Use of mechanical force-responsive macrophage subgroup in diagnostic or prognostic estimation for pancreatic cancer
By detecting the subpopulation of mechanical force-responsive macrophages and using methods that target inhibit or knock out PYK2 expression, combined with PD-1 immunosuppressant, the problems of early diagnosis and poor treatment effects were solved, and diagnostic accuracy and therapeutic effect were improved.
Patent Information
- Application Number
- PCT/CN2023/133649
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2023-11-23
- Publication Date
- 2025-05-30
AI Technical Summary
Early diagnosis of pancreatic cancer is difficult, common markers are inaccurately detected, and poor treatment effect, resulting in high mortality rate.
By detecting the proportion of mechanical force-responsive macrophage subpopulations, especially CD68+p-PYK2+YAP1+ or CD68+CD206+p-PYK2+YAP1+p-MLC2+ cells, it is used as an indicator of diagnosis and prognosis evaluation of pancreatic cancer. At the same time, drugs for the treatment of pancreatic cancer were prepared using reagents targeting inhibition or knockout of PYK2 expression, combined with PD-1 immunosuppressant.
The diagnostic accuracy and effectiveness of prognostic evaluation of pancreatic cancer were improved, and the growth of pancreatic cancer was significantly inhibited and the survival of mice was extended by inhibiting PYK2 expression and combining PD-1 immunosuppressant.
Smart Images

Figure CN2023133649_30052025_PF_FP_ABST
Abstract
Description
Application of mechanoresponsive macrophage subsets in the diagnosis or prognosis of pancreatic cancer Technical Field
[0001] The present invention relates to the technical field of tumor prognosis assessment, and in particular to the application of a mechanoresponsive macrophage subpopulation in the diagnosis or prognosis assessment of pancreatic cancer. Background Art
[0002] Pancreatic cancer is a highly lethal disease with an insidious onset, difficult early diagnosis, rapid progression, high risk of metastasis, and a poor prognosis. Despite progress in conventional chemotherapy for pancreatic cancer, the 5-year survival rate is less than 9% (Siegel, RL, et al., Cancer statistics, 2019. CA Cancer J Clin, 2019. 69(1):7-34), and it is projected to become the second leading cause of cancer death by 2030 (Cronin, KA, et al., Annual Report to the Nation on the Status of Cancer, part I: National cancer statistics. Cancer, 2018. 124(13):2785-2800).
[0003] Pancreatic cancer lacks early characterization, so accurate clinical diagnosis is a challenge. Currently, commonly used pancreatic cancer marker detection indicators such as CA19-9 and CA125 are elevated in some patients and cannot accurately reflect the patient's condition, leading to misdiagnosis and missed diagnosis. Surgical resection is the main treatment for pancreatic cancer. In recent years, despite the continuous progress in surgical resection and drug treatment of pancreatic cancer, the mortality rate of pancreatic cancer patients remains high (Brahmer, JR, et al., Safety and activity of anti-PD-L1 antibody in patients with advanced cancer. The New England journal of medicine, 2012. 366 (26): 2455-2465). Therefore, there is an urgent need to develop new diagnostic and treatment methods for pancreatic cancer.
[0004] One of the characteristics of pancreatic cancer is the presence of dense connective tissue and high fibrosis in pancreatic tissue (Whatcott, CJ, et al., Desmoplasia in Primary Tumors and Metastatic Lesions of Pancreatic Cancer. Clinical cancer research: an official journal of the American Association for Cancer Research, 2015. 21(15): 3561-3568), which forms a high-stiffness physical microenvironment of pancreatic cancer. Therefore, the high-stiffness elastic modulus of pancreatic cancer tissue may become a diagnostic indicator of pancreatic cancer.
[0005] The immunosuppressive tumor microenvironment is one of the main obstacles to the treatment of pancreatic cancer. Among them, tumor-associated macrophages are one of the most abundant immunosuppressive cells and play an important role in promoting tumor progression (Christofides A., et.al., The complex role of tumor-infiltrating macrophages. Nature Immunology, 2022, 23: 1148-1156). The high-stiffness physical microenvironment may activate the mechanical force signaling pathway of monocytes / macrophages, thereby promoting the formation of tumor-associated macrophages. Therefore, it is crucial to find mechanical force signaling checkpoints that regulate the differentiation and polarization of monocytes / macrophages. At the same time, detecting monocytes / macrophages that respond to mechanical force signals may be used as a method for pancreatic cancer diagnosis, treatment efficacy evaluation and prognosis.
[0006] Proline-rich tyrosine kinase 2 (PYK2) is a non-receptor tyrosine kinase and an important member of focal adhesion kinase. It is involved in various physiological and pathological processes, including cell adhesion, cell migration, inflammatory response, tumor infiltration, etc. (Ryzhakov, G., et.al., Defactinib inhibits PYK2 phosphorylation of IRF5 and reduces intestinal inflammation. Nature Communications, 2021, 12: 6702; Müller, AK, et.al., Mouse Modeling Dissecting Macrophage–Breast Cancer Communication Uncovered Roles of PYK2 in Macrophage Recruitment and Breast Tumorigenesis. Advanced Science, 2022, 9: 2105696). In macrophages, PYK2 is located in the podosome of macrophages and can participate in regulating the cell adhesion, morphology and migration of macrophages (Duong, LT and Rodan GA, PYK2 is an adhesion kinase in macrophages, localized in podosomes and activated by beta(2)-integrin ligation, Cell Motil Cytoskeleton, 2000, 47(3): 174-88; Okigaki, M., Pyk2 regulates multiple signaling events crucial for macrophage morphology and migration. PNAS, 2003, 100(19): 10740-10745). Macrophages differentiate from monocytes. Previous studies have shown that the differentiation process of monocytes / macrophages is mainly regulated by biochemical signals such as cytokines (such as M-CSF and PMA). Whether and how mechanical force signals are involved in the differentiation of monocytes / macrophages is still unknown.Although PYK2 is highly expressed and activated during the differentiation and polarization of monocytes / macrophages, there have been no reports on whether it can serve as a mechanical checkpoint to regulate the perception and response of monocytes / macrophages to the external physical microenvironment. The mechanical signaling pathway involved in PYK2 is still unclear, and the role of PYK2, a mechanical checkpoint of monocytes / macrophages, in the diagnosis and treatment of pancreatic cancer is even less studied.
