Method for detecting genomic mutation through nucleic acid pattern-based purification, and disease diagnosis method using same

Abstract

To address errors in NGS for single-nucleotide variant (SNV) analysis, conventional approaches have attempted to use Unique Molecular Identifiers (UMI) or Blocker Displacement Amplification (BDA). However, UMI requires a high-depth analysis of 25,000x or more to ensure accurate variant calls, significantly increasing analysis costs and limiting its application in various research fields, and BDA suffers from the problem of being unable to detect de novo mutation. Therefore, the present invention is devised to solve the above problems, and relates to a method for detecting a genomic mutation through nucleic acid pattern-based purification. By using the method for detecting a genomic mutation of the present invention, it is possible to detect not only a single nucleotide variation (SNV) with very high sensitivity, but also a de novo mutation. Furthermore, this approach enables prediction of disease onset caused by single nucleotide mutations, accurate disease diagnosis, and identification of therapeutic targets, and thus is expected to be widely used in the overall bio / medical field.

Description

Method for detecting genetic mutations through nucleic acid pattern-based purification, and method for diagnosing diseases using the same

[0001] The present invention relates to a method for detecting genetic mutations through nucleic acid pattern-based purification, and a method for diagnosing diseases using the same.

[0002] The development of Next Generation Sequencing (NGS) has ushered in a new era of genomic research, enhancing our understanding of biology and medicine. NGS technology enables the simultaneous sequencing of millions of DNA molecules, significantly reducing costs and time while offering high scalability. This enables high-throughput sequencing of nucleic acids (DNA and RNA), enabling large-scale genomic research, improving our understanding of diseases caused by genetic mutations, and revealing new targets for diagnosis and treatment.

[0003] However, although NGS platforms have significantly expanded the scope of genome understanding, they still have limitations in certain applications such as rare mutation analysis. Analyzing rare mutations, such as those in circulating tumor DNA (ctDNA), is crucial because they can act as biomarkers in certain diseases such as cancer. However, conventional NGS has had errors such as poor signal quality during sequencing, incorrect base calls (substitution) due to interference from adjacent bases, or nucleotide insertions / deletions during sequencing, which make it difficult to accurately analyze single-nucleotide variants (SNVs) that differ in frequency of less than 1% compared to the reference population.

[0004] As an alternative to this, there have been efforts to improve the sensitivity of mutation detection using Unique Molecular Identifiers (UMIs) or Blocker Displacement Amplification (BDA). However, UMIs require high-depth NGS analysis of 25,000x or more to ensure accurate mutation calling, which significantly increases the analysis cost and limits their application to various studies. BDA has the problem of not being able to detect new mutations (de novomutations).

[0005] Accordingly, the present invention was conceived to address the above-mentioned problems, and relates to a method for detecting genetic mutations using nucleic acid pattern-based purification. The method of the present invention not only enables the detection of single nucleotide variants (SNVs) with high sensitivity, but also the detection of novel mutations (de novomutations). Furthermore, the method for detecting genetic mutations of the present invention can be used to predict the likelihood of disease caused by SNVs, diagnose such diseases, and precisely identify targets for their treatment. Therefore, it is expected to be widely utilized in the bio / medical fields in general.

[0006] [reference]

[0007] This invention was made possible with the support of the Future Promising Convergence Technology Pioneer Project (NRF-2022M3C1A3081366) of the Ministry of Science, ICT and Future Planning of the Republic of Korea through the National Research Foundation of Korea, and the Biomedical Technology Development Project (RS-2024-00440370) of the Ministry of Science and ICT of the Republic of Korea.

[0008] One object of the present invention is to provide a method for identifying a single nucleotide mutation in a target object.

[0009] Another object of the present invention is to provide a method for predicting the risk of disease occurrence in a target subject.

[0010] Another object of the present invention is to provide a composition for predicting the risk of disease occurrence.

[0011] Another object of the present invention is to provide a kit for predicting the risk of disease occurrence.

[0012] Another object of the present invention is to provide a method for screening candidate substances for gene therapy for diseases.

[0013] However, the technical problems to be solved by the present invention are not limited to the problems mentioned above, and other problems not mentioned can be clearly understood by those skilled in the art from the description below.

[0014] Hereinafter, various embodiments described herein will be described with reference to the drawings. In the following description, various specific details, such as specific configurations, compositions, and processes, are set forth to provide a thorough understanding of the present invention. However, specific embodiments may be practiced with one or more of these specific details, or with other known methods and configurations. In other instances, well-known processes and manufacturing techniques have not been described in specific detail so as not to unnecessarily obscure the present invention. Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, configuration, composition, or characteristic described in connection with the embodiment is included in one or more embodiments of the present invention. Thus, the appearances of “one embodiment” or “an embodiment” in various places throughout this specification do not necessarily refer to the same embodiment of the present invention. Additionally, the particular features, configurations, compositions, or characteristics may be combined in any suitable manner in one or more embodiments.

[0015] Unless otherwise specifically defined in the specification, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs.

[0016] The development of Next Generation Sequencing (NGS) has ushered in a new era of genomic research, enhancing our understanding of biology and medicine. NGS technology enables the simultaneous sequencing of millions of DNA molecules, significantly reducing costs and time while offering high scalability. This enables high-throughput sequencing of nucleic acids (DNA and RNA), enabling large-scale genomic research, improving our understanding of diseases caused by genetic mutations, and revealing new therapeutic targets.

[0017] However, while NGS platforms have significantly expanded the scope of genomic understanding, they still have limitations in certain applications, such as rare mutation analysis. Analyzing rare mutations, such as those in circulating tumor DNA (ctDNA), is crucial because they can serve as biomarkers in certain diseases like cancer. However, conventional NGS has been unable to accurately analyze single-nucleotide variants (SNVs) with a frequency of less than 1% compared to the reference population. This can be due to errors such as poor signal quality during sequencing, incorrect base calls due to interference from adjacent bases, or nucleotide insertions / deletions occurring during sequencing. Generally, the error rate of NGS is known to be 0.1-1%.

[0018] To address this issue, methods utilizing Unique Molecular Identifiers (UMIs) or Blocker Displacement Amplification (BDA) have been proposed. Error correction methods using UMIs improve mutation detection sensitivity by reducing false mutation calls. This is achieved by incorporating a unique barcode that binds to each DNA molecule and reading all fragments multiple times, ensuring that all molecules containing the same UMI represent the variant sequence. However, this method requires high-depth analysis of more than 25,000x to ensure accurate mutation calling, resulting in very high analysis costs per sample, which limits its practical application. Furthermore, BDA has the problem of being unable to detect de novo mutations.

