ T cells, total T cells or total immune cells.

[0291] In some embodiments, a percentage of at least one antigen specific CD4+ T cell in the biological sample is at most about 0.00001%, 0.00005%, 0.0001%, 0.0005%, 0.001%, 0.005%, 0.01%, 0.05%, 0.1% or 0.5% of total CD4+ T cells, total CD8+ T cells, total T cells or total immune cells.

[0292] In some embodiments, the antigen is an overexpressed antigen, a viral antigen, a bacterial antigen, a protozoan antigen, a helminth antigen, or a combination thereof.

[0293] In some embodiments, the number of at least one antigen specific CD8+ T cell in the composition is atleast about lxlOA6, 2x10A6, 5xlOA6, 1x10A7, 2x10A7, 5xlOA7, 1x10A8, 2xlOA8, or 5x10A8, antigen specific CD8+ T cells.

[0294] In some embodiments, a number of at least one antigen specific CD4+ T cell in the composition is atleast about lxlOA6, 2x10A6, 5xlOA6, 1x10A7, 2x10A7, 5xlOA7, 1x10A8, 2xlOA8, or 5x10A8, antigen specific CD4+ T cells.Method of T cell Manufacturing

[0295] Provided herein are methods for antigen specific T cell manufacturing. Provided herein are methods of preparing T cell compositions, such as therapeutic T cell compositions. For example, a method can comprise expanding or inducing antigen specific T cells. Preparing (e.g., inducing or expanding) T cells can also refer to manufacturing T cells, and broadly encompasses procedures to isolate, stimulate, culture, induce, and / or expand any type of T cells (e.g., CD4+ T cells and CD8+ T cells). In one aspect, providedherein is a method of preparing at least one antigen specific T cell comprising a T-cell receptor (TCR) specific to at least one antigen peptide sequence, the method comprising incubating an APC with a population of immune cells from a biological sample depleted of cells expressing CD14 and / or CD25. In some embodiments, the method comprises preparing at least one antigen specific T cell comprising a T-cell receptor (TCR) specific to at least one antigen peptide sequence, the method comprising incubating an APC with a population of immune cells from a biological sample depleted of cells expressing CD1 lb and / or CD19. In some embodiments, the method comprises incubating an APC with a population of immune cells from a biological sample depleted of cells expressing any CDl lb and / or CD19 and / or CD14 and / or CD25 or any combination thereof.

[0296] In a second aspect, provided here is a method of preparing at least one antigen specific T cell comprising a T-cell receptor (TCR) specific to at least one antigen peptide sequence, the method comprising incubating an FMS-like tyrosine kinase 3 receptor ligand (FLT3L)-stimulated APC with a population of immune cells from a biological sample.

[0297] In a third aspect, provided herein is a method of preparing a pharmaceutical composition comprising at least one antigen specific T cell comprising a T-cell receptor (TCR) specific to at least one antigen peptide sequence, the method comprising: incubating FMS-like tyrosine kinase 3 receptor ligand (FLT3L) with a population ofimmune cells from a biological sample for a first time period; and thereafter incubating at least one T cell of the biological sample with an APC.

[0298] In a fourth aspect, provided herein is a method of preparing at least one antigen specific T cell comprising a T-cell receptor (TCR) specific to at least one antigen peptide sequence, the method comprising incubating a population of immune cells from a biological sample with one or more APC preparations for one or more separate time periods of less than 28 day s from incubating the population ofimmune cells with a first APC preparation of the one or more APC preparations, wherein at least one antigen specific memory T cell is expanded, or at least one antigen specific naive T cell is induced.

[0299] In a fifth aspect, provided herein is a method of preparing at least one antigen specific T cell comprising a T-cell receptor (TCR) specific to at least one antigen peptide sequence, the method comprising incubating a population of immune cells from a biological sample with 3 or less APC preparations for 3 or less separate time periods, wherein at least one antigen specific memory T cell is expanded or at least one antigen specific naive T cell is induced.

[0300] In some embodiments, a method of preparing antigen specific T cells comprises a T-cell receptor (TCR) specific to atleastone antigen peptide sequence comprisesincubatinga population of immune cells from a biological sample with one or more APC preparations for one or more separate time periods, thereby stimulating T cells to become antigen specific T cells, wherein a percentage of antigen specific T cells is at least about 0.00001%, 0.00002%, 0.00005%, 0.0001%, 0.0005%, 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of total CD4+ T cells, total CD8+ T cells, total T cells or total immune cells. In some embodiments, a method of preparing antigen specific T cells comprises a T-cell receptor (TCR) specific to at least one antigen peptide sequence comprises incubating a population of immune cells from a biological sample with 3 or less APC preparations for 3 or less separate time periods, thereby stimulating T cells to become antigen specific T cells. In some embodiments, a method of preparing antigen specific T cells comprises a T-cell receptor (TCR) specific to at least one antigen peptide sequence comprises incubating apopulation of immune cells from a biological sample with 2 or less APC preparations for 2 or less separate time periods, thereby stimulating T cells to become antigen specific T cells.

[0301] In some embodiments, provided herein is a method that comprises incubating a population of immune cells from a biological sample with one or more APC preparations for one or more separate time periods, thereby stimulating T cells to become antigen specific T cells, wherein the APC preparation is a PBMC cell population from which cells expressing one or more cell surface markers are depleted prior to antigen loading of the APC population. In some embodiments, CD 14+ cells are depleted prior to antigen loading of an APC population. In some embodiments, CD25+ cells are depleted prior to antigen loading of an APC population. In some embodiments, CD 1 lb+ cells are depleted prior to antigen loading of an APC population. In some embodiments, CD 19+ cells are depleted prior to antigen loading of an APC population. In some embodiments, CD3+ cells are depleted prior to antigen loading of an APC population. In some embodiments, CD25+cells and CD 14+ cells are depleted prior to antigen loading of an APC population. In some embodiments, CDl lb+ and CD25+ cells are depleted prior to antigen loading of an APC population. In some embodiments, CD1 Ib+and CD 14+ cells are depleted prior to antigen loading of an APC population. In some embodiments, CD1 lb+, CD14+ and CD25+ cells are depleted prior to antigen loading of an APC population. In some embodiments, CD 1 lb+, and CD 19+ cells are depleted prior to antigen loading of an APC population. In some embodiments, CD1 lb+, CD 19+ and CD25+ cells are depleted prior to antigen loading of an APC population. In some embodiments, CDllb+, CD14+, CD 19+ and CD25+ cells are depleted prior to antigen loading of an APC population. In some embodiments, the method comprises adding to any of the depleted APC population described above, an APC enriched cell PBMC-derived population that are depleted of CD3+ cell. In some embodiments, the APC enriched cell PBMC-derived population is depleted of CD3+ and cells depleted of any one or more of CD 1 lb+, CD 14+, CD 19+, or CD25+.

[0302] In some embodiments, a biological sample comprises peripheral blood mononuclear cells (PBMCs). In some embodiments, the method comprises addingto aPBMC sample, a composition comprising one or more antigenic peptides or nucleic acids encoding the same, thereby loading the APCs within the PBMCs with antigens for antigen presentation to T cells in the PBMC.

[0303] In some embodiments, a method comprises: (a) obtaining a biological sample from a subject comprising at least one antigen-presenting cell (APC); (b) enriching cells expressing CDl lc from the biological sample, thereby obtaining a CDl lc+cell enriched sample; (c) incubating the CD 11 c+cell enriched sample with at least one cytokine or growth factor for a first time period; (d) incubating at least one peptide with the CD1 lc+enriched sample of (c) for a second time period, thereby obtaining an APC peptide loaded sample; (e) incubating the APC peptide loaded sample with one or more cytokines or growth factors for a third time period,thereby obtaining a matured APC sample; (f) incubating APCs of the matured APC sample with a CD 11b and / or CD14 and / or CD25 depleted sample comprising PBMCs for a fourth time period; (g) incubating the PBMCs with APCs of a matured APC sample for a fifth time period; (h) incubating the PBMCs with APCs of a matured APC sample for a sixth time period; and (i) administering at least one T cell of the PBMCs to a subject in need thereof.

[0304] In some embodiments, a method comprises: (a) obtaining a biological sample from a subject comprisingatleast one antigen-presenting cell (APC); (b) enriching cells expressing CD14 from the biological sample, thereby obtaining a CD 14+ cell enriched sample; (c) incubating the CD 14+ cell enriched sample with at least one cytokine or growth factor for a first time period; (d) incubating at least one peptide with the CD14+ enriched sample of (c) for a second time period, thereby obtaining an APC peptide loaded sample; (e) incubating the APC peptide loaded sample with one or more cytokines or growth factors for a third time period, thereby obtaining a matured APC sample; (f) incubating APCs of the matured APC sample with a CD 14 and / or CD25 depleted sample comprising PBMCs for a fourth time period; (g) incubating the PBMCs with APCs of a matured APC sample for a fifth time period; (h) incubating the PBMCs with APCs of a matured APC sample for a sixth time period; and (i) administering at least one T cell of the PBMCs to a subject in need thereof.