[0007] Summary of the Invention
[0008] In view of this, one of the objects of the present invention is to provide an application of a mechanoresponsive macrophage subpopulation in the diagnosis or prognosis assessment of pancreatic cancer; a second object of the present invention is to provide an application of a reagent for detecting the mechanoresponsive macrophage subpopulation in the preparation of a product for the diagnosis or prognosis assessment of pancreatic cancer; a third object of the present invention is to provide an agent for targeted inhibition or knockout of the expression of the mechanoresponsive signal PYK2 in reducing cell elastic modulus or inhibiting the differentiation of monocytes into macrophages; a fourth object of the present invention is to provide an application of a PYK2 inhibitor combined with a PD-1 immunosuppressant in the preparation of a drug for the treatment of pancreatic cancer.
[0009] In order to achieve the above object, the present invention provides the following technical solutions:
[0010] 1. Application of mechanoresponsive macrophage subsets in the diagnosis or prognosis of pancreatic cancer, wherein the mechanoresponsive macrophage subsets are defined as CD68 cell surface markers at the protein level. + p-PYK2 + YAP1 + or CD68 + CD206 + p-PYK2 + YAP1 + p-MLC2 + .
[0011] Preferably, in the present invention, in the detection results, the higher the proportion of the mechanical force responsive macrophage subpopulation in the total cells, the higher the possibility of pancreatic cancer or the worse the prognosis.
[0012] 2. Use of a reagent for detecting the mechanical force-responsive macrophage subpopulation in the preparation of a product for pancreatic cancer diagnosis or prognosis assessment.
[0013] Preferably, the reagents for detecting mechanical force-responsive macrophage subpopulations include one or more immune reagents selected from CK 19, CD68, YAP1, FAP, COL1A1, p-PYK2, Lamin A / C, p-MLC2, Ki67, Lyve1, CD206, CD8 and CD3.
[0014] Preferably, the immunoreagent is used for immunofluorescence / immunohistochemistry antibody or immunocolloidal gold labeling.
[0015] Preferably, the tumor region marker is CK19 + , fibrotic areas are marked by COL1A1 + , macrophage marker CD68 + , M2 macrophages are marked by CD206 + , resident macrophages are marked by Lyve1 + , T cells are marked by CD3 + CD8 + , proliferating cells are marked by Ki67 + , fibroblasts are marked by FAP + .
[0016] Preferably, the immunoreagent includes a chromogen-labeled molecular probe that specifically recognizes Cytokeratin 19, CD68, YAP1, FAP, COL1A1, p-PYK2, Lamin A / C, p-MLC2, Ki67, Lyve1, CD206, CD8, and CD3.
[0017] Preferably, the chromogen-labeled molecular probes for specifically recognizing Cytokeratin 19, CD68, YAP1, FAP, COL1A1, p-PYK2, Lamin A / C, p-MLC2, Ki67, Lyve1, CD206, CD8, and CD3 of the present invention include primary antibodies and secondary antibodies, wherein the primary antibody is a human monoclonal antibody that specifically recognizes the corresponding signaling molecules, and the secondary antibody is a HistoFine secondary antibody that conforms to the resistance of the primary antibody.
[0018] 3. The role of agents that target the inhibition or knockout of the expression of the mechanical force response signal PYK2 in reducing cell elastic modulus or inhibiting the differentiation of monocytes into macrophages.
[0019] 4. The application of PYK2 inhibitors combined with PD-1 immunosuppressants in the preparation of drugs for the treatment of pancreatic cancer.
[0020] Preferably, the PYK2 inhibitors of the present invention include but are not limited to siRNA, sgRNA / CRISPR, small molecule inhibitors, etc. targeting Ptk2b or PYK2, and Cre-loxP gene knockout reagents targeting Ptk2b or PYK2.
[0021] In the present invention, preferably, the siRNA targeting Ptk2b is shown in SEQ ID NOs. 1 to 3.
[0022] Preferably, the PYK2 inhibitor further comprises siRNA, sgRNA / CRISPR, a small molecule inhibitor targeting piezo1, or a Cre-loxP gene knockout agent targeting piezo1.
[0023] Preferably, the siRNA targeting piezo1 is shown in SEQ ID NOs. 4 to 6.
[0024] Preferably, the PD-1 immunosuppressant of the present invention is an αPD-1 antibody.
[0025] The beneficial effects of the present invention are: to address the medical challenges of pancreatic ductal adenocarcinoma, such as difficulty in diagnosis, treatment, and short five-year survival, the present invention studies the interaction between the high-rigidity physical microenvironment of pancreatic cancer and immune cells, and discovers a new mechanical force signal checkpoint, PYK2, that regulates monocyte / macrophage differentiation (Figure 1). Monocytes / macrophages sense the physical signals of the microenvironment through the mechanical force sensing receptor piezo1. In a physical microenvironment with high stiffness, piezo1 is activated, and Ca 2+ Influx of macrophages leads to PYK2 phosphorylation, actomyosin assembly and activation, further leading to nuclear translocation of YAP / TAZ, promoting the expression of macrophage-related genes, and ultimately developing into mature macrophages. + p-PYK2 + YAP1 + The number of positive mechanoresponsive macrophages in pancreatic cancer is significantly higher than in adjacent tissues, and the number of such macrophages is positively correlated with the progression of pancreatic cancer. Therefore, mechanoresponsive macrophages can serve as a diagnostic and prognostic marker for pancreatic cancer. Inhibition of the monocyte / macrophage mechanocheckpoint PYK2 can reduce the elastic modulus of cells and inhibit monocyte-to-macrophage differentiation, thereby improving the tumor microenvironment of pancreatic cancer. Targeted inhibition of the mechanocheckpoint PYK2, which regulates monocyte / macrophage differentiation, combined with treatment with the immune checkpoint PD-1, can significantly inhibit pancreatic cancer growth and prolong the survival of mice with pancreatic cancer. Therefore, targeting the monocyte / macrophage mechanocheckpoint PYK2 and combining it with immunotherapy, chemotherapy, or radiotherapy has great application prospects and value in the treatment of pancreatic cancer. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] In order to make the purpose, technical solutions and beneficial effects of the present invention more clear, the present invention provides the following drawings for illustration:
[0027] Figure 1 shows the mechanical force signaling pathway in which the mechanical force checkpoint PYK2 is involved in regulating monocyte / macrophage differentiation.
