RNA inhibitor for inhibiting gene expression of complement system and use thereof

Abstract

An RNA inhibitor for inhibiting gene expression of a complement system, or a pharmaceutically acceptable salt thereof. The structure of the RNA inhibitor further contains vector structures 5'MVIP and 3'MVIP. The provided RNA inhibitor interferes with the translation template function of the mRNA of the complement system, and continuously and efficiently inhibits the gene expression of the complement system, so that CFB, C5 and C3 protein levels of the complement system in blood are continuously reduced. The RNA inhibitor can be used for treating and / or preventing diseases associated with an increased level of the complement system.

Description

RNA inhibitor for inhibiting complement system gene expression and its application Technical Field

[0001] The present invention belongs to the field of biomedicine, and in particular relates to an RNA inhibitor for inhibiting complement system gene expression and an application thereof. Background Art

[0002] RNAi

[0003] RNAi (RNA interference) was discovered in 1998 by Andrew Z. Fire and others while conducting antisense RNA inhibition experiments in Caenorhabditis elegans. This process was named RNA interference (RNAi). This discovery was named one of the top ten scientific advances of 2001 by Science magazine and ranked first among the top ten scientific advances of 2002. Since then, siRNA, which acts through RNA interference, has garnered widespread attention as a potential gene therapy drug. In 2006, Andrew Z. Fire and Craig C. Mello were awarded the Nobel Prize in Physiology or Medicine for their contributions to the study of RNAi mechanisms. RNAi can be triggered by double-stranded RNA (dsRNA) in many organisms, including animals, plants, and fungi. During the RNAi process, an endonuclease called Dicer cuts or "dices" long dsRNA into smaller fragments of 21 to 25 nucleotides. These small fragments, called small interfering RNA (siRNA), have their antisense strands (Guide strands) loaded onto the Argonaute protein (AGO2). AGO2 loading occurs in the RISC-loading complex, a ternary complex composed of Argonaute protein, Dicer, and dsRNA binding protein (TRBP for short). During the loading process, the positive strand (Passenger strand) is cleaved and expelled by AGO2. AGO2 then uses the antisense strand to bind to mRNA containing a completely complementary sequence and then catalyzes the cleavage of these mRNAs, causing the mRNA to split and lose its role as a translation template, thereby preventing the synthesis of related proteins. After cleavage, the cleaved mRNA is released, and the RISC-loading complex loaded with the antisense strand is recycled for another round of cleavage.

[0004] According to statistics, over 80% of disease-related proteins in the human body cannot be targeted by currently available small-molecule drugs or biopharmaceuticals, making them undruggable proteins. Gene therapy, which aims to treat diseases through gene expression or silencing, is considered by the industry to be the third generation of therapeutics, following small-molecule and biopharmaceutical drugs. This approach treats diseases at the genetic level, unhindered by the limitations of undruggable proteins. As the most mainstream type of gene therapy, RNAi technology targets diseases at the mRNA level, offering greater efficacy than small-molecule and biopharmaceutical drugs that target proteins. Using RNAi technology, highly specific and potent inhibitory siRNA sense and antisense strands can be designed based on specific gene sequences. These single-stranded sequences are then synthesized through solid-phase synthesis. The sense and antisense strands are then combined in a specific annealing buffer according to base pairing principles to form siRNA. Finally, siRNA is delivered to the target site in the body via a vector system, where it degrades the target mRNA, disrupting its function as a translation template and thereby preventing the synthesis of the associated protein.

[0005] siRNA delivery system

[0006] siRNA is unstable in blood and tissues and easily degraded by nucleases. To improve siRNA stability, modifications can be made to the sense and / or antisense strands of the siRNA. However, these chemical modifications provide only limited protection from nuclease degradation and may ultimately affect siRNA activity. Therefore, a suitable delivery system is needed to ensure the safe and efficient passage of siRNA across the cell membrane. Due to its large molecular weight, high negative charge, and high water solubility, siRNA cannot successfully cross the cell membrane and enter the cell on its own.

[0007] Liposomes, with their basic structure consisting of a hydrophilic core and a phospholipid bilayer, possess a phospholipid bilayer similar to biological membranes and possess high biocompatibility. This is why liposomes once became the most popular and widely used siRNA delivery vehicle. Liposome-mediated siRNA delivery primarily involves encapsulating siRNA within liposomes, protecting it from nuclease degradation and improving its efficiency across cell membrane barriers, thereby promoting cellular uptake. Examples include anionic liposomes, pH-sensitive liposomes, immunoliposomes, fusogenic liposomes, and cationic lipids. While some progress has been made, liposomes themselves are prone to inflammatory responses, necessitating the use of multiple antihistamines and hormones, such as cilitidine and dexamethasone, prior to administration to mitigate potential acute inflammatory reactions. Therefore, liposomes are not suitable for all therapeutic areas in actual clinical practice, especially for the treatment of chronic diseases, where the potential for cumulative toxicity from long-term use is a potential safety concern. Therefore, a safer and more effective delivery system for siRNA is needed.

[0008] The asialoglycoprotein receptor (ASGPR) in the liver is a receptor specifically expressed on hepatocytes and is a highly efficient endocytic receptor. Because galactose residues are exposed at the penultimate end of various glycoproteins after enzymatic or acidic hydrolysis of sialic acid in the body, ASGPR specifically binds to galactosyl groups, hence its name, the galactose-specific receptor. Monosaccharides and polysaccharides such as galactose, galactosamine, and N-acetylgalactosamine all have a high affinity for ASGPR. The primary physiological function of ASGPR is to mediate the clearance of substances such as asialoglycoproteins and lipoproteins from the blood, and it is closely associated with the development and progression of liver diseases such as viral hepatitis, cirrhosis, and liver cancer. The discovery of this characteristic of ASGPR has played a significant role in the diagnosis and treatment of liver diseases (Ashwell G, Harford J, Carbohydrate-specific Receptors of the Liver, Ann Rev Biochem 1982 51:531-554). Liver-derived disease therapeutic drugs containing galactose or galactosamine and their derivatives in their structures can specifically bind to ASGPR, thereby having active liver targeting and requiring no other carrier system for delivery.

[0009] complement system

[0010] The complement system is activated through three pathways: the classical pathway, the lectin pathway, and the alternative pathway. These pathways differ primarily in their initiation process. After initiation, C3 convertase is formed, which further cleaves C3. The C3b fragment binds to the preceding complex to form C5 convertase, which cleaves C5b and C5a, triggering the assembly of MACs. MACs lyse cells and stimulate an inflammatory response to clear foreign substances.

[0011] The classical pathway (CP) is typically initiated by the attachment of C1q to an immune complex (such as IgM or IgG). C1q then activates C1r, altering the conformation of the C1r2-C1s2 structure. C1r releases C1s, which, with its serine protease (SP) activity, cleaves C4 and C2 to form C4b2a (C3 convertase). C3 convertase cleaves C3 and subsequently binds to C3b to form C5 convertase. C4a, C3a, and C5a stimulate the inflammatory response. C5b, with the help of C6, C7, C8, and C9, forms the C5b-9MAC, which attacks host cells or pathogens.