[0305] In some embodiments, a method comprises: (a) obtaining a biological sample from a subject comprisingatleast one APC and at least one PBMC; (b) depleting cells expressing CD1 lb and / or CD 19 from the biological sample, thereby obtaining a CD 1 lb and / or CD 19 cell depleted sample; (c) incubatingthe CDl lb and / or CD19 cell depleted sample with FLT3L for a first time period; (d) incubating at least one peptide with the CD1 lb and / or CD19 cell depleted sample of (c) for a second time period, thereby obtaining an APC peptide loaded sample; (e) incubating the APC peptide loaded sample with the at least one PBMC for a third time period, thereby obtaining a first stimulated PBMC sample; (f) incubating a PBMC of the first stimulated PBMC sample with an APC of a matured APC sample for a fourth time period, thereby obtaining a second stimulated PBMC sample; (g) incubating a PBMC of the second stimulated PBMC sample with an APC of a matured APC sample for a fifth time period, thereby obtaining a third stimulated PBMC sample; (h) administering at least one T cell of the third stimulated PBMC sample to a subject in need thereof.

[0306] In some embodiments, a method comprises: (a) obtaining a biological sample from a subject comprisingatleast one APC and at least one PBMC; (b) depleting cells expressing CDllb and / or CD 19 and / or CD 14 and / or CD25 from the biological sample, thereby obtaining a CDllb and / or CD 19 cell depleted sample; (c) incubatingthe CD1 lb and / or CD19 and / or CD 14 and / or CD25 cell depleted sample with FLT3L for a first time period; (d) incubating at least one peptidewith the CD1 lb and / or CD19 and / or CD14 and / or CD25 cell depleted sample of (c) for a second time period, thereby obtaining an APC peptide loaded sample; (e) incubating the APC peptide loaded sample with the at least one PBMC for a third time period, thereby obtaining a first stimulated PBMC sample; (f) incubating a PBMC of the first stimulated PBMC sample with an APC of a matured APC sample for a fourth time period, thereby obtaining a second stimulated PBMC sample; (g) incubating a PBMC of the second stimulated PBMC sample with an APC of a matured APC sample for a fifth time period, thereby obtaining a third stimulated PBMC sample; (h) administering at least one T cell of the third stimulated PBMC sample to a subject in need thereof.

[0307] In some embodiments, a method comprises: (a) obtaining a biological sample from a subject comprising at least one APC and at least one PBMC; (b) depleting cells expressing CD14 and / or CD25 from the biological sample, thereby obtaining a CD14 and / or CD25 cell depleted sample; (c) incubatingthe CD14 and / or CD25 cell depleted sample with FLT3L for a first time period; (d) incubating at least one peptide with the CD14 and / or CD25 cell depleted sample of (c) for a second time period, thereby obtaining an APC peptide loaded sample; (e) incubating the APC peptide loaded sample with the at least one PBMC for a third time period, thereby obtaining a first stimulated PBMC sample; (f) incubating a PBMC of the first stimulated PBMC sample with an APC of a matured APC sample for a fourth time period, thereby obtaining a second stimulated PBMC sample; (g) incubating a PBMC of the second stimulated PBMC sample with an APC of a matured APC sample for a fifth time period, thereby obtaining a third stimulated PBMC sample; (h) administering at least one T cell of the third stimulated PBMC sample to a subject in need thereof.

[0308] In some embodiments, a method of preparing at least one antigen specific T cell comprising a T-cell receptor (TCR) specific to at least one antigen peptide sequence comprises incubating an APC with a population of immune cells from a biological sample depleted of cells expressing CD 14 and / or CD25.

[0309] In some embodiments, provided herein is a method of preparing at least one antigen specific T cell comprising a T-cell receptor (TCR) specific to at least one antigen peptide sequence, the method comprising incubating a population of immune cells from a biological sample with one or more APC preparations for one or more separate time periods of less than 28 days from incubatingthe population of immune cells with a first APC preparation of the one or more APC preparations, wherein at least one antigen specific memory T cell is expanded, or at least one antigen specific naive T cell is induced. In some embodiments, provided herein is a method of preparing at least one antigen specific T cell comprising a T-cell receptor (TCR) specific to at least one antigen peptide sequence, the method comprising incubating a populationof immune cells from a biological sample with 3 or less APC preparations for 3 or less separate time periods, wherein at least one antigen specific memory T cell is expanded or at least one antigen specific naive T cell is induced.

[0310] In some embodiments, a method of preparing antigen specific T cells comprises a T-cell receptor (TCR) specific to atleast one antigen peptide sequence comprises contacting a population of immune cells (e.g., PBMCs) to APCs. In some embodiments, a method of preparing antigen specific T cells comprises a T-cell receptor (TCR) specific to at least one antigen peptide sequence comprises incubating a population of immune cells (e.g. , PBMCs) with APCs for a time period. In some embodiments, the population of immune cells is from a biological sample. In some emb odiments, the population of immune cells is from a sample (e.g. , a biological sample) depleted of CD14 expressing cells. In some embodiments, the population of immune cells is from a sample (e.g., a biological sample) depleted of CD25 expressing cells. In some embodiments, the population of immune cells is from a sample (e.g., a biological sample) depleted of CD 14 expressing cells and CD25 expressing cells.

[0311] In some embodiments, a method of preparing at least one antigen specific T cell comprising a T-cell receptor (TCR) specific to at least one antigen peptide sequence comprises incubating an FMS-like tyrosine kinase 3 receptor ligand (FLT3L)-stimulated APC with a population of immune cells from a biological sample. In some embodiments, provided herein is a method of preparing a pharmaceutical composition comprising at least one antigen specific T cell comprising a T-cell receptor (TCR) specific to at least one antigen peptide sequence, the method comprising: incubating FMS-like tyrosine kinase 3 receptor ligand (FLT3L) with a population of immune cells from a biological sample for a first time period; and thereafter incubating at least one T cell of the biological sample with an APC.

[0312] In some embodiments, a method of preparing at least one antigen specific T cell comprising a T-cell receptor (TCR) specific to at least one antigen peptide sequence comprises contacting a population of immune cells from a sample (e.g., a biological sample) with FMS-like tyrosine kinase 3 receptor ligand (FLT3L). In some embodiments, a method of preparing atleast one antigen specific T cell comprises a T-cell receptor (TCR) specific to at least one antigen peptide sequence comprises contacting a population of immune cells from a sample (e.g., a biological sample) with FMS-like tyrosine kinase 3 receptor ligand (FLT3L)-stimulated APCs. In some embodiments, a method of preparing atleast one antigen specific T cell comprises a T-cell receptor (TCR) specific to atleast one antigen peptide sequence comprisesincubatinga population of immune cells from a sample (e.g. , a biological sample) with FMS-like tyrosine kinase 3 receptor ligand (FLT3L)-stimulated APCs. In some embodiments, a method of preparing a pharmaceutical composition comprising atleast one antigen specific T cell comprising a T-cell receptor (TCR)specific to at least one antigen peptide sequence comprises incubating FMS-like tyrosine kinase 3 receptor ligand (FLT3L) with a population of immune cells from a biological sample (e.g., for a time period); and then contacting T cells of the biological sample to APCs. In some embodiments, a method of preparing at least one antigen specific T cell comprising a T-cell receptor (TCR) specific to at least one antigen peptide sequence comprises contacting a population of immune cells from a sample (e.g., a biological sample) to one or more APC preparations. In some embodiments, a method of preparing at least one antigen specific T cell comprising a T-cell receptor (TCR) specific to atleastone antigen peptide sequence comprisesincubatinga population of immune cells from a sample (e.g., a biological sample) to one or more APC preparations for one or more separate time periods. In some embodiments, a method of preparing at least one antigen specific T cell comprising a T-cell receptor (TCR) specific to at least one antigen peptide sequence comprises incubating a population of immune cells from a sample (e.g., a biological sample) to one or more APC preparations for 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 separate time periods. In some embodiments, the one or more separate time periodsis less than 28 days calculated from incubating the population of immune cells with a first APC preparation of the one or more APC preparations.