[0028] FIG2 shows the elastic modulus of pancreatic cancer tissue measured by nanoindentation;
[0029] (A) Nanoindenter measurement of the elastic modulus of pancreatic tissue; the black arrow indicates the nanoindenter probe, and the white arrow indicates the tissue; (B) Average elastic modulus of pancreatic cancer tissue (n=7) and adjacent adjacent tissue (n=3). P values were calculated using a t-test.
[0030] FIG3 is a graph showing mIHC detection of monocytes / macrophages in response to mechanical force signals in pancreatic cancer;
[0031] Among them, (A) pancreatic cancer tissue mIHC staining image; (B) pancreatic cancer tissue (n = 8 ROIs) and adjacent tissue (n = 6 ROIs) mIHC staining fluorescence superposition, p-PYK2 + YAP1 + Macrophage statistics; (C) Statistical graph of mechanical force signal expression in monocytes / macrophages in pancreatic cancer tissue (n=8 ROIs) and adjacent normal tissue (n=6 ROIs), P value was calculated by t-test, scale bar 200 μm.
[0032] FIG4 shows the application of mIF in detecting monocytes / macrophages that respond to mechanical force signals in pancreatic cancer in diagnosing pancreatic cancer and evaluating the prognosis of pancreatic cancer;
[0033] (A) Multiple immunofluorescence staining of CK19, CD68, p-PYK2, YAP, and collagen in TMA; (B) Collagen area, tumor area, and other area in pancreatic cancer and adjacent adjacent tissues in TMA; (C) Statistical analysis of p-PYK2- and YAP-positive macrophages in the collagen region of pancreatic cancer (n=49) and adjacent adjacent tissues (n=12); (D) Expression of p-PYK2- and YAP-positive macrophages in well-differentiated (n=25) and poorly differentiated (n=15) pancreatic cancer patients, as well as correlation analysis between high expression and prognosis. P values were calculated using t-tests. Scale bar, 250 μm.
[0034] FIG5 shows the application of a Ptk2b gene inhibitor in inhibiting the differentiation of human monocytes into macrophages;
[0035] Among them, (A) Actual picture of the cell elastic modulus detected by nanoindenter, the white arrow points to the nanoindenter probe, and the black arrow points to THP-1 cells; (B) Effect of Ptk2b gene inhibitor on the elastic modulus of THP-1 cells, si-NC, n=50; si-Ptk2b_1, n=45; si-Ptk2b_2, n=43; si-Ptk2b_3, n=41; (C) Flow cytometry analysis of the effect of Ptk2b gene inhibitor on CD11b and CD68 after THP-1 cells differentiated into macrophages, n=3, P value calculated by one-way ANOVA.
[0036] FIG6 shows the application of Ptk2b gene inhibition in the differentiation of mouse monocytes into macrophages;
[0037] (A) Cell elastic modulus of bone marrow-derived macrophages from mice with normal Ptk2b expression and Ptk2b knockout, WT, n = 118; KO, n = 120; (B) Flow cytometry analysis of the proportion of bone marrow-derived cells from mice with normal Ptk2b expression and Ptk2b knockout that differentiated into macrophages, n = 3, WT: normal gene expression; KO: gene knockout, P values calculated by t-test.
[0038] Figure 7 shows the role of the mechanosensitive receptor Piezo1 in regulating the novel mechanosignaling checkpoint PYK2;
[0039] Among them, (A) Effect of Piezo1 inhibitor on calcium influx in THP-1 cells, arrows indicate the time point of Yoda1 addition, si-NC, n = 22; si-Piezo1, n = 15; (B) After the addition of Yoda1, the ratio of the fluorescence value of the peak calcium ion signal and the fluorescence value of the stable calcium ion signal (8 min) in THP-1 cells to the calcium ion fluorescence value before the addition of Yoda1, P value calculated by t test; (C) Effect of Piezo1 inhibitor on the mRNA expression of Piezo1 and Ptk2b in THP-1 cells, P value calculated by one-way ANOVA; (D) Effect of Piezo1 inhibitor on the protein expression and phosphorylation of Ptk2b in THP-1 cells.
[0040] Figure 8 shows the application of the combined treatment of monocyte / macrophage mechanical force signal checkpoint PYK2 and immune checkpoint PD-1 in the treatment of pancreatic cancer (Ptk2b fl / fl +Iso, n=10; Ptk2b fl / fl +αPD-1, n=8; Ptk2b fl / fl Lyz2-Cre ki / + +Iso, n=7; Ptk2b fl / fl Lyz2-Cre ki / ++αPD-1, n = 7; P values calculated by Gehan-Breslow-Wilcoxon test). DETAILED DESCRIPTION
[0041] The present invention will be further described below with reference to the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it. However, the embodiments are not intended to limit the present invention.
[0042] Example 1.