[0012] Activation of the lectin pathway (LP) is similar to that of the classical pathway (CP), except that the initiator of the LP is mannose-binding lectin (MBL), which binds to ficolin to form a multimeric lectin complex. This binding leads to activation of MBL-associated serine proteases (MASPs), triggering the complement system. MASP-1 and MASP-2 are similar to C1r and C1s, respectively. MASP-1 and MASP-2 fully activate the complement system by cleaving C4 and C2 to form the C3 convertase.

[0013] The alternative activation pathway (AP) differs from the classical pathway (CP) in that activation bypasses C1, C4, and C2 components and directly activates C3. Upon detecting an invading pathogen, the abundant C3 thioester domain (TED) becomes metastable, exposing C3 to the factor b (Fb) binding site. C3b is recognized by factor B, forming the complex C3bB. The C3bB complex is in turn cleaved by factor D, producing the active form of C3 convertase (C3bBb). C3 convertase (C3bBb) breaks down C3 into C3a and C3b, which, as the active fragment, binds to the pathogen or target cell. In response to C3 convertase, C3b produces C5 convertase, which cleaves C5 to recruit the membrane attack complex (MAC) to lyse the pathogen. Both types of C3 convertase (C3bB and C3bBb) cleave C3 to form C3b. C3b then binds to more factor B, enhancing complement activation through the AP. Alternatively, C3b leads to the formation of active C5 convertase (C3bBbC3b or C4bC2bC3b), which cleaves C5 and triggers later events leading to the formation of the membrane attack complex (MAC) (C5b-9).

[0014] Diseases caused by inappropriate activation of the complement system

[0015] Inhibitors that inhibit the expression of complement C3 and C5 genes can be used to treat diseases such as paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome, rheumatoid arthritis, Alzheimer's disease (AD), amyotrophic lateral sclerosis (ALS), schizophrenia, Parkinson's disease (PD), prion diseases, complement component C3-related eye diseases, ischemia-reperfusion injury, and neurodegenerative diseases.

[0016] Inhibitors that inhibit the expression of the complement factor B gene can be used to treat subjects with complement factor B-associated disorders, such as C3 glomerulopathy, systemic lupus erythematosus (SLE) such as lupus nephritis, IgA nephropathy, diabetic nephropathy, and polycystic kidney disease.

[0017] Combination of drugs

[0018] Complement inhibitors currently available on the market include Soliris, Ultomiris, Empaveli, Eculizumab, Ravulizumab, or Iptacopan (LNP023). These peptides, monoclonal antibodies, or small molecule drugs can be used in combination with RNAi inhibitors that inhibit complement system expression, thereby enhancing the ability to suppress the complement system systemically. However, most current complement inhibitors evaluated in clinical practice are administered once a week or two, which is costly and can also induce low-level hemolysis in PNH subjects. Therefore, patients with complement system problems still need a new alternative or combination therapy. Summary of the Invention

[0019] In one aspect, the present invention provides an RNA inhibitor or a pharmaceutically acceptable salt thereof that inhibits the expression of complement system genes.

[0020] An RNA inhibitor for inhibiting complement system gene expression, or a pharmaceutically acceptable salt thereof, wherein the RNA inhibitor is formed by base pairing of a sense strand and an antisense strand having a chain length of 15-30 nucleotides, preferably 19-23 nucleotides, wherein the antisense strand includes a region complementary to an mRNA encoding a complement system, and wherein the complementary region comprises at least 15 consecutive nucleotides that differ from the antisense strand of any one of Tables 1-1, 1-2, and 1-3 by 0, 1, 2, or 3 nucleotides.

[0021] The aforementioned RNA inhibitor for inhibiting complement system gene expression or a pharmaceutically acceptable salt thereof, wherein the RNA inhibitor is an RNA inhibitor for inhibiting CFB gene expression, wherein the antisense strand includes a region complementary to a target sequence, the target sequence being: 5'gucuagucaacuuaauugaga 3' SEQ ID NO: 25, the starting position of which in NM_001710.5 is at position 1157, and there is at least 85% base complementarity between the sense strand and the antisense strand.

[0022] The aforementioned RNA inhibitor for inhibiting complement system gene expression or a pharmaceutically acceptable salt thereof, wherein the RNA inhibitor is an RNA inhibitor for inhibiting C5 gene expression, wherein the antisense strand includes a region complementary to a target sequence, the target sequence being: 5'uugucccaguauucuauguuu 3' SEQ ID NO: 826, the starting position of which is at position 3073 in NM_001735.3, and the base complementarity between the sense strand and the antisense strand is at least 85%.

[0023] The aforementioned RNA inhibitor for inhibiting complement system gene expression or a pharmaceutically acceptable salt thereof, wherein the RNA inhibitor is an RNA inhibitor for inhibiting C3 gene expression, wherein the antisense strand includes a region complementary to a target sequence, the target sequence being: 5'gguguugacagauacaucu 3' SEQ ID NO: 1952, the starting position in NM_000064.4 is at position 4329; 5'ggagccuacagagaaauucua 3' SEQ ID NO: 2039, the starting position in NM_000064.4 is at position 771; the target sequence being: 5'agaaauucuacuacaucuaua 3' SEQ ID NO: 2048, the starting position in NM_000064.4 is at position 782; the target sequence being: 5'gcugaggagaauugcuucaua 3' SEQ ID NO: NO: 2240, the starting position in NM_000064.4 is 4603; the target sequence is: 5'ggagaauugcuucauacaaaa 3' SEQ ID NO: 2245, the starting position in NM_000064.4 is 4608; there is at least 85% base complementarity between the sense strand and the antisense strand.

[0024] The antisense strand of the aforementioned CFB RNA inhibitor or a pharmaceutically acceptable salt thereof is selected from the following sequences:

[0025] 5'ucucaauuaaguugacuagacac 3'SEQ ID NO: 293;

[0026] or a sequence having at least 15 consecutive nucleotides identical to the antisense strand, or a sequence differing from the antisense strand by one, two, or three nucleotides, the sense strand being any sequence having at least 85% base complementarity with the antisense strand;

[0027] Wherein, g = guanylate, a = adenylate, u = uridine, c = cytidylate, and t = thymidine deoxyribonucleotide.

[0028] The aforementioned CFB RNA inhibitor or a pharmaceutically acceptable salt thereof, wherein the sense chain is selected from the following sequences:

[0029] 5'gucuagucaacuuaauugaga 3'SEQ ID NO: 25;

[0030] or a sequence having at least 15 consecutive nucleotides identical to the sense strand, or a sequence differing from the sense strand by one, two, or three nucleotides, the sense strand being any sequence having at least 85% base complementarity with the antisense strand;

[0031] Wherein, g = guanylate, a = adenylate, u = uridylate, and c = cytidylate.