[0313] In some embodiments, a method of preparing antigen specific T cells comprises a T-cell receptor(TCR) specificto atleastone antigen peptide sequence comprisesincubatingapopulation of immune cells to APCs for a time period, wherein the population of immune cells is from a biological sample comprising PBMCs. In some embodiments, a method of preparing antigen specific T cells comprises a T-cell receptor (TCR) specific to at least one antigen peptide sequence comprises incubating a population of immune cells to APCs for a time period, wherein the population of immune cells is from a biological sample depleted of CD 14 and / or CD25 expressing cells.

[0314] In some embodiments, a method of preparing antigen specific T cells comprising a T-cell receptor (TCR) specificto atleastone antigen peptide sequence comprisesincubatingapopulation of immune cells from a biological sample with FMS-like tyrosine kinase 3 receptor ligand (FLT3L)-stimulated APCs for a time period.

[0315] In some embodiments, a method of preparing a pharmaceutical composition comprising antigen specific T cells comprising a T-cell receptor (TCR) specific to at least one antigen peptide sequence comprises incubating FMS-like tyrosine kinase 3 receptor ligand (FLT3L) with a population of immune cells from a biological sample; and then contacting T cells of the biological sample with APCs.

[0316] In some embodiments, a method of preparing antigen specific T cells comprising a T-cell receptor (TCR) specific to atleastone antigen peptide sequence comprisesincubatinga populationof immune cells from a biological sample with one or more APC preparations for one or more separate time periods, thereby inducing or expanding antigen specific T cells, wherein the one or more separate time periods is less than 28 days calculated from incubating the population of immune cells with a first APC preparation of the one or more APC preparations. In some embodiments, incubatingapopulationof immune cells from a biological sample with one or more APC preparations for one or more separate time periods is performed in a medium containing IL- 7, IL-15, or a combination thereof. In some embodiments, the medium further comprises an indoleamine 2,3-dioxygenase-l (IDO) inhibitor, an anti-PD-1 antibody, IL-12, or a combination thereof. The IDO inhibitor can be epacadostat, navoximod, 1 -Methyltryptophan, or a combination thereof. In some embodiments, the IDO inhibitor can increase the number of antigen -specific CD8+cells. In some embodiments, the IDO inhibitor can maintain the functional profile of memory CD8+ T cell responses. The PD-1 antibody can increase the absolute number of antigenspecific memory CD8+ T cell responses. The PD-1 antibody can increase proliferation rate of the cells treated with such antibody. The additional of IL-12 can result in an increase of antigenspecific cells and / or an increase in the frequency of CD8+ T cells.

[0317] In some embodiments, a method of preparing antigen specific T cells comprising a T-cell receptor (TCR) specific to atleastone antigen peptide sequence comprisesincubatinga population of immune cells comprising from a biological sample with one or more APC preparations for one or more separate time periods, thereby expanding or inducing antigen specific T cells, wherein a percentage of antigen specific T cells, antigen specific CD4+ T cells, or antige...

Claims

CLAIMSWhat is claimed is:1 . A method of determining whether an infectious disease vaccine comprising a therapeutic polypeptide or a polynucleotide encoding the therapeutic polypeptide is capable of inducing T cell specific immune response in a subject, the method comprising:(a) contacting a population of cells comprising antigen-presenting cells (APCs) comprising the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide with a population of T cells expressing a T-cell receptor (TCR) specific to a peptide:MHC complex, wherein the therapeutic polypeptide comprises a polypeptide sequence from a protein encoded by a genome of a pathogen associated with an infectious disease, wherein the peptide:MHC complex comprises:(i) an epitope sequence from the therapeutic polypeptide, and(ii) an MHC molecule expressed by the population of cells comprising APCs;(b) assaying for activation of the T cells using an activation assay or an activation marker; and(c) determining the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide as being capable of inducing a T cell specific immune response in a subject when the T cells are activated according to the activation assay or the activation marker of (b); wherein:(A) the epitope sequence of the peptide:MHC complex is present at a level in the population of cells comprising APCs that is undetectable by mass spectrometry,(B)the pathogen is a pathogen that only infects human cells, and / or(C)the protein encoded by the genome of the pathogen associated with the infectious disease is expressed by human cell infected with the pathogen, but is not expressed by non-human cell infected with the pathogen.

2. The method of claim 1, wherein the infectious disease vaccine comprises a ribonucleic acid (RNA) sequence encoding the therapeutic polypeptide.

3. The method of claim 1 or 2, wherein the therapeutic polypeptide comprises two or more polypeptide sequences each from a different protein encoded by the genome of the pathogen associated with the infectious disease.

4. The method of any one of claims 1-3, wherein the therapeutic polypeptide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polypeptide sequences eachfrom a different protein encoded by the genome of the pathogen associated with the infectious disease.

5. The method of any one of claims 1 -4, wherein the therapeutic polypeptide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different epitope sequences from two or more different proteins encoded by the genome of a pathogen associated with an infectious disease.

6. The method of any one of claims 1-5, wherein contacting comprises contacting the population of T cells to the population of cells comprising (i) APCs pulsed with the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide and (ii) APCs pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the protein encoded by the genome of the pathogen associated with an infectious disease.

7. The method of claim 6, wherein the ratio of (i) APCs pulsed with the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide and (ii) APCs pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the protein encoded by the genome of the pathogen associated with an infectious disease is from 99:1 to 1 :99, from 90: 10 to 10:90, or from 70:30 to 30:70.

8. The method of any one of claims 1-7, wherein the APCs comprise a cell line, optionally wherein the cell line is a A375 cell line.

9. The method of any one of claims 1-8, wherein contacting comprises contacting the population of T cells to the population of cells comprising APCs incubated with from 0.01 nM - 100 pM, from 0.1 nM - 10 pM, or from 1 nM - 1 pM of the therapeutic polypeptide or the polynucleotide encoding the therapeutic polypeptide.

10. A method of determining whether an epitope sequence from a protein encoded by a genome of a pathogen associated with an infectious disease is presented by an MHC molecule expressed by a cell infected by the pathogen, the method comprising:(a) contacting a population of cells comprising cells infected by the pathogen with a population of T cells expressing a T-cell receptor (TCR) specific to a peptide:MHC complex comprising:(i) an epitope sequence from a protein encoded by the genome of the pathogen associated with the infectious disease, and(ii) an MHC molecule expressed by the cells infected by the pathogen;(b) assaying for activation of the T cells using an activation assay or an activation marker; and(c) determining the epitope sequence from the protein encoded by the genome of the pathogen associated with an infectious disease to be presented by the MHC molecule expressed by the cell infected by the pathogen when the T cells are activated according to the activation assay or the activation marker of (b); wherein:(A)the epitope sequence of the peptide :MHC complex is present at a level in the population of cells comprising APCs that is undetectable by mass spectrometry,(B)the pathogen is a pathogen that only infects human cells, and / or(C)the protein encoded by the genome of the pathogen associated with the infectious disease is expressed by human cell infected with the pathogen, but is not expressed by non-human cell infected with the pathogen.

11. The method of claim 10, wherein the population of cells comprises primary cells infected by the pathogen, optionally wherein the population of cells comprises hepatocytes infected by the pathogen.

12. The method of claim 10 or 11, wherein contacting comprises contacting the population of T cells to a population of cells comprising (i) cells infected by the pathogen and (ii) cells not infected by the pathogen.

13. The method of any one of claim 12, wherein the ratio of (i) cells infected by the pathogen and (ii) cells not infected by the pathogen is from 99:1 to 1 :99, from 90:10 to 10:90, or from 70:30 to 30:70.

14. The method of any one of claims 1-13, further comprising, prior to (a), identifying the TCR specific to the peptide:MHC complex in an ex vivo assay.

15. The method of any one of claims 1-14, wherein the population of T cells expressing the TCR specific to the peptide :MHC complex are primary T cells or a cell line, optionally wherein the cell line is a Jurkat cell line.

16. The method of any one of claims 1-15, wherein the population of T cells expressing the TCR specific to the peptide :MHC complex is from a peripheral blood mononuclear cell (PBMC) sample.

17. The method of any one of claims 1-16, wherein the population of cells is from a PBMC sample.

18. The method of any one of claims 1-17, wherein contacting comprises contacting the population of T cells with the population of cells at a ratio of from 20: 1 to 1 :20, 10:1 to 1 :10, or 5: 1 to 1 :5.

