Rabies vaccine immunogen composition

Abstract

An anti-rabies virus immunogen composition capable of simultaneously inducing a humoral immune response and a cellular immune response and a use thereof. The anti-rabies virus immunogen composition involves a dual-immunogen combination, comprising a rabies virus glycoprotein G as an immunogen for activating neutralizing antibodies and a polymerase large protein L as a T-cell immunogen. The rabies virus glycoprotein is derived from the full length of a glycoprotein or extracellular region amino acids thereof or an antigenic fragment thereof, and the T-cell immunogen is derived from a recombinant sequence of a conserved region of a polymerase large protein. Optionally, the two immunogens are loaded onto the same type of carrier or different types of carriers. The vaccine is safe and can simultaneously activate anti-rabies virus T cells and an antibody response, thereby realizing combined protection for preventing and treating rabies virus infection.

Description

Rabies vaccine immunogen composition Technical Field

[0001] The present invention belongs to the field of biomedicine and relates to genetic engineering vaccine technology, and specifically to a dual-antigen mRNA rabies vaccine that can simultaneously induce humoral immune responses and cellular immune responses, as well as its construction and application in rabies prevention and treatment. Background Art

[0002] Rabies is a zoonotic disease with a near 100% mortality rate after the onset of clinical symptoms, making it one of the most lethal infectious diseases known. Rabies virus replicates rapidly and can paralyze the host's central nervous system within days, but it can be prevented through early and timely pre- or post-exposure vaccination. Therefore, vaccination must immediately elicit a strong immune response. This includes both a humoral immune response to generate sufficient rabies virus-neutralizing antibodies to neutralize the virus before it reaches the central nervous system, and a cellular immune response to eliminate virus-infected cells. While rabies virus clearance relies on antibodies, T cell-driven mechanisms contribute to the control of viral replication, particularly through the production of IFN-γ by infiltrating T cells. Within the central nervous system, both an innate immune response to suppress viral replication and active, infiltrating rabies virus-specific T and B cells to completely eliminate the virus are required. Previous reports have demonstrated that rabies vaccination, whether pre- or post-exposure, stimulates a cellular immune response. Among them, cytokines IFN-γ, IL-2, and TNF-α secreted by Th1 cells are very important in antiviral immunity. They can promote the interaction between CD8+ T cells and dendritic cells and help B cells produce high-affinity neutralizing antibodies. Cytokines secreted by Th2 cells (such as IL-4, IL-5, and IL-13) also play a key role in B cell-mediated humoral immune responses.

[0003] In recent years, with the maturity of mRNA vaccine technology, rabies mRNA vaccines developed in many countries have entered preclinical or clinical trials. For example, CV7202, developed by Germany's CureVac AG, has entered Phase I clinical trials; LVRNA001, developed by Zhuhai Livanda Biotechnology Co., Ltd., has submitted its clinical trial application; and Everest Medicines' rabies mRNA vaccine has completed proof of concept. These vaccines tend to use the rabies virus glycoprotein (RABV-G) as an immunogen to induce neutralizing antibodies and exert a protective immune response.

[0004] Summary of the Invention

[0005] Currently, no vaccine manufacturer has explored the targeted induction of T cell immune responses, especially the cytotoxic T lymphocyte-mediated clearance of virus-infected cells.

[0006] Driven by the research interest of enhancing immune protection through dual immunization, our research group is committed to developing a rabies vaccine that can both quickly induce humoral immune responses and stimulate strong cellular immune responses. This vaccine can quickly inhibit viral replication at the site of infection to prevent and control the spread of rabies virus, especially when administered in the early stages of vaccination or after exposure, it can induce the body's response more quickly. Therefore, under the premise of ensuring effectiveness, the design of a potent vaccine that can simultaneously target humoral immunity and cellular responses must meet the requirements of effectively processing and presenting the epitopes of B cell immunogens and T cell immunogens, so as to induce the production of neutralizing antibodies to the greatest extent and activate T cells to exert immune protection. If the B cell immunogen and T cell immunogen are simply fused and expressed, it is difficult to achieve their maximum effect. Therefore, it is necessary to meet the requirement that when inducing a specific cellular immune response, there is no significant effect on the humoral immune response that can induce the production of neutralizing antibodies.

[0007] In short, the technical problem addressed by the present invention is to provide a dual-immunogen composition that can rapidly induce both humoral and cellular immune responses. The B-cell immunogen that induces the humoral immune response is derived from the rabies virus glycoprotein (G), while the T-cell immunogen that stimulates the cellular immune response is derived from the polymerase large protein (L). Both are loaded onto the same carrier, allowing the two immunogens to respond without interfering with each other, thereby achieving effective prevention and / or treatment of rabies.

[0008] To solve this technical problem, the present invention provides a dual immunogen composition that can simply, conveniently and simultaneously efficiently express two exogenous genes. When used in vaccine preparation, the vaccine has good immunogenicity. After immunizing the body, it can not only quickly form strong immune protection, but also induce a strong cellular immune response. In addition, the production cost is low and the preparation technology is simple to operate. It is suitable for rapid, efficient and large-scale preparation of various vaccines and has huge development potential.

[0009] Specifically, the present invention includes the following technical solutions:

[0010] Provided is an immunogen composition, which contains: rabies virus structural protein glycoprotein (G) as an immunogen for activating neutralizing antibodies; and polymerase large protein L as a T cell immunogen for inducing cellular immune response.

[0011] The above-mentioned immunogens are derived from widely prevalent rabies virus strains including different genotypes, including but not limited to the Pitman-Moore (PM) strain, Pasteur (PV) strain, CTN strain, aG strain, Flury-LEP strain, Evelyn-Rokitnicki-Abelseth (ERA) strain, Street-Alabama-Duffering (SAD) strain, and related viruses KHUV (Khujand lyssavirus), BBLV (Bokelohbat lyssavirus), ARAV (Aravan lyssavirus), EBLV-1 (European bat lyssavirus), EBLV-2 (European bat2lyssavirus), IRKV (Irkutlyssavirus), LBV (Lagosbatlyssavirus), SHIBV (Shimonibatlyssavirus), MOKV (Mokolalyssavirus), WCBV (WestCaucasianbatlyssavirus) rus), IKOV (Ikomalyssavirus), DUVV (Duvenhagelyssavirus), ABLV (Australianbatlyssavirus), GBLV (Gannoruwabatlyssavirus) or LLEBV (Lleidabatlyssavirus) and other strains.

[0012] The method for obtaining the above-mentioned T cell antigen sequence comprises the following steps:

[0013] i. Sequence similarity comparison of amino acid sequences of various L proteins (Large Protein) of rabies virus;

[0014] ii. Perform T cell epitope prediction on the obtained similar sequence information to obtain information on conserved regions with immunogenicity. This includes using online tools to predict peptides in the L protein that may strongly bind to HLA supertype molecules, i.e., peptides that may be presented;

[0015] iii. Designing and preparing different immunogen sequences or polypeptide sequences based on the conserved region information, including mapping these polypeptides to the corresponding target L protein, further comprehensively analyzing the enriched regions between different vaccine strains, and truncating the enriched regions to form the L protein recombinant immunogen amino acid sequence L protein, as shown in SEQ ID NO: 5.

[0016] iv. combining the resulting immunogenic sequence or coding sequence or with other sequences that are co-expressed (eg, fused or expressed separately), such as antigenic sequences that can generate a humoral immune response.

[0017] Through the above research, the technical solution provided by the present invention includes the following contents:

[0018] A rabies vaccine immunogen composition, which is a protein immunogen composition or a DNA immunogen composition, wherein the DNA is a gene encoding the protein, wherein:

[0019] The protein immunogen composition comprises:

[0020] A. rabies virus structural protein glycoprotein G, referred to as "rabies virus G protein", as a humoral immunogen for activating neutralizing antibodies (referred to as "antibody immunogen"), for inducing a humoral immune response, and

[0021] B. polymerase large protein L as a T cell immunogen for inducing a cellular immune response (referred to as "cellular immunogen"), used to induce a cellular immune response;

[0022] The DNA immunogen composition comprises:

[0023] a. a nucleic acid molecule encoding the structural protein glycoprotein G of rabies virus of item A above, and

[0024] b. Nucleic acid molecule b encoding the polymerase large protein L described in item B above.