[0032] The antisense strand of the aforementioned C5 RNA inhibitor or a pharmaceutically acceptable salt thereof is selected from the following sequences:

[0033] 5'aaacauagaauacugggacaacg 3'SEQ ID NO: 1278;

[0034] or a sequence having at least 15 consecutive nucleotides identical to the antisense strand, or a sequence differing from the antisense strand by one, two, or three nucleotides, the sense strand being any sequence having at least 85% base complementarity with the antisense strand;

[0035] Wherein, g = guanylate, a = adenylate, u = uridine, c = cytidylate, and t = thymidine deoxyribonucleotide.

[0036] The aforementioned C5 RNA inhibitor or a pharmaceutically acceptable salt thereof, wherein the sense chain is selected from the following sequences:

[0037] 5'uugucccaguauucuauguuu 3'SEQ ID NO: 826;

[0038] or a sequence having at least 15 consecutive nucleotides identical to the sense strand, or a sequence differing from the sense strand by one, two, or three nucleotides, the antisense strand can be any sequence containing at least 85% base complementarity with the sense strand;

[0039] Wherein, g = guanylate, a = adenylate, u = uridylate, and c = cytidylate.

[0040] The antisense strand of the aforementioned C3 RNA inhibitor or a pharmaceutically acceptable salt thereof is selected from the following sequences:

[0041] 5'agauguaucugucaacaccau 3'SEQ ID NO.2543;

[0042] 5'uagaauuucucugaggcuccac 3'SEQ ID NO.2630;

[0043] 5'uauagauguaguagaauuucucu 3'SEQ ID NO.2639;

[0044] 5'uaugaagcaauucuccagcac 3'SEQ ID NO.2831;

[0045] 5'uuuuguaugaagcaauucuccuc 3'SEQ ID NO.2590;

[0046] or a sequence having at least 15 consecutive nucleotides identical to the antisense strand, or a sequence differing from the antisense strand by one, two or three nucleotides,

[0047] Wherein, g = guanylate, a = adenylate, u = uridylate, c = cytidylate, t = thymidine deoxyribonucleotide; the sense strand can be any sequence that contains at least 85% base complementarity with the antisense strand.

[0048] The aforementioned C3 RNA inhibitor or a pharmaceutically acceptable salt thereof, wherein the sense chain is selected from the following sequences:

[0049] 5'gguguugacagauacaucu 3'SEQ ID NO.1952;

[0050] 5'ggagccuacagagaaauucua 3'SEQ ID NO.2039;

[0051] 5'agaaauucuacuacaucuaua 3'SEQ ID NO.2048;

[0052] 5'gcugaggagaauugcuucua 3'SEQ ID NO.2240;

[0053] 5'ggagaauugcuucauacaaaa 3'SEQ ID NO.2245;

[0054] or a sequence having at least 15 consecutive nucleotides identical to the sense strand, or a sequence differing from the sense strand by one, two, or three nucleotides,

[0055] Wherein, g = guanylate, a = adenylate, u = uridylate, c = cytidylate; the antisense strand can be any sequence that contains at least 85% base complementarity with the sense strand.

[0056] The aforementioned CFB RNA inhibitor or a pharmaceutically acceptable salt thereof, wherein the sense strand is SEQ ID NO: 25, or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence differing therefrom by one, two, or three nucleotides; and the antisense strand is SEQ ID NO: 293, or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence differing therefrom by one, two, or three nucleotides:

[0057] Sense strand: 5'gucuagucaacuuaauugaga 3' SEQ ID NO: 25;

[0058] Antisense strand: 5'ucucaauuaaguugacuagacac 3' SEQ ID NO: 293;

[0059] Wherein, g = guanylate, a = adenylate, u = uridine, c = cytidylate, and t = thymidine deoxyribonucleotide.

[0060] The aforementioned C5 RNA inhibitor or a pharmaceutically acceptable salt thereof, wherein the sense strand is SEQ ID NO: 826, or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence that differs therefrom by one, two, or three nucleotides; and the antisense strand is SEQ ID NO: 1278, or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence that differs therefrom by one, two, or three nucleotides:

[0061] Sense strand: 5'uugucccaguauucuauguuu 3' SEQ ID NO: 826;

[0062] Antisense strand: 5'aaacauagaauacugggacaacg 3' SEQ ID NO: 1278;

[0063] Wherein, g = guanylate, a = adenylate, u = uridine, c = cytidylate, and t = thymidine deoxyribonucleotide.

[0064] The aforementioned C3 RNA inhibitor or a pharmaceutically acceptable salt thereof, wherein the sense strand is SEQ ID NO: 2048, or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence that differs therefrom by one, two, or three nucleotides; and the antisense strand is SEQ ID NO: 2639, or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence that differs therefrom by one, two, or three nucleotides:

[0065] Sense strand: 5'agaaauucuacuacaucuaua 3' SEQ ID NO: 2048;

[0066] Antisense strand: 5'uauagauguaguagaauuucucu 3' SEQ ID NO: 2639;

[0067] Wherein, g = guanylate, a = adenylate, u = uridine, c = cytidylate, and t = thymidine deoxyribonucleotide.

[0068] The aforementioned C3 RNA inhibitor or a pharmaceutically acceptable salt thereof, wherein the sense strand is SEQ ID NO: 2639, or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence differing therefrom by one, two, or three nucleotides; and the antisense strand is SEQ ID NO: 2831, or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence differing therefrom by one, two, or three nucleotides:

[0069] Sense strand: 5'gcugaggagaauugcuucaua 3' SEQ ID NO: 2240;

[0070] Antisense strand: 5'uaugaagcaauucuccucagcac 3' SEQ ID NO: 2831;

[0071] Wherein, g = guanylate, a = adenylate, u = uridine, c = cytidylate, and t = thymidine deoxyribonucleotide.

[0072] The aforementioned RNA inhibitor or a pharmaceutically acceptable salt thereof, wherein at least one nucleotide of the RNA inhibitor is modified.

[0073] The aforementioned RNA inhibitor or a pharmaceutically acceptable salt thereof, the modification includes: 2'-fluoro modification, 2'-methoxy modification, thiophosphate modification, invAb modification, glycerol nucleotide, 3'-terminal deoxythymine (dT) nucleotide, locked nucleotide, unlocked nucleotide, conformationally restricted nucleotide, constrained ethyl nucleotide, 2'-amino modified nucleotide, 2'-O-allyl modified nucleotide, 2'-C-alkyl modified nucleotide, 2'-hydroxyl modified nucleotide, 2'-methoxyethyl modified nucleotide, 2'-O-alkyl modified nucleotide, 2' phosphate modification or 2-O-(N-methylacetamide) modification, morpholino nucleotide, phosphoramidate, abasic nucleotide, abasic deoxynucleotide, nucleotide containing non-natural base, tetrahydropyran modified nucleotide, 1,5-anhydrohexitol modified nucleotide, cyclohexenyl modified nucleotide, methylphosphonate modification, 5'-phosphate modification, 5'-phosphate analog modification, thermally unstable nucleotide, nucleotide analogs or a combination of several thereof.

