New double-stranded RNA based on CXCL12 RNA sequence and use thereof

Abstract

A double-stranded RNA disclosed herein comprises a first strand and a second strand that is complementary to the first strand. The first strand is formed of: a main sequence that is any one of CCAAGGUCGUGGUCGUGCU (SEQ ID NO: 1), GUGCUGGUCCUCGUGCUGA (SEQ ID NO: 2), GGGAAGCCCGUCAGCCUGA (SEQ ID NO: 3), CGUCAGCCUGAGCUACAGA (SEQ ID NO: 4), or GUCAGCCUGAGCUACAGAU (SEQ ID NO: 5) determined from the base sequence encoding CXCL12; and an additional sequence that is added to the 3'-end side of the main sequence and that is formed of 2-4 bases.

Description

Novel double-stranded RNA based on CXCL12 RNA sequence and its use

[0001] The present disclosure relates to double-stranded RNA, compositions comprising the double-stranded RNA, and methods of using the same, particularly to double-stranded RNA used to suppress or inhibit tumor cell growth or metastasis, and compositions comprising the double-stranded RNA.

[0002] CXCL12 (C-X-C motif chemokine ligand 12) is a type of chemokine, a group of cytokines with cell migration activity. Chemokines activate leukocytes, neutrophils, etc., and are often induced by inflammatory stimuli such as lipopolysaccharide, TNF, and IL-1. CXCL12 is primarily expressed in lymphocytes, but is also widely expressed in many tissues other than lymphocytes, such as bone marrow and lungs. CXCL12 plays an important role in the migration and settlement of hematopoietic stem cells and progenitor cells to the bone marrow, and in recent years, its involvement in the in vivo migration of tumor cells has been suggested.

[0003] CXCL12 is a ligand for CXCR4 (C-X-C motif chemokine receptor 4) and CXCR7 (C-X-C motif chemokine receptor 7), which are also chemokines. CXCL12 induces the migration and recruitment of immune cells by binding to CXCR4, and is involved in multiple biological processes, such as immune responses and cardiovascular development. CXCL12 and CXCR4 are known to be overexpressed in various tumor cells. Furthermore, the CXCL12-CXCR4 axis has been suggested to promote tumor cell proliferation, migration, metastasis, and invasion. JP 2018-505144 A discloses an antibody drug targeting CXCL12.

[0004] Special table 2018-505144 publication

[0005] However, antibody drugs and the like are expensive and it is difficult to maintain consistent quality. Therefore, the inventors focused on nucleic acid drugs, which can be mass-produced by organic synthesis and whose consistent quality can be easily controlled.

[0006] A main object of the present disclosure is to provide a technique for suppressing or inhibiting cell proliferation in which CXCL12 expression is involved.

[0007] The double-stranded RNA disclosed herein comprises a first strand and a second strand complementary to the first strand, wherein the first strand comprises any one of the following main sequences determined from a base sequence encoding CXCL12: CCAAGGUCGUGGGUCGUGCU (SEQ ID NO: 1); GUGCUGGUCCUCGUGCUGA (SEQ ID NO: 2); GGGAAGCCCGUCAGCCUGA (SEQ ID NO: 3); CGUCAGCCUGAGCUACAGA (SEQ ID NO: 4); or GUCAGCCUGAGCUACAGAU (SEQ ID NO: 5); and an additional sequence of 2 to 4 bases added to the 3'-end of the main sequence.

[0008] The double-stranded RNA can function as at least small interfering RNA (siRNA). That is, such double-stranded RNA is predicted to induce RNA interference (RNAi). Such an effect is at least due to the suppression of CXCL12 expression, thereby inhibiting the proliferation of cells in which CXCL12 is involved.

[0009] In one embodiment of the double-stranded RNA disclosed herein, the second strand comprises a main sequence complementary to the first strand and an additional sequence of 2 to 4 bases added to the 3'-end of the complementary main sequence. Such double-stranded RNA can function favorably as an siRNA. This allows for more reliable inhibition of cell proliferation involving CXCL12.

[0010] In one embodiment of the double-stranded RNA disclosed herein, at least three of the five bases on the 3'-end of the main sequence are adenine (A) and / or uracil (U), thereby more sufficiently suppressing CXCL12 expression and inhibiting cell proliferation in which CXCL12 is involved.

[0011] In one embodiment of the double-stranded RNA disclosed herein, the base sequence constituting the additional sequence is thymine-thymine (TT), which can improve the stability of the double-stranded RNA.

[0012] The present disclosure provides a composition capable of inhibiting the proliferation of at least one type of cell. One embodiment of the composition disclosed herein comprises a first strand and a second strand complementary to the first strand, wherein the first strand comprises any of the following main sequences determined from a base sequence encoding CXCL12: CCAAGGUCGUGGGUCGUGCU (SEQ ID NO: 1); GUGCUGGUCCUCGUGCUGA (SEQ ID NO: 2); GGGAAGCCCGUCAGCCUGA (SEQ ID NO: 3); CGUCAGCCUGAGCUACAGA (SEQ ID NO: 4); or GUCAGCCUGAGCUACAGAU (SEQ ID NO: 5); and an additional sequence consisting of 2 to 4 bases added to the 3'-end of the main sequence. When such a composition is supplied to cells, it inhibits at least the expression of CXCL12, thereby inhibiting cell proliferation in which CXCL12 is involved.