[0043] A method for measuring the elastic modulus of pancreatic cancer tissue, comprising the following steps:
[0044] 1) Tumor tissue and adjacent tissue samples were obtained from pancreatic cancer patients and transported to the laboratory in ice-cold PBS. The tissues were cut into pieces approximately 1 cm long, 0.5 cm thick, and adhered to the bottom of a culture dish using biological tissue glue (Bio-Decker, Henkel Adhesives Co., Ltd.). PBS buffer was added to submerge the tissues, as shown in Figure 2, A.
[0045] 2) The nanoindenter probe (0.5 N / m) was connected to a nanoindenter (Optics11life, Amsterdam, The Netherlands) and calibrated using a confocal dish (Cat. No. 801002, NEST). The elastic modulus of the tissue was measured. The specific parameters were as follows: 2 s of depression, 10,000 nm of depth; 1 s of hold; and 2 s of lift. The elastic modulus was calculated using Dataviewer version 2.2 (Piuma; Optics11, Amsterdam, The Netherlands).
[0046] The results are shown in Figure 2, B. The elastic modulus of pancreatic cancer tissue is significantly higher than that of adjacent paracancerous tissue. Therefore, this method can be used to detect pancreatic cancer and adjacent paracancerous tissue.
[0047] Example 2.
[0048] A method for detecting activation of the mechanosignaling pathway in pancreatic cancer monocytes / macrophages, the specific experimental steps are as follows:
[0049] 1) Human pancreatic cancer tissue and adjacent paraffin tissue were paraffin-embedded and cut into 5 mm sections. The sections were dried at 65°C for 1 hour until the paraffin completely melted. Slides were then treated with a gradient of treatments: xylene (5 min each, twice); 100% ethanol and 95% ethanol (2 min each, twice); 70% ethanol (2 min each, once); and deionized water (2 min each, twice). The sections were stained with hematoxylin (Cat. No. CS700, Dako) for 1 minute, rinsed twice in deionized water, and washed in TBST for 2 minutes. The sections were then mounted with mounting medium (VectaMount AQ Aqueous Mounting, Cat. No. LS-J1038-60, Vector Lab), and images were acquired using a pathology scanner.
[0050] After scanning, the slides were stored in TBST (this can be left overnight), washed in TBST with shaking for 1 minute, and the coverslips were gently removed. The slides were blocked with peroxidase (245 mL Methanol + 5 mL 30% Hydrogen Peroxide), incubated at room temperature for 30 minutes, and washed with TBST for 1 minute. The slides were placed in antigen retrieval solution (Cat. No. GT100411, GeneTack) and the retrieval solution was boiled in a microwave oven, heating at maximum power for 30 seconds, then at full high power for 3 minutes, halfway covered, and heated at low power for 12 minutes. The slides were allowed to cool at room temperature for about 15 minutes. The slides were then treated with deionized water and TBST for 1 minute each.
[0051] 3) Dry the tissue with TBST and add 100 μL of antigen blocking solution (2 mL 5% goat serum + 38 mL PBS + 1 g BSA) to each slide. Block at room temperature for 10 min. Remove the blocking solution and wipe the back of the slide and the tissue area dry. Incubate each slide with 100 μL of CD8 primary antibody dilution (1:100; Cat. No. 853365, CST) at room temperature for 1 h. After incubation, wash three times with TBST for 2 min each. Add HistoFine secondary antibody (Vector, Mouse / Rabbit) according to the primary antibody resistance and incubate for 30 min. Prepare AEC color development solution (Cat. No. SK-4200, Vector lab, 10 mL ddH2O + 1st Reagent 4 drops + 2st Reagent 6 drops + 3rd Reagent 4 drops). Wrap in tin foil and store at 4°C in the dark.
[0052] 4) After incubation, wash three times with TBST (2 minutes each) with shaking. Transfer the slides to deionized water for a brief rinse. Add 100 μL of AEC colorimetric solution to each slide and incubate at room temperature for 15 minutes. Observe the color development under a microscope to confirm the staining. Wash with TBST, mount the slides with mounting agent, and scan. After scanning, soak the slides in TBST overnight. Gently remove any coverslips that have fallen off. Rinse in deionized water and 70% ethanol for 1 minute.
[0053] 5) Repeat steps 2)-4) for a total of 15 cycles of mIHC staining. In addition to using a white slide as a negative control (Cycle 15) and hematoxylin as a nuclear stain (Cycle 1), 13 biological staining markers (Cycles 2 to 16) were included, covering the characterization of various cellular mechanical force signaling proteins as well as immune cells and fibroblasts. The specific staining sequence and antibody information are shown in the table below:
[0054] Table 1. mIHC staining cycle sequence and antibody information
[0055] 6) After staining, the collected images were quantitatively analyzed and fluorescently stained using ImageScope × 64 (Aperio Technologies), Cell profiler (Broad Institute), and FSC Express 7 Research Edition (Win64) (De Novo Software).
[0056] The results are shown in Figure 3. Compared with adjacent adjacent tissues, collagen + The region (corresponding to COL1A1 in Figure A) is significantly elevated, confirming that pancreatic cancer has highly fibrotic characteristics, which echoes the high-rigidity physical microenvironment of pancreatic cancer. + p-PYK2 + YAP1 + The expression of these cells increased significantly (Figure 3, B), indicating that these macrophages are highly infiltrated in human pancreatic cancer. Spatial location analysis found that macrophages were mostly located in fibrotic areas, and CD68 + The co-expression of the cells and mechanical force signaling markers p-PYK2, YAP1, p-MLC2, and Lamin A / C was significantly upregulated, as shown in Figure 3, C, indicating that the mechanical force signaling of macrophages in human pancreatic cancer tissues was highly activated.
[0057] Example 3.