19. A method of determining whether a polypeptide sequence from a protein encoded by the genome of a pathogen associated with an infectious disease contains an epitopesequence that is presented by an MHC molecule expressed by antigen-presenting cells (APCs), the method comprising:(a) contacting to a plurality of APCs(i) a polypeptide comprising the polypeptide sequence from the protein encoded by the genome of the pathogen associated with the infectious disease, or(ii) a polynucleotide encoding the polypeptide comprising the polypeptide sequence from the protein encoded by the genome of the pathogen associated with the infectious disease;(b) contacting the plurality of APCs from (a) to a population of immune cells comprising T cells, thereby forming a stimulated population of immune cells;(c) enriching T cells expressing a TCR that binds to an MHC multimer in complex with a candidate epitope sequence from the stimulated population of immune cells comprising T cells;(d) sequencing the TCR from the enriched T cells;(e) expressing the TCR in a population of T cells and assaying for activation of T cells in the population of T cells using an activation assay or an activation marker, wherein assaying comprises contacting the population of T cells expressing the TCR to APCs comprising a polypeptide comprising the candidate epitope sequence; and(f) identifying the candidate epitope sequence as being an epitope presented by an MHC molecule corresponding to the MHC multimer expressed by APCs when the T cells are activated according to the activation assay or the activation marker of (e).

20. The method of claim 19, further comprising preparing a vaccine using the polypeptide sequence from the protein encoded by the genome of the pathogen associated with the infectious disease.21 . The method of claim 20, wherein the vaccine comprises a ribonucleic acid (RNA) sequence encoding the polypeptide.

22. The method of claim 20 or 21, wherein the RNA sequence encodes two or more polypeptide sequences each from a different protein encoded by the genome of the pathogen associated with the infectious disease.

23. The method of any one of claims 20-22, wherein the RNA sequence encodes 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polypeptide sequences each from a different protein encoded by the genome of the pathogen associated with the infectious disease.

24. The method of any one of claims 20-23, wherein the RNA sequence encodes 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different epitope sequences from two or more different proteins encoded by the genome of a pathogen associated with an infectious disease.

25. The method of any one of claims 1-24, wherein the activation assay comprises detecting the activation marker by flow cytometry.

26. The method of any one of claims 1-25, wherein the activation assay comprises measuring a secreted cytokine or chemokine via an immunoassay.

27. The method of any one of claims 1-26, wherein the activation assay comprises measuring a secreted cytokine or chemokine via MesoScale Discovery (MSD).

28. The method of any one of claims 1-27, wherein the activation marker is a cell surface marker.

29. The method of claim 28, wherein the cell surface marker is selected from the group consisting of CD69, CD25, CD40L, CD38, OX-40, 4-1BB, CD27, and ICOS.

30. The method of claim 27, wherein secreted cytokine or chemokine is selected from the group consisting of IL-2, IFN-y, TNF-a, IL-6, IL-12, IL-17A, IL-17B, IL-17C, IL-17D, IL-17E, and IL-17F.

31. The method of any one of claims 1-18, wherein the epitope sequence of the peptide:MHC complex is present at a level in the population of cells comprising APCs that is undetectable by mass spectrometry.

32. The method of any one of claims 19-31, wherein the epitope sequence that is presented by an MHC molecule expressed by APCs is present in the APCs at a level that is undetectable by mass spectrometry.

33. The method of any one of claims 1-31, wherein the pathogen is a pathogen that only infects human cells.

34. The method of any one of claims 1 -31 , wherein the protein encoded by the genome of the pathogen associated with the infectious disease is expressed by human cell infected with the pathogen, but is not expressed by non-human cell infected with the pathogen.

35. The method of any one of claims 19-34, wherein expressing the TCR in a population of T cells comprises expressing the TCR in PBMCs.

36. The method of any one of claims 19-34, wherein expressing the TCR in a population of T cells comprises expressing the TCR in a cell line.

37. The method of claim 36, wherein expressing the TCR in a population of T cells comprises expressing the TCR in a Jurkat cell line.

38. The method of any one of claims 19-37, wherein assaying comprises contacting the population of T cells expressing the TCR to APCs that express an MHC molecule corresponding to the MHC multimer.

39. The method of any one of claims 19-38, wherein the APCs from (e) are a cell line.

40. The method of claim 39, wherein the cell line comprises A375 cells.

41. The method of any one of claims 19-38, wherein the APCs from (e) are primary cells.

42. The method of claim 41, wherein the primary cells comprise primary hepatocytes.

43. The method of any one of claims 19-42, wherein assaying comprises contacting the population of T cells expressing the TCR to APCs infected with the pathogen.

44. The method of any one of claims 19-43, wherein assaying comprises contacting the population of T cells expressing the TCR to the APCs that are hepatocytes infected with the pathogen.

45. The method of any one of claims 19-44, wherein assaying comprises contacting the population of T cells expressing the TCR to the APCs comprising a polypeptide comprising the candidate epitope sequence at a ratio of from 20:1 to 1 :20.

46. The method of any one of claims 19-45, wherein assaying comprises contacting the population of T cells expressing the TCR to the APCs comprising a polypeptide comprising the candidate epitope sequence at a ratio of from 10:1 to 1 :10.

47. The method of any one of claims 19-46, wherein assaying comprises contacting the population of T cells expressing the TCR to the APCs comprising a polypeptide comprising the candidate epitope sequence at a ratio of from 5:1 to 1 :5.

48. The method of any one of claims 19-47, wherein assaying comprises contacting the population of T cells expressingthe TCR to the APCs incubated with from 0.01 nM - 100 pM of the polypeptide comprising the candidate epitope sequence.

49. The method of any one of claims 19-48, wherein assaying comprises contacting the population of T cells expressingthe TCR to the APCs incubated with from 0.1 nM- 10 pM of the polypeptide comprising the candidate epitope sequence.

50. The method of any one of claims 19-49, wherein assaying comprises contacting the population of T cells expressingthe TCR to the APCs incubated with from 1 nM- 1 pM of the polypeptide comprising the candidate epitope sequence.

51. The method of any one of claims 19-50, wherein assaying comprises contacting the population of T cells expressing the TCR to the APCs comprising (i) APCs pulsed with the polypeptide comprising the candidate epitope sequence and (ii) APCspulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence.

52. The method of any one of claim 51, wherein the ratio of (i) the APCs pulsed with the polypeptide comprising the candidate epitope sequence to (ii) the APCs pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence is from 99:1 to 1 :99.

53. The method of any one of claim 51, wherein the ratio of (i) the APCs pulsed with the polypeptide comprising the candidate epitope to (ii) the APCs pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence is from 90:10 to 10:90.

54. The method of any one of claim 51, wherein the ratio of (i) the APCs pulsed with the polypeptide comprising the candidate epitope sequence to (ii) the APCs pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence is from 70:30 to 30:70.

55. The method of any one of claims 19-54, wherein assaying comprises contacting the population of T cells expressing the TCR to the APCs comprising (i) APCs that express an MHC molecule corresponding to the MHC multimer and that have been pulsed with the polypeptide comprising the candidate epitope sequence and (ii) APCs that do not express an MHC molecule corresponding to the MHC multimer and that have been pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence.

56. The method of claim 55, wherein the ratio of (i) the APCs that express an MHC molecule corresponding to the MHC multimer and that have been pulsed with the polypeptide comprising the candidate epitope sequence to (ii) the APCs that do not express an MHC molecule corresponding to the MHC multimer and that have been pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence is from 99:1 to 1 :99.

57. The method of claim 55, wherein the ratio of (i) the APCs that express an MHC molecule corresponding to the MHC multimer and that have been pulsed with the polypeptide comprising the candidate epitope sequence to (ii) the APCs that do not express an MHC molecule corresponding to the MHC multimer and that have been pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence is from 90:10 to 10:90.

58. The method of claim 55, wherein the ratio of (i) the APCs that express an MHC molecule corresponding to the MHC multimer and that have been pulsed with thepolypeptide comprising the candidate epitope sequence to (ii) the APCs that do not express an MHC molecule corresponding to the MHC multimer and that have been pulsed with an irrelevant polypeptide or a polypeptide that does not comprise the candidate epitope sequence is from 70:30 to 30:70.

59. The method of any one of claims 19-58, wherein the population of immune cells are from a PBMC sample or is a cell line.