[0013] In one embodiment of the composition disclosed herein, the cell type whose proliferation is inhibited by the composition is tumor cells, thereby enabling more reliable inhibition of cell proliferation.

[0014] One embodiment of the composition disclosed herein comprises a peptide fragment having cell membrane permeability that allows a foreign substance to be introduced into the cytoplasm by passing through the cell membrane from the outside of the cell, thereby facilitating the introduction of double-stranded RNA into a target cell.

[0015] The present disclosure provides a method for inhibiting the proliferation of at least one type of cell. One aspect of the method disclosed herein comprises the steps of (1) preparing a composition disclosed herein and (2) supplying the composition to a target cell in vitro. This allows for the inhibition of CXCL12-mediated cell proliferation.

[0016] In one embodiment of the method disclosed herein, the biological species of the cells is the same as the biological species containing CXCL12, thereby enabling more reliable inhibition of cell proliferation involving CXCL12.

[0017] 1 is a schematic diagram showing the portion of the human CXCL12 (SDF-1) gene focused on for the preparation of double-stranded RNA of the present disclosure. 2 is a graph showing the growth curves of tumor cells in Examples 1 to 5 and Comparative Examples 1 and 2.

[0018] <Definition of Terms> The technology disclosed herein is described in detail below. Matters other than those specifically mentioned in this specification (e.g., the structure of double-stranded RNA) that are necessary for implementing this technology (e.g., general matters such as methods for synthesizing polynucleotides, cell culture techniques, and constructs mainly composed of peptides or nucleic acids) can be understood as design matters of a person skilled in the art based on conventional technology in the fields of cell engineering, physiology, medicine, pharmacology, organic chemistry, biochemistry, genetic engineering, protein engineering, molecular biology, genetics, etc. The technology disclosed herein can be implemented based on the content disclosed in this specification and common general technical knowledge in the relevant field.

[0019] As used herein, the term "polynucleotide" refers to a polymer in which multiple (two or more) nucleotides are linked by phosphodiester bonds, and is not limited by the number of nucleotides. For example, a "polynucleotide" herein also encompasses those containing both deoxyribonucleotides and nucleotides. Furthermore, as used herein, the term "artificially designed polynucleotide" refers to a polynucleotide whose nucleotide chain (full length) does not exist alone in nature, but is artificially synthesized by chemical synthesis or biosynthesis (i.e., production based on genetic engineering).

[0020] As used herein, the terms "first strand" and "second strand" refer to one being a sense strand (or coding strand or passenger strand) and the other being an antisense strand (or template strand or non-coding strand or guide strand). That is, if the first strand is a sense strand, the second strand refers to an antisense strand. Also, if the second strand is a sense strand, the first strand refers to an antisense strand. The first strand and the second strand may be completely complementary to each other, or may be at least partially complementary. That is, they may be capable of hybridizing at least under physiological conditions.

[0021] In the present specification, unless the notation "5'" and "3'" is used, the left side of a base sequence always indicates the 5'-terminal side and the right side indicates the 3'-terminal side. Furthermore, in the present specification, the term "amino acid residue" includes the N-terminal amino acid and the C-terminal amino acid of a peptide chain, unless otherwise specified. Furthermore, in the amino acid sequences described in the present specification, the left side always indicates the N-terminal side and the right side indicates the C-terminal side.

[0022] As used herein, the term "tumor" is broadly interpreted and refers to tumors in general (typically malignant tumors), including carcinomas and sarcomas, as well as lesions of the blood or hematopoietic tissues (leukemia, lymphoma, etc.). Furthermore, "tumor cells" are synonymous with "cancer cells," and refer to cells that form such tumors, typically cells that have reached the stage of abnormal proliferation independent of surrounding normal tissues (so-called cancerous cells). Therefore, unless otherwise specified, any cell that is classified as a tumor cell (cancer cell) rather than a normal cell is referred to as a tumor cell, regardless of its origin or properties.

[0023] In this specification, when a numerical range is described as "A to B (where A and B are any numerical values)," it means "A or more and B or less," and also encompasses the meanings of "greater than A and less than B," "greater than A and B or less," and "greater than A and less than B."

[0024] <CXCL12> As used herein, "CXCL12" is also referred to as CXCL12 (C-X-C motif chemokine ligand 12) or SDF-1 (stromal cell-derived factor 1). However, the term is intended to encompass all synonyms, including naturally occurring CXCL12 and variants thereof. The biological species from which CXCL12 is derived is not particularly limited, but is preferably the same as the animal species of the target cells to which the double-stranded RNA or composition disclosed herein is to be supplied. For example, when the double-stranded RNA or composition disclosed herein is to be supplied to human-derived cells, it is preferable to use a base sequence based on the base sequence of human CXCL12 as the main sequence. Note that while human-derived CXCL12 will be described as a preferred example here, the present technology can also be applied to CXCL12 derived from biological species, including mammals other than humans and other animal species.

[0025] CXCL12 binds to CXCR4 or CXCR7 and plays an important role in angiogenesis and the like. CXCL12 is also known to be overexpressed in various tumor cells. Specifically, it is known that the expression level of CXCL12 is increased in uterine cancer, head and neck cancer, gastric cancer, liver cancer, pancreatic cancer, breast cancer, leukemia, lymphoma, coronary artery disease, and the like. That is, the double-stranded RNA and composition disclosed herein can act favorably on cells in which the expression level of CXCL12 is increased due to the above-mentioned diseases, and inhibit their proliferation.