[0074] The antisense strand of the aforementioned CFB RNA inhibitor or a pharmaceutically acceptable salt thereof is selected from the following sequences:

[0075] 5'UsdCsUCdAATUAAGTUfGACUAGACsAsC 3'SEQ ID NO: 588;

[0076] Among them, G = 2'-O-methylguanylate, A = 2'-O-methyladenylate, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Cs = 2'-O-methyl-3'-thiocytidylate; fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidylate; fGs = 2'-fluoro-3'-thioguanylate, T = 2'-deoxythymidylate, dA = 2'-deoxyadenylate, dG = 2'-deoxyguanylate; the sense strand can be any sequence containing at least 85% base complementarity with the antisense strand, and the modification method is not limited.

[0077] The antisense strand of the aforementioned C5 RNA inhibitor or a pharmaceutically acceptable salt thereof is selected from the following sequences:

[0078] 5'AsdAsACdAUdAGAAUdACfUGGGACAAsCsG 3'SEQ ID NO: 1598;

[0079] Among them, G = 2'-O-methylguanylate, A = 2'-O-methyladenylate, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Cs = 2'-O-methyl-3'-thiocytidylate; fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidylate; fGs = 2'-fluoro-3'-thioguanylate, T = 2'-deoxythymidylate, dA = 2'-deoxyadenylate, dG = 2'-deoxyguanylate; the sense strand can be any sequence containing at least 85% base complementarity with the antisense strand, and the modification method is not limited.

[0080] The antisense strand of the aforementioned C3 RNA inhibitor or a pharmaceutically acceptable salt thereof is selected from the following sequences:

[0081] 5'UsdAsUAdGATGUAGTAfGAAUUUCUsCsU 3'SEQ ID NO: 1665;

[0082] 5'UsfAsUGAfAGfCAAUUCfUCfCUCAGCsAsC 3'SEQ ID NO: 1671;

[0083] Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenosine, U = 2'-O-methyluridine, C = 2'-O-methylcytidine; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridine, Cs = 2'-O-methyl-3'-thiocytidine; fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridine The sense strand can be any sequence that contains at least 85% base complementarity with the antisense strand, and the modification method is not limited.

[0084] The aforementioned CFB RNA inhibitor or a pharmaceutically acceptable salt thereof, wherein the sense chain is selected from the following sequences:

[0085] 5'GsUsCUAGfUCfAfAfCUUAAUUGAsGsA 3'SEQ ID NO: 559;

[0086] Among them, G = 2'-O-methylguanylate, A = 2'-O-methyladenosine, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'-O-methyl-3'-thiocytidylate; fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidylate; the antisense strand can be any sequence containing at least 85% base complementarity with the sense strand, and the modification method is not limited.

[0087] The aforementioned C5 RNA inhibitor or a pharmaceutically acceptable salt thereof, wherein the sense chain is selected from the following sequences:

[0088] 5'UsUsGUCCfCAfGfUfAUUCUAUGUsUsU 3'SEQ ID NO: 1537;

[0089] Among them, G = 2'-O-methylguanylate, A = 2'-O-methyladenosine, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'-O-methyl-3'-thiocytidylate; fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidylate; the antisense strand can be any sequence containing at least 85% base complementarity with the sense strand, and the modification method is not limited.

[0090] The aforementioned C3 RNA inhibitor or a pharmaceutically acceptable salt thereof, wherein the sense chain is selected from the following sequences:

[0091] 5'AsGsAAAUfUCfUfAfCUACAUCUAsUsA 3'SEQ ID NO: 1645;

[0092] 5'GsCsUGAGfGAfGfAfAUUGCUUCAsUsA 3'SEQ ID NO: 1651;

[0093] Among them, G = 2'-O-methylguanylate, A = 2'-O-methyladenosine, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'-O-methyl-3'-thiocytidylate; fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidylate; the antisense strand can be any sequence containing at least 85% base complementarity with the sense strand, and the modification method is not limited.

[0094] Preferably, the aforementioned CFB RNA inhibitor or a pharmaceutically acceptable salt thereof has a sense strand represented by SEQ ID NO: 559 or a sequence differing therefrom by one, two, or three nucleotides, and an antisense strand represented by SEQ ID NO: 588 or a sequence differing therefrom by one, two, or three nucleotides:

[0095] Sense strand: 5'GsUsCUAGfUCfAfAfCUUAAUUGAsGsA 3' SEQ ID NO: 559;

[0096] Antisense strand: 5'UsdCsUCdAATUAAGTUfGACUAGACsAsC 3' SEQ ID NO: 588;

[0097] Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenylate, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'-O-methyl-3'-thiocytidylate; fG = 2'-fluoroguanylate, f A = 2'-fluoroadenylic acid, fU = 2'-fluorouridylic acid, fC = 2'-fluorocytidylic acid; fGs = 2'-fluoro-3'-thioguanylic acid, fAs = 2'-fluoro-3'-thioadenylic acid, fUs = 2'-fluoro-3'-thiouridylic acid, fCs = 2'-fluoro-3'-thiocytidylic acid, T = 2'-deoxy-thymidylic acid, Ts = 2'-deoxy-3'-thiothymidylic acid, dA = 2'-deoxy-adenylic acid.

[0098] Preferably, the aforementioned C5 RNA inhibitor or a pharmaceutically acceptable salt thereof has a sense strand of SEQ ID NO: 1537 or a sequence differing therefrom by one, two, or three nucleotides, and an antisense strand of SEQ ID NO: 1598 or a sequence differing therefrom by one, two, or three nucleotides:

[0099] Sense strand: 5'UsUsGUCCfCAfGfUfAUUCUAUGUsUsU 3' SEQ ID NO: 1537;

[0100] Antisense strand: 5'AsdAsACdAUdAGAAUdACfUGGGACAAsCsG 3' SEQ ID NO: 1598;

[0101] Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenylate, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'-O-methyl-3'-thiocytidylate; fG = 2'-fluoroguanylate, f A = 2'-fluoroadenylic acid, fU = 2'-fluorouridylic acid, fC = 2'-fluorocytidylic acid; fGs = 2'-fluoro-3'-thioguanylic acid, fAs = 2'-fluoro-3'-thioadenylic acid, fUs = 2'-fluoro-3'-thiouridylic acid, fCs = 2'-fluoro-3'-thiocytidylic acid, T = 2'-deoxy-thymidylic acid, Ts = 2'-deoxy-3'-thiothymidylic acid, dA = 2'-deoxy-adenylic acid.