[0025] In the above-mentioned rabies vaccine immunogen composition, the rabies virus structural protein glycoprotein G is the full-length amino acid sequence of glycoprotein G, the amino acid sequence of its extracellular region or an antigenic fragment thereof,

[0026] The glycoprotein G full-length amino acid sequence is selected from the group consisting of:

[0027] (1) a polypeptide whose amino acid sequence is shown in SEQ ID NO: 1; and

[0028] (2) A polypeptide having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology to the amino acid sequence of SEQ ID NO: 1, and having the same function as SEQ ID NO: 1, wherein the function is to induce a humoral immune response and produce neutralizing antibodies;

[0029] The amino acid sequence of the glycoprotein G extracellular region is selected from the group consisting of:

[0030] (3) a polypeptide whose amino acid sequence is shown in SEQ ID NO: 2; and

[0031] (4) a polypeptide having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology to the amino acid sequence of SEQ ID NO: 2, and having the same function as SEQ ID NO: 1, wherein the function is to induce a humoral immune response and produce neutralizing antibodies; and

[0032] The polymerase large protein L is selected from the group consisting of:

[0033] (5) a polypeptide whose amino acid sequence is shown in SEQ ID NO: 5; and

[0034] (6) A polypeptide having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology to the amino acid sequence of SEQ ID NO: 5, and having the same function as SEQ ID NO: 5, wherein the function is the function of inducing a cellular immune response.

[0035] Preferably, when the nucleic acid molecule a encodes the polypeptide SEQ ID NO: 1, it can be selected from the following group:

[0036] (7) the nucleotide sequence shown in SEQ ID NO: 3,

[0037] (8) a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology to SEQ ID NO: 3;

[0038] When the nucleic acid molecule a encodes the polypeptide SEQ ID NO: 2, it can be selected from the following group:

[0039] (9) the nucleotide sequence shown in SEQ ID NO: 4,

[0040] (10) a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology to SEQ ID NO: 4;

[0041] When the nucleic acid molecule b encodes the polypeptide SEQ ID NO: 5, it can be selected from the following group:

[0042] (11) The nucleotide sequence shown in SEQ ID NO: 6, which is a sequence optimized for codons and RNA secondary structure,

[0043] (12) A nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology to SEQ ID NO: 6.

[0044] The second aspect of the present invention is to provide the use of the above-mentioned rabies vaccine immunogen composition in the preparation of rabies vaccine.

[0045] Preferably, the rabies vaccine can induce both humoral immune response and cellular immune response.

[0046] As a preferred application embodiment, the above-mentioned nucleic acid molecule a and nucleic acid molecule b can be inserted into an expression vector to constitute a vector vaccine, and the vector used can be selected from the following groups: nucleic acid vaccine vectors, i.e., mRNA vectors and DNA plasmid vectors; recombinant virus vectors; recombinant bacterial vectors.

[0047] Furthermore, the above-mentioned mRNA vector can be selected from linear, circular and self-replicating vectors; the recombinant viral vector is selected from poxvirus, adenovirus, adeno-associated virus, herpes simplex virus, measles virus, reovirus, rhabdovirus, forest encephalitis virus, influenza virus, respiratory syncytial virus, poliovirus and other vectors.

[0048] In one embodiment, the nucleic acid molecule a and the nucleic acid molecule b can be inserted into the same type of vector or different types of vectors. When inserted into multiple vectors of the same type, a multivalent vaccine is formed; when inserted into different vectors, a combination vaccine is formed. Those skilled in the art will readily appreciate that both multivalent and combination vaccines can achieve combined protection by simultaneously activating anti-rabies virus T cell and antibody responses through sequential or combined immunization.

[0049] The above-mentioned recombinant adenovirus vector can be selected from the following groups: adenovirus 5, adenovirus 11, adenovirus 26, adenovirus 35, adenovirus 63, adenovirus 68, etc.

[0050] The recombinant poxvirus vector can be selected from the following groups: Tiantan strain, North American vaccine strain, Wyeth-derived strain, Lister strain, Ankara-derived strain, Copenhagen strain and New York strain, etc., preferably Tiantan strain.

[0051] In some aspects of the present invention, the nucleic acid molecule a (antibody immunogen) and the nucleic acid molecule b (T cell immunogen) can be inserted into an mRNA expression vector, including a 5'UTR, a 3'UTR, a polyadenylic acid sequence, and a coding sequence, wherein the coding sequence contains different signal peptide sequences, different degradation domains, internal ribosome entry site sequences from different sources (non-coding region mRNA sequences in viruses and mRNA sequences in cells), and an antigen coding region (including a first protein domain and a second protein domain).

[0052] In some embodiments, the expression vector further includes basic elements required for transcription from the 5′ end to the 3′ end, specifically a T7 promoter region, a 5′ non-translated region, a coding sequence, a 3′ non-coding region and a polyadenylic acid tail (poly A) sequence. All four basic elements must be included; the UTR sequence, the 3'-UTR sequence, and the polyadenylic acid tail (poly A) sequence are sequences in the optimal combination described in the Chinese patent document with application number 202211129466.2.

[0053] In some embodiments, the coding sequence comprises a signal peptide sequence, an antigen coding region, and different degradation domains.

[0054] The signal peptide sequence includes a signal peptide sequence of a transmembrane antigen and a signal peptide sequence of a secretory antigen. The secretory signal peptide sequence can be a signal peptide sequence of mouse IL-2, a light chain signal peptide sequence of an IgG antibody, a heavy chain signal peptide sequence of an IgG antibody, a human erythropoietin signal peptide sequence, a bovine prolactin signal peptide sequence, a tissue plasminogen signal peptide sequence, or an influenza hemagglutinin signal peptide sequence. According to a specific embodiment of the present invention, the signal peptide sequence is preferably derived from a signal peptide sequence of a transmembrane antigen.

[0055] The antigen coding region is a pathogen antigen coding sequence that includes, from the N-terminus to the C-terminus, a first protein domain, an internal ribosome entry site sequence, and a second protein domain. The first protein domain and the second protein domain can be antigens of various infectious pathogens. These pathogen antigens include antigens that can specifically induce humoral immune responses and T cell antigens that activate cellular immune responses mediated by cytotoxic T lymphocytes.

[0056] In the antigen coding region, different protein tags are added to the pathogen antigen coding sequence, which can be at least one of a Myc tag, an HA tag, a Flag tag, or a His tag. According to a specific embodiment of the present invention, a Flag tag sequence is preferred.

[0057] Furthermore, if the first protein domain is an antigen sequence that specifically induces a humoral immune response, the second protein domain is a T cell antigen sequence that can activate a cellular immune response; if the first protein domain is a T cell antigen sequence that can activate a cellular immune response, the second protein domain is an antigen sequence that specifically induces a humoral immune response. According to a specific embodiment of the present invention, it is further preferred that the first protein domain is an antigen sequence that induces a humoral immune response, and the second protein domain is a T cell antigen sequence that activates a cellular immune response.

[0058] The antigen coding region sequence is bicistronic or polycistronic, and the coding sequence in the bicistronic or polycistronic mRNA encodes antigen sequences of various infectious disease pathogens as defined in the present invention, or fragments or variants thereof.

[0059] Furthermore, the bicistronic or polycistronic mRNA is separated by at least one IRES (internal ribosome entry site) sequence, thereby recruiting ribosomes to achieve independent translation of pathogen antigen sequences or fragments or variants thereof.

[0060] The internal ribosome entry site sequence (IRES) includes non-coding region mRNA sequences from viruses and mRNA sequences in cells.

[0061] Furthermore, the IRES sequence in the virus is preferably derived from a non-coding region mRNA sequence in a virus, and the virus includes the following different types, such as DNA viruses and RNA viruses. Specifically, DNA viruses can be herpes viruses (e.g., Kaposi's sarcoma herpesvirus) and polyoma viruses (e.g., simian vacuolating virus); RNA viruses can be picornaviruses (e.g., poliovirus, coxsackievirus, enterovirus, hepatitis A virus, foot-and-mouth disease virus, encephalomyocarditis virus, classical swine fever virus), hepatitis C virus, classical swine fever virus, retroviruses (e.g., mouse leukemia virus, human T-cell leukemia virus type 1, Rous sarcoma virus, simian immunodeficiency virus, human immunodeficiency virus). According to a specific embodiment of the present invention, a sequence derived from encephalomyocarditis virus is further preferred, as shown in SEQ ID NO: 7.

[0062] The different degradation domains are selected from Salmonella virulence factor SopE, estrogen receptor domain mutant 2 (ERmut2), FKB protein (FKBP, FK506 binding protein) domain, or dihydrofolate reductase (DHFR). According to a specific embodiment of the present invention, it is further preferably derived from estrogen receptor (ER) domain mutant 2, as shown in SEQ ID NO: 8; and even more preferably derived from dihydrofolate reductase (DHFR), as shown in SEQ ID NO: 9.

[0063] Furthermore, the degradation domain is located at: the N-terminus of the T cell antigen sequence (or the first protein domain or the second protein domain) that can activate a cellular immune response; or the C-terminus of the T cell antigen sequence that can activate a cellular immune response. According to a specific embodiment of the present invention, it is further preferably located at the C-terminus of the T cell antigen sequence that can activate a cellular immune response.

[0064] In some embodiments, the first protein domain is the antigenic sequence RABV-G that induces a humoral immune response, which is highly conserved among various rabies viruses. For example, RABV-G can be derived from the Pitman-Moore (PM) strain, whose amino acid sequence is shown in SEQ ID NO: 1.