[0026] CXCL12 is known to produce several isoforms through alternative splicing. Each isoform has different functions and expression. For example, SDF-1α is the major isoform expressed in most organs. SDF-1β is expressed in the liver, pancreas, spleen, kidney, etc. and is involved in angiogenesis. In contrast to SDF-1β, SDF-1γ is known to be expressed in tissues with little angiogenesis, such as the heart and brain. SDF-1Δ is most expressed in the pancreas and is not detected in the heart, kidney, spleen, or pancreas.

[0027] The nucleotide sequence of CXCL12 can be obtained from international databases. For example, international databases include NCBI (National Center for Biotechnology Information), ENA (European Nucleotide Archive), DDBJ (DNA Data Bank of Japan), UniPlot, Ensembl, etc. Specifically, the nucleotide sequence of human CXCL12 is provided by NCBI under accession numbers NM_199168.4, NM_000609.7, NM_001033886.2, NM_001178134.2, etc. Information on the signal peptide region of CXCL12 can also be obtained from the above-mentioned international databases.

[0028] CXCL12 consists of approximately 89 amino acid residues. CXCL12 is composed of a signal peptide, a receptor-binding region, and a loop region (RFFESH motif). It has also been suggested that lysine and proline at the N-terminus of the mature CXCL12 protein are involved in binding to receptors such as CXCR4. The inventors focused on regions that do not change during alternative splicing of CXCL12, i.e., the signal peptide region and the vicinity of the region exhibiting receptor-binding activity, and determined the double-stranded RNA. Figure 1 shows the regions of interest from the amino acid sequence of human CXCL12 (SDF-1α).

[0029] The amino acid sequence shown in SEQ ID NO: 6 consists of 89 amino acid residues and represents the amino acid sequence of human SDF-1α, while the nucleotide sequence shown in SEQ ID NO: 7 consists of 270 bases and represents the entire nucleotide sequence of human SDF-1α.

[0030] <Double-Stranded RNA> The double-stranded RNA of the present disclosure is double-stranded RNA consisting of a first strand and a second strand complementary to the first strand. Hereinafter, the first strand will be referred to as the sense strand and the second strand as the antisense strand, as will be described in detail. The sense strand is composed of a main sequence consisting of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases added to the 3'-terminal side of the main sequence. Furthermore, the main sequence is determined from the base sequence encoding CXCL12.

[0031] The main sequence is typically composed of a polynucleotide, which is a polymer of ribonucleotides. In other words, the main sequence is composed of RNA. That is, the base sequence of the main sequence is typically represented by the four letters A (adenine), U (uracil), G (guanine), and C (cytosine), or the four letters a, u, g, and c. However, in the attached sequence listing, uracil may be represented by T (thymine).

[0032] The main sequence of the sense strand may be a partial base sequence encoding the signal peptide region and receptor-binding region of CXCL12. This allows the double-stranded RNA to function as an siRNA (small interfering RNA) targeting CXCL12. Furthermore, because the base sequences of the signal peptide region and receptor-binding region of CXCL12 are located upstream of the mRNA, the double-stranded RNA may be able to effectively suppress the expression of CXCL12 when functioning as an siRNA.

[0033] The double-stranded RNA disclosed herein can at least function as an siRNA. That is, such double-stranded RNA is predicted to induce RNA interference (RNAi). RNAi is a gene silencing process in which short double-stranded RNAs such as siRNAs suppress gene expression in a sequence-specific manner. When siRNAs are introduced into cells, they form a complex called RISC (RNA-induced silencing complex) with intracellular proteins. RISC binds to homologous sequences in mRNA transcribed from a target gene (here, the human CXCL12 gene) and specifically cleaves the mRNA, thereby inhibiting translation.

[0034] The main sequence is preferably selected from among the base sequences encoding the signal peptide region and receptor binding region of CXCL12, but one or more bases (e.g., two bases) may be substituted with other bases, deleted, and / or added (inserted) within the scope in which the effects of the present technology are exhibited.

[0035] The proportion of the base sequence encoding CXCL12 in the main sequence is preferably 45% or more, when the entire main sequence is taken as 100%, and may be 60% or more, 75% or more, 90% or more, or 100% or more.

[0036] The 5' end of the main sequence is preferably guanine or cytosine. Because guanine and cytosine have stronger binding strength with complementary strands than adenine and uracil, the stability of the 5' end of the sense strand (i.e., the 3' end of the antisense strand) is increased. In other words, the stability of the 5' end of the antisense strand is relatively reduced. Although the details of the mechanism are unclear, RISC, an RNAi-related protein, tends to preferentially incorporate the strand with the more energetically unstable 5' end between the sense strand and the antisense strand. Therefore, by having guanine or cytosine at the 5' end of the main sequence, the antisense strand can be more easily incorporated into RISC, thereby more effectively inducing RNAi. This allows the double-stranded RNA to function favorably as siRNA.