[0019] Recently, a novel method has been proposed to reduce the depth of sequencing by capturing rare mutations using hybridization capture probes that specifically bind to mutations. Hybridization capture selectively recovers only low-frequency mutations, increasing the mutation rate and reducing sequencing depth. Hybridization probes are designed to target well-known variants, limiting the identification of novel mutations. However, this method also suffers from a lack of universality, as capture efficiency varies depending on the target sequence.

[0020] Therefore, the present invention provides a method for detecting genetic mutations through nucleic acid pattern-based purification and a disease diagnosis method using the same to solve the above problems. The nucleic acid pattern-based purification method of the present invention enables SNV detection at low-depth sequencing without additional hybridization probes while achieving high complexity. The proposed method uses the first few sequences of randomly cleaved nucleic acid fragments as unique search sequences. According to NGS sequence data, reads containing SNVs are joined with reversible terminators based on the unique search sequence, while other sequences are blocked by irreversible terminators. After detecting all variant reads, including NGS errors, actual mutations can be verified through amplification. Furthermore, the hybridization probe-free method of the present invention not only detects all types of SNVs with equal efficiency, but also detects extremely rare de novo mutations. Furthermore, error verification is possible at low depths even when the library complexity exceeds 1 million. Therefore, using the method of the present invention, low-frequency mutations as low as 0.01% can be detected with the same efficiency even at a low depth of 100x or less.

[0021] In one aspect of the present invention, the present invention provides a method for identifying a single nucleotide mutation in a target object.

[0022] The method may comprise the steps of (a) extracting nucleic acid from a biological sample isolated from a target individual; (b) randomly cleaving the nucleic acid; and (c) selectively amplifying a nucleic acid fragment containing a target single-nucleotide variant.

[0023] The term "nucleic acid" as used herein refers to a polymeric substance in the form of a long nucleotide chain in which nucleotides composed of a base, a pentose sugar, and a phosphate group are linked by phosphodiester bonds. It is a substance that controls heredity and protein synthesis, and is the blueprint of living organisms that records the genetic information of life. It is divided into RNA (Ribonucleic acid) when the constituent pentose sugar is ribose, and DNA (Deoxyribonucleic acid) when it is deoxyribose.

[0024] In the present invention, the term “base” refers to a nitrogenous base constituting the nucleic acid, which is a molecule containing one or two rings composed of carbon atoms and nitrogen atoms. This molecule is called a “base” because it is chemically basic and can bind to hydrogen ions. There are two types of nitrogenous bases, pyrimidine and purine. Pyrimidine is a heterocycle composed of six atoms with two nitrogen atoms, and includes cytosine (C), thymine (T), and uracil (U). Purine is a two-ring structure in which a pyrimidine ring and an imidazole ring are fused, and includes adenine (A) and guanine (G). Cytosine, adenine, and guanine exist in both DNA and RNA, but thymine is found only in DNA, and uracil is found only in RNA. Purines and pyrimidines can form hydrogen bonds in a complementary pattern, similar to puzzle pieces. Under normal cellular conditions, adenine forms hydrogen bonds with thymine (in DNA) or uracil (in RNA), and guanine forms hydrogen bonds with cytosine. This is called complementary.

[0025] In the present invention, the term “single nucleotide mutation” is a concept included in single nucleotide polymorphism (SNP), and SNP refers to a common mutation that appears in one of several DNA bases in a single region of a chromosome. It is estimated that there are approximately 3 million SNPs in the human genome, appearing at a rate of about 1 per 500 to 1,000 bases, and of these, approximately 200,000 are cSNPs that exist in genes that create proteins. SNPs are frequent and stable, and are distributed throughout the genome, which creates genetic diversity in individuals. That is, some people have adenine (A) in a specific region of the DNA chain, while others have cytosine (C). These subtle differences (SNPs) can change the function of each gene, and these interact to create people with different appearances and differences in susceptibility to different diseases. In other words, if we can find genetic differences between people who develop liver cancer and those who do not, we can find out the function of why the susceptibility to liver cancer differs. Using this, it is possible to develop drugs used for the prevention or treatment of liver cancer by taking into account genetic susceptibility. A single-nucleotide variant (SNV) is a rare base mutation that occurs at a low frequency of less than 1% among SNPs. In genome research tools such as next-generation sequencing (NGS), accurate analysis of SNVs is still difficult due to errors such as poor signal quality during sequencing, incorrect base calling due to interference from adjacent bases, and insertion / deletion of nucleotides during sequencing. Therefore, the development of an efficient SNV analysis method is necessary.

[0026] In the method for confirming a single nucleotide mutation in the target object of the present invention, the biological sample is tissue, cell, cell extract, whole blood, leukocytes, peripheral blood mononuclear cells, buffy coat, plasma, serum, sputum, tears, mucus, nasal washes, nasal aspirate, breath, urine, semen, saliva, peritoneal washings, ascites, cystic fluid, meningeal fluid, amniotic fluid, glandular fluid, pancreatic fluid, lymph fluid, pleural fluid, nipple aspirate, bronchial It may be any one or more selected from the group consisting of bronchial aspirate, synovial fluid, joint aspirate, organ secretions, and cerebrospinal fluid.

[0027] In the method for confirming a single base mutation in the target object of the present invention, the selective amplification in step (c) is performed by (a) replacing a part of the base sequence of the target nucleic acid with X n X n+1 Step to identify; (I) X nA method may be performed including: (a) a step of treating a mixture composed of two or more types of base units; (b) a step of removing the base mixture in step (c); and (d) a step of recognizing the base unit treated in step (d). The method may be performed by a method including, where n may be a natural number.

[0028] The mixture composed of two or more types of base units in the above step (b) may be a mixture of a reversible terminator-labeled base and an irreversible terminator-labeled base, a mixture of unlabeled dNTPs and a reversible terminator-labeled base, a mixture of unlabeled dNTPs and an irreversible terminator-labeled base, or a mixture of unlabeled dNTPs, a reversible terminator-labeled base, and an irreversible terminator-labeled base, but is not limited thereto.

[0029] The method for selecting a target nucleic acid of the present invention may further include, after step (d), a step (e) of binding a base only to the target nucleic acid using a polymerase.