60. The method of any one of claims 19-59, wherein the population of immune cells are isolated from a healthy subject.

61. An ex vivo method of preparing antigen-specific T cells, the method comprising:(a) depleting CD14+ cells and / or CD25+ cells from a population of immune cells comprising antigen-presenting cells (APCs) and T cells, thereby forming a CD14 and / or CD25 depleted population of immune cells comprising a first population of APCs and T cells, wherein the population of immune cells is from a biological sample from a human subject;(b) incubating the first population of APCs and T cells from (a) for a first time period in the presence of:(i) FMS-like tyrosine kinase 3 receptor ligand (FLT3L), and(ii) (A) a polypeptide comprising an epitope sequence, wherein the epitope sequence is from a protein encoded by the genome of a pathogen associated with an infectious disease, or (B) a polynucleotide encoding the polypeptide; thereby forming a population of cells comprising stimulated T cells;(c) expandingthe stimulated T cells from (b), thereby formingan expanded population of cells comprising antigen-specific T cells, wherein the antigen-specific T cells express a T-cell receptor (TCR) specific to a peptide:MHC complex comprising:(i) a peptide consisting of the epitope sequence from the protein encoded by the genome of the pathogen associated with the infectious disease, and(ii) an MHC molecule expressed by the APCs of the population of immune cells of (a).

62. The method of claim 61 , wherein the expanded population of cells comprises at least 1x106total cells.

63. The method of claim 61 or 62, wherein the expanded population of cells comprises at least IxlO7total cells.

64. The method of any one of claims 61-63, wherein the expanded population of cells comprises at least 1x108total cells.

65. The method of any one of claims 61-64, wherein the expanded population of cells comprises from IxlO8to IxlO11total cells.

66. The method of any one of claims 61-63, wherein the expanded population of cells comprises from 0.75xl08to 1.25xl010total cells.

67. The method of any one of claims 61-64, wherein the expanded population of cells comprises from 5x108to lxl010total cells, 5xl08to IxlO9total cells, or from 5xl08to 2xl09total cells.

68. The method of any one of claims 61-67, wherein the depleting comprises depleting CD14+ cells and / or CD25+ cells directly from a washed and / or cryopreserved peripheral blood mononuclear cell (PBMC) sample from a human subject.

69. The method of any one of claims 61-68, wherein the incubating comprises incubatingthe CD14 and / or CD25 depleted population of immune cells comprising a first population of APCs and T cells for a first time period in the presence of:(i) FMS-like tyrosine kinase 3 receptor ligand (FLT3L), and(ii) a polypeptide comprisingatleasttwo different epitope sequences, wherein each of the least two different epitope sequences is from the same protein encoded by the genome of a pathogen associated with an infectious disease.

70. The method of any one of claims 61-68, wherein the incubating comprises incubatingthe CD14 and / or CD25 depleted population of immune cells comprising a first population of APCs and T cells for a first time period in the presence of:(i) FMS-like tyrosine kinase 3 receptor ligand (FLT3L), and(ii) a polypeptide comprisingatleasttwo different epitope sequences, wherein each of the least two different epitope sequencesis from a different protein encoded by the genome of a pathogen associated with an infectious disease.

71. The method of any one of claims 61-68, wherein the incubating comprises incubatingthe CD14 and / or CD25 depleted population of immune cells comprising a first population of APCs and T cells for a first time period in the presence of:(i) FMS-like tyrosine kinase 3 receptor ligand (FLT3L), and(ii) an mRNA encoding a polypeptide comprising at least two different epitope sequences, wherein each of the least two different epitope sequences is from the same protein encoded by the genome of a pathogen associated with an infectious disease.

72. The method of any one of claims 61-68, wherein the incubating comprises incubatingthe CD14 and / or CD25 depleted population of immune cells comprising a first population of APCs and T cells for a first time period in the presence of:(i) FMS-like tyrosine kinase 3 receptor ligand (FLT3L), and(ii) an mRNA encoding a polypeptide comprising at least two different epitope sequences, wherein each of the least two different epitope sequences is from a different protein encoded by the genome of a pathogen associated with an infectious disease.

73. The method of any one of claims 69-72, wherein a first epitope sequence of the at least two different epitope sequences is connected to a second epitope sequence of the at least two different epitope sequences via a linker sequence.

74. The method of any one of claims 69-73, wherein the at least two different epitope sequences are expressed as a single polypeptide chain.

75. The method of any one of claims 70, or 72-74, wherein the polypeptide comprises at least2, 3, 4, 5, 6, 7, 8, 9, 10 or more different epitope sequences from two or more different proteins encoded by the genome of a pathogen associated with an infectious disease.

76. The method of any one of claims 61-75, wherein (b) comprises introducing the polynucleotide encoding the polypeptide or the mRNA encoding the polypeptide into the APCs of the first population of APCs and T cells from (a).

77. The method of claim 76, wherein the introducing comprises electroporating or nucleofecting, optionally wherein the electroporating or nucleofecting is carried out without separating the T cells from the APCs of the first population of APCs and T cells from (a).

78. The method of any one of claims 61-77, wherein (b) and (c) are performed in less than 28 days.

79. The method of any one of claims 61-78, wherein the fraction of CD8+ antigenspecific T cells of the total number of CD8+ T cells in the expanded population of cells is at least two-fold higher than the fraction of CD8+ antigen-specific T cells of the total number of CD8+ T cells in the CD14 and / or CD25 depleted population of immune cells.

80. The method of any one of claims 61-79, wherein the fraction of CD4+ antigenspecific T cells of the total number of CD4+ T cells in the expanded population of cells is at least two-fold higher than the fraction of CD4+ antigen-specific T cells of the total number of CD4+ T cells in the CD14 and / or CD25 depleted population of immune cells.

81. The method of any one of claims 61-80, wherein at least 0.1% of the CD8+ T cells in the expanded population of cells are CD8+ antigen-specific T cells derived from naive CD8+ T cells.

82. The method of any one of claims 61-81, wherein at least 0.1% of the CD4+ T cells in the expanded population of cells are CD4+ antigen-specific T cells derived from naive CD4+ T cells.

83. The method of any one of claims 61-82, wherein expanding comprises (A) contacting the population of cells comprising stimulated T cells with a second population of mature APCs, wherein the second population of mature APCs (i) have been incubated with FLT3L and (ii) present the peptide consisting of the epitope sequence from the protein encoded by the genome of the pathogen associated with the infectious disease; and (B) expanding the population of cells comprising stimulated T cells for a second time period, thereby forming an expanded population of T cells.

84. The method of claim 83, wherein the second population of mature APCs have been incubated with FLT3L for at least 1 day prior to contacting the population of cells comprising stimulated T cells with the second population of mature APCs.

85. The method of any one of claims 61-84, wherein depleting CD 14+ cells and / or CD25+ cells from the population of immune cells comprising a first population of APCs and T cells comprises contacting the population of immune cells comprising a first population of APCs and T cells with a CD 14 binding agent and / or a CD25 binding agent.

86. The method of any one of claims 61-85, wherein the population of immune cells is from a biological sample from a human subject.

87. A method of identifying an antigen from an infectious disease caused by a pathogen that is recognizable by a T-cell receptor (TCR) from a subject, the method comprising:(a) contacting a population of T cells expressing TCRs with a plurality of antigen- presenting cells (APCs) presenting a candidate antigen from the pathogen, wherein a subset of T cells expressing a subset of TCRs recognizing the antigen are activated;(b) contacting one or more TCRs from the subset of TCRs with a cell infected by the pathogen, wherein the cell presents an epitope in complex with a major histocompatibility complex (MHC) molecule from an antigen of the pathogennaturally processed within the cell, and wherein the one or more TCRs recognize the epitope; and(c) identifying the candidate antigen as an antigen capable of being recognized by a T-cell receptor (TCR) from a subject.

88. The method of claim 87, further comprising, prior to (b), identifying the one or more TCRs from the subset of T cells expressing the subset of TCRs.

89. A method of identifying an antigen from an infectious disease caused by a pathogen that is recognizable by a T-cell receptor (TCR) from a subject, the method comprising:(a) identifying in an in vitro assay one or more TCRs that recognize a candidate antigen from the pathogen;(b) contacting the one or more TCRs with a cell infected by the pathogen, wherein the cell presents an epitope in complex with a major histocompatibility complex (MHC) molecule from an antigen of the pathogen naturally processed within the cell, and wherein the one or more TCRs recognize the epitope; and(c) identifying the candidate antigen as an antigen capable of being recognized by a T-cell receptor (TCR) from a subject.

90. The method of any one of claims 87-89, wherein identifying comprises identifying the one or more TCRs by sequencing.

91. The method of any one of claims 87-90, further comprising, prior to (b), selecting the one or more TCRs.

92. The method of any one of claims 87-91, further comprising, prior to (b), expressing the one or more TCRs recombinantly in one or more cells.

93. The method of claim 92, wherein one or more cells comprise PMBCs or a cell line, optionally wherein the cell line is a Jurkat cell line.

94. The method of any one of claims 87-93, wherein the one or more TCRs comprise the TCR that is expressed by the subject.