[0037] Of the five bases on the 3'-end of the main sequence, adenine and / or uracil preferably account for 60% or more (i.e., 3 or more bases), but may also account for 80% or more (i.e., 4 or more bases), or even 100% (i.e., 5 bases). This makes the 5'-end of the antisense strand less stable than the 3'-end. As a result, the antisense strand is more easily incorporated into RISC, allowing for more effective induction of RNAi.

[0038] The GC content of the entire main sequence (the total proportion of G and C in the entire base sequence constituting the main sequence) is not particularly limited, but may be, for example, 20% to 60%, preferably 30% to 50%, or may be 30% to 45%. The GC content is a parameter related to the binding strength between the antisense strand incorporated into RISC and RNA having the main sequence, the ease of cleavage of RNA, etc. With this GC content, the effect of RNAi can be efficiently exerted.

[0039] The main sequence can be selected from 19 to 23 bases from G or C of the gene encoding human C-X-C motif chemokine ligand 12 (CXCL12). For example, the main sequence can be any of the following base sequences: CCAAGGUCGUGGGUCGUGCU (SEQ ID NO: 1); GUGCUGGUCCUCGUGCUGA (SEQ ID NO: 2); GGGAAGCCCGUCAGCCUGA (SEQ ID NO: 3); CGUCAGCCUGAGCUACAGA (SEQ ID NO: 4); GUCAGCCUGAGCUACAGAU (SEQ ID NO: 5). All of the base sequences shown in SEQ ID NOs: 1 to 5 are composed of RNA. The base sequences shown in SEQ ID NOs: 1 to 5 are all specific to the CXCL12 gene, and can avoid the risk of inhibiting translation of mRNA in a host cell having a base sequence similar to the target sequence (the so-called off-target effect).

[0040] The nucleotide sequence shown in SEQ ID NO: 1 is the 9th to 27th nucleotide sequence of the nucleotide sequence encoding human CXCL12 (i.e., the sequence from the initiation codon to the termination codon). The nucleotide sequence shown in SEQ ID NO: 2 is the 22nd to 40th nucleotide sequence of the nucleotide sequence encoding human CXCL12. The nucleotide sequences shown in SEQ ID NOs: 1 and 2 are a portion of the nucleotide sequence of the signal peptide region of human CXCL12. The nucleotide sequence shown in SEQ ID NO: 3 is the 61st to 79th nucleotide sequence of the nucleotide sequence encoding human CXCL12. A portion of the nucleotide sequence shown in SEQ ID NO: 3 (the three nucleotides from the 5' end) is a portion of the nucleotide sequence of the signal peptide region of human CXCL12. The nucleotide sequence shown in SEQ ID NO: 4 is the 69th to 87th nucleotide sequence of the nucleotide sequence encoding human CXCL12. The nucleotide sequence shown in SEQ ID NO: 5 is the 70th to 88th nucleotide sequence of the nucleotide sequence encoding human CXCL12.

[0041] Double-stranded RNA comprising the main sequence shown in SEQ ID NO: 1 or 2 can suppress or inhibit the proliferation of at least one type of cell by supplying it to the cell. Typically, by supplying it to tumor cells (e.g., neuroblastoma), the proliferation of the tumor cells can be suppressed or inhibited. CXCL12 is expressed at low levels in normal cells other than tumor cells, but is overexpressed in tumor cells. Therefore, even if the double-stranded RNA disclosed herein is supplied to normal cells, the amount of CXCL12 present in normal cells is relatively small, and therefore the double-stranded RNA is thought to have little effect.

[0042] <Additional Sequence> The sense strand of the double-stranded RNA disclosed herein may have an additional sequence consisting of 2 to 4 bases added to the 5'-end or 3'-end of the main sequence. Preferably, the additional sequence is added to the 3'-end of the main sequence. The addition of an additional sequence can more effectively induce RNAi.

[0043] The additional sequence is composed of a polynucleotide (dimer, trimer, or tetramer). The polynucleotide constituting the additional sequence may be composed of only ribonucleotides, only deoxynucleotides, or both ribonucleotides and deoxynucleotides. That is, the sense strand and the antisense strand may be entirely RNA, or may be chimeric polynucleotides of RNA and DNA. The additional sequence may also contain modified deoxyribonucleotides, modified ribonucleotides, other known nucleotide analogs, and the like.

[0044] The base sequence constituting the additional sequence is not particularly limited, but preferably contains at least one base of adenine, uracil, or thymine. From the viewpoint of improving the stability of the double-stranded RNA, the base sequence constituting the additional sequence is more preferably TT (thymine-thymine).

[0045] <Sense strand and antisense strand> The sense strand is composed of, for example, a base sequence of 21 to 27 bases, and may be composed of 21 to 25 bases, or 21 to 23 bases. In a preferred example, it is composed of 21 bases, consisting of a 19-base main sequence and a 2-base additional sequence. In such an example, RNAi can be effectively induced.

[0046] The antisense strand has a base sequence complementary to the main sequence of the sense strand. This allows the antisense strand to hybridize with the sense strand, forming a double-stranded structure. The base sequence of the antisense strand may also be partially complementary to the main sequence of the sense strand. That is, one or more bases (e.g., two bases) of the antisense strand may be substituted, deleted, and / or added (inserted) with other bases. As long as the sense strand and the antisense strand can hybridize at least under physiological conditions, they can function as siRNA. The complementary base sequence is typically composed of a ribonucleotide polymer (RNA).