[0065] In some aspects of the present invention, the second protein domain is a T cell antigen sequence that induces a cellular immune response. Specifically, early viral expressed proteins (such as various proteins related to the viral replication cycle) are selected as the main immunogens, and sequences of various strains of different pathogens are collected, shared sequences are extracted from them, and T cell epitope prediction is performed, and conserved regions with high immunogenicity are selected alone or in combination.

[0066] Furthermore, the cytotoxic T lymphocyte epitope is a plurality of different co-sequences, which are mainly connected in series, and flexible linkers or rigid linkers can be added. Cytotoxic T lymphocyte epitopes can be predicted by bioinformatics methods such as artificial neural networks (ANNs). Prediction software is known in the art and includes but is not limited to tools provided by http: / / www.bio.med.ucm.es / episopt.html, http: / / www.ddg-pharmfac.net / mhcpred / MHCPred, and http: / / www.syfpeithi.de / software.

[0067] The third aspect of the present invention provides a rabies vaccine that can induce both humoral immune response and cellular immune response, which is obtained through the above-mentioned application method and is a nucleic acid vaccine, an adenovirus vector vaccine or an inactivated cell vaccine.

[0068] In a preferred embodiment, the above-mentioned rabies vaccine is an mRNA vaccine, which is formed by inserting the above-mentioned nucleic acid molecule a and nucleic acid molecule b into an mRNA vector. In the mRNA expression vector after insertion, from 5' to 3' end are the T7 promoter region, the 5' non-translated region, the coding sequence, the 3' non-coding region, the polyadenylic acid tail (polyA) sequence and the single enzyme cleavage site, wherein the coding sequence is the immunogen coding region, and from the N-terminal to the C-terminal direction contains a first protein sequence, an internal ribosome entry site sequence, a second protein sequence and a degradation domain, wherein the first protein sequence is one of the rabies virus structural protein glycoprotein G coding sequence and the polymerase large protein L coding sequence, and the second protein sequence is both of the rabies virus structural protein glycoprotein G coding sequence and the polymerase large protein L coding sequence.

[0069] The first protein sequence in the above-mentioned immunogen coding region is an antigen sequence that induces neutralizing antibodies to produce humoral immune response, namely, the rabies virus structural protein glycoprotein G coding sequence (referred to as the first protein domain G protein), and the second protein sequence is a T cell antigen sequence that activates cellular immune response, namely, the polymerase large protein L coding sequence (referred to as the second protein domain recombinant L protein).

[0070] The internal ribosome entry site sequence (IRES) may be a nucleotide sequence such as SEQ ID NO: 7, which is derived from encephalomyocarditis virus;

[0071] The above-mentioned degradation domain can be selected from the estrogen receptor (ER) domain, the FKB protein (FKBP) domain or the dihydrofolate reductase (DHFR). Preferably, the degradation domain is a dihydrofolate reductase (DHFR) having a nucleotide sequence as shown in SEQ ID NO: 9, or a nucleotide sequence having at least 90%, 95%, 97%, 98%, 99% or 100% homology with SEQ ID NO: 9.

[0072] Preferably, the above-mentioned rabies vaccine is a dual-antigen mRNA rabies vaccine, and the sequences contained in the mRNA expression vector from the 5' end to the 3' end are T7 promoter, UTR sequence, first protein domain G protein, IRES sequence, second protein domain recombinant L protein, degradation domain, 3'-UTR sequence, polyadenylation tail sequence and single enzyme cutting site, etc.

[0073] In some aspects of the present invention, the use of the immunogenic polypeptide sequence of the present invention, namely the T cell antigen sequence RABV-LT, in preventing rabies virus infection is also provided.

[0074] In some embodiments, the T cell antigen sequence can be used alone for rabies virus infection, and can be further used in T cell vaccines or drugs against rabies virus infection. In some embodiments, the application comprises the full sequence of the T cell immunogenic peptide of the present invention, or a partial sequence thereof, or a conjugate thereof.

[0075] In some aspects of the present invention, some or all of the uracil and / or cytosine nucleosides are replaced when the RABV-G, RABV-LT and dual antigen RABV-G-LT are transcribed to prepare mRNA.

[0076] Furthermore, the above rabies vaccine is a dual antigen mRNA rabies vaccine, and is a chemically modified mRNA vaccine, wherein the modification comprises replacing at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% of the uracil in the mRNA vaccine backbone with the following substances, and the substances replacing uracil are selected from the following compounds: uridine, N1-methyl pseudouridine, N1-ethyl pseudouridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine uridine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-T-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine or 5-methoxyuridine and 2′-O-methyluridine.

[0077] It's well known to those skilled in the art that simple chemical modifications to the mRNA backbone are crucial to the success of mRNA vaccines. These modifications can help mRNA vaccines induce a potent immune response without causing significant side effects and also improve mRNA stability. For example, the COVID-19 mRNA vaccines developed by Moderna and Pfizer / BioNTech utilize chemically modified mRNA. Numerous studies have demonstrated that modified mRNA is the best-performing technology for preventive vaccines.

[0078] The above-mentioned substance is preferably pseudouridine, N1-methylpseudouridine or N1-ethylpseudouridine, and more preferably N1-methylpseudouridine.

[0079] Preferably, the above-mentioned rabies vaccine comprises, in addition to the immunogen body, one or more pharmaceutically or veterinarily acceptable carriers or excipients, wherein the carriers or excipients are preferably carriers or excipients that make the rabies vaccine suitable for oral, intradermal, subcutaneous, intramuscular or intranasal administration.

[0080] In some aspects of the present invention, a formulation is also provided, comprising an mRNA vaccine prepared using a sequence that induces a humoral immune response, such as RABV-G; an mRNA vaccine prepared using a T cell antigen sequence that induces a cellular immune response, such as RABV-LT; or an mRNA vaccine prepared using a dual antigen sequence, such as RABV-G-LT, that induces both a humoral immune response and a cellular immune response. The formulation also comprises a vector for delivering the mRNA vaccine for prophylactic and / or therapeutic purposes. The vector comprises a cationic liposome, polymer, protein, or lipid nanoparticle, preferably a cationic liposome or a cationic lipid nanoparticle, and more preferably a cationic lipid nanoparticle. The formulation can be prepared by mixing the cationic lipid nanoparticle with the mRNA vaccine.

[0081] It is easy to understand that the above-mentioned rabies vaccine is used to vaccinate humans or animals to prevent rabies virus infection; or for therapeutic vaccination after humans are bitten or scratched by animals to prevent the onset of rabies, especially in combination with anti-rabies virus serum or antibodies.

[0082] The present invention provides an mRNA vector that can simultaneously and efficiently express multiple different types of antigen molecules. The sequence encoded by the mRNA vector is a bicistronic sequence, which is loaded with internal ribosome entry site sequences from different sources and can simultaneously target humoral responses and cellular responses. Different degradation domains are also added to the antigen coding region, so that the T cell immunogen targeting the cellular response is quickly transferred to the proteasome for degradation after translation and expression, thereby better presenting T cell epitopes and activating cytotoxic T lymphocytes to exert immune protection. Moreover, when different antigen molecules in the antigen coding region stimulate the body, the humoral response and the cellular response have no significant effect on each other. In addition, the mRNA vector can be used for the preparation of the dual-antigen rabies mRNA vaccine RABV-G-LT vaccine, so that it can quickly induce an effective immune response after vaccination, and is used for the prevention and treatment of rabies virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0083] The present disclosure will be further described below with reference to the accompanying drawings. These drawings are only for illustrating the embodiments of the present disclosure and are not intended to limit the scope of the present disclosure.

[0084] Figure 1 shows the construction and verification of RABV-LT recombinant T antigen.

[0085] Figure 2 shows the immunogenicity evaluation of the RABV-LT mRNA vaccine in BALB / c mice. The mice used in the experiment were 6-8 weeks old female BALB / c mice, and the immunogen was the RABV-LT mRNA vaccine. The results show the antigen-specific CD8+ T cell responses (A) and antigen-specific CD4+ T cell responses (B) induced by the RABV-LT mRNA vaccine 7 days after the first dose. ns: not significant; *: p < 0.05; **: p < 0.01; ***: p < 0.001; ****: p < 0.0001.

[0086] Figure 3 shows the protective effect of RABV-LT mRNA vaccine challenge, including the comparison of weight changes (A) and survival rates (B) of mice in different groups after challenge.

[0087] Figure 4 shows the construction and validation of a dual-antigen RABV-G-LT molecule loaded with RABV-LT and RABV-G antigens. These include the RABV-G-IRES-LT antigen (A), the RABV-G-IRES-LT-ERmut2 antigen coupled to estrogen receptor domain mutant 2 (ERmut2) (B), and the RABV-G-IRES-LT-DHFR antigen coupled to dihydrofolate reductase (DHFR) (C).

