Mutated br2 protein and use thereof

Abstract

A br2 mutant protein, a CDS sequence and a 3'UTR sequence of the mutant br2 protein having base deletions relative to the CDS sequence and the 3'UTR sequence of a parent br2 protein, and the parent br2 protein being derived from corn. The br2 mutant protein can cause reduced plant height and ear height in corn, improved lodging resistance and increased yield under high-density planting conditions, and has important application value in dwarf corn breeding.

Description

Mutated br2 protein and its application

[0001] This application claims priority to Chinese patent application CN202311559090.3, filed on November 22, 2023. This application incorporates the entire text of the aforementioned Chinese patent application. Technical Field

[0002] The invention belongs to the fields of biotechnology and crop genetic breeding, and relates to a mutant br2 protein and an application thereof, in particular to a mutant br2 protein in corn and an application thereof in reducing corn plant height and ear height and improving corn lodging resistance. Background Art

[0003] Corn is the world's largest crop, with an annual global planting area exceeding 2 billion mu (approximately 2.3 hectares), and a total production reaching 1 billion tons. Its edible, industrial, and feed value make it a crucial component of my country's food security. The current increase in corn yield is attributed to increased planting density. Under high-density conditions, plants undergo a shade-avoidance response, manifesting as increased plant and ear height, thinner stems, a reduced stem-leaf angle, elongated leaves, abnormal male and female development, and an increased inter-male-female interval. Ultimately, this results in reduced lodging resistance, lower photosynthetic efficiency, lower seed set, and lower yield per plant. Varieties with compact plant height and low plant height generally exhibit greater tolerance to high density. Reducing plant height often results in thicker stems, and lowering the ear position, in particular, is beneficial for increasing lodging resistance. Furthermore, appropriately reducing plant and ear height can also improve the harvest index. Therefore, dwarfing while maintaining yield is a key focus in corn breeding.

[0004] While extensive research has been conducted on plant height, and plant hormones such as auxins, gibberellins, brassinosteroids, and cytokinins can regulate plant height, the available corn germplasm resources for dwarfing plant height improvement are limited. Using limited dwarfing germplasm resources to improve plant height through traditional breeding methods will further narrow the already limited corn breeding germplasm resources, hindering the development of more superior corn varieties.

[0005] Gene editing has created a variety of dwarf mutants in maize inbred lines by knocking out single genes, altering gene amino acid sequences, and changing gene expression levels. These mutants can achieve varying degrees of plant height reduction. Some of these mutations show a greater reduction in ear height than in plant height. Mutations that primarily reduce internode length below the ear are more beneficial for breeding maize that is resistant to lodging and tolerant to dense planting.

[0006] Summary of the Invention

[0007] The present invention provides a mutant br2 protein and application of the mutant protein in reducing corn plant height and ear height, improving corn lodging resistance, increasing corn yield, and increasing corn yield under high-density planting conditions.

[0008] On the one hand, the present invention provides a br2 mutant protein, wherein the CDS sequence and 3'UTR sequence of the mutant br2 protein have base deletions relative to the CDS sequence and 3'UTR sequence of the parent br2 protein, and the parent br2 protein is derived from corn; the mutant br2 protein causes the plant height and / or ear height of corn to be reduced, the lodging resistance to be improved, the yield to be increased, and the yield to be increased under high-density planting conditions.

[0009] In one embodiment, the CDS sequence of the mutated br2 protein lacks bases 4102-4137 corresponding to the sequence shown in SEQ ID No. 1 relative to the CDS sequence of the parent br2 protein; the 3'UTR sequence of the mutated br2 protein lacks bases 1-36 and bases 160-162 corresponding to the sequence shown in SEQ ID No. 2 relative to the 3'UTR sequence of the parent br2 protein.

[0010] In one embodiment, the parent br2 protein is derived from a naturally occurring corn strain (e.g., a naturally occurring corn inbred line), and the CDS sequence of the parent br2 protein has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence shown in SEQ ID No. 1; the 3'UTR sequence of the parent br2 protein has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence shown in SEQ ID No. 2.

[0011] In one embodiment, the parent br2 protein is derived from a maize inbred line.

[0012] In one embodiment, the parent br2 protein is derived from the maize inbred line PH4CV.

[0013] In one embodiment, the corn is the corn inbred line PH4CV.

[0014] In one embodiment, the CDS sequence of the parent br2 protein is shown as SEQ ID No.1.

[0015] In one embodiment, the 3'UTR sequence of the parent br2 protein is shown as SEQ ID No. 2.

[0016] In one embodiment, the amino acid sequence of the parent br2 protein is shown as SEQ ID No.3.

[0017] In one embodiment, the CDS sequence of the mutated br2 protein is shown as SEQ ID No.5.

[0018] In one embodiment, the 3'UTR sequence of the mutant br2 protein is shown as SEQ ID No.6.

[0019] In another aspect, a fusion protein is provided, comprising the aforementioned mutant protein or a biologically active fragment thereof; further, the fusion protein further comprises a protein fused to the mutant protein, such as a tag peptide, a plastid targeting peptide, or a regulatory element. The tag peptide includes, for example, a histidine tag, 6×His; the plastid targeting peptide includes, for example, a peptide that targets the chloroplast; and the regulatory element includes, for example, a promoter sequence, a terminator sequence, a leader sequence, a polyadenylation sequence, a marker gene, and the like.

[0020] On the other hand, the present invention provides a polynucleotide encoding the br2 mutant protein or fusion protein.

[0021] In another preferred embodiment, the polynucleotide is selected from the following group: genomic sequence, cDNA sequence, RNA sequence, or a combination thereof.

[0022] In another preferred embodiment, the polynucleotide is preferably single-stranded or double-stranded.