[0030] In the method for confirming a single nucleotide mutation in the target object of the present invention, the selective amplification in step (c) may be performed in a more specific manner. In this case, the selective amplification in step (c) may be performed by (a) replacing a part of the base sequence of the target nucleic acid with X n X n+1 Step to identify; (I) X n A method comprising: (a) treating a mixture of reversible terminator-labeled complementary bases and irreversible terminator-labeled non-complementary bases; (b) removing the mixture of bases in step (c); and (d) removing the reversible terminator label in step (c); wherein n may be a natural number.

[0031] In addition, the above single nucleotide mutation confirmation method is performed after the above step (a), (ma) X n+1 The method may further include a step of treating a mixture of reversible terminator-labeled complementary bases and irreversible terminator-labeled non-complementary bases; (b) a step of removing the base mixture in step (e); and, (g) a step of removing the reversible terminator label in step (e). In addition, the method for selecting a nucleic acid of the present invention may further include, after step (a), a step of (a-1) adding a primer that recognizes the polynucleotide sequence of the nucleic acid of the present invention.

[0032] In the present invention, the term “reversible” means that it is possible to return to the original state, and the term “irreversible” means that it is impossible to return to the original state. In the present invention, in order to amplify a target nucleic acid, it is presumed that the base sequence of the nucleic acid is identified, and based on this, it is presumed that a base combination capable of complementarily binding to the sequence of the target nucleic acid is provided. At this time, the base combination may be a mixture of nucleotides labeled with a reversible terminator or an irreversible terminator. Here, “label” may be interpreted as having the same meaning as tagging or labeling. Both nucleotides labeled with a reversible terminator and nucleotides labeled with an irreversible terminator may function to block a second base from being linked after the first base. However, in the case of a reversible terminator label, the label may be removed or modified through an appropriate process, in which case additional bases may be linked thereafter.

[0033] In the method for selecting a nucleic acid of the present invention, the reversible terminator may be selected from the group consisting of an azidomethyl moiety, an aryl moiety, and a nitrobenzyl moiety, and when the reversible terminator is an azidomethyl moiety, the removal of the reversible terminator label may be performed with tris(2-carboxyethyl) phosphine, and when the reversible terminator is an aryl moiety, the removal of the reversible terminator label may be performed with sodium tetrachloropalladate and sodium triphenylphosphine trisulfonate, and when the reversible terminator is a nitrobenzyl moiety, the removal of the reversible terminator label may be performed with 345 to It may be performed by laser irradiation at 365 nm, but is not limited thereto. In addition, the irreversible terminator-labeled nucleotide may be a dideoxynucleotide (ddNTP).

[0034] The term "nucleic acid" as used herein refers to a polymeric substance in the form of a long nucleotide chain in which nucleotides composed of a base, a pentose sugar, and a phosphate group are linked by phosphodiester bonds. It is a substance that controls heredity and protein synthesis, and is the blueprint of living organisms that records the genetic information of life. It is divided into RNA (Ribonucleic acid) when the constituent pentose sugar is ribose, and DNA (Deoxyribonucleic acid) when it is deoxyribose.

[0035] In the present invention, the term “base” refers to a nitrogenous base constituting the nucleic acid, which is a molecule containing one or two rings composed of carbon atoms and nitrogen atoms. This molecule is called a “base” because it is chemically basic and can bind to hydrogen ions. There are two types of nitrogenous bases, pyrimidine and purine. Pyrimidine is a heterocycle composed of six atoms with two nitrogen atoms, and includes cytosine (C), thymine (T), and uracil (U). Purine is a two-ring structure in which a pyrimidine ring and an imidazole ring are fused, and includes adenine (A) and guanine (G). Cytosine, adenine, and guanine exist in both DNA and RNA, but thymine is found only in DNA, and uracil is found only in RNA. Purines and pyrimidines can form hydrogen bonds in a complementary pattern, similar to puzzle pieces. Under normal cellular conditions, adenine forms hydrogen bonds with thymine (in DNA) or uracil (in RNA), and guanine forms hydrogen bonds with cytosine. This is called complementary.

[0036] In the method for selectively amplifying the target nucleic acid of the present invention, the bases include adenine, thymine, cytosine, and guanine, as well as isoguanine, isocytosine, 2-amino-6-(2-thienyl)purine, pyridine-2-one, pyrrole-2-carbaldehyde, 7-(2-thienyl)imidazo[4,5-b]pyridine, 4-[3-(6-aminohexanamido)-1-propynyl]-2-nitropyrrole, 2,6-dimethyl-2H-isoquinoline-1-thione, 2-Methoxy-3-methylnaphthalene, 2-amino-imidazo[1,2-a]-1,3,5-triazin-4(8 H)one, 6-amino-5-nitro-2(1 H)-pyridone, It may be selected from the group consisting of, but is not limited to, 7-(2,2′-bithien-5-yl)-imidazo[4,5-b]pyridine, 4-[3-(6-aminohexanamido)-1-propynyl]-2-nitropyrrole, and inosine.

[0037] In the present invention, as an example of a method for selecting a target nucleic acid using a base combination including a mixture of reversible terminator-labeled or irreversible terminator-labeled nucleotides as a base combination capable of complementarily binding to a nucleic acid fragment sequence for which selective amplification is desired, when the target nucleic acid, i.e., the nucleic acid region to be selectively amplified, is composed of two bases (X1X2) and includes a single nucleotide variant (SNV) to be identified, and X1 is cytosine (C) and X2 is guanine (G), the first base pool may be a mixture of 3'-O-azidomethyl dGTP as a reversible terminator-labeled nucleotide for a base complementary to cytosine and ddATP, ddTTP, and ddCTP as nucleotides irreversibly terminator-labeled for a base non-complementary to cytosine. In addition, the second base pool can be a mixture of 3'-O-azidomethyl dCTP as a reversible terminator-labeled nucleotide for the base complementary to guanine and ddATP, ddTTP, and ddGTP as irreversible terminator-labeled nucleotides for the base non-complementary to guanine. After reaction with the first base pool, 3'-O-azidomethyl dGTP is bound to cytosine (C) as X1. The 3'-O-azidomethyl functions as a blocking agent that prevents guanine (G) as X2 from binding to other complementary bases, but can be removed by treatment with tris(2-carboxyethyl) phosphine (TCEP), in which case the bases can be further linked, so that 3'-O-azidomethyl dCTP is bound to guanine (G) as X2 in the second base pool that reacts thereafter.