[0102] Preferably, the aforementioned C3 RNA inhibitor or a pharmaceutically acceptable salt thereof has a sense strand of SEQ ID NO: 1651 or a sequence differing therefrom by one, two, or three nucleotides, and an antisense strand of SEQ ID NO: 1671 or a sequence differing therefrom by one, two, or three nucleotides:

[0103] Sense strand: 5'AsGsAAAUfUCfUfAfCUACAUCUAsUsA 3' SEQ ID NO: 1645;

[0104] Antisense strand: 5'UsdAsUAdGATGUAGTAfGAAUUUCUsCsU 3' SEQ ID NO: 1665;

[0105] Alternatively, the sense strand is SEQ ID NO: 1645 or a sequence differing therefrom by one, two or three nucleotides, and the antisense strand is SEQ ID NO: 1665 or a sequence differing therefrom by one, two or three nucleotides:

[0106] Sense strand: 5'GsCsUGAGfGAfGfAfAUUGCUUCAsUsA 3' SEQ ID NO: 1651;

[0107] Antisense strand: 5'UsfAsUGAfAGfCAAUUCfUCfCUCAGCsAsC 3' SEQ ID NO: 1671;

[0108] Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenylate, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'-O-methyl-3'-thiocytidylate; fG = 2'-fluoroguanylate, f A = 2'-fluoroadenylic acid, fU = 2'-fluorouridylic acid, fC = 2'-fluorocytidylic acid; fGs = 2'-fluoro-3'-thioguanylic acid, fAs = 2'-fluoro-3'-thioadenylic acid, fUs = 2'-fluoro-3'-thiouridylic acid, fCs = 2'-fluoro-3'-thiocytidylic acid, T = 2'-deoxy-thymidylic acid, dG = 2'-deoxy-guanylic acid, dAs = 2'-deoxy-3'-thioadenylic acid.

[0109] In some embodiments, mismatches can be accommodated in the sense strand or antisense strand of the RNA inhibitor of the present invention. The mismatch position can occur at the 5' or 3' end or within the sequence. As a preference, the mismatch is no more than 3 nucleotides, for example, 0, 1, 2, or 3 nucleotides.

[0110] In a technical manner, preferably, the RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof further contains carrier structures 5'MVIP and 3'MVIP, and the structure of the RNA inhibitor is as shown in Formula Ia, Ib or Ic:

[0111] in,

[0112] The vector structure includes 5'MVIP (5'MultiValent Import Platform) and 3'MVIP (3'MultiValent Import Platform);

[0113] 5'MVIP consists of a transfer point R1, a connecting chain D, a linker B, a side chain L, and a liver-targeting specific ligand X. It is connected to the 5' end of the sense chain or the 5' end of the antisense chain through the transfer point R1. Its structure is shown in Formula I:

[0114] (XL) n -BD-R1-

[0115] I

[0116] 3'MVIP consists of a transfer point R2, a connecting chain D, a linker B, a side chain L, and a liver-targeting specific ligand X. It is connected to the 3' end of the sense chain or the 3' end of the antisense chain through the transfer point R2. Its structure is shown in Formula II:

[0117] (XL) m -BD-R2-

[0118] II

[0119] in,

[0120] n and m are each independently any integer from 0 to 4, preferably an integer from 1 to 3, and n+m=an integer from 2 to 6, preferably n+m=2, 3 or 4, more preferably 4;

[0121] The transition point R1 is a heterocyclic or carbocyclic structure containing N, S or O as shown below:

[0122] Alternatively, R1 is -NH(CH2) x CH2O-, wherein x is any integer from 3 to 12, preferably any integer from 4 to 6;

[0123] The transition point R2 is a heterocyclic or carbocyclic structure containing N, S or O as shown below:

[0124] Alternatively, the transfer point R2 is -NH(CH2) x1CH(OH)(CH2) x2 CH2O-, wherein x1 is any integer from 1 to 4, and x2 is any integer from 0 to 4;

[0125] The liver-targeting specific ligand X is selected from a structure for enhancing the uptake of RNA inhibitors by hepatocytes, and is the same or different within each of 5'MVIP and 3'MVIP or between 5'MVIP and 3'MVIP, and is selected from monosaccharides and their derivatives, preferably N-acetylgalactosamine and its derivatives, and more preferably selected from the following structures:

[0126] Wherein, W is selected from -OH, -NHCOOH and -NHCO(CH2) q One or two of CH3, wherein q is an integer from 0 to 4;

[0127] The branch chain L is the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP, and is selected from one or more of the following structures:

[0128] wherein r1 is any integer from 1 to 12, r2 is any integer from 0 to 20, and Z is H, an alkyl group or an amide group, wherein the alkyl group is, for example, a C1-C5 alkyl group;

[0129] Linker B is the same or different within each of 5'MVIP and 3'MVIP or between 5'MVIP and 3'MVIP, and is selected from the following structures:

[0130] wherein A1 and A2 are each independently C, O, S, -NH-, carbonyl, amide, phosphoryl or thiophosphoryl, and r is any integer from 0 to 4;

[0131] The connecting chain D is the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP, and is selected from the following structures:

[0132] Wherein, each p is independently any integer from 1 to 20; s is any integer from 2 to 13; Z1 and Z2 are the same or different substituent groups, such as C3-C 10 alkyl.

[0133] In some embodiments, the 5'MVIP is selected from any one of 5'MVIP01 to 5'MVIP22 in Table 11.

[0134] In some embodiments, the 3'MVIP is selected from any one of 3'MVIP01 to 3'MVIP27 in Table 12.

[0135] In some embodiments, in the RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof, 5'MVIP is 5'MVIP01 or 5'MVIP09 as shown below, and 3'MVIP is 3'MVIP01, 3'MVIP09 or 3'MVIP17 as shown below:

[0136] In some embodiments, in the RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof, the combination of the sense chain 5'MVIP and the antisense chain 3'MVIP is 5'MVIP01 / 3'MVIP01, 5'MVIP01 / 3'MVIP17 or 5'MVIP09 / 3'MVIP09, or the combination of the sense chain 5'MVIP and the antisense chain 3'MVIP is 5'MVIP01 / 3'MVIP09 or 5'MVIP09 / 3'MVIP01.

[0137] In another aspect, the CFB RNA inhibitor is selected from Kylo-17-DS2911.

[0138] In another aspect, the C5 RNA inhibitor is selected from Kylo-19-DS7881.

[0139] In another aspect, the C3 RNA inhibitor is selected from Kylo-27-DS8201 and Kylo-27-DS8141.

[0140] In another aspect, the RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof is used in the preparation of a medicament for treating and / or preventing diseases associated with increased levels of the complement system, including but not limited to lipid metabolism disorders.

[0141] In another aspect, a pharmaceutical composition comprises the aforementioned RNA inhibitor or other therapeutic agents for treating or preventing diseases related to the complement system.

[0142] On the other hand, a pharmaceutical composition comprises the aforementioned RNA inhibitor or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient, and the dosage form is oral, intravenous, or subcutaneous or intramuscular injection, preferably subcutaneous injection.