[0023] In another preferred embodiment, the polynucleotide further contains auxiliary elements flanking the ORF of the mutant polypeptide selected from the following groups: signal peptide, secretory peptide, tag sequence (such as 6His), nuclear localization signal or a combination thereof.

[0024] In another preferred embodiment, the polynucleotide further comprises a promoter operably linked to the ORF sequence of the mutant polypeptide.

[0025] In another preferred embodiment, the promoter is selected from the following group: a constitutive promoter, a tissue-specific promoter, an inducible promoter, or a strong promoter.

[0026] In another aspect, the present invention provides a nucleic acid construct comprising the polynucleotide and a regulatory element operably linked thereto.

[0027] In another preferred embodiment, the regulatory element is selected from one or more of the following groups: enhancer, transposon, promoter, terminator, leader sequence, polyadenylation sequence, and marker gene.

[0028] On the other hand, the present invention also provides a vector, which contains a nucleic acid sequence encoding the br2 mutant protein of the present invention or the above-mentioned polynucleotide. Preferably, the vector also includes an expression control element operably linked to the above-mentioned nucleic acid sequence.

[0029] In another preferred embodiment, the vector includes a cloning vector, an expression vector, a shuttle vector or an integration vector.

[0030] In one embodiment, the vector can be a vector for gene editing the CDS sequence and / or 3'UTR sequence of the endogenous br2 protein of the host cell.

[0031] In one embodiment, the expression vector further contains at least one replication origin to achieve self-replication.

[0032] In one embodiment, the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated.

[0033] The vector can be a plasmid, virus, cosmid, phage, etc., which are well known to those skilled in the art.

[0034] Preferably, the vector in the present invention is a plasmid.

[0035] In another aspect, the present invention provides a host cell, wherein the host cell contains one or more of the br2 mutant protein, the encoding gene, the fusion protein, the polynucleotide, the nucleic acid construct, and the vector; or, the polynucleotide is integrated into the host cell genome.

[0036] In another preferred embodiment, the host cell is a eukaryotic cell, such as a yeast cell, an animal cell, or a plant cell.

[0037] In another preferred embodiment, the host cell is a prokaryotic cell, such as Escherichia coli.

[0038] In another preferred embodiment, the plants include angiosperms and gymnosperms.

[0039] In another preferred embodiment, the plants include monocotyledonous plants and dicotyledonous plants.

[0040] In another preferred embodiment, the plants include herbaceous plants and woody plants.

[0041] In another preferred embodiment, the plants include Arabidopsis, tobacco, rice, corn, sorghum, barley, wheat, millet, soybean, tomato, potato, quinoa, lettuce, rapeseed, cabbage, and strawberry.

[0042] On the other hand, the present invention provides an editing vector system, which comprises one or more vectors, and the one or more vectors at least contain a guide sequence targeting the 3'UTR sequence of the parent br2 protein. The guide sequence contains the nucleotide sequence of the 3'UTR sequence of a portion of the parent br2 protein, preferably contains at least 15bp of the nucleotide sequence of the 3'UTR sequence of the br2 protein, and more preferably includes at least 20bp of the nucleotide sequence of the 3'UTR sequence of the br2 protein. In one embodiment, the editing vector system also includes a gene editing enzyme. The gene editing enzyme includes nucleases of CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), TALEN (Tanscription Activator-like (TAL) effector nucleases), and ZFN (Zinc finger nuclease) editing tools.

[0043] Preferably, the gene editing enzyme is a Cas protein, also known as CRISPR enzyme or Cas effector protein, and its types include but are not limited to: Cas9 protein, Cas12 protein, Cas13 protein, Cas14 protein, Csm1 protein, FDK1 protein.

[0044] Preferably, the Cas protein is operably linked to a first regulatory element.

[0045] In one embodiment, the gene editing enzyme is a Cas9 protein, and the vector further includes a Scaffold sequence that can specifically bind to the Cas9 protein. After the Scaffold sequence is operably connected to the guide sequence, it constitutes a guide sequence (gRNA). Preferably, the gRNA is operably connected to the second regulatory element.

[0046] In other embodiments, the gene editing enzyme is a Cas12 protein, for example, Cas12a, Cas12b, Cas12i, Cas12i mutant protein, and the vector further includes a unidirectional repeat sequence (Direct Repeat) that specifically binds to the Cas12 protein. After the unidirectional repeat sequence is operably connected to the guide sequence, it constitutes a guide sequence (gRNA). Preferably, the gRNA is operably connected to the second regulatory element.

[0047] In other embodiments, the gene editing enzyme is a Cas12i mutant protein, and the amino acid sequence of the wild-type Cas12i is shown in SEQ ID No. 4; compared with SEQ ID No. 4, the Cas12i mutant protein has S at position 7 mutated to R, D at position 233 mutated to R, D at position 267 mutated to R, N at position 369 mutated to R, and S at position 433 mutated to R.

[0048] Such regulatory elements include promoters, terminator sequences, leader sequences, polyadenylation sequences, signal peptide coding regions, marker genes, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences).

[0049] Preferably, the editing vector system further comprises a base editing element, and the base editing element is selected from adenine deaminase and / or cytosine deaminase.

[0050] In one embodiment, the editing vector further comprises resistance genes for easy screening, wherein the resistance genes include hyg, bar, kana, rif, spec, and amp, and the resistance genes are well known to those skilled in the art.

[0051] Preferably, the Cas protein is nCas9 or other Cas9 proteins with nick activity, where "n" represents nick, i.e., a Cas protein with only single-strand cleavage activity.