[0047] In the double-stranded RNA of the present disclosure, the sense strand or antisense strand is typically composed of chemically unmodified ribonucleotides (RNA). However, the double-stranded RNA of the present disclosure may also contain DNA, chemically modified DNA or RNA, other known nucleotide analogs, etc., to the extent that the technology of the present disclosure is not significantly impaired. That is, one or more bases (e.g., two bases) in the sense strand or antisense strand may be substituted with chemically modified RNA (or DNA) such as methylated or pseudouridylated. Examples of chemically modified RNA include pseudouridine, N1-methylpseudouridine, 5-methylcytosine, or inosine. For example, one or more bases (e.g., two bases) of uridine in the double-stranded RNA of the present disclosure can be substituted with pseudouridine.

[0048] In the double-stranded RNA of the present disclosure, the antisense strand may be composed of a main sequence complementary to the sense strand and an additional sequence consisting of 2 to 4 bases added to the 5'-end or 3'-end of the complementary main sequence. From the viewpoint of improving the function of the siRNA, the additional sequence may be added to the 3'-end of the complementary base sequence. In a preferred example, when the additional sequence of the sense strand is added to the 3'-end of the main sequence, the additional sequence of the antisense strand is added to the 3'-end of the complementary base sequence. The configuration of the additional sequence in the antisense strand may be the same as the configuration of the additional sequence in the sense strand described above. Typically, the base sequence of the additional sequence in the antisense strand is the same as the additional sequence in the sense strand to which it hybridizes, but it may also be a different base sequence.

[0049] The antisense strand is composed of, for example, a base sequence of 21 to 27 bases, and may be composed of 21 to 25 bases, or 21 to 23 bases. The antisense strand is composed of a base sequence of the same length as the sense strand, and all or part of the base sequence excluding the additional sequence is composed of a base sequence complementary to the main sequence of the sense strand. In a preferred example, the antisense strand is composed of a base sequence of the same length as the sense strand, and all of the base sequence excluding the additional sequence is composed of a base sequence complementary to the main sequence of the sense strand.

[0050] <Method for Producing Double-Stranded RNA> The sense strand and antisense strand constituting the double-stranded RNA disclosed herein can be produced according to a general chemical synthesis method. For example, they can be synthesized using a commercially available DNA / RNA automatic synthesizer. Alternatively, the sense strand and antisense strand may be synthesized in vitro or in vivo based on genetic engineering techniques. The synthesized sense strand and antisense strand are preferably purified, and can be purified, for example, by HPLC or the like.

[0051] The double-stranded RNA disclosed herein can be produced, for example, by annealing (hybridizing) a sense strand and an antisense strand. Annealing can be performed according to conventional methods. For example, annealing can be performed by mixing equal amounts of the sense strand and the antisense strand in a solvent, heating at 90°C for 1 to 5 minutes, and then cooling to 4°C to room temperature. Examples of such solvents that can be used include distilled water, pure water, ultrapure water, and buffers (e.g., HEPES-KOH buffer at pH 7.4, PBS, etc.). To prevent active RNase (RNA degrading enzyme) from being mixed into the solvent, solvents that have been treated with, for example, DEPC or autoclaved are preferably used.

[0052] <Composition> The composition disclosed herein contains the double-stranded RNA described above. In addition to the double-stranded RNA described above, the composition may contain various pharmaceutically acceptable carriers depending on the intended use. Preferred carriers include those commonly used in medicines as diluents, excipients, etc. The carriers vary depending on the intended use and form of the composition. Typical examples include water, physiological buffer solutions, various organic solvents, etc. The carrier may also be an aqueous solution of an appropriate concentration of alcohol (e.g., ethanol), glycerol, a non-drying oil such as olive oil, or liposomes. Examples of secondary components that may be contained in the pharmaceutical composition include various fillers, extenders, binders, humectants, surfactants, dyes, fragrances, etc. The composition may also contain carriers used in conventional drug delivery systems (DDS).

[0053] The form of the composition disclosed herein is not particularly limited. For example, typical composition forms include solutions, suspensions, emulsions, aerosols, foams, granules, powders, tablets, capsules, and ointments. Furthermore, for use in injections, etc., the composition can be made into a lyophilized product or granulated product that is dissolved in physiological saline or an appropriate buffer solution (e.g., PBS) immediately before use to prepare a medicinal solution. Furthermore, the process of preparing various forms of drugs (compositions) using double-stranded RNA (main component) and various carriers (secondary components) can be based on conventionally known methods. Since such formulation methods do not characterize the present disclosure, detailed explanations are omitted. For example, a detailed source of information regarding formulations is "Comprehensive Medicinal Chemistry," edited by Corwin Hansch, published by Pergamon Press (1990).

[0054] The composition disclosed herein inhibits the proliferation of at least one type of cell. The cells whose proliferation is inhibited are cells in which CXCL12 expression is involved, such as tumor cells (e.g., neuroblastoma, lung cancer cells, lymphoma, etc.), mesenchymal stem cells, vascular endothelial progenitor cells, hematopoietic stem cells, primordial germ cells, etc. Among these, the composition disclosed herein preferably inhibits the proliferation of tumor cells because CXCL12 is overexpressed in the composition. In other words, the double-stranded RNA and composition disclosed herein can be preferably used as antitumor agents (anticancer agents) that suppress the proliferation of tumor cells.