[0038] In another aspect of the present invention, the present invention provides a method for predicting the risk of disease occurrence in a target subject.

[0039] The above method may be configured to include (a) a step of identifying a single nucleotide mutation in a target individual using the single nucleotide mutation identification method of the present invention described above; and (b) a step of predicting the risk of disease occurrence in the individual based on the single nucleotide mutation.

[0040] In the present invention, the term “risk” refers to the probability that a specific disease will occur in an individual who provided a biological sample as a specimen.

[0041] In the method for predicting the risk of disease occurrence in the target object of the present invention, the disease is a disease whose prevalence is associated with a single nucleotide mutation for which an allelic genotype is to be identified, and may be referred to as a target disease. The above target diseases can be broadly classified into chronic diseases, cancer diseases, drug reaction sensitive diseases, and other diseases, and specifically, the above chronic diseases are type 1 diabetes, type 2 diabetes, hepatitis C, Kawasaki, ankylosing spondylitis, psoriasis, tuberculosis, hypertension, osteoarthritis, osteoporosis, coronary artery disease, ulcerative colitis, narcolepsy, glaucoma, cerebral aneurysm, stroke, polycystic ovary syndrome, multiple sclerosis, gallstones, Lou Gehrig's disease, lupus, rheumatoid arthritis, rheumatic heart disease, chronic kidney disease, knee osteoarthritis, pathological myopia (high myopia), Behcet's disease, cataracts, vitiligo, obesity, non-alcoholic fatty liver disease, myocardial infarction, atrial fibrillation, aspirin hypersensitivity chronic urticaria, atopic dermatitis, allergic hypersensitivity to food, gestational diabetes, preeclampsia, triglyceride levels, It consists of asthma, herniated disc, dementia, Crohn's disease, gout, Parkinson's disease, obstructive pulmonary disease, sebaceous chronic disease, coronary heart disease, migraine, and macular degeneration, and the cancer disease consists of liver cancer, thyroid cancer, testicular cancer, oral cancer, acute myeloid leukemia, ovarian cancer, biliary tract cancer, colon cancer, head and neck cancer, diffuse gastric cancer, bladder cancer, childhood leukemia, esophageal cancer, kidney cancer, stomach cancer, breast cancer, cervical cancer, endometrial cancer, prostate cancer, pancreatic cancer, lung cancer, and skin cancer, and the drug reaction sensitivity disease consists of methamphetamine-induced psychosis, angiotensin-converting enzyme inhibitor, warfarin drug sensitivity, and propofol anesthetic sensitivity, and the other diseases consist of, but are not limited to, ADHD, panic disorder, nicotine addiction, alcohol dependence, bipolar disorder, depression, autism, and schizophrenia.

[0042] In another aspect of the present invention, the present invention provides a composition for predicting the risk of disease occurrence.

[0043] The composition of the present invention is a mixture of a reversible terminator-labeled complementary base and an irreversible terminator-labeled non-complementary base for a desired single base mutation as a desired nucleic acid, for example, dATP, ddTTP, ddCTP, and ddGTP labeled with an azidomethyl moiety, an aryl moiety, or a nitrobenzyl moiety, or dTTP, ddATP, ddCTP, and ddGTP labeled with an azidomethyl moiety, an aryl moiety, or a nitrobenzyl moiety, or dTTP, ddATP, ddCTP, and ddGTP labeled with an azidomethyl moiety, an aryl moiety, or a nitrobenzyl moiety. It may comprise dCTP, ddATP, ddTTP, and ddGTP, or it may comprise dGTP, ddATP, ddTTP, and ddCTP labeled with an azidomethyl moiety, an aryl moiety, or a nitrobenzyl moiety.

[0044] In another aspect of the present invention, the present invention provides a kit for predicting the risk of disease occurrence.

[0045] The kit of the present invention may include the composition for predicting the risk of disease occurrence of the present invention described above.

[0046] In another aspect of the present invention, the present invention provides a method for screening a candidate substance for gene therapy for a disease.

[0047] The method may be configured to include: (a) a step of confirming a single nucleotide mutation in a disease-affecting individual using the single nucleotide mutation confirmation method of the present invention described above; (b) a step of administering a candidate substance for gene therapy for the disease; (c) a step of reconfirming a single nucleotide mutation in the individual using the single nucleotide mutation confirmation method of the present invention described above; and, (d) a step of determining the candidate substance as a gene therapy agent for the disease in the case where the base is changed.

[0048] In the present invention, the term "gene therapy" refers to a pharmaceutical product that delivers genes into the human body in various forms and methods, and treats or prevents a disease through the resulting protein. The single nucleotide mutation identification method of the present invention can be used to determine whether the allelic type of a specific single nucleotide mutation is altered by a candidate gene therapy agent for a disease associated with that single nucleotide mutation. Therefore, this can be used as a screening method to determine the effectiveness of a gene therapy agent for a specific disease.

[0049] In another aspect of the present invention, the present invention provides a device for identifying a single nucleotide mutation in a target object.

[0050] The single nucleotide mutation confirmation device of the present invention is characterized in that it operates by reflecting the configuration of the single nucleotide mutation confirmation method of the present invention described above.

[0051] In another aspect of the present invention, the present invention provides a device for predicting the risk of disease occurrence in a target subject.

[0052] The disease occurrence risk prediction device of the present invention is characterized in that it operates by reflecting the configuration of the disease occurrence risk prediction method of the present invention described above.

[0053] Hereinafter, the present invention will be described in detail based on examples.

[0054] The present invention's method for detecting genetic mutations not only enables the detection of single nucleotide variants (SNVs) with high sensitivity, but also enables the detection of novel mutations (de novomutations). Furthermore, it can predict the likelihood of disease caused by SNVs, diagnose such diseases, and precisely identify treatment targets, making it expected to be widely utilized across the bio / medical fields.