[0052] On the other hand, the present invention provides a gene editing reagent capable of producing the above-mentioned mutant polypeptide in plants; the gene editing reagent comprises a CRISPR / Cas protein and a gRNA, and the gRNA can target the CDS sequence and 3'UTR sequence of the plant's endogenous br2 protein; optionally, the gene editing reagent further comprises a base editing element, and the base editing element is selected from adenine deaminase and / or cytosine deaminase.

[0053] In another embodiment, the gene editing reagent includes the above-mentioned editing vector system.

[0054] On the other hand, the present invention provides a method for reducing the plant height and / or ear height of a plant, improving the plant's resistance to lodging, increasing the plant yield, or increasing the yield of a plant under high-density planting conditions, or a method for preparing a plant with reduced plant height and / or ear height, improved lodging resistance, increased yield, or increased yield under high-density planting conditions, the method comprising the steps of introducing the above-mentioned br2 mutant protein into plant cells, plant seeds, plant tissues, plant parts, or plants, wherein the plant is corn.

[0055] On the other hand, the present invention provides a method for improving plant traits, which comprises the step of introducing the above-mentioned br2 mutant protein into plant cells, plant seeds, plant tissues, plant parts or plants, wherein the plant is corn.

[0056] In one embodiment, the improved plant traits include reducing plant height and / or ear height, improving plant lodging resistance, increasing plant yield, or increasing plant yield under high-density planting conditions.

[0057] In one embodiment, the introduction of the br2 mutant protein includes the step of expressing the br2 mutant protein in plant cells, plant tissues, plant parts or plants, for example, expressing the mutant protein through an expression vector, or integrating the polynucleotide encoding the mutant protein into the plant genome for expression.

[0058] In another preferred embodiment, the introduction of the br2 mutant protein comprises the step of mutating the CDS sequence and 3'UTR sequence of the plant's endogenous br2 protein to thereby introduce the mutant protein.

[0059] In another preferred embodiment, the introduction of the br2 mutant protein comprises the steps of mutating the CDS sequence and 3'UTR sequence of the plant's endogenous br2 protein and expressing the mutated protein to introduce the mutant protein.

[0060] In another preferred embodiment, in the method described above, the method of introducing mutations includes natural variation, physical mutagenesis (such as ultraviolet mutagenesis, X-ray or Y-ray mutagenesis), chemical mutagenesis (such as nitrous acid, hydroxylamine, EMS, nitrosoguanidine, etc.), biological mutagenesis (such as virus- or bacteria-mediated mutagenesis), and gene editing.

[0061] In another preferred embodiment, the method comprises the following steps:

[0062] (1) Introducing expression vectors containing gene editing tools into plant cells, plant tissues, or plant parts;

[0063] (2) allowing the gene editing tool to act on the 3'UTR sequence of its endogenous br2 protein and causing mutations at the above-mentioned mutation sites corresponding to SEQ ID No. 1 and SEQ ID No. 2;

[0064] (3) Screening for mutant plant cells, plant tissues, and plant parts;

[0065] (4) Isolating the gene editing tool.

[0066] In another preferred embodiment, the gene editing tools include CRISPR, TALEN and ZFN.

[0067] On the other hand, the present invention also provides the use of the above-mentioned br2 mutant protein, polynucleotide, vector, nucleic acid construct, gene editing reagent or host cell in preparing plants with reduced plant height and / or ear height, improved lodging resistance, increased yield or increased yield under high-density planting conditions, wherein the plant is corn; or, the use of the above-mentioned br2 mutant protein, polynucleotide, vector, nucleic acid construct, gene editing reagent or host cell in preparing plants with reduced plant height and / or ear height, improved lodging resistance, increased plant yield or increased yield under high-density planting conditions.

[0068] The present invention also provides a corn plant with reduced plant height and / or ear height, improved lodging resistance, increased yield, or increased yield under high-density planting conditions, wherein the corn plant contains the above-mentioned br2 mutant protein, polynucleotide, vector, gene editing reagent or host cell.

[0069] The said reduction of plant height and / or ear height, or reduction of plant height and / or ear height, means that the plant height and / or ear height of the corn plant containing the above-mentioned br2 mutant protein, nucleic acid, nucleic acid construct, vector, gene editing reagent or host cell is lower than the plant height and / or ear height of the corn plant containing the parent br2 protein.

[0070] The plant height refers to the height from the ground to the highest point of the corn.

[0071] In one embodiment, corn plants containing the br2 mutant protein of the present invention have a plant height reduced by about 10%-90% compared to the wild type, for example, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 55%, 60%, 65%, 70%, 75%, 80%, 85%.

[0072] The improved lodging resistance of plants, or the improved lodging resistance, means that the lodging resistance of corn plants containing the above-mentioned br2 mutant protein, nucleic acid, nucleic acid construct, vector, gene editing reagent or host cell is stronger than the lodging resistance of corn plants containing the parent br2 protein.

[0073] The increased plant yield, or yield increase, means that the yield of a corn plant containing the above-mentioned br2 mutant protein, nucleic acid, nucleic acid construct, vector, gene editing reagent or host cell is higher than the yield of a corn plant containing the parent br2 protein.

[0074] The said increasing plant yield under high-density planting conditions, or increasing yield under high-density planting conditions, means that the yield of corn plants containing the above-mentioned br2 mutant protein, nucleic acid, nucleic acid construct, vector, gene editing reagent or host cell under high-density planting conditions is higher than the yield of corn plants containing the parent br2 protein under high-density planting conditions.

[0075] High-density planting refers to the number of plants planted per unit area of ​​land exceeding the optimal planting density, the guideline planting density, the conventional planting density, or the average planting density. For example, in the Huanghuai region, the average planting density of corn is approximately 4,500 plants per mu, and a few corn varieties have an average planting density of up to 5,000 plants per mu. In one embodiment, high-density planting conditions refer to a corn planting density exceeding 4,500 plants per mu; preferably, exceeding 5,000 plants per mu; and more preferably, exceeding 5,500 plants per mu.