[0088] Figure 5 shows the immunogenicity evaluation of different dual-antigen RABV-G-LT mRNA vaccines in BALB / c mice. This evaluation includes ELISA assays for RABV-G-specific antibody titers in mouse sera 12 days after vaccination (A) and ELISPOT assays for T cell responses in mouse spleens 12 days after vaccination (B). The horizontal axis represents immunization group, and the vertical axis represents the number of IFN-γ-secreting cells per million splenocytes. ns or no marker indicates no significant difference; * indicates p < 0.05; ** indicates p < 0.01; *** indicates p < 0.001; and **** indicates p < 0.0001.

[0089] Figure 6 shows the protective efficacy of the RABV-G-LT mRNA vaccine, RABV-G mRNA vaccine, and a commercial inactivated vaccine against lethal rabies virus challenge 7 days after vaccination. This includes the titer of real virus neutralizing antibodies in mouse serum 7 days after vaccination with the three vaccines (A); viral RNA levels in brain tissue (B) and spinal cord (C) at different time points after lethal rabies virus challenge in mice; and comparisons of body weight changes (D) and survival rates (E) among mice in different groups. ns or no marker: not significant; *: p < 0.05; **: p < 0.01; ***: p < 0.001; ****: p < 0.0001. DETAILED DESCRIPTION

[0090] To further illustrate the technical means and effects of the present invention, the present invention is further described below in conjunction with a specific embodiment of rabies vaccine construction. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the scope of the present invention.

[0091] In the description herein, for simplicity, the names of certain proteins and their encoding genes (DNA) are sometimes used interchangeably. Those skilled in the art will understand that these refer to different substances in different descriptions. Those skilled in the art will readily understand their meanings based on the context and language.

[0092] Similarly, for ease of description, RNA, such as mRNA, is sometimes used interchangeably with the names of its coding gene (DNA). Those skilled in the art will understand that they represent different substances in different descriptions. Those skilled in the art will readily understand their meanings based on the context and language.

[0093] In the embodiments of the present invention, if there is no specific description of the experimental operating temperature, the temperature generally refers to room temperature (10-30° C.).

[0094] This article involves the addition amount, content and concentration of various substances, and the percentages mentioned therein, unless otherwise specified, refer to the percentage by mass.

[0095] If no specific techniques or conditions are specified in the examples, all are conventional methods, which are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. All reagents and instruments used are conventional products that can be purchased through regular channels.

[0096] Materials and methods

[0097] The immunogen design and screening, mRNA preparation, mRNA vaccine preparation, animal immunization scheme, and detection methods involved in the experiments in the examples are as follows:

[0098] I. Design of Immunogens

[0099] The genome of rabies virus encodes five major proteins: N, P, M, G and L. L protein (Large Protein) is the RNA-dependent RNA polymerase of rabies virus and is very important for the replication and transcription process of rabies virus. Although the mutation rate of RNA viruses is relatively high, such mutations are often limited for proteins important in the viral life cycle (such as L protein), because any mutation that negatively affects its function may lead to a decrease in the viability of the virus. The present invention selects the L protein sequences in five vaccine strains (CVS-11, aG, CTN, ERA, PM1503) as the source for LT antigen design, and uses this as a target for screening to obtain conserved dominant T cell epitope-enriched regions.

[0100] i. Search and download the protein sequences of five vaccine strains L from the Genebank database, including PM (GenBank: DQ099525.1), CTN-1 (GenBank: FJ959397.1), aG (GenBank: GQ412744.1), ERA (GenBank: EF206707.1), and CVS-11 (GenBank: GQ918139).

[0101] ii. Using the prediction tools NetMHCpan and NetMHCIIpan, 12 MHC-I and 54 MHC-II supertypes with more than 90% population coverage were selected as pre-bound HLA types;

[0102] iii. Analyze the five L protein antigen sequences one by one, screen for highly binding MHC-I and MHC-II epitopes, and map the potential dominant epitopes to the original sequence;

[0103] iv. Combining the analysis of the dominant epitope-enriched regions and the high similarity regions of the five proteins, the LT protein T cell antigen sequence was initially truncated and screened;

[0104] v. The allergic and toxic characteristics of the T antigen were eliminated using the tools ALLERGENFP V1.0, ALLERGENFP V2.0, and allercatpro, and finally the recombinant protein LT (1035 amino acid residues in length) of the L protein was obtained.

[0105] The obtained recombinant LT protein sequence was inserted between the BamHI and AgeI multiple cloning sites of the high expression vector in the optimal combination described in the Chinese patent document with application number 202211129466.2. A flag tag was added to its 3' end, and the sequence was optimized according to the preference of eukaryotic codons and RNA secondary structure. The corresponding DNA template sequence of the coding region was as described in SEQ ID NO: 6 and sent to Shanghai Jierui Bioengineering Co., Ltd. for synthesis, namely RABV-LT; this sequence was inserted into the above-mentioned high expression vector, and the corresponding DNA template sequence for preparing mRNA was as described in SEQ ID NO: 10.

[0106] Another antigen sequence for inducing the production of neutralizing antibodies is constructed using a DNA sequence containing the glycoprotein (RABV-G) of the Pitman-Moore (PM) vaccine strain and optimized according to the codon preference of eukaryotic organisms. The corresponding DNA template sequence for the coding region is as described in SEQ ID NO: 3; the corresponding DNA template sequence for preparing mRNA is as described in SEQ ID NO: 11.

[0107] II. Construction of different dual-antigen RABV-G-LT molecules

[0108] The high expression vector in the optimal combination described in the Chinese patent document with application number 202211129466.2 is used as a template. Following the T7 promoter, the vector comprises, from the N-terminus to the C-terminus, a 5′-UTR sequence, a coding sequence, a 3′-UTR sequence, a polyadenylation tail sequence, and a linearization restriction site, XbaI. The coding sequence comprises, from the 5′ end to the 3′ end, a first protein domain, a RABV-G sequence, as described in SEQ ID NO: 3; an IRES element sequence, as described in SEQ ID NO. 7; a second protein domain, a RABV-LT sequence, as described in SEQ ID NO: 6; and a degradation domain sequence, an estrogen receptor (ER) domain mutant 2, as described in SEQ ID NO: 8, or a degradation domain sequence, a dihydrofolate reductase (DHFR), as described in SEQ ID NO: 9. According to the above sequence, different dual-antigen RABV-G-LT molecules are named as follows: RABV-G-IRES-LT, the corresponding DNA template sequence for preparing mRNA is as described in SEQ ID NO: 12; RABV-G-IRES-LT-ERmut2, the corresponding DNA template sequence for preparing mRNA is as described in SEQ ID NO: 13; RABV-G-IRES-LT-DHFR, the corresponding DNA template sequence for preparing mRNA is as described in SEQ ID NO: 14.

[0109] III. Preparation of mRNA vaccines

[0110] The different dual-antigen RABV-G-LT expression vectors constructed in the above II were linearized using XbaI restriction endonuclease, and the in vitro transcription kit and capping kit purchased from Jinan Protein Technology Co., Ltd. were used, and 1-methyluridine was used instead of uridine. The corresponding modified mRNA was synthesized according to the instructions, and purified by lithium chloride precipitation, washed three times with 75% ethanol, and dried. It was then dissolved in RNase-free water and its concentration was determined by Nano drop. The prepared mRNA molecules were sent to the company to prepare mRNA liposome nanoparticle vaccines for subsequent mouse experiments.

[0111] IV Animal Immunization Protocol

[0112] The first set of immune experiments was to test the immunogenicity of the recombinant RABV-LT protein of the polymerase L large protein. Female BALB / c mice aged 6-8 weeks were divided into two groups, with 15 mice in each group (10 of which were used for immune efficacy evaluation after challenge and 5 for testing cellular immune response). They were the empty LNP negative control group and the 3 μg RABV-LT mRNA group, which were injected intramuscularly into the thigh muscle of one of the hind limbs of the mice with an inoculation volume of 50 μL. Seven days later, the muscles were challenged with 40MLD50 rabies virus CVS-11 (the other hind limb was challenged).

[0113] The second set of immunization experiments evaluated the immunogenicity of different dual-antigen RABV-G-LT mRNA vaccines in BALB / c mice. Six- to eight-week-old female BALB / c mice were divided into four groups of six: an empty LNP negative control group, a RABV-G-IRES-LT mRNA vaccine group, a RABV-G-IRES-LT-ERmut2 mRNA vaccine group, and a RABV-G-IRES-LT-DHFR mRNA vaccine group. All mice were administered intramuscularly at a dose of 3 μg, with a single immunization volume of 100 μL (see Table 1). Blood was collected 12 days after vaccination to analyze serum RABV-G-specific antibody levels. Additionally, three mice from each group were randomly assigned to perform ELISPot assays to analyze T cell responses.

[0114] Table 1

[0115] The third group of immunization experiments evaluated the protective efficacy of the dual-antigen RABV-G-LT mRNA vaccine, RABV-G mRNA vaccine, and commercial inactivated vaccine against lethal rabies virus challenge 7 days after vaccination.