[0055] Figure 1 illustrates a target amplification process using the synthesis and selection technique of the present invention, which enables detection of low-frequency genomic variants even at low sequencing depths, according to one embodiment of the present invention. Specifically, referring to an example of an error-checking system using nucleic acid pattern-based purification, sequencing libraries are prepared through random fragmentation and aligned to a reference genome for variant calling. Due to the random fragmentation, each sequencing read has a unique initial sequence, which serves as a reference for selecting target reads. For the synthesis and selection process, an NGS library containing sequencing adapters is recovered from a flow cell where NGS has been completed by denaturing the DNA using 8 M urea. The recovered library is captured through hybridization with magnetic beads linked to the sequencing adapters, and the library then undergoes a synthesis and selection process for selective amplification of targets. Errors are verified after reads containing mutations are amplified (Figure 1a). Referring to the molecular mechanism of synthesis and selection using reversible terminators, such as 3'-O-azidomethyl dNTPs, and irreversible terminators, such as ddNTPs, the process begins with hybridization of a universal adapter. During the coupling step, the reversible terminator is added to the target barcode, and another sequence is coupled to the irreversible terminator. The blocking agent of the reversible terminator is then removed, enabling the next synthesis step. By repeating this cycle, only molecules containing the target barcode are fully elongated and ultimately PCR amplified (Figure 1b).

[0056] Figure 2 illustrates the selective amplification of low-frequency target oligos through synthesis and selection, according to one embodiment of the present invention. Specifically, oligos with distinct 5-bp barcodes and 5-bp length differences were designed (Figure 2a), and the oligos were mixed in different ratios, with one type intentionally present at a low fraction (minimum 0.001) (Figure 2b). The oligo mixture synthesized and selected based on the 5-bp barcode yielded selectively amplified target oligos (Figure 2c), and the selected oligo products with targets of 80, 85, 90, and 95 bp in length were visualized on polyacrylamide gel electrophoresis (Figure 2d). The enrichment fold (EF) values ​​of eight samples with initial target ratios ranging from 0.03 to 0.1% are plotted in a heatmap (Figure 2e), and the post-selection VAFs of various target oligos after synthesis and selection are shown (Figure 2f). Their pre-selection VAFs varied from 0.01 to 1% as measured by NGS.

[0057] FIG. 3 shows the results of confirming the effects of the synthesis and selection cycles on the amplification of reads starting with a barcode, the amplification of target reads, and the variant allele frequency (VAF) of SNV according to one embodiment of the present invention.

[0058] FIG. 4 is a diagram illustrating an advantage of the method of the present invention compared to a conventional technique using UMI or BDA, according to one embodiment of the present invention.

[0059] In the present invention, mutation verification was performed through synthesis and selection on a human genomic DNA (gDNA) sample containing seven different mutations (BRAF V600E, EGFR G719S, EGFR L858R, EGFR T790M, KRAS G12D, NRAS Q61K, PIK3CA H1047R), each of which has a variant allele frequency (VAF) of 0.1%. After selecting target mutations using the sample through next-generation sequencing (NGS), the target mutations were selectively amplified based on the sequencing data. The sample was recovered from the flow cell, immobilized on magnetic beads, and subjected to the selection and synthesis process. After synthesis and selection, the VAF of the EGFR T790M mutation increased 100-fold from 0.08% to 7.96%. Therefore, in the present invention, the target amplification efficiency according to the selection and synthesis cycle was additionally confirmed. Initially, the log2 (counts per million, CPM) of the target barcode was 6.69. After 8, 9, and 10 cycles of synthesis and selection, this value increased to 12.96, 13.10, and 13.51, respectively, indicating a 112-fold enrichment. Similarly, the initial log2 (CPM) of the target reads, which was -0.97, increased to 8.21, 9.21, and 9.34 after 8, 9, and 10 cycles, representing a 1273-fold increase. These results indicate that the enrichment of both the target barcode and the target reads improved with additional cycles. The 100-fold increase in VAF also confirmed that the enriched target reads contained true mutations rather than sequencing errors.

[0060] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples, in accordance with the gist of the present invention.

[0061] Example

[0062] The method for detecting genomic variants using nucleic acid pattern-based purification proposed in the present invention performs low-depth sequencing, making it cost-competitive while also accurately detecting SNVs with a variant allele frequency (VAF) of less than 1% compared to the reference population. The initial NGS library is prepared through random fragmentation of gDNA, generating a unique starting sequence for each fragment (Figure 1a). Because sequencing is performed at low depth, variant calls contain both true variants and sequencing errors. Therefore, the post-sequencing library is recovered to confirm the authenticity of the variant call. After NGS is complete, the sequencing reads are denatured and the DNA pool is recovered from the flow cell through hybridization with universal adapters conjugated to magnetic beads. The selection process involves cyclic coupling of reversible and irreversible terminators (Figure 1b). In the initial coupling step, 3'-azidomethyl dNTPs are coupled to the target SNV start sequence, or dideoxynucleotides (ddNTPs) are coupled to terminate the elongation of non-target DNA. For example, if the target sequence in Figure 1b is G, 3'-azidomethyl dCTP and dd(A,T,G)TP are added for coupling. The 3'-azidomethyl acts as a reversible blocker, allowing only single-base synthesis until the blocker is removed by the reducing agent tris(2-carboxyethyl)phosphine (TCEP). In the subsequent step, the blocker is removed by TCEP, restoring the system to a state where the next dNTP can be bound. By repeating this process, only the target SNV undergoes complete elongation and amplification via polymerase chain reaction (PCR) for subsequent NGS.

[0063] [Research Method]

[0064] 1. Design and synthesis of oligonucleotides

[0065] Oligonucleotides were designed with a 20-bp universal primer region at both ends, a 5-bp unique barcode region located after the forward primer, and a core region with a 5-bp difference in length, resulting in 10 different oligos ranging from 65 to 110 bp in total length (SEQ ID NOs: 1 to 10). Each of the 10 different DNA samples was assigned a unique barcode sequence for selection. Although the designed barcode region did not contain a homopolymer sequence, this method can be validated with various barcode sequences, including homopolymers. The designed oligonucleotides were synthesized and purified using Macrogen's PAGE purification method.

[0066] 2. Preparation of NHS-amine bead-immobilized oligonucleotides

[0067] 200 μl of Pierce™ NHS-activated magnetic beads (Thermo Fisher Scientific, catalog no. 88826) were equilibrated at room temperature for 30 min prior to the reaction and prewashed with 1 ml of 1 mM hydrochloric acid. 100 μl of 5' amine-modified reverse primers (50 μM) (forward primer (SEQ ID NO: 11) and reverse primer (SEQ ID NO: 12)) and 100 μl of phosphate-buffered saline (Sigma-Aldrich) were added to the magnetic beads and incubated on a rotator at room temperature for 2 h. The tubes were vortexed every 5 min for the first 15 min of the reaction and every 15 min thereafter until the 1-h mark. The magnetic beads were washed twice with 1 ml of nuclease-free water and then three times with 1 ml of phosphate-buffered saline. Finally, the prepared beads were resuspended in 200 μl of phosphate buffered saline and stored at 4°C.