[0076] The present invention also provides a method for reducing plant height and / or ear height, improving plant lodging resistance, improving plant yield, or improving plant yield under high-density planting conditions, or a method for preparing plants with reduced plant height and / or ear height, improved lodging resistance, improved yield, or improved yield under high-density planting conditions, the method comprising the step of using the above-mentioned gene editing reagent to perform gene editing on the plant's endogenous br2 protein CDS sequence and 3'UTR sequence, wherein the plant is corn.

[0077] In another aspect, the present invention provides a reagent or kit, which can be used to reduce the plant height and / or ear height of a plant, improve the lodging resistance of a plant, increase the yield of a plant, or increase the yield of a plant under high-density planting conditions. The reagent contains the mutant protein, polynucleotide encoding the mutant protein, vector, nucleic acid construct, gene editing reagent or host cell according to the present invention.

[0078] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0079] The term "vector" refers to a vector that contains elements that allow the vector to be integrated into the host cell genome or to replicate autonomously within the cell independently of the genome. The vector may contain any elements that ensure self-replication. It usually carries genes that are not part of the central metabolism of the cell and is usually in the form of double-stranded DNA. The choice of vector usually depends on the compatibility of the vector with the host cell into which the vector is to be introduced. If a vector is used, the choice of vector depends on methods well known to those skilled in the art for transforming host cells. For example, a plasmid vector can be used.

[0080] The term "3'UTR" refers to the 3' untranslated region or 3' non-coding region of the br2 gene (Brachytic2) in corn, and the term "parental 3'UTR" refers to the sequence from which the mutated 3'UTR sequence is derived. In a preferred embodiment, the parental 3'UTR is a 3'UTR nucleic acid molecule of the br2 gene that can be found in corn in nature, and its nucleotides can be obtained through genetic engineering techniques, such as genome sequencing, polymerase chain reaction (PCR), etc.

[0081] As used herein, the term "identity" refers to the match between two polypeptides or between two nucleic acids. When a position in both sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of the two DNA molecules is occupied by adenine, or a position in each of the two polypeptides is occupied by lysine), then the molecules are identical at that position. The "percent identity" between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared x 100. For example, if 6 out of 10 positions in two sequences match, then the two sequences have 60% identity. For example, the DNA sequences CTGACT and CAGGTT share 50% identity (3 out of 6 positions match). Typically, two sequences are compared when they are aligned for maximum identity. Such an alignment can be achieved, for example, by using the method of Needleman et al. (1970) J. Mol. Biol. 48:443-453, which can be conveniently performed using a computer program such as the Align program (DNAstar, Inc.). The percent identity between two amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (Comput. Appl Biosci., 4:11-17 (1988)), which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. In addition, the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (J Mol Biol. 48:444-453 (1970)) algorithm, which has been incorporated into the GAP program in the GCG software package (available at www.gcg.com), using a Blossum 62 matrix or a PAM250 matrix and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.

[0082] "Homology" or "identity" may be calculated by known methods including, but not limited to, Computational Molecular Biology (Lesk, A.M., ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, D.W., ed.) Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (Griffin, A.M. and Griffin, H.G., eds.) Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton, NJ (1993). Stockton Press, New York (1991).

[0083] The specific amino acid positions (numbers) of the br2 proteins of the present invention are determined by aligning the target amino acid sequences using standard sequence alignment tools, such as the Smith-Waterman algorithm or the CLUSTALW2 algorithm, wherein the sequences are considered aligned when the alignment score is the highest. The alignment score can be calculated according to the method described in Wilbur, WJ and Lipman, DJ (1983) Rapid similarity searches of nucleic acid and protein data banks. Proc. Natl. Acad. Sci. USA, 80:726-730. The default parameters for the ClustalW2 (1.82) algorithm are preferably used: protein gap open penalty = 10.0; protein gap extension penalty = 0.2; protein matrix = Gonnet; protein / DNA end gap = -1; protein / DNAGAPDIST = 4. Preferably, the AlignX program (part of the vectorNTI suite) is used with default parameters suitable for multiple alignment (gap opening penalty: 10 log, gap extension penalty: 0.05). The amino acid sequences of the br2 proteins of different maize inbred lines or varieties are compared to determine the specific positions where the amino acids of the br2 proteins of different parents correspond to SEQ ID No. 3. By using sequence alignment methods known in the art, those skilled in the art can determine the amino acid correspondence between the br2 protein sequences of different maize varieties and SEQ ID No. 3.

[0084] The specific nucleotide (base) position (number) within the 3'UTR of the present invention is determined by aligning the target nucleotides using standard sequence alignment tools, such as the Smith-Waterman algorithm or the CLUSTALW2 algorithm, wherein the sequences are considered aligned when the alignment score is the highest. The alignment score can be calculated according to the method described in Wilbur, WJ and Lipman, DJ (1983) Rapid similarity searches of nucleic acid and protein data banks. Proc. Natl. Acad. Sci. USA, 80:726-730. The default parameters are preferably used in the ClustalW2 (1.82) algorithm: protein gap open penalty = 10.0; protein gap extension penalty = 0.2; protein matrix = Gonnet; protein / DNA end gap = -1; protein / DNAGAPDIST = 4. Preferably, the AlignX program (part of the vectorNTI suite) is used with default parameters suitable for multiple alignment (gap opening penalty: 10 log, gap extension penalty: 0.05). The specific positions of the 3' UTRs of different parents are determined by comparing the 3' untranslated region or 3' non-coding region (3'UTR) sequences of the br2 gene (Brachytic2) of different maize inbred lines or varieties with SEQ ID No. 2 (the 3' UTR sequence of the br2 gene of the maize inbred line PH4CV). Using sequence alignment methods known in the art, those skilled in the art can determine the base correspondence between the 3' UTR sequences of the br2 genes of different maize varieties and SEQ ID No. 2.