[0058] A method for detecting mechanoresponsive monocytes / macrophages and its application in the diagnosis and prognosis of pancreatic cancer, comprising the following steps:
[0059] 1) Pancreatic cancer patient TMA tissue slides (Shanghai Xinchao Biotechnology Co., Ltd.) were baked at 65°C for 2 hours, immersed in Xylene for 10 minutes, repeated three times, and then immersed in graded ethanol: 100% for 5 minutes; 95% for 5 minutes; 70% for 5 minutes. The slides were then rinsed in ddH2O for 3 minutes. Antigen retrieval solution (Cat. No. GT100411, GeneTack) was boiled in a microwave on high heat, and the slides were placed in an antigen retrieval box and retrieval was carried out in a microwave on low heat for 20 minutes. The slides were cooled at room temperature for 15 minutes, then rinsed in ddH2O. The samples were treated with 3% H2O2 (Cat. No. STBH9407, Sigma) for 10 minutes to remove endogenous peroxidases, and washed with TBST for 3 minutes.
[0060] 2) After TBST washing, remove the TBST buffer from the slides, circle the tissue sample area on the slide with an immunohistochemistry pen, and stain using the Opal kit (Cat. No. NEL811001KT, Opal 6-Plex Manual Detection Kit, Akoya biosciences). Add blocking buffer to cover the tissue area and incubate for 10 minutes. After incubation, remove the blocking buffer from the slides and add approximately 100 μL of CD68 primary antibody (1:300; Cat. No. ab955, Abcam) to each tissue. Incubate for 1 hour at room temperature with TBST and shake for 3 times at room temperature.
[0061] 3) After washing, add HRP secondary antibody to the slides, immerse the tissue area, incubate at room temperature for 10 minutes, rinse with TBST, and shake three times at room temperature. After removing TBST, add 1× TSA colorimetric solution (1:150; Opal 690), immerse the tissue area, incubate at room temperature for 10 minutes, and wash three times with TBST at room temperature with shaking. Microwave the slides to remove the primary and secondary antibodies (high heat for 3 minutes, low heat for 20 minutes), cool naturally at room temperature, and rinse with ddH2O.
[0062] 4) Counterstain with YAP (1:200; Cat. No. ab52771, Abcam), CK19 (1:500; Cat. No. MA5-11458, Invitogen), COL1A1 (1:200; Cat. No. 72026t, CST), and p-PYK2 (1:100; Cat. No. ab4800, Abcam). Repeat steps 1) to 3) until all antigens are labeled. After repairing and washing, add DAPI (1:500; Cat. No. M5107, AbMole) working solution and incubate for 5 minutes. Anti-fading mounting medium is then applied to the slides, and images are acquired using a Vectra multispectral imaging system. Images are quantitatively analyzed using HALO (Indica Labs) and combined with TMA patient prognostic information.
[0063] The results are shown in Figure 4, A. The expression of CD68, COL1A1, p-PYK2, and YAP1 in pancreatic cancer tissues was significantly increased compared with adjacent tissues. Figures 4, B and C show that CD68 expression was increased in and around the collagen region, and that mechanical force signals p-PYK2, YAP1, and p-MLC2 were significantly activated. Figure 4, D shows that mechanical force-responsive macrophages, namely CD68 + p-PYK2 + YAP1 + The cell population expressed increased expression in poorly differentiated cancer patients, and CD68 + p-PYK2 + YAP1 + High expression of poorly differentiated cancer cells is significantly associated with poor prognosis in pancreatic cancer patients. + p-PYK2 + YAP1 + The cells can be used as diagnostic indicators for pancreatic cancer and to assess the prognosis of pancreatic cancer patients.
[0064] Example 4.
[0065] A novel mechanical force signaling checkpoint, PYK2, and its application in regulating the differentiation of human monocytes into macrophages.
[0066] The present invention provides the following three human Ptk2b gene inhibitors (siRNA): Si-Ptk2b_1: GGATCATCATGGAATTGTA (SEQID NO. 1); Si-Ptk2b_2: GGACGAGGACTATTACAAA (SEQID NO. 2); Si-Ptk2b_3: CACATGAAGTCCGATGAGA (SEQID NO. 3), and verifies their roles in monocytes sensing mechanical forces in the microenvironment and monocyte differentiation into macrophages. The specific steps are as follows:
[0067] 1) Transfection of THP-1 cells. Cells were seeded into 24-well plates at a density of 2.5×10^5 / well. Transfection reagent A was prepared by adding 3 μL of transfection reagent (Lipofectamine 50 μL) to 50 μL of reduced serum medium (Opti-MEM I Reduced Serum Medium, Cat. No. 31985070, Gibco). TM RNAiMAX Transfection Reagent, Cat. No. 13778075, Invitrogen). B: Add 1 μL of siRNA (RiboBio) to 50 μL of Opti-MEM I Reduced Serum Medium (Cat. No. 31985070, Gibco). Mix A and B, incubate at room temperature for 5 minutes, and then add 50 μL of this mixture to THP-1 cells and culture overnight.
[0068] 2) The cell suspension was collected and centrifuged at 1000 rpm for 5 min at room temperature. The supernatant was removed and PMA (50 ng / mL, Cat. No. p1585, Sigma) was added and induced for 24 h.
[0069] 3) The cell culture medium was replaced with PBS, and after instrument calibration using a confocal dish, the elastic modulus of the cells was measured. The results are shown in Figure 5, A. Compared with the si-NC control group, si-Ptk2b_1, si-Ptk2b_2, and si-Ptk2b_3 significantly reduced the elastic modulus of THP-1 macrophages.