95. The method of any one of claims 87-94, further comprising preparing a vaccine, wherein the vaccine comprises a polypeptide comprising the candidate antigen or a polynucleotide encoding the polypeptide comprising the candidate antigen.

96. The method of claim 95, wherein the vaccine comprises a ribonucleic acid (RNA) sequence encoding the polypeptide comprising the candidate antigen.

97. The method of claim 95 or 96, wherein the polypeptide comprises two or more polypeptide sequences each from a different protein encoded by the genome of the pathogen associated with the infectious disease.

98. The method of any one of claims 95-97, wherein the polypeptide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polypeptide sequences each from a different protein encoded by the genome of the pathogen associated with the infectious disease.

99. The method of any one of claims 95-98, wherein the polypeptide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different epitope sequences from two or more different proteins encoded by the genome of a pathogen associated with an infectious disease.

100. The method of any one of claims 2-9, 21-60, 71-86, or 96-99, wherein the RNA sequence or the mRNA further comprises an RNA sequence encoding (i) an MHC class I trafficking signal (MITD) sequence, (ii) a linker, and / or (iii) a signal peptide.

101. A method of identifying a T-cell receptor (TCR) that recognizes an antigen from an infectious disease caused by a pathogen in complex with a major histocompatibility complex (MHC) molecule, the method comprising:(a) contacting a population of T cells expressing candidate TCRs with a plurality of antigen-presenting cells (APCs) presenting antigens from the infectious disease, wherein a subset of T cells expressing a subset of candidate TCRs recognizing the antigens are activated;(b) identifying one or more TCRs from the subset of T cells expressing the subset of candidate TCRs;(c) contacting the one or more TCRs with a cell infected by the pathogen, wherein at least one TCR of the one or more TCRs recognizing an antigen presented by an MHC molecule of the cell is activated; and(d) selecting the at least one TCR recognizing the antigen presented by the MHC molecule of the cell, thereby identifying the TCR.

102. The method of claim 101, wherein the cell infected by the pathogen is a cell that is infected naturally by the pathogen.

103. The method of claims 101 or 102, wherein the antigen comprises an epitope that is naturally processed by the cell.

104. The method of any one of claims 101-103, wherein the antigens in (a) comprises a sequence of the antigen presented by the MHC molecule of the cell.

105. The method of any one of claims 101-104, wherein the pathogen infects a human subject but lacks ability to infect a non-human subject.

106. The method of any one of claims 101-105, further comprising, prior to (b), expanding the subset of T cells expressing the subset of candidate TCRs recognizing the antigens.

107. The method of any one of claims 101-106, further comprising, prior to (b), sequencing the subset of T cells expressing the subset of candidate TCRs recognizing the antigens.

108. The method of any one of claims 101-107, wherein identifying in (b) comprises identifying the one or more TCRs from the sequencing.

109. The method of any one of claims 101-108, wherein contacting in (c) comprises contacting cells expressing the one or more TCRs with the cell infected by the pathogen.

110. The method of any one of claims 87-88, or 101-109, wherein the subset of T cells activated or the at least one TCR activated (i) expresses an activation marker selected from the group consisting of CD69, CD25, CD40L, CD38, OX-40, 4-1BB, CD27, and ICOS and / or (ii) secretes a cytokine or chemokine selected from the group consisting of IL-2, IFN-y, TNF-a, IL-6, IL-12, IL-17A, IL-17B, IL-17C, IL- 170, IL-17E, and IL-17F.

111. The method of any one of claims 1-110, wherein the pathogen does not infect a nonhuman cell.

112. The method of any one of claims 1-111, wherein the MHC molecule is an MHC class I molecule or an MHC class II molecule.

113. The method of any one of claims 1-112, wherein the MHC molecule is encoded by an HLA allele selected from the group consisting of HLA-A02 allele, HLA-A01 allele, HLA-A03 allele, HLA-A24 allele, HLA-A26 allele, HLA-A31 allele, HLA- A68 allele, HLA-A69 allele, HLA-B07 allele, HLA-B08 allele, HLA-B12 allele, HLA-B35 allele, HLA-B46 allele, HLA-B50 allele, HLA-B51 allele, HLA-C04 allele, HLA-C06 allele, HLA-C07 allele, and HLA-C12 allele.

114. The method of any one of claims 1-113, wherein the MHC molecule is encoded by an HLA-A02 allele.

115. The method of any one of claims 1-114, wherein the epitope(s), the epitope sequence(s), or the candidate epitope sequence has a binding affinity of an IC50of 500 nM or less for the MHC molecule.

116. The method of any one of claims 1-115, wherein the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from 8 to 12 amino acids in length.

117. The method of any one of claims 1-115, wherein the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from 15 to 25 amino acids in length.

118. The method of any one of claims 1-117, wherein the infectious disease is selected from the group consisting of malaria, Epstein-Barr Virus (EBV), Human Papillomavirus (HPV), Cytomegalovirus (CMV), COVID-19, Middle Eastern Respiratory Syndrome (MERS), Human Immunodeficiency Virus (HIV), Measles, Rubella, Chickenpox, Poliomyelitis, Pertussis, Chlamydia, Gonorrhea, Spirochete infections (optionally, Lyme, syphilis, or leptospirosis), Tuberculosis, Toxoplasmosis, Giardia, Chagas Disease, and Helminth infections (optionally, hookworm, ascaris, whipworm, or tapeworm).

119. The method of any one of claims 1-118, wherein the pathogen is selected from the group consisting of Plasmodium falciparum, EBV, HPV, CMV, SARS-CoV-2, SARS-CoV-1, HIV, Varicella-zoster Virus (VZV), measles virus (MV), Poliovirus, Rubella Virus, Bordetella pertussis, Chlamydia trachomatis, Neisseria gonorrhoeae, Borrelia burgdorferi, Treponema pallidum, Leptospira, Mycobacterium tuberculosis, Toxoplasma gondii, Giardia duodenalsis, Trypanosoma cruzi, Ankylostoma duodenale , Ascaris lumbricoides, Trichuris, and Taenia.

120. The method of any one of claims 1-119, wherein infectious disease is malaria.

121. The method of any one of claims 1-120, wherein the pathogen is Plasmodium falciparum.

122. The method of any one of claims 1-120, wherein the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from a protein encoded by the genome of Plasmodium falciparum.

123. The method of claim 122, wherein the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from TRAP.

124. The method of claim 122 or 123, wherein the epitope(s), the epitope sequence(s), or the candidate epitope sequence is selected from the group consisting of FLIFFDLFLV (SEQ ID NO: 1), NLTDALLQV (SEQ ID NO: 2), and LLMDCSGSI (SEQ ID NO: 3).

125. The method of claim 122, wherein the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from CSP, LISP1, LSAlb, or LSAP2, optionally wherein (i) the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from LISP1 and is selected from one or more of KIFGCITNK (SEQ ID NO: 75), KQLSLIPSI (SEQ ID NO: 69), and TVGDVLRYV (SEQ ID NO: 71); or (ii) the epitope(s), the epitope sequence(s), or the candidate epitope sequence is from LSAlb and is SLYDEHIKK (SEQ ID NO: 76).

126. The method of claim 122 or 125, wherein the epitope(s), the epitope sequence(s), or the candidate epitope sequence is selected from the amino acid sequence set forth in any one of SEQ ID NOs: 60-88.

127. The method of any one of claims 3-5, 22-60, 70, or 72-75, wherein the different protein(s) are encoded by the genome of Plasmodium falciparum.

128. The method of claim 122 or 127, wherein the protein or the different protein(s) encoded by the genome of Plasmodium falciparum is selected from one or more of CSP, TRAP, UIS3, UIS4, LSAP2, LSA-l(a), LSA-l(b), LISP-2, and LISP-1.

129. A recombinant nucleic acid encoding a T-cell receptor (TCR) comprising a TCR beta chain construct and a TCR alpha chain construct, wherein the TCR beta chain construct comprises a complementarity determining region 3 (CDR3) having an amino acid sequence CASSQGKGNTIYF (SEQ ID NO: 10).

130. The recombinant nucleic acid of claim 129, wherein the TCR beta chain construct comprises a variable region having an amino acid sequence with at least 80% sequence identity to an amino acid sequence as set forth in SEQ ID NO: 13.

131. The recombinant nucleic acid of claim 129 or 130, wherein the TCR beta chain construct comprises a complementarity determining region 1 (CDR1) having an amino acid sequence set forth in SEQ ID NO: 8 and a complementarity determining region 2 (CDR2) having an amino acid sequence set forth in SEQ ID NO: 9.