[0085] The term "plant tissue" or "plant part" includes plant cells, protoplasts, plant tissue cultures, plant callus, plant pieces, as well as plant embryos, pollen, ovules, seeds, leaves, stems, flowers, branches, seedlings, fruits, kernels, ears, roots, root tips, anthers, and the like.

[0086] The term "plant cell" is to be understood as any cell from or found in a plant, which is capable of forming, for example, undifferentiated tissue such as callus, differentiated tissue such as embryos, plant components, plants or seeds.

[0087] The term "gene editing" technology includes CRISPR technology, TALEN technology, and ZFN technology. CRISPR technology refers to clustered, regularly interspaced short palindromic repeats, which come from the immune system of microorganisms. Among them, gene editing tools include guideRNA, Cas proteins (such as Cas9, Cpf1, Cas12b, etc.). The gene editing tool referred to in TALEN technology is a restriction enzyme that can cut a specific DNA sequence, which includes a TAL effector DNA binding domain and a DNA cleavage domain. The gene editing tool referred to in ZFN technology is also a restriction enzyme that can cut a specific DNA sequence, which includes a zinc finger DNA binding domain and a DNA cleavage domain. It is well known to those skilled in the art that by constructing the nucleotides encoding the gene editing tool and other regulatory elements into a suitable vector and then transforming the cell, the editing of the genome in the cell can be achieved. The types of editing include gene knockout, insertion, and base editing.

[0088] Those skilled in the art will appreciate that protein structure can be altered without adversely affecting its activity and functionality. For example, one or more conservative amino acid substitutions can be introduced into a protein's amino acid sequence without adversely affecting the activity and / or three-dimensional structure of the protein molecule. Examples and implementations of conservative amino acid substitutions will be apparent to those skilled in the art. Specifically, an amino acid residue can be substituted with another amino acid residue belonging to the same group as the substituted residue, i.e., a non-polar amino acid residue can be substituted for another non-polar amino acid residue, a polar uncharged amino acid residue can be substituted for another polar uncharged amino acid residue, a basic amino acid residue can be substituted for another basic amino acid residue, and an acidic amino acid residue can be substituted for another acidic amino acid residue. Such substituted amino acid residues may or may not be encoded by the genetic code. Conservative substitutions, where one amino acid is replaced with another amino acid from the same group, fall within the scope of the present invention, as long as the substitution does not inactivate the biological activity of the protein. Therefore, the proteins of the present invention may contain one or more conservative substitutions in their amino acid sequences, preferably generated by substitutions according to Table 1. Furthermore, the present invention also encompasses proteins containing one or more other non-conservative substitutions, as long as such non-conservative substitutions do not significantly affect the desired function and biological activity of the proteins of the present invention. Conservative amino acid replacement can be carried out at the non-essential amino acid residue of one or more predictions.A "non-essential" amino acid residue is an amino acid residue that can be changed (deletion, substitution or replacement) without changing biological activity, while an "essential" amino acid residue is required for biological activity.A "conservative amino acid replacement" is a replacement in which an amino acid residue is replaced by an amino acid residue with a similar side chain.Amino acid replacement can be carried out in the non-conserved region of br2 protein.In general, This type of replacement is not carried out to a conserved amino acid residue, or is not carried out to an amino acid residue located within a conserved motif, wherein this type of residue is required for protein activity.However, it will be appreciated by those skilled in the art that functional variants can have less conservative or non-conservative changes in a conserved region.

[0089] It is well known in the art that one or more amino acid residues can be altered (replaced, deleted, truncated, or inserted) from the N- and / or C-termini of a protein while still retaining its functional activity. Thus, proteins wherein one or more amino acid residues are altered from the N- and / or C-termini of a br2 protein while retaining its desired functional activity are also within the scope of the present invention. These alterations may include those introduced by modern molecular methods such as PCR, which involves altering or extending the protein coding sequence by including the amino acid coding sequence within the oligonucleotides used in the PCR amplification.

[0090] It will be appreciated that proteins can be altered in various ways, including amino acid replacements, deletions, truncations, and insertions, and methods for such manipulations are generally known in the art. For example, amino acid sequence variants of br2 proteins can be prepared by mutations in the DNA. Other mutagenesis modalities and / or directed evolution can also be employed, for example, using known mutagenesis, recombination, and / or shuffling methods, in conjunction with relevant screening methods, to perform single or multiple amino acid replacements, deletions, and / or insertions.

[0091] Those skilled in the art will appreciate that these minor amino acid changes in the br2 proteins of the present invention can occur (e.g., naturally occurring mutations) or be produced (e.g., using r-DNA technology) without loss of protein function or activity. If these mutations occur in the catalytic domain, active site, or other functional domains of the protein, the properties of the polypeptide may be altered, but the polypeptide may retain its activity. If the mutations are not located near the catalytic domain, active site, or other functional domains, lesser effects may be expected.

[0092] Those skilled in the art can identify the essential amino acids of the br2 protein using methods known in the art, such as site-directed mutagenesis or protein evolution or bioinformatics analysis. The catalytic domain, active site, or other functional domains of the protein can also be determined by physical analysis of the structure, such as by techniques such as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, combined with mutations in putative key amino acids.