[0143] Those skilled in the art can easily discern other aspects and advantages of the present application from the detailed description below. In the detailed description below, only exemplary embodiments of the present application are shown and described. As will be appreciated by those skilled in the art, the content of this application enables those skilled in the art to modify the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application relates. Accordingly, the descriptions in the drawings and specification of this application are merely exemplary and not restrictive. BRIEF DESCRIPTION OF THE DRAWINGS

[0144] The specific features of the invention involved in this application are shown in the appended claims. The features and advantages of the invention involved in this application can be better understood by referring to the exemplary embodiments described in detail below and the accompanying drawings.

[0145] The accompanying drawings are briefly described as follows:

[0146] Figure 1 is a high-resolution mass spectrum of ERCd-01-c2 synthesized in 3.1.15 of Example 3 of the present application;

[0147] Figure 2 is a high-resolution mass spectrum of 3'MVIP17-c1 synthesized in 3.1.2.6 of Example 3 of the present application;

[0148] FIG3 is a high-resolution mass spectrum of 5'MVIP09-ERCd-PFP-c2 synthesized in 3.2.1.2 of Example 3 of the present application;

[0149] FIG4 is a schematic diagram showing the effect of hCFB administration of the present invention on the hCFB protein inhibition rate in mouse serum;

[0150] FIG5 is a schematic diagram showing the effect of hC5 administration of Example 7-2 of the present invention on the inhibition rate of hC5 protein in mouse serum;

[0151] FIG6 is a schematic diagram showing the effect of hC5 administration of Example 7-3 of the present invention on the inhibition rate of hC5 protein in mouse serum;

[0152] FIG7 is a schematic diagram showing the effect of hC3 administration of the present invention on the hC3 protein inhibition rate in mouse serum;

[0153] FIG8 is a schematic diagram showing the effect of the CFB RNA inhibitor of the present invention on the inhibition rate of CFB protein in NHP cynomolgus monkeys;

[0154] FIG9 is a schematic diagram showing the effect of the CFB RNA inhibitor of the present invention on CFB mRNA levels in cynomolgus monkey liver tissue;

[0155] Figure 10 is a schematic diagram showing the effect of the C5 RNA inhibitor of the present invention on the inhibition rate of NHP cynomolgus monkey C5 protein;

[0156] Figure 11 is a schematic diagram showing the effect of the C5 RNA inhibitor of the present invention on the retention level of CH50 activity in NHP cynomolgus monkeys;

[0157] Figure 12 is a schematic diagram showing the effect of the C3 RNA inhibitor of the present invention on the inhibition rate of NHP cynomolgus monkey C3 protein; DETAILED DESCRIPTION

[0158] The following describes the embodiments of the present invention through specific embodiments. People skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification.

[0159] Definition of terms

[0160] In the present application, examples of complement system mRNA sequences are readily available using publicly available databases, such as GenBank, UniProt, OMIM, and the Macaca Genome Project website.

[0161] The term "CFB" refers to complement factor B, the mRNA sequences of which can be found, for example, in GenBank at NM_001710.5; 001710; cynomolgus monkey NC_041757.1, mouse NM_001142706 and NM_008198; rat NM_212466.3.

[0162] The term "C3" refers to complement C3, the mRNA sequence of which can be found, for example, in GenBank NM_000064.4; cynomolgus monkey NC_000019.10; mouse NM_009778; rat NM_016994.

[0163] The term "C5" refers to complement C5, the mRNA sequence of which can be found, for example, in GenBank NM_001735.3; mouse NM_013485; rat NM_057146.

[0164] Indicators for determining "inhibition of CFB expression" include: inhibition of any level of inhibition, such as inhibition of the CFB gene mRNA level, inhibition of the CFB gene protein level, etc., and may also be: CH50 activity as a measure of total hemolytic complement, AH50 measuring the hemolytic activity of the alternative complement pathway, and / or lactate dehydrogenase (LDH) level as a measure of intravascular hemolysis, and / or hemoglobin level; the levels of C3, C9, C5, C5a, C5b and soluble C5b-9 complex may also be measured to evaluate the CFB expression level.

[0165] Indicators for determining "inhibition of C3 expression" include: C3 assays, total complement assays, immune complex assays, C3 plasma concentration assays, and C3 fixed antibody assays. C3 assays can measure any level of inhibition, including inhibition of C3 gene mRNA or protein levels. C3 assays may be performed in conjunction with other complement components to assess the function of the entire complement system. This typically includes measuring C4 concentrations and indicators such as CH50. Immune complex assays: Immune complexes are structures composed of antibodies and antigens and are formed in certain autoimmune diseases. Serum immune complex assays can be used to detect these immune complexes to assess whether they have activated the immune system, leading to a decrease in C3. C3 plasma concentration assays: Complement system function is assessed by measuring C3 concentrations in plasma. Under normal circumstances, C3 concentrations should be within the normal range. C3 fixed antibody assays: This method measures the ability of C3 to bind to specific antigens to assess complement system function. Alternatively, indices related to C3 gene levels may be measured, such as CH50 activity, which measures total hemolytic complement, AH50, which measures hemolytic activity of the alternative complement pathway, and / or lactate dehydrogenase (LDH) levels, which measure intravascular hemolysis, and / or hemoglobin levels. C3 expression may also be assessed by measuring levels of CFB, C9, C5, C5a, C5b, and soluble C5b-9 complex.

[0166] Indicators for judging "inhibition of C5 expression" include: inhibition of any level of inhibition, such as inhibition of the mRNA level of the C5 gene, inhibition of the protein level of the C5 gene, and can also be: CH50 activity as a measure of total hemolytic complement, AH50 measuring the hemolytic activity of the complement alternative pathway, and / or lactate dehydrogenase (LDH) level as a measure of intravascular hemolysis, and / or hemoglobin level; the levels of C3, C9, C5, C5a, C5b and soluble C5b-9 complex can also be measured to evaluate the CFB expression level.

[0167] In this application, a "target sequence" refers to a continuous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a complement system gene, including mRNA that is a product of RNA processing of the primary transcript. In some embodiments, the target portion of the sequence will be at least long enough to serve as a substrate for RNA inhibitor-directed degradation at or near the portion of the nucleotide sequence of the mRNA molecule formed during the transcription of a complement system gene. The length of a "target sequence" is typically about 15-30 nucleotides.

[0168] In this application, the term "RNA inhibitor" generally refers to an agent comprising RNA as defined in the present invention, and which can mediate targeted cleavage of RNA transcripts through the RNA-induced silencing complex (RISC) pathway. Through a process known as RNA inhibition, the sequence-specific degradation of mRNA is directed, regulating (e.g., inhibiting) the expression of complement system genes in cells (e.g., cells in a subject such as a mammalian subject).

[0169] In some embodiments, the RNA inhibitor can be a single-stranded siRNA (ssRNA inhibitor) introduced into a cell or organism to inhibit a target mRNA (i.e., a complement system gene). The single-stranded RNA inhibitor binds to the RISC endonuclease Argonaute 2, which then cleaves the target mRNA. The single-stranded siRNA is generally 15 to 30 nucleotides in length and is chemically modified.