[0070] 4) Collect cells, centrifuge, and wash once with PBS. Then, add 1 μL Fixable Viability Stain 780 (Cat. No. 565388, BD), mix well, incubate on ice for 20 minutes, and wash twice with FACS buffer (2% BSA in PBS). Add 2.5 μL FC blocking antibody (Cat. No. 422302, Biolegend), block on ice for 20 minutes, then add 2.5 μL CD14-BV421 (Cat. No. 563743, BD) and 1 μL CD11b-PE (Cat. No. 101207, Biolegend) antibodies. Incubate on ice in the dark for 20 minutes, and then wash twice with FACS buffer. 100 μL of cell fixative (Cat. No. 00-8222-49, eBioscience) was added and incubated at room temperature in the dark for 40 min. The cells were then washed twice with the prepared permeabilization buffer (Cat. No. 00-8333-56, eBioscience) and resuspended in 100 μL of permeabilization buffer. 1.5 μL of CD68-AF647 (Cat. No. 333820, Biolegend) was added and incubated on ice in the dark for 20 min. The cells were then washed twice with permeabilization buffer and resuspended in 100 μL of FACS buffer for analysis. As shown in Figure 5, B, the PYK2 inhibitors si-Ptk2b_1, si-Ptk2b_2, and si-Ptk2b_3 significantly inhibited the fluorescence intensity of CD11b and CD68 on THP-1 cells, confirming that PYK2 inhibition significantly inhibits the differentiation of THP-1 monocytes into macrophages.
[0071] Example 5.
[0072] A novel mechanosignaling checkpoint, PYK2, and its application in the differentiation of murine monocytes into macrophages.
[0073] 1) Prepare piranha wash solution (30 mL 30% H₂O₂ and 70 mL H₂SO₄). Place a 30 mm diameter coverslip in the piranha wash solution for 3 hours. Rinse with deionized water until neutral, then rinse twice with ethanol, sonicating for 5 minutes each time. Prepare the reaction solution by adding 3 mL 10% acetic acid and 1 mL 3-(methacryloyloxy)propyltrimethoxysilane to 100 mL ethanol. Place the coverslip in the reaction solution, react at 80°C for 5 hours, then sonicate three times with ethanol. Store sealed in a refrigerator at 4°C.
[0074] 2) To prepare GelMA, 5 g of gelatin (Cat. No. 9382, Sigma) was dissolved in 50 mL of PBS. 1 mL of methacrylic anhydride was added dropwise to the gelatin solution while stirring at 50°C for 2 hours. The reaction was terminated by adding 100 mL of 40°C PBS. The mixture was dialyzed at 40°C for 4 days using a 12-14 kDa dialysis bag. The mixture was freeze-dried to remove moisture and stored in a refrigerator at 4°C.
[0075] 3) Prepare an 8% GelMA solution in PBS and dissolve at 37°C. Prepare a 20% PEG (Cat. No. 455008, Sigma) solution in PBS and dissolve by vortexing. Prepare a 20 mg / mL LAP (Cat. No. 900889, Sigma) solution in PBS and sonicate for 30 seconds to dissolve. Store on ice, protected from light, and prepare immediately before use. Mix the GelMA solution and PEG solution in a 1:1 ratio by volume. Add LAP to a 1:100 ratio of LAP to hydrogel by weight and vortex for 20 seconds. Place the mixture on a non-stick plate, cover with a treated coverslip, and irradiate with UV light at 365 nm for 2 minutes to chemically crosslink. Rheometer measurements show that the elastic modulus of the hydrogel is approximately 10 kPa. Transfer the prepared hydrogel to a 6-well plate, sterilize with UV light for 10 minutes, and rinse twice with PBS until ready for use.
[0076] 4) Bone marrow cells from Ptk2b gene-expressing and gene-knockout mice were added with M-CSF (20 ng / mL, Cat. No. 315-02, PeproTech) at a rate of 2×10 6 The cells were seeded on the hydrogel at a density of 10 cells and cultured in a 37°C, 5% CO2 incubator for 6 days to differentiate into macrophages.
[0077] 5) After 6 days of differentiation, the cell culture medium was replaced with PBS. The nanoindenter probe was connected to a nanoindenter (Optics11 Life, Amsterdam, The Netherlands) and calibrated using a confocal microscope. The elastic modulus of the cells was then measured. As shown in Figure 6, A, inhibition of PYK2 protein expression significantly reduced the elastic modulus of mouse macrophages.
[0078] 6) After 6 days of differentiation, collect the supernatant and adherent cells. Gently scrape the adherent cells with a spatula. After centrifugation, wash the cells once with PBS. Then, add 1 μL of Fixable Viability Stain 700 (Cat. No. 564997, BD), mix well, incubate on ice for 20 minutes, and wash twice with FACS buffer. Add 2 μL FC blocking antibody (Cat. No. 156604, Biolegend) and block on ice for 20 min. Then add 1 μL CD45-BV510 (Cat. No. 563891, BD), 0.3 μL Ly-6C-PE-Cy7 (Cat. No. 25-5932-82, eBioscience), 0.3 μL Ly-6G-PE (Cat. No. 12-9668-82, eBioscience), 0.625 μL CD11b-BV605 (Cat. No. 63-0112-82, eBioscience), and 1.25 μL F4 / 80-PE-Cy5.5 (Cat. No. 45-4801-82, eBioscience) antibodies. Incubate on ice in the dark for 20 min, wash twice with FACS buffer, and resuspend in 100 μL FACS buffer. Buffer, test on the machine. CD45 + CD11b + f / 4 / 80 + Ly6G-Ly6C- cells were labeled as macrophages. The results are shown in Figure 6, B. Inhibition of PYK2 protein expression significantly inhibited the formation of macrophages, suggesting that inhibition of PYK2, a mechanical force signaling checkpoint, can inhibit the differentiation of mouse bone marrow-derived cells into macrophages.
[0079] Example 6.
[0080] The role of the mechanosensitive receptor Piezo1 in regulating the novel mechanosignaling checkpoint PYK2.