[0116] Female BALB / c mice were divided into four groups, each containing 14 mice: a negative control group (50 μL empty LNP), a group vaccinated with one injection of 3 μg of RABV-G mRNA vaccine, a group vaccinated with one injection of 3 μg of dual-antigen RABV-G-LT mRNA, and a group vaccinated with one injection of a commercial inactivated vaccine (effective unit 1 IU / mL). The mice were injected intramuscularly into the thigh muscle of one hind limb with a 50 μL inoculation volume. Seven days later, the other hind limb was challenged with 40 MLD50 of rabies virus CVS-11. Brains and spinal cords of three mice were randomly sampled on days 7 and 12 post-challenge (dpi), and viral RNA levels in the tissues were monitored, as shown in Table 2 below.

[0117] Table 2

[0118] V. Detection Method

[0119] Blood collection

[0120] Mice were bled before the first immunization on day 1, and then at planned time points by orbital venous plexus. Mice were sacrificed by cervical dislocation at the end of the experiment.

[0121] Whole blood was collected from mice into sterile 1.5 mL EP tubes and allowed to stand at 37°C for 1 hour. The blood was then placed at 4°C for 20 minutes to allow for natural coagulation. The coagulated mouse serum was centrifuged at 7500g for 20 minutes. The serum was then inactivated in a 56°C water bath for 30 minutes to remove complement activity. A small amount was reserved for later use, and the remainder was stored at -80°C.

[0122] Western blot assay to detect the expression of target protein

[0123] i. Based on the size of the target protein, we select a separation gel with the corresponding concentration for SDS-polyacrylamide gel electrophoresis (SDS-PAGE);

[0124] ii. Add 20 μL of the prepared sample in the order to be verified; after half an hour at 80 V, adjust the voltage to 100 V and continue electrophoresis for 1.5 hours. Terminate the electrophoresis based on the position of the bromophenol blue band.

[0125] iii. Transfer: Using the wet transfer method, first activate the PVDF membrane in methanol for 30 seconds. Then soak the sponge, filter paper, and PVDF membrane in transfer solution and place them in the order of cathode plate (black) - sponge - filter paper - gel - PVDF membrane - filter paper - sponge - anode plate (white). Constant current 200 mA for 1.5-2 hours.

[0126] iv. After completion, the PVDF membrane was blocked in 5% skim milk powder for 1-2 hours;

[0127] v. Primary antibody incubation: Add specific antibody at a 1:1000 w / v ratio, incubate on a shaker at room temperature for 2 h, and then wash with PBST five times for 3 min each.

[0128] Secondary antibody incubation: HRP-labeled IgG antibody was added at a dilution ratio of 1:5000 w / v, incubated at room temperature for 1 hour, and washed with PBST five times for 3 minutes each.

[0129] vii. Color development: add color development solution and incubate for 1 minute. Expose using an analyzer for 2 minutes. Record and analyze the color development results.

[0130] Detection of RABV-G binding antibody titer by enzyme-linked immunosorbent assay (ELISA)

[0131] i. Dilute the RABV-G protein to 1 ng / μL in coating buffer (50 mM carbonate buffer, pH 9.6), add 100 μL / well, and incubate overnight at 4°C.

[0132] ii. Wash once with PBST (containing 0.05% Tween-20), pat dry, add 5% skim milk (200 μL / well), and block at room temperature for 2 h.

[0133] iii. Using 5% skim milk as the sample diluent, the serum sample was diluted 100-fold in the first well, and then serially diluted 2-fold, and added to the reaction wells. Incubate at 37°C for 1 hour.

[0134] iv. After washing five times with PBST, pat dry, add 100 μL / well of HRP-labeled goat anti-mouse IgG antibody (1:5000) and react at room temperature for 1 hour;

[0135] v. After the reaction, wash with PBST six times, pat dry, and add gold and silver OPD (1 gold and 1 silver sheet dissolved in 20 mL of deionized water) solution in the dark for 5-10 minutes.

[0136] vi. Add 2M sulfuric acid stop solution to stop the reaction. Read the plate at 490 nm on a microplate reader.

[0137] vii. Data analysis: 2.1 times the negative control reading was used as the cut-off value. The titer corresponding to the dilution endpoint of the RABV-G-specific binding antibody was calculated and expressed as the geometric mean (GMT). Graphs were generated using Graphpad Prism 9 software.

[0138] Fluorescent antibody virus neutralization test (FAVN) to detect serum true virus neutralizing antibody titer

[0139] Refer to the standard operating procedures of the UK canine International Office of Animal Diseases (OIE) rabies laboratory. First, add 100 μL of DMEM complete medium to each well, add 50 μL of pre-inactivated serum sample to the first column, mix with a multichannel pipette, draw 50 μL into the second column, dilute to the last column in the same way, mix and discard 50 μL. Take another 96-well plate as a control plate, dilute the standard positive serum (0.5 IU / mL) and standard negative serum (non-immune mouse serum) in the above manner, and set up virus repeat titration areas, as well as virus control, cell control, and culture medium control areas. Then add 50 μL of 100 TCID to each well. 50 Rabies virus (standard virus strain [CVS-11]) was added to the cell and culture medium control wells without virus, but with complete DMEM medium. The cells were incubated at 37°C and 5% CO2 for 1 hour. 50 μL of BHK-21 cell suspension was then added to each well at a cell density of 4 × 10 5 / mL, culture medium control wells were not added with cells, and incubated at 37°C and 5% CO2 for 48h. After the incubation, the cell supernatant was discarded and fixed and stained. First, add 80% acetone solution to fix for 30 minutes, discard the fixative, and air dry. Add fluorescent antibody labeled with FITC against rabies nucleocapsid protein, add 50μL of 1% Evans blue staining solution to each well, and react at 37°C in the dark for 45-60 minutes. Observe under a fluorescence microscope whether there are one or more fluorescent cells, and qualitatively divide the wells into "positive" (fluorescence indicates infection) or "negative" (no fluorescence). The serum titer is the dilution that neutralizes 100% of the virus in 50% of the wells (logD50). 0.5 IU / mL is the neutralization standard recommended by the WHO. Under the same experimental conditions, the half-neutralization dilution multiples of the neutralizing dilutions of the test serum and the canine International Office of Epizootics (OIE) reference serum against the quantitative virus were calculated. The two were compared and then multiplied by the standard serum titer (0.5 IU / ml) to obtain the rabies neutralization titer of the test serum. The neutralization titer was expressed as the geometric mean (GMT) and graphed using Graphpad Prism 9 software.

[0140] Intracellular cytokine staining (ICS) analysis of RABV-G / RABV-LT antigen-specific T cells

[0141] i. Isolate mouse spleen cells at different time points after immunization and prepare single-cell suspensions: After killing mice, remove spleens and grind into single cells with R10. Centrifuge at 500g for 5 minutes, discard the supernatant, resuspend the cells, add 5mL of mouse red blood cell lysis buffer, gently shake, and let stand at room temperature for 5-10 minutes. Add 10mL of R10 to terminate the reaction, centrifuge at 800g for 3 minutes, discard the supernatant, wash once with 5mL of R10, and resuspend the cells in 5mL of R10 for counting.

[0142] ii. Peptide stimulation: 2×10 per well 6 Cells were plated in 96-well plates and stimulated with rabies virus glycoprotein peptide library at a final concentration of 1 μg / mL. The negative control group was DMSO, and the positive control group was PMA at a final concentration of 50 ng / mL and ionomycin at 5 μg / mL. The cells were incubated at 37°C under 5% CO2 for 1 h.

[0143] iii. Join BD GolgiStop TM Protein Transport Inhibitor (1:1000) was added and incubated at 37°C for 5 h. Stimulation was terminated by centrifugation at 500 g for 5 min, followed by washing with PBS and subsequent fluorescent antibody staining (50 μL of each staining system, the same below).

[0144] iv. First use Zombie Aqua TM , Mouse CD4-AF700, Mouse CD8a-FITC, Mouse CD3 PerCP-Cy5.5 staining, staining at room temperature in the dark for 20 minutes. Wash once with PBS and centrifuge at 500g for 5 minutes;

[0145] v. Fix with Cytofix / Cytoperm at 4°C in the dark for 20 min, wash once with PBS, and centrifuge at 1000 g for 5 min.

[0146] vi. Permeabilization of cells: 10×BD Perm / Wash TM Buffer was diluted with ultrapure water to 1× working solution for standby use, 1× BD Perm / Wash TM Resuspend cells in 4% paraformaldehyde buffer (200 μL / well) and incubate at room temperature in the dark for 15 minutes. Centrifuge at 1000 g for 5 minutes and carefully discard the supernatant.

[0147] vii. Use 1×BD Perm / Wash TM Mouse IFN-γ-PE, Mouse IL-2-APC, and Mouse TNF-α-BV605 were diluted in buffer and stained at 4°C for 30 minutes. Data were acquired using a BD LSRFortessa flow cytometer; at least 30,000 CD8+ T cells were collected for each sample, and data were analyzed using FlowJo software.