[0068] 3. Selective amplification of target oligos

[0069] The initial step in this process to selectively amplify the single nucleotide variant (SNV) region of interest involves hybridizing the forward primer to oligonucleotides immobilized on NHS-amine magnetic beads. The hybridization protocol began with a 3-minute incubation at 95°C, followed by a stepwise temperature decrease from 75°C to 55°C, with 1°C decrease every 30 seconds. For the hybridization step, a 50-μl reaction mixture was prepared, consisting of 1 μl of 10 μM forward primer, 5 μl of 10X Thermopol reaction buffer, 3 μl of 100 mM magnesium sulfate (MgSO4), and 41 μl of nuclease-free water.

[0070] A single base coupling cycle consists of a two-step process. Initially, 3'-azidomethyl-dNTPs are simultaneously incorporated into the target barcode only, while dideoxynucleotides (ddNTPs) are incorporated into the non-target barcode. Finally, the 3'-azidomethyl group is removed using 100 mM tris(2-carboxyethyl)phosphine (TCEP), pH 9.0. In the first step, if the target sequence is dATP, 1 μl of 1 mM 3'-azidomethyl dTTP and 1 μl each of 2 mM dd(A,C,G)TP are mixed with 5 μl of 10X thermopol reaction buffer, 1 μl of Therminator III DNA polymerase, and 40 μl of nuclease-free water at 65°C for 30 s. Cleavage of the 3'-azidomethyl group is catalyzed with 50 μl of TCEP, pH 9.0, solution at 65°C for 1 min. Between each step, beads were washed three times with 50 μl of 1X thermopol reaction buffer.

[0071] After the final selection step, the target oligos underwent final extension and denaturation. Magnetic beads were treated with a mixture of 1 μl of BST DNA polymerase, Large Fragment (New England Biolabs, catalog number M0275S), 5 μl of 10X Thermopol reaction buffer, 3 μl of 100 mM magnesium sulfate (MgSO4), 1 μl of 1 mM dNTP, and 40 μl of nuclease-free water at 65°C for 1 min. The extended products were then denatured on the magnetic beads with 50 μl of 8 M urea at 70°C for 3 min. After denaturation, the supernatant was separated from the magnetic beads and purified using the Monarch® Nucleic Acid Purification Kit (New England Biolabs).

[0072] Here, the selective amplification process of the above target oligo is specifically described with an example in Fig. 1b. First, a common primer is bound. At this time, the common primer binds to both the target nucleic acid (target DNA) and the non-target nucleic acid (non-target DNA). Assuming that the target nucleic acid sequence is GAC, since the first base is guanine (G), in the first cycle, a mixture of 3'-O-azidomethyl dCTP, a reversible terminator-labeled nucleotide for the base complementary to guanine, and ddATP, ddTTP, and ddGTP, which are irreversible terminator-labeled nucleotides for the bases non-complementary to guanine, is processed. As a result, 3'-O-azidomethyl dCTP binds to both the target nucleic acid (target DNA) and the non-target nucleic acid (non-target DNA) if the first base is guanine (G). Afterwards, the blocking agent (3'-O-azidomethyl) labeled on 3'-O-azidomethyl dCTP is removed with TCEP. Since the second base of the nucleic acid sequence to be amplified is adenine (A), in the second cycle, a mixture of 3'-O-azidomethyl dTTP, a reversible terminator-labeled nucleotide for the base complementary to adenine, and ddATP, ddCTP, and ddGTP, which are irreversible terminator-labeled nucleotides for the bases non-complementary to adenine, is treated. As a result, only 3'-O-azidomethyl dTTP is bound to the target DNA. In the case of non-target DNA, even if the second base is adenine (A), the irreversible terminator of ddATP bound to the first base is not removed by TCEP, so the second base cannot bind to ddNTP, and subsequent elongation is impossible. This process is repeated a third, fourth, … By repeating the base sequence, only the target nucleic acid (target DNA) can be selectively extended (Figure 1b).

[0073] 4. Polyacrylamide gel electrophoresis (PAGE) analysis

[0074] Polyacrylamide gels were prepared using a 40% acrylamide and bisacrylamide solution (19:1) in 1X TAE buffer containing 7 M urea, 0.06% APS, and 0.06% TEMED. To verify target oligonucleotide selection, 3 μl of PCR purified samples with different targets (80, 85, 90, and 95 bp) were mixed with 3 μl of 2x loading dye, and the gel was then electrophoresed at 200 V for 45 min. The electrophoresed PAGE gel was stained with SYBR Gold (Thermo Scientific™) and scanned using an Invitrogen iBright FL1500 Imaging System (Thermo Scientific™).

[0075] 5. Next-generation sequencing (NGS) and analysis

[0076] PCR products were processed using standard library preparation protocols for the Illumina iSeq and Novaseq sequencing platforms. Raw FASTQ files were obtained from NGS sequencing. Paired-end reads were merged using PEAR software and aligned to the synthesized reference sequence or the human genome sequence (hg38) using BWA. The alignment file (in SAM format) was converted to BAM format using SAMtools for more efficient downstream analysis. Additional bioinformatics analyses, including quality control, variant calling, and annotation, were performed using Biopython, a Python library for computational biology.

[0077] 6. Preparation of chips with various mutation rates using randomly fragmented gDNA.

[0078] Cancer mutant gDNA samples (KRAS G12D 50%, NRAS Q61K 5%, PIK3CA H1047R 5%, BRAF V600E 5%, EGFR L858R 5%, EGFR T790M 5%, EGFR G719S 5%) and tumor gene reference gDNA samples (tumor wild type) were purchased from Genewell. To prepare samples with various mutant allele frequencies, wild type tumor gene samples were amplified with each cancer mutant gene primer, and only error-free samples were used. Mutant and wild type tumor gene samples were mixed in various ratios according to the Qubit quantification results. All libraries were prepared with the xGen™ DNA EZ Library Prep Kit and sequenced on Illumina iSeq.