[0081] The present invention provides the following three human Piezo1 gene inhibitors (siRNA): Si-Piezo1_1: ATGGCCTCTGGGACCATGA (SEQID NO. 4); Si-Piezo1_2: TCCGCCTACCAGATCCGCT (SEQID NO. 5); Si-Piezo1_3: GCCCTCTACCTGCGCAAGA (SEQID NO. 6), which are verified to regulate the expression and activation of cellular PYK2 by regulating monocyte / macrophage calcium ion signals. The specific steps are as follows:
[0082] 1) Transfection of THP-1 cells. Cells were seeded into 24-well plates at a density of 2.5×10^5 / well. Transfection reagent A was prepared by adding 3 μL of transfection reagent (Lipofectamine 50 μL) to 50 μL of reduced serum medium (Opti-MEM I Reduced Serum Medium, Cat. No. 31985070, Gibco). TM RNAiMAX Transfection Reagent, Cat. No. 13778075, Invitrogen). B: Add 1 μL of siRNA (RiboBio) to 50 μL of Opti-MEM I Reduced Serum Medium (Cat. No. 31985070, Gibco). Mix A and B, incubate at room temperature for 5 minutes, and then add 50 μL of this mixture to THP-1 cells and culture overnight.
[0083] 2) The cell suspension was collected and centrifuged at 1000 rpm for 5 min at room temperature. The supernatant was removed and PMA (50 ng / mL, Cat. No. p1585, Sigma) was added. After inducing differentiation for 24 h, the cell culture medium was replaced with PBS. After further culture for 24 or 48 h, cellular calcium influx, real-time PCR, and western blot experiments were performed, respectively.
[0084] 3) Cellular calcium influx experiment. After 48 hours of PMA induction, the cells were washed three times with DPBS, and Fluo 4-AM (5μM, Cat.No.S1060, Beyotime) and Pluronic F-127 (0.1%, Cat.No.ST501-0.1g, Beyotime) were added. The cells were incubated at 37°C for 30 minutes, washed three times with DPBS, and incubated at 37°C for another 30 minutes. The cells were then placed under a fluorescence microscope and observed using the FITC channel. Yoda1 is an agonist of Piezo1. Yoda1 (300nM, Cat.No.HY-18723, MCE) was added to the cells, and the changes in fluorescence before and after the addition of Yoda1 were recorded. The results are shown in Figure 7, A and B. THP-1 cells transfected with si-Piezo1 can significantly inhibit the calcium influx caused by Yoda1, suggesting that the mechanical force sensing receptor si-Piezo1 can directly regulate the influx of calcium ions.
[0085] 4) Real-time PCR. After 48 hours of PMA induction, cells were lysed using TRIzol (Cat. No. 15596026, Invitrogen), and RNA was extracted. cDNA synthesis was performed using the HiScript III RT SuperMix for qPCR kit (Cat. No. 15596026, Novagen). Piezo1 and Ptk2b mRNA were quantified using the Taq Pro Universal SYBR qPCR Master Mix (Cat. No. Q127, Novagen) and primers Piezo1_F, Piezo1_R, Ptk2b_F, Ptk2b_R, GAPDH_F, and GAPDH_R.
[0086] Piezo1_F:CCTGGAGAAGACTGACGGCTAC(SEQID NO.7);
[0087] Piezo1_R:ATGCTCCTTGGATGGTGAGTCC(SEQID NO.8);
[0088] Ptk2b_F:CATCGTGAAGCTGATCGGCATC(SEQID NO.9);
[0089] Ptk2b_R:TCTTGTTCCGCTCCAGGTAGTG(SEQID NO.10);
[0090] GAPDH_F:GTCTCCTCTGACTTCAACAGCG(SEQID NO.11);
[0091] GAPDH_R:ACCACCCTGTTGCTGTAGCCAA (SEQ ID NO. 12).
[0092] The results are shown in Figure 7, C. In cells transfected with si-Piezo1, the mRNA expressions of Piezo1 and Ptk2b were significantly reduced, indicating that si-Piezo1 can significantly inhibit the mRNA expressions of Piezo1 and Ptk2b.
[0093] 5) Western blot. Prepare cell lysis buffer (RIPA buffer (Cat. No. 89900, Thermo Scientific) supplemented with protease inhibitors (Cat. No. 04693116001, Roche) and phosphatase inhibitors (Cat. No. 04906837001, Roche). After 72 hours of PMA induction, cells were lysed with RIPA buffer and centrifuged at 12,000 rpm for 15 minutes at 4°C. The supernatant was used as the cell protein extract. Protein was quantified using a BCA protein quantification kit (Cat. No. AP12L025, Liji Biotechnology). The protein extract was added to loading buffer (Cat. No. 1610747, Bio-rad), incubated at 95°C for 5 minutes, and then subjected to polyacrylamide gel electrophoresis. Proteins in the gel were transferred to NC membrane (Cat. No. 10600001, GE) using a rapid transfer buffer (Cat. No. WB4600, Suzhou New Saimei Biotechnology Co., Ltd.). The membrane was blocked with 5% skim milk powder at room temperature for 1 hour. Primary antibodies against PYK2 (1:2000; Cat. No. ab32571, Abcam), p-PYK2 (1:1000; Cat. No. ab4800, Abcam), and GAPDH (1:10,000; Cat. No. ab181602, Abcam) were added and incubated overnight at 4°C. After washing three times with TBST, secondary antibodies (Cat. No. A0208, Beyotime) were added and incubated at room temperature for 1 hour. The membrane was developed using ECL (Cat. No. S6009S, Suzhou Uniland Biotechnology Co., Ltd.). The results are shown in Figure 7, D. Cells transfected with si-Piezo1 significantly inhibited the expression and phosphorylation of Ptk2b protein.
[0094] These experimental results demonstrate that Piezo1 can respond to changes in extracellular matrix mechanical forces by directly regulating calcium influx in monocytes and macrophages. Piezo1 also regulates Ptk2b mRNA and protein expression and protein activation, indicating that Piezo1 is an upstream signaling protein of Ptk2b.
[0095] Example 7.