[0148] Mouse IFN-γ ELISPot assay

[0149] i. Prepare the antibody coating kit from the BD Elispot mouse kit: Dilute the anti-IFN-γ antibody 1:200 w / v in sterile PBS according to the desired number of wells. Add 100 μL / well to the Elispot plate. (Antibody dilution volume calculated: 110 μL per well). Incubate overnight at 4°C.

[0150] ii. Remove the Elispot plate from the overnight incubation, discard the liquid in the wells, add 200 μL of R10 to wash once, let it sit for 3 minutes, and discard. Add 200 μL of fresh R10 and block at room temperature for 2 hours;

[0151] iii. After blocking, discard the culture medium and add 50 μL of stimulator (stimulatory peptide library, single peptide final concentration 5 μg / mL), negative control R10, positive control [PMA (50 ng / mL) + Ionomycin (1 μg / mL) or other positive stimulators] to each well. Then adjust the cell concentration to 4×10 6 cells / mL, add 50 μL of cells to each well in sequence. After gently mixing, place in a humidified chamber and incubate in a CO2 incubator for approximately 20 hours. The first three steps must be performed in a biosafety cabinet; the following steps do not require sterile conditions. Cryopreserve the remaining cells at 500 g for 5 minutes, discard the supernatant, add 2 mL of commercial freezing solution, and aliquot into 2 tubes per sample.

[0152] iv. After incubation, discard the culture. Wash each well twice with 200 μL of pre-cooled distilled water and three times with 200 μL of PBST, leaving each well for 3-5 minutes before discarding. Pat any remaining liquid dry on absorbent paper (keep the plate moist during the washes; do not let it dry out).

[0153] v. Dilute the biotin-conjugated detection antibody at a 1:250 w / v ratio in antibody diluent (PBS + 10% FBS), add 100 μL / well, and incubate at room temperature for 2 hours. Discard the solution and wash four times with 200 μL of PBST per well. After each wash, allow the solution to stand for 1-2 minutes and discard. Pat any remaining solution dry on absorbent paper.

[0154] vi. Dilute Streptavidin-HRP 1:100 w / v in antibody diluent (PBS + 10% FBS), add 100 μL / well, and incubate at room temperature for 1 hour. Discard the reaction solution and wash five times with 200 μL of PBST per well, typically leaving it for 1-2 minutes before discarding. Finally, add 200 μL of PBS per well, wash three times, and discard.

[0155] vii. Color development: Prepare the AEC color development solution immediately before use: Add 1 drop (approximately 20 μL) of color development substrate to every 1 mL of color development solution, mix thoroughly, and add 100 μL to each well. Incubate at room temperature in the dark for 5-60 minutes. Pay attention to the degree of color development. When a clear red dot appears, gently rinse the plate with tap water for 5 minutes to stop the reaction. (If the color development time is short, the positive dot will be lighter. If the color development time is too long, a darker background will appear. Use the positive and negative wells as a reference for judgment.) Allow the plate to air dry or blow dry with a fan.

[0156] Viii. Read the data. Place the 96-well plate on an Elispot plate reader to read the positive spots.

[0157] The following is a description of the RABV-LT recombinant protein T cell epitope peptide library:

[0158] Sequence alignment of the RABV-LT recombinant protein with the full-length L protein revealed that amino acid positions 600-950 house the RNA-dependent RNA polymerase domain, which functions as a capping enzyme. Therefore, the present invention used the overlap (11 amino acid overlap) method to cover this region, resulting in a total of 85 T cell epitope peptides, which were synthesized by Qiangyao Biotechnology Co., Ltd.

[0159] Peptide library: 10 peptide libraries were established using the above single peptides in order of amino acids. Each peptide library in peptide libraries 1 to 5 contained 9 single peptides, and each peptide library in peptide libraries 6 to 10 contained 8 single peptides.

[0160] RNA extraction and detection from mouse brain tissue / spinal cord

[0161] i. First, mice were taken at different time points after infection, and the brain tissue and spinal cord were removed after cervical dislocation. The brain tissue was divided into two equal parts. One part was fixed with 4% paraformaldehyde, and after 24 hours, it was replaced with 75% ethanol and then sent to the company for paraffin sectioning and HE staining; the other part of the brain tissue and spinal cord tissue were each fixed with 1 mL of pre-cooled RT reagent (Molecular Research Center), placed in a tissue ultrasonic disruptor and fully disrupted (65 Hz, 30 s, 2 times);

[0162] ii. Centrifuge the disrupted sample at 4°C, 18,000 g for 10 min. Transfer the supernatant to another EP tube, aspirate 200 μL from each tube for total RNA extraction, and freeze the remainder at -80°C for later use.

[0163] iii. Add anhydrous ethanol to the tissue supernatant in a 1:1 volume ratio, mix thoroughly using a Vortex, centrifuge at 18,000 g for 2 minutes at 4°C, and add the supernatant to the adsorption column.

[0164] iv. Centrifuge at 18,000 g for 2 min at 4°C and resuspend once; then add 400 μL of Prewash buffer and centrifuge at 18,000 g for 1 min at 4°C to wash twice;

[0165] v. Add 700 μL RNAwash buffer and centrifuge at 18,000 g at 4°C for 2 min, spinning once.

[0166] vi. Transfer the solution to a nuclease-free EP tube and add 50 μL of nuclease-free water. Centrifuge at 4°C, 18,000 g for 2 min and measure the total RNA concentration.

[0167] Fluorescence quantitative PCR

[0168] This experiment used the Novizan One-Step RT-PCR Kit, which combines reverse transcription and PCR reactions in a single system, minimizing experimental errors. First, the reaction system was prepared using the forward primer NF: AATGCGACGGTTATTGCTGC, which amplifies the RABV nucleocapsid protein; and the reverse primer NR: TGCCACGTCGGTCTTTGTTA. The total RNA concentration of each sample was determined, with 50 ng per reaction. The reaction system is shown in Table 3:

[0169] Table 3

[0170] After the reaction system is prepared in the EP tube (replicate 4 wells per sample), add it to the 96-well PCR plate and set the reaction program (40 cycles) as shown in Table 4:

[0171] Table 4

[0172] After the reaction is completed, the amplification curve of Real Time PCR is collected and exported for data analysis.

[0173] The present invention is further described in detail below with reference to the accompanying drawings and specific experiments. Unless otherwise specified, the reagents, instruments, equipment and methods used in this invention are all commercially available reagents, instruments, equipment and methods commonly used in the art.

[0174] Example 1: Construction of recombinant T antigen RABV-LT and verification of its expression in HEK293T cells by mRNA transfection

[0175] The L protein recombinant T antigen RABV-LT was constructed according to the above experimental method I, and a flag tag was added to its 3' end, as shown in Figure 1A.

[0176] RABV-LT mRNA was prepared according to the aforementioned experimental method III and transfected into HEK293T cells for expression verification. mRNA was mixed with the transfection reagent Lipofectamine 3000 at a mass ratio of 1:3. Samples were collected 24 hours after transfection. Western blot verification was performed using an anti-flag antibody as the primary antibody.

[0177] The results are shown in Figure 1B. RABV-LT mRNA can be expressed in large quantities after transfection into HEK293T cells. The target band is sized at 120 kDa, which is the correct size.

[0178] Example 2: Evaluation of the immunogenicity of RABV-LT mRNA vaccine in BALB / c mice

[0179] In this example, the RABV-LT mRNA verified to be correctly expressed in Example 1 was used to prepare and encapsulate the RABV-LT mRNA cationic lipid nanoparticle vaccine for animal experiments.

[0180] BALB / c mice were immunized with the prepared mRNA-RABV-LT vaccine, with each mouse receiving 3 μg of the mRNA cationic lipid nanoparticle vaccine. A negative control group received an equal volume of cationic lipid nanoparticles without nucleic acid encapsulation. One week after immunization, the mice were sacrificed and their spleen cells isolated. In this example, specific T cell responses were detected by analyzing the secretion of RABV-LT antigen-specific T cell factors using intracellular cytokine staining (ICS) according to the above-described experimental method V.

[0181] The results are shown in Figure 2A and B. Compared with the control group, in mice immunized with RABV-LTmRNA vaccine, both RABV-LT specific positive CD4+T cells and specific positive CD8+T cells can secrete higher levels of IFN-γ and TNF-α cytokines. Among them, the average proportion of IFN-γCD4+T cells was 0.6% (the average proportion of IFN-γCD4+T cells in the negative control group was 0.2%) (Figure 2B); the average proportion of IFN-γCD8+T cells was 1.25% (the average proportion of IFN-γCD4+T cells in the negative control group was 0.45%), and the secretion level of TNF-αCD8+T (0.61%) was also significantly higher than that of the negative control group (0.28%) (p < 0.05) (Figure 2A).

[0182] The results show that RABV-LT vaccine can effectively induce antigen-specific T cell responses after immunization, thereby secreting multiple cytokines, indicating that the vaccine has a strong virus clearance ability and has great potential in resisting rabies virus infection.