[0093] Table 1

[0094] The terms "protein", "polypeptide" and "peptide" are used interchangeably in the present invention and refer to polymers of amino acid residues, including polymers in which one or more amino acid residues are chemical analogs of natural amino acid residues. The proteins and polypeptides of the present invention can be produced recombinantly or by chemical synthesis. The term "mutant" or "mutant protein" refers to a protein that has one or more amino acid residues substituted, inserted, deleted and / or added compared to the amino acid sequence of the parent protein. As used herein, the terms "br2 mutant protein", "mutated br2 polypeptide", "mutant br2 polypeptide", "mutant br2 protein", "mutant protein", "mutant polypeptide" and the like are used interchangeably.

[0095] The term "encode" refers to the inherent property of a particular nucleotide sequence in a polynucleotide, such as a gene, cDNA, or mRNA, to serve as a template for the synthesis of other polymers and macromolecules in a biological process having a defined nucleotide sequence (i.e., rRNA, tRNA, and mRNA) or a defined amino acid sequence and the resulting biological properties. Thus, a gene encodes a protein if transcription and translation of the mRNA corresponding to that gene produces the protein in a cell or other biological system.

[0096] The term "amino acid" refers to a carboxylic acid containing an amino group. Various proteins in living organisms are composed of 20 basic amino acids.

[0097] The term "plant" is to be understood as meaning any differentiated multicellular organism capable of photosynthesis, including crop plants, in particular monocotyledonous or dicotyledonous plants, at any stage of maturity or development, vegetable crops, including artichokes, Brussels sprouts, rocket, leeks, asparagus, lettuce (e.g., head lettuce, leaf lettuce, romaine lettuce), bok choy, yellow taro, melons (e.g., cantaloupe, watermelon, Crenshaw melon, honeydew melon, cantaloupe), oilseed crops (e.g., Brussels sprouts, cabbage, cauliflower, broccoli, kale, kale, Chinese cabbage, bok choy), cardoon, carrot, napa, okra, onion, celery, parsley, chickpeas, parsnips, endive, peppers, potatoes, cucurbits (e.g., zucchini, cucumber, courgette, squash, pumpkin), radish, cabbage, Onions, rutabagas, eggplant (also known as eggplant), salsify, lettuce, shallots, endive, garlic, spinach, green onions, squash, greens, beets (sugar beets and fodder beets), sweet potatoes, Swiss chard, horseradish, tomatoes, turnips, and spices; fruits and / or vines such as apples, apricots, cherries, nectarines, peaches, pears, plums, prunes, cherries, quince, almonds, chestnuts, hazelnuts, pecans, pistachios, walnuts, citrus, blueberries, boysenberries, y), cranberries, currants, loganberries, raspberries, strawberries, blackberries, grapes, avocados, bananas, kiwis, persimmons, pomegranates, pineapples, tropical fruits, pome fruits, melons, mangoes, papayas, and lychees; field crops such as clover, alfalfa, evening primrose, meadowsweet, corn / maize (feed corn, sweet corn, popcorn), hops, jojoba, peanuts, rice, safflower, small grain cereals (barley, oats, rye, wheat, etc.), sorghum, tobacco, kapok, and legumes (beans, lentils, peas, soybeans) , oil plants (rapeseed, mustard, poppy, olive, sunflower, coconut, castor oil plant, cocoa bean, peanut), Arabidopsis, fiber plants (cotton, flax, hemp, jute), Lauraceae (cinnamon, camphor), or a plant such as coffee, sugar cane, tea, and natural rubber plant; and / or bedding plants, such as flowering plants, cacti, succulents and / or ornamental plants, as well as trees such as forests (broadleaf trees and evergreen trees, such as conifers), fruit trees, ornamental trees, and nut-bearing trees, as well as shrubs and other seedlings.

[0098] The main advantages of the present invention are:

[0099] The present invention screens out a mutant br2 protein. Compared with wild-type corn plants, corn plants containing the mutant br2 protein have significantly lower plant height and ear height and improved lodging resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0100] FIG1 is a schematic diagram of the gene editing vector used in this embodiment.

[0101] Figure 2 Comparison of plant height and ear height between edited plants and wild-type PH4CV corn plants.

[0102] Figure 3 Comparison of plant height (Figure 3A) and ear height (Figure 3B) of different mutant lines.

[0103] Figure 4 Comparison of agronomic traits between edited plants and wild-type PH4CV plants.

[0104] Sequence Listing DETAILED DESCRIPTION

[0105] The present invention will be further described below with reference to the following embodiments. The following description is merely a preferred embodiment of the present invention and does not limit the present invention in any other form. Any person skilled in the art may utilize the above disclosed technical content to make equivalent embodiments with equivalent variations. Any simple modification or equivalent variation of the following embodiments made in accordance with the technical essence of the present invention without departing from the content of the present invention shall fall within the scope of protection of the present invention.

[0106] Example 1. Target design and vector construction

[0107] The genomic sequence and amino acid sequence of the br2 gene were obtained through the NCBI website (https: / / www.ncbi.nlm.nih.gov). Target selection and design were performed based on different domain coding regions and 3'UTR sequences, and the br2 gene sequence of the maize inbred line PH4CV was obtained. The CDS sequence of the br2 gene of the maize inbred line PH4CV is shown in SEQ ID No. 1, and the amino acid sequence is shown in SEQ ID No. 3; the 3'UTR sequence of the br2 gene of the maize inbred line PH4CV is shown in SEQ ID No. 2.