[0170] In some embodiments, the "RNA inhibitor" used herein is double-stranded RNA and is referred to herein as a "double-stranded RNA inhibitor," "double-stranded RNA (dsRNA, DS) molecule," "dsRNA agent," or "dsRNA." The term "dsRNA" refers to a complex of ribonucleic acid molecules having a duplex structure comprising two antiparallel and substantially complementary nucleic acid strands, referred to as having "sense" and "antisense" orientations relative to the target mRNA. In some embodiments of the present application, double-stranded RNA (dsRNA) triggers degradation of the target mRNA through a post-transcriptional gene silencing mechanism (referred to herein as RNA inhibition or RNA interference).

[0171] The duplex structure can be any length that triggers the specific degradation of complement system mRNA through the RISC pathway, and can be in the range of about 15 to 36 base pairs in length, for example, about 15-30 base pairs in length, for example, about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or 36 base pairs in length. In certain embodiments, the RNA inhibitor of the present application is a dsRNA of 15-30 nucleotides that interacts with the target sequence to guide the cleavage of the complement system mRNA.

[0172] Typically, most of the nucleotides in the sense and antisense strands of a dsRNA molecule are ribonucleotides, but as described in detail herein, may also include one or more non-ribonucleotides, for example, deoxyribonucleotides or modified nucleotides. In addition, the RNA inhibitors described herein may include chemically modified ribonucleotides, and may have modified nucleotides in multiple regions. The term "modified nucleotides" as used herein refers to nucleotides that independently have modified sugar moieties, modified internucleotide linkages, or modified nucleobases, or any combination thereof. Therefore, the term "modified nucleotides" encompasses substitutions, additions, or removals of, for example, functional groups or atoms of internucleotide linkages, sugar moieties, or nucleobases. Modifications applicable to the RNA inhibitors of the present application include all types of modifications disclosed herein or known in the art.

[0173] In this application, the term "nucleotide sequence" generally refers to a series or sequence of nucleotides, whether modified or unmodified, described as a series of letters using standard nucleotide nomenclature and the symbol table for modified nucleotides described in this application. The nucleotide sequence described in this application is a polymer composed of phosphodiester bonds (or related structural variants or synthetic analogs thereof), including naturally occurring nucleotide polymers, but it should be understood that the scope of the term also includes various analogs, including but not limited to: peptide nucleic acids (PNA), phosphoramidates, phosphorothioates, methylphosphonates and 2'-O-methyl ribonucleic acids. Typically, there are about 15-30 nucleotides, but the term can also refer to molecules of any length.

[0174] In some embodiments, the nucleotide sequence comprises one or more unmodified ribonucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleotides. The term "modified nucleotide sequence" generally refers to a series or sequence of nucleotides comprising at least one modification and / or at least one modified internucleotide linkage.

[0175] In this application, the term "modified nucleotides" generally means comprising at least one chemical modification compared to naturally occurring RNA or DNA nucleotides. For example, 2'-deoxy-thymidylic acid 2'-O-methyl modified nucleotides, 2'-fluoro-modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, abasic nucleotides, 2'-amino-modified nucleotides, 2'-O-long chain alkyl-modified nucleotides (such as hexadecyl), morpholino nucleotides, phosphoramidate nucleotides, non-natural core base nucleotides, 5'-phosphorothioate nucleotides, and nucleotides connected with cholesterol derivatives or dodecanoic acid didecylamide groups.

[0176] Modified nucleotides contain modified sugar groups and / or modified nucleobases.

[0177] In this application, the term "nucleobase" or "base" generally refers to a heterocyclic pyrimidine or purine compound, which is a component of all nucleic acids and includes adenine, guanine, cytosine, thymine and uracil. Nucleotides can include modified nucleotides or nucleotide mimetics, abasics or alternative replacement moieties. The term "unmodified nucleobase" or "naturally occurring nucleobase" generally refers to the naturally occurring heterocyclic nucleobases of RNA or DNA: the purine bases adenine and guanine; and the pyrimidine bases thymine, cytosine and uracil. "Modified nucleobase" generally refers to any nucleobase that is not a naturally occurring nucleobase.

[0178] In this application, the term "sugar group" generally refers to a naturally occurring sugar group or a modified sugar group of a nucleotide. The term "naturally occurring sugar group" generally refers to a ribofuranosyl group as found in naturally occurring RNA or a deoxyribofuranosyl group as found in naturally occurring DNA. "Modified sugar group" refers to a substituted sugar group or sugar surrogate, for example, a fluoro or methoxy substitution at the 2' position of the sugar group.

[0179] In this application, the term "internucleotide linkage" generally refers to a covalent linkage between adjacent nucleotides in a nucleotide sequence. "Naturally occurring internucleotide linkage" means a 3' to 5' phosphodiester linkage. "Modified internucleotide linkage" means any internucleotide linkage other than a naturally occurring internucleotide linkage.

[0180] In this application, the term "antisense strand" (AS) generally refers to the strand of an RNA inhibitor (e.g., dsRNA) that includes a region that is substantially complementary to a target sequence. As used herein, the term "region of complementarity" generally refers to the region on the antisense strand that is substantially complementary to a sequence defined herein (e.g., a target sequence).

[0181] In this application, the term "sense strand" (SS) generally refers to a strand of an RNA inhibitor (e.g., dsRNA) comprising a region substantially complementary to that of the "antisense strand" (AS). The "sense" strand is sometimes referred to as the "sense" strand, the "passenger" strand, or the "anti-guide" strand. The antisense strand targets the desired mRNA by virtue of the sequence of the sense strand, while the sense strand may target different targets or be degraded. Therefore, if the antisense strand is incorporated into RISC, the correct target is targeted. The incorporation of the sense strand can result in off-target effects. These off-target effects can be limited by using modifications or using 5' end caps on the sense strand.

[0182] The loading of the siRNA duplex into the AGO protein must first be initiated by recognition of the 5' end of the antisense strand, a prerequisite for placing the remainder of the duplex into the AGO protein-nucleic acid binding channel. The AGO protein's MID domain recognizes the nucleotide at the 5' end. Once recognized, the siRNA duplex is loaded into the AGO protein-nucleic acid binding channel to form the pre-RISC. After the siRNA duplex is loaded into the nucleic acid binding channel, the pre-RISC ejects the sense strand (passenger strand) to form the RISC with the remaining antisense strand (guide strand).

[0183] In this application, the term "complementary" refers to the ability of two nucleotide sequences to hybridize under certain conditions, form base pair hydrogen bonds, and form a duplex or double helix structure. For example, the antisense strand of an RNA inhibitor hybridizes with the sense strand of an RNA inhibitor or the complement system mRNA to form Watson-Crick base pairs or non-Watson-Crick base pairs, and includes natural or modified nucleotides or nucleotide mimics. "Complementary" does not necessarily require that each nucleoside has nucleobase complementarity. On the contrary, some mismatches can be tolerated.