[0055] One embodiment of the composition disclosed herein includes, in addition to the double-stranded RNA described above, a peptide fragment (cell-penetrating peptide, CPP) that has cell membrane permeability and can pass through the cell membrane from the outside of a cell to introduce a foreign substance into the cytoplasm. The peptide fragment is directly or indirectly linked to the double-stranded RNA of the present disclosure to construct a construct of the peptide fragment and double-stranded RNA. Generally, double-stranded RNA is negatively charged and therefore cannot pass through the cell membrane. However, for example, by directly or indirectly linking the double-stranded RNA disclosed herein to the N-terminus and / or C-terminus of the peptide fragment, the construct of the peptide fragment and the double-stranded RNA can be introduced into the cytoplasm. The number of amino acid residues in the peptide fragment is not limited as long as cell membrane permeability is not impaired.

[0056] When the peptide fragment and the double-stranded RNA are indirectly bound, for example, a linker is placed between the peptide fragment and the double-stranded RNA. The type of linker is not particularly limited. Typically, it is a peptidic linker, a non-peptidic linker, or the like. Furthermore, the method for binding the peptide fragment and the double-stranded RNA is not particularly limited, and can be carried out according to various conventionally known scientific techniques.

[0057] One embodiment of the composition disclosed herein comprises a peptide fragment and the double-stranded RNA of the present disclosure. However, the double-stranded RNA does not necessarily have to be bound to the N- or C-terminus of the peptide fragment. In such an embodiment, the double-stranded RNA and the peptide fragment may form a complex, for example, through electrical or molecular interaction. Such a complex is more easily introduced into eukaryotic cells, thereby enabling efficient introduction of the double-stranded RNA. Nucleic acids such as double-stranded RNA are typically negatively charged. Therefore, the peptide fragment used preferably has a high proportion of basic amino acids and is positively charged. Furthermore, the proportion of the peptide fragment in this case may be 5 to 100 times, preferably 40 to 60 times, the molar ratio of the double-stranded RNA.

[0058] <Method for producing the composition disclosed herein and use thereof> The present disclosure may provide a method for inhibiting the proliferation of at least one type of cell using the composition disclosed herein. The method disclosed herein includes the steps of preparing the composition disclosed herein and supplying the composition to a target cell.

[0059] In the preparation step, for example, as described above, the composition disclosed herein may be prepared by a conventionally known method.

[0060] In the supplying step, the composition disclosed herein is supplied to at least one type of cell (e.g., tumor cells) in vivo or ex vivo. The animal species of the supplied cells is not particularly limited and may be, for example, mammals, birds, amphibians, reptiles, fish, etc. Preferably, the animal species from which CXCL12, which is the basis of the main sequence of the double-stranded RNA contained in the composition, is derived is the same as the animal species of the target cells. The type of target cells is also not particularly limited, but is preferably tumor cells, more preferably neuroblastoma cells. Note that, although cells other than tumor cells may be present at the destination of the composition, the composition may be supplied only to the target cells (i.e., tumor cells).

[0061] The method of administering the composition may be similar to methods conventionally used in animal treatments and is not particularly limited. The composition can be used in vivo in a manner and dosage appropriate for its form and purpose. For example, as a liquid formulation, it can be administered in a desired amount to the affected area (e.g., malignant tumor tissue, virus-infected tissue, inflammatory tissue, etc.) of a patient or animal (i.e., living body) by intravenous, intralymphatic, intramuscular, subcutaneous, intradermal, or intraperitoneal injection. Alternatively, a solid form such as a tablet, or a gel or aqueous jelly such as an ointment, can be administered directly to a specific tissue (e.g., an affected area such as a tissue or organ containing tumor cells, inflammatory cells, etc.). Alternatively, a solid form such as a tablet can be administered orally. For oral administration, encapsulation or application of a protective (coating) material is preferred to prevent degradation by digestive enzymes in the digestive tract.

[0062] The amount of the composition to be supplied in vivo is not particularly limited. For example, the lower limit of the amount of double-stranded RNA per kg of animal may be 0.01 mg or more, 0.05 mg or more, or 0.1 mg or more. The upper limit of the amount of double-stranded RNA per kg of animal may be, for example, 10 mg or less, 5 mg or less, or 1 mg or less. The amount of the composition to be supplied in vitro is not particularly limited. In the culture medium of the subject to be supplied, such as cells, the lower limit of the double-stranded RNA concentration may be, for example, 1 nM or more, 5 nM or more, or 10 nM or more. The upper limit of the double-stranded RNA concentration in such culture medium may be, for example, 10 μM or less, 5 μM or less, 2 μM or less, 1 μM or less, or 100 nM or less.

[0063] The compositions disclosed herein can be delivered to the interior of target cells by known transfection methods. Examples include chemical gene transfer methods using cationic molecules (e.g., commercially available transfection reagents), physical transfer methods such as microinjection and electroporation, and biological gene transfer methods using viruses. Alternatively, as described above, the compositions may be delivered to the interior of cells using cell membrane-permeable peptide fragments.

[0064] Below, several test examples relating to the technology disclosed herein will be described, but it is not intended that the technology disclosed herein be limited to those shown in these test examples.