[0108] CDS sequence of br2 gene:

[0109] 3'UTR sequence of br2 gene:

[0110] Amino acid sequence of the br2 gene:

[0111] In this embodiment, the 3'UTR of the br2 gene was edited in the maize inbred line PH4CV using a Cas12i mutant protein and an sgRNA targeting the 3'UTR sequence of br2. The specific operation method can be carried out according to conventional methods in the art. In this embodiment, the schematic diagram of the constructed gene editing vector is shown in Figure 1; wherein, ZmU6 pro is U6 promoter, gly-tRNA is glycine tRNA, ZmU6 Ter For terminator, UBI pro is a UBI promoter, NLS is a nuclear localization signal, and Cas12i is a Cas12i mutant protein; in this embodiment, the wild-type Cas12i is Cas12f.4 in CN111757889B, and the amino acid sequence is shown in SEQ ID No.4; compared with SEQ ID No.4, the Cas12i mutant protein has the following mutations: S at position 7 is mutated to R, D at position 233 is mutated to R, D at position 267 is mutated to R, N at position 369 is mutated to R, and S at position 433 is mutated to R.

[0112] Amino acid sequence of wild-type Cas12i:

[0113] Specifically, in this embodiment, sgRNA was designed using target Design (http: / / skl.scau.edu.cn / targetdesign / ), and the gRNA targeting the 3'UTR sequence involved was as follows:

[0114] g3'UTR-1(AGCTTCCTCACCCATCAATC);

[0115] g3'UTR-2(GACGATCTGTTTGAGTCGGG).

[0116] g3'UTR-1 and g3'UTR-2 were combined to construct vector P1515, and the two gRNAs were separated by glycine tRNA.

[0117] The specific construction method is as follows:

[0118] 1) Amplify the target fragment g3'UTR-1&2 using the primer pair, and digest the recovered fragment with BsaI;

[0119] 2) The backbone vector P0522 was digested with BsaI to recover a 23 Kb fragment;

[0120] 3) Ligate g3'UTR-1&2 with P0522 to construct the final vector P1515;

[0121] 4) The above ligation products were transformed into competent E. coli Trans-T1, spread on Kan plates for culture, and 8 colonies were selected for liquid culture for 2 hours. PCR bacterial liquid detection was performed, and 2 correct monoclonal clones were selected for bacterial liquid testing.

[0122] 5) Select the single clone with correct sequencing for expansion, bacterial preservation, plasmid extraction, and transformation of Agrobacterium EHA105. Pick 5 single colonies for culture. After PCR detection is correct, preserve the bacteria for future use.

[0123] Example 2, genetic transformation

[0124] 2.1 Transformation of Agrobacterium

[0125] The vector in Example 1 was transformed into Agrobacterium strain EHA105 using the heat shock method, and a single clone was picked, cultured in liquid, identified by PCR, and stored in a -80°C refrigerator for later use.

[0126] 2.2 Bacteria activation

[0127] The bacteria were taken out from the refrigerator and streaked onto YEP solid medium.

[0128] 2.3 Preparation of Agrobacterium infection solution

[0129] Scrape fresh bacteria from the newly activated bacterial plate and resuspend them in the infection solution.

[0130] 2.4 Taking corn embryos

[0131] Take corn ears about 10 days after pollination, remove the bracts and filaments, pick out the young embryos, and place them in the infection medium (without Agrobacterium) containing AS.

[0132] 2.5 Infection

[0133] Wash the embryos to be transformed three times with infection solution until the solution is clear. Pour off the solution and add 1 ml of bacterial solution. Gently invert the dish 10 times and let it sit for 5-10 minutes. Place three sterile filter papers on a clean Petri dish. After infection, invert the dish several times and quickly pour the bacterial solution onto the filter paper. Hold the Petri dish and rotate it to evenly distribute the bacterial solution carrying the embryos on the filter paper.

[0134] 2.6 Co-culture

[0135] When the bacterial liquid is no longer visible on the top layer of filter paper, use tweezers to pick up the upper layer of filter paper, and stick the side stained with the immature embryos on the co-culture medium. After using tweezers to drive out the bubbles between the filter paper and the medium, use tweezers to pinch a corner of the filter paper and quickly peel it off. Use an embryo peeling knife to transfer the immature embryos remaining on the filter paper to the culture medium, with the shield side of the immature embryo facing up, and culture in the dark at 22℃ for 3 days.

[0136] 2.7 Recovery culture

[0137] After 3 days of co-culture, young embryos were transferred to recovery medium.

[0138] 2.8 Differentiation

[0139] The immature embryos transformed with the P1515 vector were directly differentiated in differentiation medium.

[0140] 2.9 Rooting

[0141] Transfer the differentiated seedlings to the rooting medium, with 3 to 4 seedlings per bottle, and culture them under light at 25 to 28°C until they grow into complete plants. After 7 days of rooting culture, small white roots will grow and can be sampled for testing.

[0142] Example 3. Screening of positive seedlings and editing plant phenotypes

[0143] For regenerated seedlings, a small amount of leaves were taken to extract genomic DNA using the TPS method.

[0144] For plants transformed with the vector, if the target product can be amplified using primers, the regenerated seedlings are transgenic positive seedlings.

[0145] For transgenic seedlings, primers were used to amplify the corresponding fragment of the br2 gene. The amplified product was sequenced by Sanger sequencing to confirm the editing pattern. If the sequencing result showed double peaks, the PCR product was ligated into a T vector and five clones were selected for sequencing to confirm the editing pattern.

[0146] Using P1515 to transform immature embryos of PH4CV, the 3'UTR sequence of the br2 gene of the inbred line PH4CV was edited. The resulting edited plants contained deletions of bases 4102-4137 in the CDS region of the br2 gene, as well as bases 1-36 and 160-162 in the 3'UTR sequence. Based on amino acid structural predictions, the br2 protein lacked amino acids 1368-1378 and was extended by 45 amino acids.