[0079] 7. Library recovery from the Illumina iSeq flow cell

[0080] After sequencing, the flow cell was treated with 20 μl of TCEP at 65°C for 1 min. This was followed by a mixture of 1 μl of BST DNA polymerase, Large Fragment (New England Biolabs, catalog number M0275S), 5 μl of 10X thermopol reaction buffer, 1 μl of 10 mM dNTPs, and 13 μl of nuclease-free water, and the reaction was incubated at 65°C for 1 min. Finally, the oligos were denatured in the flow cell with 20 μl of 8 M urea at 70°C for 1 min. Between all steps, the flow cell was washed three times with 1X SSC buffer and purified using the Monarch® Nucleic Acid Purification Kit (New England Biolabs) for use in subsequent experiments.

[0081] [Research Results]

[0082] 1. Verification of concept using synthetic oligos

[0083] To demonstrate selective amplification of low-VAF samples, we designed a proof-of-concept experiment using a mixture of 10 different oligos of different lengths. The designed oligos consisted of a 5-bp barcode region at each end, a common gene sequence, and a 20-bp universal primer region (Figure 2a). To verify the concept, the synthesized oligos were mixed in different fractions, specifically varying the target oligo fraction from 1% to as low as 0.014% (Figure 2b). The low-fraction oligos were recovered for amplification through a coupling cycle (Figure 2c). Polyacrylamide gel electrophoresis results showed that the 1% target oligo was selectively enriched after synthesis and selection. When the target oligo was 80 bp in length, the other oligos in the 65- to 110-bp bands were visible, while the 80-bp band was ambiguous. After selection, the 80-bp band became the only visible band, and bands of other sizes became ambiguous. This result was consistent with targets of different lengths at the same frequency of 1% (Fig. 2d). For low-frequency samples (<0.1%), the frequencies of on-target and off-target oligos were measured via NGS. To demonstrate target enrichment efficiency, the enrichment fold (EF), which represents the relationship between the frequencies of target oligos before and after selection, was calculated. The results showed that the EF increased only for target oligos with a fraction ranging from 0.03% to 0.1% on average, with the lowest target fraction being 0.014% (Fig. 2e). Therefore, selective enrichment of target oligos was successful regardless of the frequency, type, and location of SNVs (Fig. 2f).

[0084] 2. Verification of cancer-related mutation diagnosis through synthesis and selection

[0085] In the present invention, mutation verification was performed through synthesis and selection on a human genomic DNA (gDNA) sample containing seven different mutations (BRAF V600E, EGFR G719S, EGFR L858R, EGFR T790M, KRAS G12D, NRAS Q61K, PIK3CA H1047R), each of which has a variant allele frequency (VAF) of 0.1%. After selecting target mutations using the sample through next-generation sequencing (NGS), the target mutations were selectively amplified based on the sequencing data. The sample was recovered from the flow cell, immobilized on magnetic beads, and subjected to the selection and synthesis processes.

[0086] After synthesis and selection, the VAF of the EGFR T790M mutation increased 100-fold from 0.08% to 7.96% (Fig. 3). Therefore, in the present invention, we additionally confirmed the target amplification efficiency according to the selection and synthesis cycles. Initially, the log2 (counts per million, CPM) of the target barcode was 6.69. After 8, 9, and 10 cycles of synthesis and selection, this value increased to 12.96, 13.10, and 13.51, respectively, indicating a 112-fold enrichment. Similarly, the initial log2 (CPM) of the target reads, which was -0.97, increased to 8.21, 9.21, and 9.34 after 8, 9, and 10 cycles, representing a 1273-fold increase. These results indicate that the enrichment of both the target barcode and the target reads improved with additional cycles. The 100-fold increase in VAF also confirmed that the enriched target reads contained true mutations rather than sequencing errors.

[0087] Accordingly, when comparing the method of the present invention with conventional methods utilizing UMI or BDA, the advantages of the present invention are clear (Fig. 4). Therefore, the present invention is expected to be widely utilized in the overall bio / medical field as a new technology that can solve the problems of conventional techniques.

[0088] While specific aspects of the present invention have been described in detail above, it should be apparent to those skilled in the art that these specific descriptions are merely preferred embodiments and do not limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

[0089] The method for detecting genetic mutations of the present invention is expected to be widely used in the overall bio / medical field, as it can predict the possibility of disease occurrence due to single nucleotide mutations, diagnose diseases, and accurately suggest targets for their treatment.

[0090] Sequence number 1: TCTAG barcode oligo

[0091] TCTAGGGAAAACTGAATTCAAAAAGAATCTTCTCGTATGTCGCCTG

[0092] Sequence number 2: ATACG barcode oligo

[0093] ATACGGGAAACTGAATTCAAAAAGATCAAAATCTTCTCGTATGTCGCCTG

[0094] Sequence number 3: CTACG barcode oligo

[0095] CTACGGGAAACTGAATTCAAAAAGATCAAAGTGCTATCTTTCTCTGTATGTCGCCTG

[0096] Sequence number 4: GTATC barcode oligo

[0097] GTATCGGAAACTGAATTCAGAAAGATCAAAGTGCTGAGCTATCTTCTCGTATGTCGCCTG

[0098] Sequence number 5: TCGAC barcode oligo

[0099] TCGACGGAAACTGAATTCAAAAAGATGAAACTGCTGAGCTCCGGTATCTTCTCGTATGTCGCCTG

[0100]

[0101] Sequence number 6: ATGCT barcode oligo

[0102] ATGCTGGAAACTGAATTCAAAAAGATCAAAGTGCAGAGCTCCGGTGCGTTATCTTCTCGTATGTCGCCTG

[0103] Sequence number 7: GAGCT barcode oligo

[0104] GAGCTGGAAACTGAATTCAAAAAGATCAAAGTGCTGAGCTCTGGTGCGTTCGGCAATCTTCTCGTATGTCGCCTG

[0105] Sequence number 8: CAGTA barcode oligo

[0106] CAGTAGGAAACTGAATTCAAAAAGATCAAAGTGCTGAGCTCCGGTGCGTTCGGCACGGTGATCTTCTCGTATGTCGCCTG

[0107] Sequence number 9: TAGCA barcode oligo

[0108] TAGCAGGAAACTGAATTCAAAAAGATCAAAGTGCTGAGCTCCGGTGCGTTCGGCACGGTGTATAAATCTTCTCGTATGTCGCCTG

[0109] Sequence number 10: GACAG barcode oligo

[0110] GACAGGGAAACTGAATTCAAAAAGATCAAAGTGCTGAGCTCCGGTGCGTTCGGCACGGTGTATAAGGTAAATCTTCTCGTATGTCGCCTG

[0111] Sequence number 11: Forward primer

[0112] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

[0113] Sequence number 12: Reverse primer

[0114] ACACTCTTTCCCTACACGACGCTCTTCCGATCT

Claims

1. (a) A step of extracting nucleic acid from a biological sample isolated from a target entity; (b) a step of randomly cleaving the nucleic acid; and, (c) A method for identifying a single nucleotide variant, comprising the step of selectively amplifying a nucleic acid fragment containing a desired single nucleotide variant.