[0096] A novel combination therapy targeting the mechanical force signaling checkpoint PYK2 and the immune checkpoint PD-1 is being used in the treatment of pancreatic cancer. The specific steps are as follows:
[0097] 1) By Ptk2b fl / fl Mice with Lyz2-Cre ki / + After breeding, mice were obtained that had myeloid knockout of the Ptk2b gene. fl / fl Lyz2-Cre ki / +Ptk2b fl / fl Mice were used in animal experiments.
[0098] 2) Digest the cultured KPC cells, centrifuge at 1000 rpm for 5 min, resuspend in 100 μL of pre-chilled PBS, add 900 μL of Matrigel (Cat. No. REF354234, CORNING) and mix the cells to adjust the cell concentration to 1×10 7 cells / mL, the cell mixture was aspirated with an insulin needle and placed on ice for the pancreatic in situ inoculation experiment; the experimental mice were prepared and weighed, and anesthesia was induced using an anesthesia machine (using 2.5% isoflurane concentration) after skin preparation on the lower left abdomen of the mice. After the induction of anesthesia, the mice were placed in an anesthetic mask for maintenance of anesthesia (using 2% concentration). After disinfection with iodine, the skin and peritoneum were cut along the lower edge of the left ribs, and the pancreatic tail was grasped with forceps to gently expose the pancreas. 50 μL of KPC cell mixture was slowly injected into the pancreas with an insulin needle. After the inoculation, the peritoneum and skin were sutured in sequence, and the mice were placed on a small animal heating pad to recover.
[0099] 3) One week later, the pancreatic tumor size and body weight of the mice were measured. The tumor size and weight of the mice were measured every other day. When the tumor size reached approximately 5 mm, intraperitoneal injection of the therapeutic drug αPD-1 antibody (InVivoMAb anti-mouse PD-1 (CD279), clone RMP1-14, BioXCell) or the negative control drug isotype antibody (InVivoMAb rat IgG2a isotype control, clone 2A3, BioXCell) was started. fl / fl Lyz2-Cre ki / + and Ptk2b fl / fl The mice were divided into two groups, αPD-1 and Iso, and the drug was administered every three days for a total of 11 times, and the survival of the mice was observed.
[0100] The results, as shown in Figure 8, show that mice with myeloid Ptk2b knockout significantly survived compared to wild-type mice in the negative drug control group. αPD-1 treatment significantly prolonged the survival of both wild-type and myeloid Ptk2b knockout pancreatic cancer mice compared to the negative drug control group. More importantly, Ptk2b knockout combined with αPD-1 treatment significantly improved the survival of pancreatic cancer mice.
[0101] The above embodiments are merely preferred embodiments for the purpose of fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are within the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.
Claims
1. Use of a mechanically responsive macrophage subset in the diagnosis or prognostic evaluation of pancreatic cancer, characterized in that, The mechanically responsive macrophage subset is marked by CD68 at the protein level + p-PYK2 + YAP1 + or CD68 + CD206 + p-PYK2 + YAP1 + p-MLC2 + 。 2. According to the use described in claim 1, in the test result, the higher the proportion of the mechanically responsive macrophage subset in the total cells, the higher the likelihood of having pancreatic cancer or the worse the prognostic effect.
3. Use of a reagent for detecting the mechanically responsive macrophage subset described in claim 1 in the preparation of a product for the diagnosis or prognostic evaluation of pancreatic cancer.
4. According to the use described in claim 3, characterized in that, the reagent for detecting the mechanically responsive macrophage subset includes one or more of the immunological reagents CK 19, CD68, YAP1, FAP, COL1A1, p-PYK2, Lamin A / C, p-MLC2, Ki67, Lyve1, CD206, CD8 or CD3.
5. According to the use described in claim 4, characterized in that, the immunological reagent is used for immunofluorescence / immunohistochemical antibody or immunogold labeling.
6. According to the use described in claim 4, characterized in that, The tumor area is labeled as CK19 + , the fibrosis area is labeled as COL1A1 + , macrophages are labeled as CD68 + , M2 macrophages are labeled as CD206 + , resident macrophages are labeled as Lyve1 + , T cells are labeled as CD3 + CD8 + , proliferating cells are labeled as Ki67 + , fibroblasts are labeled as FAP + .
7. Role of a reagent for targeted inhibition or knockout of the expression of the mechanically responsive signal PYK2 in reducing the cell elastic modulus or inhibiting the differentiation of monocytes into macrophages.
8. Use of a PYK2 inhibitor in combination with a PD-1 immune inhibitor in the preparation of a drug for treating pancreatic cancer.
9. According to the use described in claim 7 or 8, characterized in that, the PYK2 inhibitor includes, but is not limited to, siRNA, sgRNA / CRISPR, small molecule inhibitor targeting Ptk2b or PYK2, or Cre-loxP gene knockout reagent targeting Ptk2b or PYK2.
10. According to the use described in claim 9, characterized in that, the siRNA targeting Ptk2b is shown as SEQ ID NO.1 - 3.
11. According to the use described in claim 8, characterized in that, the PYK2 inhibitor further includes siRNA, sgRNA / CRISPR, small molecule inhibitor targeting piezo1, or Cre-loxP gene knockout reagent targeting piezo1.
12. According to the use described in claim 11, characterized in that, the siRNA targeting piezo1 is shown as SEQ ID NO.4 - 6.
13. According to the use described in claim 7 or 8, characterized in that, the PD-1 immune inhibitor is an αPD-1 antibody.
Citation Information
Patent Citations
Pancreatic cancer detection reagent, pancreatic cancer detection kit, pancreatic cancer detection device and application
CN110456054A
Combination therapies
CN111655288A
Application of CICs in pancreatic tumor tissue in preparation of product for predicting pancreatic cancer prognosis survival
CN111735945A
Methods and compositions for determining the composition of a tumor microenvironment
CN113330310A
Application of antisense oligonucleotide ASOYAP1 in inhibition of multiple YAP1 positive cancers
CN114410633A