[0147] Edit the CDS sequence of the plant's br2 gene:

[0148] Edit the 3'UTR sequence of the plant's br2 gene:

[0149] Compared with wild-type PH4CV plants, the plant height of the edited plants was reduced by about 20%, and the ear height was reduced by about 30%, as shown in Figure 2.

[0150] Statistics of the dwarf phenotypes of strains with different br2 gene mutation types showed that the plant height of most strains with br2 gene CDS region mutations decreased by more than 30%, and the ear height decreased by more than 55%. The plant height of most strains with br2 gene 3'UTR sequence mutations decreased by less than 10%, and there was no significant decrease in ear height. It can be seen that compared with the dwarf phenotypes (plant height and ear height) of strains with br2 gene CDS region mutations, the dwarf phenotype of this edited plant is milder; compared with the dwarf phenotypes (plant height and ear height) of strains with br2 gene 3'UTR sequence mutations, the dwarf phenotype of this edited plant is more obvious, as shown in Figure 3 (Figure 3A is a comparison of plant height of strains with different mutation types, and Figure 3B is a comparison of ear height of each mutation type).

[0151] The stalk strength of wild-type PH4CV and edited plants was measured using a YYD-1B stalk strength tester from Zhejiang Top Yunnong Technology Co., Ltd. Fifteen pollinated plants of each strain were selected. The stalks were secured to the instrument with a rubber band and placed 20 cm above the ground. The corn stalk was pushed at a right angle until it formed a 45-degree angle with the ground. The value was recorded in Newtons (N). This value represents the bending resistance and, therefore, the stalk strength. Greater stalk strength indicates a plant's resistance to lodging and breaking.

[0152] Agronomic traits of the edited plants are shown in Figure 4. In Figures 4A-K, PH4CV refers to wild-type PH4CV plants, and ko refers to edited plants. Compared with wild-type PH4CV, plant height was reduced by 20% (Figure 4A) and ear height was reduced by 31% (Figure 4B). Stem strength was significantly increased (Figure 4C), and resistance to lodging and breaking was enhanced. Leaf width increased (Figure 4D) and leaf length decreased (Figure 4E). There were no significant differences in the number of grains per row (Figure 4F) or number of rows per ear (Figure 4G). Ear length (Figures 4H and 4J) was slightly shorter but not significantly different. Ear diameter (Figure 4I) was slightly increased but not significantly different. There were also no significant differences in grain width and length (Figure 4K). This indicates that the edited plants not only had reduced plant height and ear height but also enhanced lodging resistance, demonstrating their potential for lodging resistance and tolerance to dense planting, as well as increased yield under high-density planting conditions.

[0153] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto.

Claims

1. A br2 mutant protein, characterized in that The CDS sequence and 3'UTR sequence of the mutant br2 protein have base deletions relative to the CDS sequence and 3'UTR sequence of the parent br2 protein; The parent br2 protein is derived from corn; the mutant br2 protein causes the plant height and / or ear height of corn to be reduced, the lodging resistance to be improved, the yield to be increased, or the yield to be increased under high-density planting conditions.

2. The mutant protein according to claim 1, characterized in that The CDS sequence of the mutant br2 protein lacks bases 4102-4137 corresponding to the sequence shown in SEQ ID No. 1 relative to the CDS sequence of the parent br2 protein; the 3'UTR sequence of the mutant br2 protein lacks bases 1-36 and bases 160-162 corresponding to the sequence shown in SEQ ID No. 2 relative to the 3'UTR sequence of the parent br2 protein; Preferably, the CDS sequence of the parent br2 protein is shown as SEQ ID No.1, and the 3'UTR sequence of the parent br2 protein is shown as SEQ ID No.

2.

3. A polynucleotide encoding the br2 mutant protein according to any one of claims 1-2. A vector comprising the polynucleotide according to claim 3.

5. A host cell comprising the br2 mutant protein according to any one of claims 1-2, or the polynucleotide according to claim 3, or the vector according to claim 4.

6. A gene editing reagent, characterized in that: The gene editing reagent can produce the mutant protein described in any one of claims 1-2 in a plant; the gene editing reagent includes CRISPR / Cas protein and gRNA, the gRNA can target the 3'UTR sequence of the plant endogenous br2 protein, and the plant is corn.

7. A method for improving plant traits, the method comprising the step of introducing the br2 mutant protein according to any one of claims 1 to 2 into plant cells, plant seeds, plant tissues, plant parts or plants, wherein the plant is corn; Preferably, the improved plant traits include reducing plant height and / or ear height, improving plant lodging resistance, increasing plant yield, or increasing plant yield under high-density planting conditions.

8. The method according to claim 7, characterized in that The introduction of the br2 mutant protein according to any one of claims 1-2 comprises the step of mutating the CDS sequence and 3'UTR sequence of the endogenous br2 protein of the plant to introduce the mutant protein; preferably, the br2 mutant protein is introduced into the plant by gene editing.

9. The method according to claim 7, characterized in that: The introduction of the br2 mutant protein according to any one of claims 1-2 comprises the step of expressing the mutant protein in plant cells, plant seeds, plant tissues, plant parts or plants.

10. Use of the mutant protein according to any one of claims 1-2, the polynucleotide according to claim 3, the vector according to claim 4, the host cell according to claim 5, or the gene editing reagent according to claim 6 in preparing plants with reduced plant height and / or ear height, improved lodging resistance, increased yield, or increased yield under high-density planting conditions; or, use of the mutant protein according to any one of claims 1-2, the polynucleotide according to claim 3, the vector according to claim 4, the host cell according to claim 5, or the gene editing reagent according to claim 6 in preparing plants with reduced plant height and / or ear height, improved lodging resistance, increased plant yield, or increased yield under high-density planting conditions; the plant is corn.

Images