[0065] <Preparation of double-stranded RNA> Polynucleotides having the base sequences shown in SEQ ID NOS: 9 to 20 were artificially synthesized. The base sequences of each polynucleotide are shown in Table 1. In each polynucleotide, the "TT" (additional sequence) at the 3' end is DNA, and the remaining sequence (main sequence) is composed of RNA. The obtained polynucleotides were annealed with a sense strand and an antisense strand having complementary sequences to prepare the double-stranded RNAs used in Examples 1 to 5 and Comparative Example 1 shown in Table 1. Each of the double-stranded RNAs shown in Examples 1 to 5 and Comparative Example 1 was dissolved in PBS to give an RNA concentration of 2 mM, preparing an RNA solution.

[0066]

[0067] As shown in Table 1, the sense strand of the double-stranded RNA of Example 1 is composed of a main sequence consisting of SEQ ID NO: 1 (a part of the base sequence encoding the CXCL12 signal peptide) and an additional sequence consisting of TT added to the 3'-end of the main sequence. Similarly, the sense strand of the double-stranded RNA of Examples 2 to 5 is composed of a main sequence consisting of SEQ ID NOs: 2 to 5 (a part of the base sequence encoding CXCL12) and an additional sequence consisting of TT added to the 3'-end of the main sequence. The sense strand of the double-stranded RNA of Comparative Example 1 is composed of a main sequence consisting of SEQ ID NO: 8 (a randomly artificially generated sequence) and an additional sequence consisting of TT added to the 3'-end of the main sequence. The antisense strand of each example is composed of a sequence complementary to the main sequence and an additional sequence consisting of TT added to the 3'-end of the sequence.

[0068] <Cell proliferation test> Human neuroblastoma cells, the SK-N-SH strain, were used as tumor cells. SK-N-SH cells were pre-cultured in a culture medium containing 10% FBS (fetal bovine serum) + E-MEM (Fujifilm Wako Pure Chemical Industries, Ltd., Cat. No. 051-07615) + 1% MEM non-essential amino acid solution (Fujifilm Wako Pure Chemical Industries, Ltd., Cat. No. 139-15651). Note that 0.5% penicillin-streptomycin (Fujifilm Wako Pure Chemical Industries, Ltd., Cat. No. 168-23191) was added to the culture medium only during pre-culture, but was not added during the following culture and evaluation.

[0069] On day 1, the SK-N-SH cells that had adhered to the culture plate were washed with PBS, and then a 0.25% trypsin / EDTA solution was added and incubated at 37°C for 2 minutes. After this incubation, the above-mentioned culture medium was added to inactivate the trypsin. The cells were then precipitated by centrifugation at 150 x g for 5 minutes. After removing the supernatant resulting from centrifugation, the above-mentioned culture medium was added to the precipitate (cell pellet), and approximately 5 x 10 ４ A cell suspension of 5 × 10 cells / mL was prepared. One commercially available 96-well plate was prepared, and the cell suspension was added to each well at a concentration of 5 × 10 ３ The cells were seeded at 100 μL per well and incubated at 37°C, 5% CO ２ and incubated overnight under

[0070] (Example 1) On the second day, 3 μL of an RNA solution adjusted to 2 mM with PBS was mixed with 75 μL of Opti-MEM™ to prepare Solution A. Furthermore, 4.5 μL of Lipofectamine™ RNAiMAX was mixed with 75 μL of Opti-MEM™ to prepare Solution B. Next, equal amounts of Solution A and Solution B were mixed to prepare Solution C, which was then incubated at room temperature for 5 minutes. The prepared Solution C was added to wells in which SK-N-SH cells had been cultured, at 11 μL / well (final concentration of double-stranded RNA: 4 μM). The mixture was then incubated at 37°C, 5% CO ２ The mixture was incubated under reduced pressure for 3 days.

[0071] Cell proliferation was evaluated using Cell Counting Kit-8 (CCK-8, Dojin Kagaku Kenkyusho). On day 5 (day 3 after siRNA addition), the 96-well plate in which SK-N-SH cells had been cultured was removed, 10 μL of CCK-8 was added to each well, and the cells were incubated at 37°C, 5% CO ２ The plates were incubated for 1.5 hours under reduced pressure. The absorbance at 450 nm of each well was measured. The absorbance was calculated as the average value of three wells. In addition, a blank well containing only the culture medium and CCK-8 reagent was set up. The absorbance in Example 1 was calculated by subtracting the absorbance of the blank from the absorbance in Example 1.

[0072] (Examples 2 to 5, Comparative Example 1) Example 2 was the same as Example 1, except that the double-stranded RNA in Example 1 was changed to the double-stranded RNA of Example 2 shown in Table 1. Comparative Example 1 was the same as Example 1, except that the double-stranded RNA in Example 1 was changed to the double-stranded RNA of Comparative Example 1 shown in Table 1.

[0073] Comparative Example 2 Comparative Example 2 was the same as Example 1, except that a PBS solution was used instead of the RNA solution in Example 1. That is, in Comparative Example 2, no double-stranded RNA was introduced.

[0074] Untreated wells were prepared in the same manner as in Example 1, except that the RNA solution and Lipofectamine™ RNAiMAX were not added. The cell viability in each test example is expressed as a percentage, with the measured value for the untreated well set at 100%, and is shown in Figure 2.