2. In paragraph 1, The above biological samples include tissue, cells, cell extracts, whole blood, leukocytes, peripheral blood mononuclear cells, buffy coat, plasma, serum, sputum, tears, mucus, nasal washes, nasal aspirate, breath, urine, semen, saliva, peritoneal washings, ascites, cystic fluid, meningeal fluid, amniotic fluid, glandular fluid, pancreatic fluid, lymph fluid, pleural fluid, nipple aspirate, bronchial aspirate, synovial fluid. A method wherein the fluid is at least one selected from the group consisting of joint aspirate, organ secretions, and cerebrospinal fluid.

3. In paragraph 1, Selective amplification in step (c) above is (a) X part of the base sequence of the target nucleic acid n X n+1 Steps to understand; (Me) X n A step of processing a mixture composed of two or more types of base units; (d) a step of removing the base mixture in step (b); and, (a) a step of recognizing the base unit processed in step (b); including, A method wherein the above n is a natural number.

4. In paragraph 3, A method wherein the mixture composed of two or more types of base units in the above step (b) is a mixture of a reversible terminator-labeled base and an irreversible terminator-labeled base.

5. In paragraph 3, A method wherein the mixture composed of two or more types of base units in the above step (b) is a mixture of unlabeled dNTPs and reversible terminator-labeled bases.

6. In paragraph 3, A method wherein the mixture composed of two or more types of base units in the above step (b) is a mixture of unlabeled dNTPs and irreversible terminator-labeled bases.

7. In paragraph 3, A method wherein the mixture composed of two or more types of base units in the step (b) is a mixture of unlabeled dNTPs, reversible terminator-labeled bases, and irreversible terminator-labeled bases.

8. In paragraph 3, After the above step (a), (b) A method further comprising a step of joining bases only to the target nucleic acid using a polymerase.

9. In paragraph 1, Selective amplification in step (c) above is (a) X part of the base sequence of the target nucleic acid n X n+1 Steps to understand; (Me) X n A step of treating a mixture of reversible terminator-labeled complementary bases and irreversible terminator-labeled non-complementary bases; (d) a step of removing the base mixture in step (b); and, (a) a step of removing the reversible terminator label in step (b); including, A method wherein the above n is a natural number.

10. In paragraph 9, After the above step (a), (Ma) X n+1 A step of treating a mixture of reversible terminator-labeled complementary bases and irreversible terminator-labeled non-complementary bases; (b) a step of removing the base mixture in the above step (ma); and, A method further comprising: (a) a step of removing a reversible terminator label in the step (b); 11. In paragraph 9, A method wherein the reversible terminator is selected from the group consisting of an azidomethyl moiety, an aryl moiety, and a nitrobenzyl moiety.

12. In paragraph 9, A method wherein the irreversible terminator labeled nucleotide is a dideoxynucleotide (ddNTP).

13. In paragraph 9, The above bases are adenine, thymine, cytosine, guanine, isoguanine, isocytosine, 2-amino-6-(2-thienyl)purine, pyridine-2-one, pyrrole-2-carbaldehyde, 7-(2-thienyl)imidazo[4,5-b]pyridine, 4-[3-(6-aminohexanamido)-1-propynyl]-2-nitropyrrole, 2,6-dimethyl-2H-isoquinoline-1-thione, 2-Methoxy-3-methylnaphthalene, 2-amino-imidazo[1,2-a]-1,3,5-triazin-4(8 H)one, 6-amino-5-nitro-2(1 H)-pyridone, 7-(2,2′-bithien-5-yl)-imidazo[4,5-b]pyridine, A method, wherein the compound is selected from the group consisting of 4-[3-(6-aminohexanamido)-1-propynyl]-2-nitropyrrole, and inosine. 14.(a) a step of confirming a single nucleotide mutation in the target object by the method of paragraph 1; and, (b) a method for predicting the risk of disease occurrence, comprising a step of predicting the risk of disease occurrence of the individual based on a single nucleotide mutation.

15. A composition for predicting the risk of disease occurrence, comprising dATP, ddTTP, ddCTP, and ddGTP labeled with an azidomethyl moiety, an aryl moiety, or a nitrobenzyl moiety.

16. A composition for predicting the risk of disease occurrence, comprising dTTP, ddATP, ddCTP, and ddGTP labeled with an azidomethyl moiety, an aryl moiety, or a nitrobenzyl moiety.

17. A composition for predicting the risk of disease occurrence, comprising dCTP, ddATP, ddTTP, and ddGTP labeled with an azidomethyl moiety, an aryl moiety, or a nitrobenzyl moiety.

18. A composition for predicting the risk of disease occurrence, comprising dGTP, ddATP, ddTTP, and ddCTP labeled with an azidomethyl moiety, an aryl moiety, or a nitrobenzyl moiety.

19. A kit for predicting the risk of disease occurrence, comprising a composition of any one of claims 15 to 18. 20.(a) A step of confirming a single nucleotide mutation in a disease-causing individual using the method of paragraph 1; (b) a step of administering a candidate substance for gene therapy for the disease; (c) a step of reconfirming a single nucleotide mutation in the above object using the method of paragraph 1; and, (d) a step of determining the candidate substance as a gene therapy agent for the disease when the base is changed; a method for screening a candidate substance for gene therapy for a disease, comprising:

21. An extraction unit for extracting nucleic acids from a biological sample separated from a target entity; A nucleic acid processing unit for randomly cleaving nucleic acids; and, A device for identifying a single nucleotide variant, comprising an amplification unit that selectively amplifies a nucleic acid fragment containing a desired single nucleotide variant.

22. A confirmation section for confirming a single nucleotide mutation in the target object by the method of Article 1; and, A disease occurrence risk prediction device, comprising a prediction unit that predicts the disease occurrence risk of the individual based on a single base mutation.

Images