132. The recombinant nucleic acid of any one of claims 129-131, wherein the TCR alpha chain construct comprises a CDR1, a CDR2, and a CDR3, wherein the CDR1 has an amino acid sequence set forth in SEQ ID NO: 5, the CDR2 has an amino acid sequence set forth in SEQ ID NO: 6, and the CDR3 has an amino acid sequence CAVGTPSNSNSGYALNF (SEQ ID NO: 7).

133. The recombinant nucleic acid of any one of claims 129-132, wherein the TCR alpha chain construct comprises a variable region having an amino acid sequence having at least 80% sequence identity to an amino acid sequence set forth in SEQ ID NO: 11134. The recombinant nucleic acid of any one of claims 129-133, wherein the TCR comprises: (a) a beta chain having an amino acid sequence set forth in SEQ ID NO: 14, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 14, and (b) an alpha chain having an amino acid sequence set forth in SEQ ID NO: 12, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 12.

135. A recombinant nucleic acid encoding a T cell receptor (TCR) comprising a TCR beta chain construct and a TCR alpha chain construct, wherein the TCR beta chainconstruct comprises a complementarity determining region 3 (CDR3) having an amino acid sequence CASSYAPTGLTEAFF (SEQ ID NO: 20).

136. The recombinant nucleic acid of claim 135, wherein the TCR beta chain construct comprises a variable region having an amino acid sequence with at least 80% sequence identity to an amino acid sequence as set forth in SEQ ID NO: 23.

137. The recombinant nucleic acid of claim 135 or 136, wherein the TCR beta chain construct comprises a complementarity determining region 1 (CDR1) having an amino acid sequence set forth in SEQ ID NO: 18 and a complementarity determining region 2 (CDR2) having an amino acid sequence set forth in SEQ ID NO: 19138. The recombinant nucleic acid of any one of claims 135-137, wherein the TCR alpha chain construct comprises a CDR1, a CDR2, and a CDR3, wherein the CDR1 has an amino acid sequence set forth in SEQ ID NO: 15, the CDR2 has an amino acid sequence set forth in SEQ ID NO: 16, and the CDR3 has an amino acid sequence CAGLNNARLMF (SEQ ID NO: 17).

139. The recombinant nucleic acid of any one of claims 135-138, wherein the TCR alpha chain construct comprises a variable region having an amino acid sequence having at least 80% sequence identity to an amino acid sequence set forth in SEQ ID NO: 21140. The recombinant nucleic acid of any one of claims 135-139, wherein the TCR comprises: (a) a beta chain having an amino acid sequence set forth in SEQ ID NO: 24, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 24, and (b) an alpha chain having an amino acid sequence set forth in SEQ ID NO: 22, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 22.

141. A recombinant nucleic acid encoding a T cell receptor (TCR) comprising a TCR beta chain construct and a TCR alpha chain construct, wherein the TCR beta chain construct comprises a complementarity determining region 3 (CDR3) having an amino acid sequence CASSPPFSGEQFF (SEQ ID NO: 30).

142. The recombinant nucleic acid of claim 141, wherein the TCR beta chain construct comprises a variable region having an amino acid sequence with at least 80% sequence identity to an amino acid sequence as set forth in SEQ ID NO: 33.

143. The recombinant nucleic acid of claim 141 or 142, wherein the TCR beta chain construct comprises a complementarity determining region 1 (CDR1) having an amino acid sequence set forth in SEQ ID NO: 28 and a complementaritydetermining region 2 (CDR2) having an amino acid sequence set forth in SEQ ID NO: 29144. The recombinant nucleic acid of any one of claims 141-143, wherein the TCR alpha chain construct comprises a CDR1, a CDR2, and a CDR3, wherein the CDR1 has an amino acid sequence set forth in SEQ ID NO: 25, the CDR2 has an amino acid sequence set forth in SEQ ID NO: 26, and the CDR3 has an amino acid sequence CAIRSGGGADGLTF (SEQ ID NO: 27).

145. The recombinant nucleic acid of any one of claims 141-144, wherein the TCR alpha chain construct comprises a variable region having an amino acid sequence having at least 80% sequence identity to an amino acid sequence set forth in SEQ ID NO: 31146. The recombinant nucleic acid of any one of claims 141-145, wherein the TCR comprises: (a) a beta chain having an amino acid sequence set forth in SEQ ID NO: 34, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 34, and (b) an alpha chain having an amino acid sequence set forth in SEQ ID NO: 32, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 32.

147. A recombinant nucleic acid encoding a T cell receptor (TCR) comprising a TCR beta chain construct and a TCR alpha chain construct, wherein the TCR beta chain construct comprises a complementarity determining region 3 (CDR3) having an amino acid sequence CASSLPFGNTIYF (SEQ ID NO: 40).

148. The recombinant nucleic acid of claim 147, wherein the TCR beta chain construct comprises a variable region having an amino acid sequence with at least 80% sequence identity to an amino acid sequence as set forth in SEQ ID NO: 43.

149. The recombinant nucleic acid of claim 147 or 148, wherein the TCR beta chain construct comprises a complementarity determining region 1 (CDR1) having an amino acid sequence set forth in SEQ ID NO: 28 and a complementarity determining region 2 (CDR2) having an amino acid sequence set forth in SEQ ID NO: 29150. The recombinant nucleic acid of any one of claims 147-149, wherein the TCR alpha chain construct comprises a CDR1, a CDR2, and a CDR3, wherein the CDR1 has an amino acid sequence set forth in SEQ ID NO: 35, the CDR2 has an amino acid sequence set forth in SEQ ID NO: 36, and the CDR3 has an amino acid sequence CALTGGGADGLTF (SEQ ID NO: 37).

151. The recombinant nucleic acid of any one of claims 147-150, wherein the TCR alpha chain construct comprises a variable region having an amino acid sequence havingat least 80% sequence identity to an amino acid sequence set forth in SEQ ID NO: 41152. The recombinant nucleic acid of any one of claims 147-151, wherein the TCR comprises: (a) a beta chain having an amino acid sequence set forth in SEQ ID NO: 44, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 44, and (b) an alpha chain having an amino acid sequence set forth in SEQ ID NO: 42, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 42.

153. The recombinant nucleic acid of any one of claims 147-149, wherein the TCR alpha chain construct comprises a CDR1, a CDR2, and a CDR3, wherein the CDR1 has an amino acid sequence set forth in SEQ ID NO: 45, the CDR2 has an amino acid sequence set forth in SEQ ID NO: 46, and the CDR3 has an amino acid sequence CALTGRGYCGSARQLTF (SEQ ID NO: 47).

154. The recombinant nucleic acid of any one of claims 147-149 or 153, wherein the TCR alpha chain construct comprises a variable region having an amino acid sequence having at least 80% sequence identity to an amino acid sequence set forth in SEQ ID NO: 48155. The recombinant nucleic acid of any one of claims 147-149, or 153-154, wherein the TCR comprises: (a) a beta chain having an amino acid sequence set forth in SEQ ID NO: 44, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 44, and (b) an alpha chain having an amino acid sequence set forth in SEQ ID NO: 49, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 49.

156. A recombinant nucleic acid encoding a T cell receptor (TCR) comprising a TCR beta chain construct and a TCR alpha chain construct, wherein the TCR beta chain construct comprises a complementarity determining region 3 (CDR3) having an amino acid sequence CASSPGTGAGNTIYF (SEQ ID NO: 55).

157. The recombinant nucleic acid of claim 156, wherein the TCR beta chain construct comprises a variable region having an amino acid sequence with at least 80% sequence identity to an amino acid sequence as set forth in SEQ ID NO: 58.

158. The recombinant nucleic acid of claim 156 or 157, wherein the TCR beta chain construct comprises a complementarity determining region 1 (CDR1) having an amino acid sequence set forth in SEQ ID NO: 53 and a complementarity determining region 2 (CDR2) having an amino acid sequence set forth in SEQ ID NO: 54159. The recombinant nucleic acid of any one of claims 156-158, wherein the TCR alpha chain construct comprises a CDR1, a CDR2, and a CDR3, wherein the CDR1 has anamino acid sequence set forth in SEQ ID NO: 50, the CDR2 has an amino acid sequence set forth in SEQ ID NO: 51, and the CDR3 has an amino acid sequence CAPYRYSGAGSYQLTF (SEQ ID NO: 52).

160. The recombinant nucleic acid of any one of claims 156-159, wherein the TCR alpha chain construct comprises a variable region having an amino acid sequence having at least 80% sequence identity to an amino acid sequence set forth in SEQ ID NO: 56161. The recombinant nucleic acid of any one of claims 156-160, wherein the TCR comprises: (a) a beta chain having an amino acid sequence set forth in SEQ ID NO: 59, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 59, and (b) an alpha chain having an amino acid sequence set forth in SEQ ID NO: 57, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 57.