[0183] Example 3: Protective effect of RABV-LT mRNA vaccine on mice challenged with virus

[0184] To further evaluate the in vivo protective effect of the RABV-G mRNA nucleic acid vaccine of the present invention, BALB / c mice were used as a model. Ten mice were injected intramuscularly with 3 μg of RABV-LT mRNA or empty LNP, with a total inoculation volume of 50 μL per mouse. Seven days after immunization, 5*10 3.5 The mice were challenged intramuscularly (the other leg) with TCID50 of fixed rabies virus CVS-11, and the body weight and survival status of each mouse were continuously monitored 15 days after infection.

[0185] The results, shown in Figures 3A and 3B, show that the RABV-LT mRNA vaccine provided 70% protection against the lethal virus challenge (Figure 3A). The weight of the unvaccinated, empty-load control group began to decline sharply on day 4 after infection, and all mice in this group died by day 9. In contrast, the weight of mice in the RABV-LT mRNA vaccine group decreased slightly on day 0 after infection, then gradually increased. From day 4 to day 9, their weight began to slowly decrease to a minimum, with two mice dying. This weight then slowly recovered, with one more mouse dying on day 13. By the time monitoring was completed on day 15, all other mice had survived normally and recovered their weight.

[0186] These results suggest that RABV-LT mRNA vaccination alone can moderately effectively control rabies virus infection in mice.

[0187] Example 4: Construction and validation of a dual-antigen RABV-G-LT mRNA vaccine containing RABV-LT antigen and RABV-G antigen

[0188] In view of the fact that the independent RABV-LT mRNA vaccine in the above-mentioned embodiment can provide a certain level of protection, and the independent RABV-G mRNA also has good protection, in this embodiment, RABV-G and RABV-LT are loaded into an antigen molecule, so that on the one hand, it can induce the expression of B cell immunogens, and on the other hand, it can normally express T cell antigens, and finally achieve rapid induction of neutralizing antibody response and cellular immune response. Based on this design purpose, in this embodiment, RABV-LT and RABV-G are introduced into an internal ribosome entry site sequence to realize the construction of a dual-antigen RABV-G-LT mRNA rabies vaccine that can be independently and normally expressed. In addition, in order to better present T cell antigens, the degradation domain estrogen receptor domain mutant 2 (ERmut2) and dihydrofolate reductase (DHFR) are coupled after the RABV-LT sequence, so that RABV-LT can self-degrade and form multiple T cell epitopes. The constructed dual-antigen RABV-G-LT molecules are RABV-G-IRES-LT, RABV-G-IRES-LT-ERmut2 coupled with estrogen receptor domain mutant 2 (ERmut2), and RABV-G-IRES-LT-DHFR coupled with dihydrofolate reductase (DHFR).

[0189] The three different dual-antigen RABV-G-LT mRNAs were prepared according to the above experimental method III and transfected into HEK293T cells for expression verification. 16 hours after transfection, the proteasome inhibitor MG132 was added to the wells transfected with RABV-G-IRES-LT and RABV-G-IRES-LT-ERmut2 at a final concentration of 50 μM. Trimethoprim (TMP), which inhibits DHFR degradation, was also added to the wells transfected with RABV-G-IRES-LT-DHFR at a working concentration of 50 μM. Samples were collected 8 hours later and expression was verified by Western blot. The primary antibodies were anti-RABV-G and anti-flag tags, respectively. The results are shown in Figure 4A and B. In the RABV-G-IRES-LT and RABV-G-IRES-LT-ERmut2 groups, the protein bands of the LT recombinant antigen were significantly weakened in the MG132(-) wells compared to those in the MG132(+) wells, while the protein bands of RABV-G were more obvious. Moreover, the addition of MG132(+) also enhanced the expression of RABV-G. In addition, in the RABV-G-IRES-LT-DHFR group, the addition of TMP also greatly increased the expression of RABV-G protein in cells, thus increasing the expression of the LT recombinant antigen from zero.

[0190] The results indicate that IRES-mediated ligation can effectively achieve the normal expression of RABV-G and RABV-LT separately, and can load RABV-LT antigen and RABV-G antigen into a dual-antigen RABV-G-LT molecule.

[0191] Example 5: Comparison of immunogenicity of different dual-antigen RABV-G-LT mRNA vaccines in BALB / c mice

[0192] This example further explores the differences in the immune efficacy of different dual-antigen RABV-G-LT mRNA vaccines in animals. The three mRNAs described in Example 4 were prepared into liposome nanoparticle vaccines. Following the second immunization experiment described in Experimental Method IV, BALB / c mice were immunized with 3 μg intramuscularly (IM). An empty vector control group was used. Orbital blood was collected 12 days after the initial immunization, and RABV-G binding antibody levels were assessed by ELISA. Splenocytes were randomly isolated from three mice and stimulated with a G protein peptide library and a LT peptide library, respectively. T cell immune responses were assessed by ELISpot.

[0193] The results are shown in Figure 5A. Compared with the empty control group, the RABV-G-IRES-LT, RABV-G-IRES-LT-DHFR, and RABV-G-IRES-LT-ERmut2 groups can all induce higher levels of RABV-G binding antibodies, and there is no significant difference among the three groups. ELISpot test results (B) in Figure 5 show that in response to the peptide library against G protein in mouse spleen cells, the average number of interferon gamma (IFN-γ) spots per million lymphocytes in the RABV-G-IRES-LT, RABV-G-IRES-LT-DHFR, and RABV-G-IRES-LT-ERmut2 groups were 347, 410, and 525, respectively; the immune response to G protein peptide library stimulation in the experimental group with added degradation domain was stronger; and in response to stimulation with the LT recombinant antigen peptide library, the average number of IFN-γ spots per million lymphocytes was the lowest in RABV-G-IRES-LT, at only 65; the highest in the RABV-G-IRES-LT-DHFR group was 193; and the highest in the RABV-G-IRES-LT-ERmut2 group was 98.

[0194] The results show that the design of RABV-G-IRES-LT-DHFR can not only stimulate effective RABV-G-specific IgG binding antibody titers, but also enable the independent translation of the RABV-LT antigen, so that it is broken into multiple epitopes under the action of DHFR degradation peptide, thereby effectively inducing a cellular immune response. Therefore, this example selects RABV-G-IRES-LT-DHFR as the immunogen of the subsequent dual-antigen mRNA vaccine and abbreviates it to RABV-G-LT.

[0195] Example 6: Comparison of the protective efficacy of the dual-antigen RABV-G-LT mRNA vaccine, RABV-G mRNA vaccine, and commercial inactivated vaccine against lethal rabies virus challenge 7 days after vaccination

[0196] Given that the RABV-LT mRNA vaccine alone provided 70% protection after challenge with the virus 7 days after the initial challenge in Example 3, this example further explored the protective efficacy of the dual-antigen RABV-G-LT mRNA vaccine 7 days after the initial challenge. Following the third group immunization experiment described in Experimental Methods IV, the protective levels of the RABV-G mRNA vaccine alone and the RABV-G-LT mRNA vaccine were evaluated using BALB / c mice as a model, with a commercially inactivated vaccine at an effective unit of 1 IU / mL serving as the control. Five groups of 14 mice were included. The mRNA vaccine group received an intramuscular inoculation of 3 μg for priming on day 0. On day 7, five mice in each group were randomly sampled for blood sampling to measure true virus neutralizing antibody titers. The results are shown in Figure 6A. The geometric mean titer of true virus neutralizing antibodies in the RABV-G mRNA vaccine group was 4.3 IU / mL, and that in the inactivated vaccine group was 1.3 IU / mL. The true virus neutralizing antibody titer in the RABV-G-LT mRNA vaccine group was the lowest among the three groups, at 0.42 IU / mL, and one mouse did not reach the WHO standard (0.5 IU / mL).

[0197] The protective efficacy of the three vaccines against lethal rabies virus challenge was further compared in vivo. On the 7th day after vaccination, mice were injected intramuscularly with 5*10 3.5 The mice were challenged with CVS-11 lethal rabies virus at a TCID50 level. Three mice were randomly selected on the 7th and 12th days after infection to extract RNA from the brain tissue / spinal cord for relative quantitative PCR detection. The weight changes and survival status of each mouse were continuously monitored for 20 days after infection.

[0198] The results, as shown in Figure 6B and C, show that large amounts of rabies virus RNA were detected in the brain and spinal cord of all mice in the empty vector control group on day 7 post-infection. All mice in the control group had died by day 12, and samples could not be collected. In contrast, viral RNA levels were lower in all vaccinated groups. Compared with the blank (unchallenged, unvaccinated) group, brain tissue viral RNA levels in the RABV-G-LT mRNA vaccine, RABV-G mRNA vaccine, and commercial inactivated vaccine groups were 5.28-, 17-, and 57.6-fold higher on day 7 post-infection in the RABV-G-LT mRNA vaccine, respectively. By day 12 post-infection, viral RNA levels had decreased, with very low but detectable levels in the RABV-G-LT group. Similarly, viral RNA levels in the spinal cord were highest in the commercial inactivated vaccine group on days 7 and 12, followed by the RABV-G mRNA vaccine, and lowest in the RABV-G-LT mRNA vaccine group.