[0075] As shown in Figure 2, Examples 1 to 5 showed a greater decrease in cell viability than Comparative Examples 1 and 2. Furthermore, Example 1 (SEQ ID NO: 1), determined from the signal peptide region of CXCL12, showed the lowest decrease in cell viability. From these test results, it is believed that the double-stranded RNAs of Examples 1 to 5 have the function of inhibiting cell proliferation. Furthermore, Comparative Example 1, in which SEQ ID NO: 8 was used as the main sequence, did not affect cell proliferation. Therefore, these sequences of SEQ ID NOs: 1 to 5 are specific to the CXCL12 gene. Therefore, the double-stranded RNAs of Examples 1 to 5 can avoid off-target effects, do not affect other organs, and are therefore expected to be useful in clinical applications.

[0076] While specific examples of the technology disclosed herein have been described in detail above, these are merely examples and do not limit the scope of the claims. The technology described in the claims includes various modifications and alterations of the specific examples exemplified above.

[0077] In the technology disclosed herein, each component and each process mentioned herein may be omitted or combined as appropriate, unless a particular problem arises. This specification also includes the disclosures described in the following sections.

[0078] Item 1: A double-stranded RNA consisting of a first strand and a second strand complementary to the first strand, wherein the first strand is composed of any of the following main sequences determined from a base sequence encoding CXCL12: CCAAGGUCGUGGGUCGUGCU (SEQ ID NO: 1); GUGCUGGUCCUCGUGCUGA (SEQ ID NO: 2); GGGAAGCCCGUCAGCCUGA (SEQ ID NO: 3); CGUCAGCCUGAGCUACAGA (SEQ ID NO: 4); or GUCAGCCUGAGCUACAGAU (SEQ ID NO: 5); and an additional sequence consisting of 2 to 4 bases added to the 3'-end of the main sequence.

[0079] Item 2: The double-stranded RNA according to Item 1, wherein the second strand is composed of a main sequence complementary to the first strand and an additional sequence consisting of 2 to 4 bases added to the 3'-end of the complementary main sequence.

[0080] Item 3: The double-stranded RNA according to Item 1 or 2, wherein at least three of the five bases on the 3'-terminal side of the main sequence are adenine (A) and / or uracil (U).

[0081] Item 4: The double-stranded RNA according to any one of Items 1 to 3, wherein the base sequence constituting the additional sequence is thymine-thymine (TT).

[0082] Item 5: A composition that inhibits the proliferation of at least one type of cell, comprising the double-stranded RNA according to any one of Items 1 to 4.

[0083] Item 6: The composition of Item 5, wherein the cells are tumor cells.

[0084] Item 7: The composition according to Item 5 or 6, wherein the composition comprises a peptide fragment having cell membrane permeability that can pass through the cell membrane from the outside of the cell and introduce a foreign substance into the cytoplasm.

[0085] Item 8: A method for suppressing the proliferation of at least one type of cell, comprising: preparing the composition according to any one of Items 5 to 7; and supplying the composition to the cell in vitro or in vivo.

[0086] Item 9: The method according to Item 8, wherein the animal species of the cells is the same as that of the CXCL12.

[0087] As described above, the double-stranded RNA disclosed herein can inhibit (or suppress) cell proliferation, and therefore, by using the double-stranded RNA, a composition (e.g., an anti-tumor agent) that inhibits the proliferation of at least one type of cell (e.g., tumor cell) can be provided.

Claims

1. A double-stranded RNA consisting of a first strand and a second strand complementary to the first strand, wherein the first strand is composed of any one of the following main sequences determined from a base sequence encoding CXCL12: CCAAGGUCGUGGUCGUGCU (SEQ ID NO: 1); GUGCUGGUCCUCGUGCUGA (SEQ ID NO: 2); GGGAAGCCCGUCAGCCUGA (SEQ ID NO: 3); CGUCAGCCUGAGCUACAGA (SEQ ID NO: 4); GUCAGCCUGAGCUACAGAU (SEQ ID NO: 5); and an additional sequence consisting of 2 to 4 bases added to the 3' end of the main sequence.

2. The double-stranded RNA according to claim 1, wherein the second strand is composed of a main sequence complementary to the first strand and an additional sequence consisting of 2 to 4 bases added to the 3'-end side of the complementary main sequence.

3. The double-stranded RNA according to claim 1, wherein at least three of the five bases on the 3'-terminal side of the main sequence are adenine (A) and / or uracil (U).

4. The double-stranded RNA according to claim 1, wherein the base sequence constituting the additional sequence is thymine-thymine (TT).

5. A composition for inhibiting the proliferation of at least one type of cell, comprising the double-stranded RNA according to any one of claims 1 to 4.

6. The composition of claim 5, wherein the cell is a tumor cell.

7. The composition according to claim 5, comprising a peptide fragment having cell membrane permeability capable of passing through the cell membrane from the outside of the cell and introducing a foreign substance into the cytoplasm.

8. A method for inhibiting the proliferation of at least one type of cell, comprising the steps of: preparing a composition according to claim 5; and delivering said composition to said cell in vitro.

9. The method according to claim 8, wherein the biological species of the cells is the same as the biological species in which the CXCL12 is contained.

Images