162. A recombinant nucleic acid encoding a T cell receptor (TCR) comprising a TCR beta chain construct and a TCR alpha chain construct, wherein the TCR beta chain construct comprises a complementarity determining region 3 (CDR3) having an amino acid sequence CASSVQAANSPLHF (SEQ ID NO: 993).

163. The recombinant nucleic acid of claim 162, wherein the TCR beta chain construct comprises a variable region having an amino acid sequence with at least 80% sequence identity to an amino acid sequence as set forth in SEQ ID NO: 996.

164. The recombinant nucleic acid of claim 162 or 163, wherein the TCR beta chain construct comprises a complementarity determining region 1 (CDR1) having an amino acid sequence set forth in SEQ ID NO: 991 and a complementarity determining region 2 (CDR2) having an amino acid sequence set forth in SEQ ID NO: 992165. The recombinant nucleic acid of any one of claims 162-164, wherein the TCR alpha chain construct comprises a CDR1, a CDR2, and a CDR3, wherein the CDR1 has an amino acid sequence set forth in SEQ ID NO: 988, the CDR2 has an amino acid sequence set forth in SEQ ID NO: 989, and the CDR3 has an amino acid sequence CAMREGPLMDSSYKLIF (SEQ ID NO: 990).

166. The recombinant nucleic acid of any one of claims 162-165, wherein the TCR alpha chain construct comprises a variable region having an amino acid sequence having at least 80% sequence identity to an amino acid sequence set forth in SEQ ID NO: 994167. The recombinant nucleic acid of any one of claims 162-166, wherein the TCR comprises: (a) a beta chain having an amino acid sequence set forth in SEQ ID NO:997, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 997, and (b) an alpha chain having an amino acid sequence set forth in SEQ ID NO: 995, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 995.

168. A recombinant nucleic acid encoding a T cell receptor (TCR) comprising a TCR beta chain construct and a TCR alpha chain construct, wherein the TCR beta chain construct comprises a complementarity determining region 3 (CDR3) having an amino acid sequence CAISSMEDEKLFF (SEQ ID NO: 1001).

169. The recombinant nucleic acid of claim 168, wherein the TCR beta chain construct comprises a variable region having an amino acid sequence with at least 80% sequence identity to an amino acid sequence as set forth in SEQ ID NO: 1004.

170. The recombinant nucleic acid of claim 168 or 169, wherein the TCR beta chain construct comprises a complementarity determining region 1 (CDR1) having an amino acid sequence set forth in SEQ ID NO: 999 and a complementarity determining region 2 (CDR2) having an amino acid sequence set forth in SEQ ID NO: 1000171. The recombinant nucleic acid of any one of claims 168-170, wherein the TCR alpha chain construct comprises a CDR1, a CDR2, and a CDR3, wherein the CDR1 has an amino acid sequence set forth in SEQ ID NO: 50, the CDR2 has an amino acid sequence set forth in SEQ ID NO: 51, and the CDR3 has an amino acid sequence CAVALYNNNDMRF (SEQ ID NO: 998).

172. The recombinant nucleic acid of any one of claims 168-171 , wherein the TCR alpha chain construct comprises a variable region having an amino acid sequence having at least 80% sequence identity to an amino acid sequence set forth in SEQ ID NO: 1002173. The recombinant nucleic acid of any one of claims 168-172, wherein the TCR comprises: (a) a beta chain having an amino acid sequence set forth in SEQ ID NO: 1005, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 1005, and (b) an alpha chain having an amino acid sequence set forth in SEQ ID NO: 1003, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 1003.

174. A recombinant nucleic acid encoding a T cell receptor (TCR) comprising a TCR beta chain construct and a TCR alpha chain construct, wherein the TCR beta chain construct comprises a complementarity determining region 3 (CDR3) having an amino acid sequence CATRESSNQPQHF (SEQ ID NO: 1009).

175. The recombinant nucleic acid of claim 174, wherein the TCR beta chain construct comprises a variable region having an amino acid sequence with at least 80% sequence identity to an amino acid sequence as set forth in SEQ ID NO: 1012.

176. The recombinant nucleic acid of claim 174 or 175, wherein the TCR beta chain construct comprises a complementarity determining region 1 (CDR1) having an amino acid sequence set forth in SEQ ID NO: 1007 and a complementarity determining region 2 (CDR2) having an amino acid sequence set forth in SEQ ID NO: 1008177. The recombinant nucleic acid of any one of claims 174-176, wherein the TCR alpha chain construct comprises a CDR1, a CDR2, and a CDR3, wherein the CDR1 has an amino acid sequence set forth in SEQ ID NO: 50, the CDR2 has an amino acid sequence set forth in SEQ ID NO: 51, and the CDR3 has an amino acid sequence CAVRSNNNDMRF (SEQ ID NO: 1006).

178. The recombinant nucleic acid of any one of claims 174-177, wherein the TCR alpha chain construct comprises a variable region having an amino acid sequence having at least 80% sequence identity to an amino acid sequence set forth in SEQ ID NO: 1010179. The recombinant nucleic acid of any one of claims 174-178, wherein the TCR comprises: (a) a beta chain having an amino acid sequence set forth in SEQ ID NO: 1013, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 1013, and (b) an alpha chain having an amino acid sequence set forth in SEQ ID NO: 1011, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 1011.

180. The recombinant nucleic acid of any one of claims 129-179, wherein the TCR is a soluble TCR or a membrane-bound TCR.

181. The recombinant nucleic acid of claim 180, wherein the soluble TCR does not comprise a transmembrane domain.

182. The recombinant nucleic acid of claim 180 or 181, wherein the soluble TCR does not comprise a constant domain.

183. The recombinant nucleic acid of any one of claims 180-182, wherein the soluble TCR consists of a beta chain variable region and an alpha chain variable region.

184. A kit comprising (i) the therapeutic polypeptide or a polynucleotide encoding the therapeutic polypeptide of any one of claims 1 -9, (ii) the epitope sequence(s) of any one of claims 1-86 or 115-128, (iii) the candidate epitope sequence of any one of claims 19-58, (iv) the candidate antigen of any one of claims 87-100, or (v) the antigen of any one of claims 101-110.

185. A kit comprising (i) the TCR specific to a peptide:MHC complex of any one of claims 1-18 or 61-86, (ii) the TCR that binds to an MHC multimer in complex with a candidate epitope sequence of any one of claims 19-60, (iii) the one or more TCRs of any one of claims 87-128, or (iv) the TCR(s) of any one of claims 129-183.

186. A T-cell receptor (TCR) identified by a method of any one of claims 101-128.

187. The TCR of claim 186, wherein the TCR is a soluble TCR or a membrane-bound TCR.

188. The TCR of claim 187, wherein the soluble TCR does not comprise a transmembrane domain.

189. The TCR of claim 187 or 188, wherein the soluble TCR does not comprise a constant domain.

190. The TCR of any one of claims 187-189, wherein the soluble TCR consists of a beta chain variable region and an alpha chain variable region.

191. Use of the TCR of any one of claims 129-183 or 186-190, in the manufacture of a medicament.

192. Use of the TCR of any one of claims 129-183 or 186-190, for the treatment or prevention of an infectious disease.

193. Use of the TCR of any one of claims 129-183 or 186-190, for determining whether an infectious disease therapy or vaccine comprising a therapeutic polypeptide or a polynucleotide encoding the therapeutic polypeptide is capable of inducing T cell specific immune response in a subject.

194. Use of the TCR of any one of claims 129-183 or 186-190, for determining whether an epitope sequence from a protein encoded by a genome of a pathogen associated with an infectious disease is presented by an MHC molecule expressed by a cell infected by the pathogen.

195. Use of the TCR of any one of claims 129-183 or 186-190, for determining whether a polypeptide sequence from a protein encoded by the genome of a pathogen associated with an infectious disease contains an epitope sequence that is presented by an MHC molecule expressed by an antigen-presenting cell (APC).

196. The use of any one of claims 193-195, wherein the use comprises determining whether the TCR binds to (i) peptide:MHC complex, (ii) the cell infected by the pathogen, or (iii) the APC.

197. The use of claim 196, wherein determining comprises detecting the peptide:MHC complex, the cell infected by the pathogen, or the APC to which the TCR is bound.

198. The use of any one of claims 193-197, wherein the TCRis conjugated to a detection marker.

199. The use of claim 197 or 198, wherein detecting comprises staining.

200. Use of the TCRof any one of claims 129-183 or 186-190, for identifying an antigen from an infectious disease caused by a pathogen that is recognizable by the TCR.