[0199] The weight changes and survival of mice in each group were monitored after infection. The results are shown in Figure 6D and E. The empty vector control group experienced a slight weight loss starting on day 1, which then rebounded until a sharp decline on day 4, with all mice in this group dying by day 9. Mice in the three vaccine groups experienced a slight weight loss starting on day 0 after infection, then gradually recovered. The inactivated vaccine control group experienced a slow weight decrease starting on day 4, reaching its lowest level on day 15 before slowly recovering. The weight of mice in the mRNA vaccine groups continued to slowly increase with minor fluctuations. By the time monitoring was completed on day 20, mice in the RABV-G-LT and RABV-G mRNA vaccine groups had all survived normally and regained weight, while the inactivated vaccine group had a survival rate of only 62.5%.

[0200] These results indicate that RABV-G-LT mRNA vaccine can more effectively eliminate the virus and control rabies virus infection.

[0201] From the above examples, it can be seen that the dual-antigen RABV-G-LT mRNA vaccine provided in the present invention can rapidly induce an immune response after vaccination, and can activate an effective cellular immune response before protective antibodies accumulate and mature in large quantities, thereby better inhibiting viral replication. It has broad application prospects in the field of rabies virus prevention and treatment.

[0202] Sequence Listing

[0203] 1. SEQ ID NO: 1, i.e. the full-length amino acid sequence of the rabies virus structural protein glycoprotein (G):

[0204] (slightly)

[0205] 2. SEQ ID NO: 2, derived from the amino acid sequence of the extracellular domain of the rabies virus structural protein glycoprotein (G):

[0206] (slightly)

[0207] 3. SEQ ID NO: 3, i.e., the full-length nucleic acid sequence of the codon-optimized rabies virus structural protein glycoprotein (G):

[0208] (slightly)

[0209] 4. SEQ ID NO: 4, derived from the codon-optimized extracellular domain nucleic acid sequence of the rabies virus structural protein glycoprotein (G):

[0210] (slightly)

[0211] 5. SEQ ID NO: 5, i.e., the amino acid sequence of RABV-LT protein:

[0212] (slightly)

[0213] 6. SEQ ID NO: 6, i.e., the DNA nucleic acid sequence of RABV-LT after codon and RNA secondary structure optimization:

[0214] (slightly)

[0215] 7. SEQ ID NO: 7, the internal ribosome entry site nucleic acid sequence derived from encephalomyocarditis virus:

[0216] (slightly)

[0217] 8. SEQ ID NO: 8, estrogen receptor (ER) domain mutant 2 sequence:

[0218] (slightly)

[0219] 9. SEQ ID NO: 9, i.e., dihydrofolate reductase (DHFR) sequence:

[0220] (slightly)

[0221] 10. SEQ ID NO: 10, DNA template sequence for preparing RABV-LTmRNA:

[0222] (slightly)

[0223] 11. SEQ ID NO: 11, DNA template sequence for preparing RABV-G mRNA:

[0224] (slightly)

[0225] 12. SEQ ID NO: 12, DNA template sequence for preparing RABV-G-IRES-LT mRNA:

[0226] (slightly)

[0227] 13. SEQ ID NO: 13, DNA template sequence for preparing RABV-G-IRES-LT-ERmut2 mRNA:

[0228] (slightly)

[0229] 14. SEQ ID NO: 14, DNA template sequence for preparing RABV-G-IRES-LT-DHFR mRNA:

[0230] (slightly)

Claims

1. A rabies vaccine immunogen composition, which is a protein immunogen composition or a DNA immunogen composition, wherein the DNA is a gene encoding the protein, wherein: The protein immunogen composition comprises: A. Rabies virus structural protein glycoprotein G as a humoral immunogen for activating neutralizing antibodies, and B. Polymerase large protein L as a T cell immunogen for inducing cellular immune responses; The DNA immunogen composition comprises: a. a nucleic acid molecule a encoding the structural protein glycoprotein G of rabies virus of item A above, and b. Nucleic acid molecule b encoding the polymerase large protein L of item B above.

2. The rabies vaccine immunogen composition according to claim 1, characterized in that The rabies virus structural protein glycoprotein G is the full-length amino acid sequence of glycoprotein G, the amino acid sequence of its extracellular region or an antigenic fragment thereof, The glycoprotein G full-length amino acid sequence is selected from the group consisting of: (1) a polypeptide whose amino acid sequence is shown in SEQ ID NO: 1; and (2) a polypeptide having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology to the amino acid sequence of SEQ ID NO: 1, and having the same function as SEQ ID NO: 1, wherein the function refers to the function of inducing humoral immune response and producing neutralizing antibodies; The amino acid sequence of the glycoprotein G extracellular region is selected from the following group: (3) a polypeptide whose amino acid sequence is shown in SEQ ID NO: 2; and (4) a polypeptide having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology to the amino acid sequence of SEQ ID NO: 2, and having the same function as SEQ ID NO: 1, wherein the function is to induce a humoral immune response and produce neutralizing antibodies; and The polymerase large protein L is selected from the following group: (5) a polypeptide whose amino acid sequence is shown in SEQ ID NO: 5; and (6) A polypeptide that has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology to the amino acid sequence of SEQ ID NO:5, and has the same function as SEQ ID NO:5, wherein the function is the function of inducing a cellular immune response.

3. The rabies vaccine immunogen composition according to claim 2, characterized in that: When the nucleic acid molecule a encodes the polypeptide SEQ ID NO: 1, it is selected from the following group: (7) the nucleotide sequence shown in SEQ ID NO: 3, (8) a nucleotide sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous to SEQ ID NO: 3; When the nucleic acid molecule a encodes the polypeptide SEQ ID NO: 2, it is selected from the following group: (9) the nucleotide sequence shown in SEQ ID NO: 4, (10) a nucleotide sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous to SEQ ID NO:4; When the nucleic acid molecule b encodes the polypeptide SEQ ID NO: 5, it is selected from the following group: (11) the nucleotide sequence shown in SEQ ID NO: 6, (12) A nucleotide sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous to SEQ ID NO:

6.

4. Use of the rabies vaccine immunogen composition according to any one of claims 1 to 3 in the preparation of rabies vaccine.

5. The use according to claim 4, characterized in that The nucleic acid molecule a and the nucleic acid molecule b described in claim 1 are inserted into an expression vector to form a vector vaccine, and the vector used is selected from the following group: nucleic acid vaccine vectors, i.e., mRNA vectors and DNA plasmid vectors; recombinant virus vectors; and recombinant bacterial vectors.

6. A rabies vaccine capable of inducing both humoral immune response and cellular immune response, obtained by the application method as claimed in claim 5, characterized in that: It is a nucleic acid vaccine, adenovirus vector vaccine or inactivated cell vaccine.

7. The rabies vaccine according to claim 6, characterized in that It is an mRNA vaccine, which is a rabies vaccine formed by inserting the nucleic acid molecule a and the nucleic acid molecule b described in claim 1 into an mRNA vector. In the inserted mRNA expression vector, from 5' to 3' end, there are T7 promoter region, 5' non-translation region, coding sequence, 3' non-coding region, polyadenylic acid tail (poly A) sequence and single enzyme cleavage site, wherein the coding sequence is an immunogen coding region, and in the direction from N-terminus to C-terminus, it contains a first protein sequence, an internal ribosome entry site sequence, a second protein sequence and a degradation domain, wherein the first protein sequence is one of the rabies virus structural protein glycoprotein G coding sequence and the polymerase large protein L coding sequence, and the second protein sequence is two of the rabies virus structural protein glycoprotein G coding sequence and the polymerase large protein L coding sequence.

8. The rabies vaccine according to claim 7, characterized in that The rabies vaccine is a dual-antigen mRNA rabies vaccine, and the sequences contained in the mRNA expression vector are T7 promoter, UTR sequence, first protein domain G protein, IRES sequence, second protein domain recombinant L protein, degradation domain, 3'-UTR sequence, polyadenylic acid tail sequence and single enzyme cleavage site from 5' end to 3' end.

9. The rabies vaccine according to claim 8, characterized in that The rabies vaccine is a dual antigen mRNA rabies vaccine and is a chemically modified mRNA vaccine, wherein the modified mRNA vaccine comprises replacing at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% of the uracil in the mRNA vaccine backbone with the following substances, wherein the substances replacing uracil are selected from the following compounds: uridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine, 5 -methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-T-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine or 5-methoxyuridine and 2′-O-methyluridine.

10. The rabies vaccine according to any one of claims 6 to 9, characterized in that In addition to the immunogen, the vaccine also comprises one or more pharmaceutically or veterinarily acceptable carriers or excipients, preferably carriers or excipients that make the rabies vaccine suitable for oral, intradermal, subcutaneous, intramuscular or intranasal administration.

Images