[0184] In this application, the term "mismatch" refers to when the region of complementarity is not completely complementary to the target sequence. The mismatch can be in the core region or the terminal region. Generally, the most tolerated mismatch is in the terminal region, for example, within 5, 4, 3 or 2 nucleotides of the 5' end and / or 3' end, and no more than 3 mismatches.

[0185] For example, the results of Gu S, Jin L, Zhang F, Huang Y, Grimm D, Rossi JJ, Kay MA. Thermodynamic stability of small hairpin RNAs highly influences the loading process of different mammalian Argonautes. Proc Natl Acad Sci USA 2011, 108: 9208-9213. indicate that any factor affecting the thermodynamic stability of the double strand, such as mismatches and non-Watson-Crick base pairs, is conducive to the expulsion of the positive strand by pre-RISC to form RISC.

[0186] In this application, the term "ligand" generally refers to any compound or molecule that can covalently or otherwise chemically bind to a biologically active substance (such as dsRNA). In some embodiments, the ligand can interact directly or indirectly with another compound, such as a receptor. The receptor that interacts with the ligand can be present on the cell surface, or alternatively can be an intracellular and / or intercellular receptor. The interaction between the ligand and the receptor can result in a biochemical reaction, or can be simply a physical interaction or binding.

[0187] In this application, the term "pharmaceutically acceptable" generally refers to one or more non-toxic substances that do not inhibit the effectiveness of the biological activity of the active ingredient. Such preparations may generally contain salts, excipients, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. Such pharmaceutically acceptable preparations may also generally include compatible solid or liquid fillers, diluents, or encapsulating materials suitable for administration to humans. When used in medicine, the salt should be a pharmaceutically acceptable salt, but non-pharmaceutically acceptable salts can be conveniently used to prepare pharmaceutically acceptable salts, and these are not excluded from the scope of this application. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, boric acid, formic acid, malonic acid, succinic acid, etc. Pharmaceutically acceptable salts can also be prepared as alkali metal salts or alkaline earth metal salts, such as sodium salts, potassium salts, or calcium salts.

[0188] In this application, the term "lipid nanoparticle" or "LNP" generally refers to a vesicle comprising a lipid layer that encapsulates a pharmacologically active molecule (e.g., dsRNA). LNP is described, for example, in Chinese Patent No. CN103189057B, the entire contents of which are incorporated herein by reference.

[0189] Detailed Description of the Invention

[0190] In one aspect, the present invention provides an RNA inhibitor or a pharmaceutically acceptable salt thereof that inhibits the expression of complement system genes.

[0191] siRNA design

[0192] A panel of siRNAs targeting human complement system genes was screened using self-designed sequence screening software: CFB human: GenBank NM_001710.5; C3 human: GenBank NM_000064.4; C5 human: GenBank NM_001735.3.

[0193] The primary sequences used by CFB are shown in Table 1-1, and the primary sequences used by C5 are shown in Table 1-2:

[0194] The modified secondary sequences used by CFB are shown in Table 2-1, the secondary sequences used by C5 are shown in Table 2-2, and the secondary sequences used by C3 are shown in Table 2-3:

[0195] siRNA Synthesis siRNA was synthesized and annealed using conventional methods known in the art.

[0196] In certain embodiments, the duplex structure (complementary region) formed by the antisense strand and the sense strand comprises at least 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides.

[0197] Table 1-1 CFB primary sequence

[0198] Table 1-2 C5 primary sequence

[0199] Table 1-3 C3 primary sequence

[0200] wherein n is a, u, g, or c, g = guanylate, a = adenylate, u = uridylate, c = cytidine, and t = thymidine deoxyribonucleotide.

[0201] In some screening embodiments, the sense strand and antisense strand of the RNAi agent are selected from the sequences in Table 1 or differ from each sequence in Table 1 by one, two, or three nucleotides.

[0202] In some embodiments, the base pairs of the sense strand in Table 1 and the corresponding antisense strand in Table 1 are complementary to form dsRNA, which may be partially complementary or completely complementary. The partial complementarity may be at least 85% base pairing.

[0203] In some embodiments, the combination of the sense strand and the antisense strand is not limited to the double-strand combination in Table 1. One of the sense strands in Table 1 can be complementary paired with any antisense strand.

[0204] The present invention is intended to protect the core sequence of the sequence in Table 1, which is any segment of the above sequence that is at least 15 consecutive nucleotides, wherein at least 15 refers to 15, 16, 17, 18, 19, 20, 21, 22, 23, etc. In some embodiments, the sense strand is as shown in formula (1): 5'-X core sequence Y-3', the antisense strand and the sense strand have at least 85% base complementarity, X and Y contain 0, 1, 2, 3, 4, 5, or 6 nucleotides, and 0, 1, 2, or 3 unpaired bases can be allowed to exist at the terminal positions in the double strand.

[0205] The antisense strand comprises consecutive nucleotides that differ from formula (2) by 0, 1, 2, or 3 nucleotides, formula (2): 5′-X′ core sequence Y′-3′, the antisense strand and the sense strand have at least 85% base complementarity, X′ and Y′ comprise 0, 1, 2, 3, 4, 5, or 6 nucleotides, and 0, 1, 2, or 3 unpaired bases can be tolerated at the terminal positions in the double strand.

[0206] As an example, the core sequence allows 0, 1, 2, or 3 nucleotide differences, which can be base pairs formed according to the Watson-Crick principle or mismatches.

[0207] In some embodiments, the RNA inhibitor can be administered to cell lines for sequence screening via cell transfection or liposome-nucleic acid nanoparticles, methods well known to those skilled in the art. Patents US9233971B2, US9080186B2, CN102985548B, and CN103189057B regarding methods for preparing lipid compounds and liposome-nucleic acid nanoparticles are incorporated herein in their entirety.

[0208] In some embodiments, the amphoteric lipids in the lipid compound are preferably macrocyclic lipid compounds D1C1, T1C1, T1C6, T4C4, B2C1, B2C6, B2C7 and M10C1.

[0209] As is well known to those skilled in the art, dsRNAs having a duplex structure of approximately 20 to 23 base pairs, for example, 21 base pairs, have been found to be particularly effective in inducing RNA inhibition (Elbashir et al., EMBO 2001, 20: 6877-6888). However, others have found that shorter or longer RNA duplex structures are also effective (Chu and Rana (2007) RNA 14: 1714-1719; Kim et al. (2005) Nat Biotech 23: 222-226). It is reasonable to expect that duplexes containing a sequence in Tables 1 and 2 with a few nucleotides added or subtracted at one or both ends would be similarly effective compared to the dsRNAs described. Thus, inhibitory dsRNAs having a sequence of at least 15, 16, 17, 18, 19, 20, 21 or more consecutive nucleotides derived from a sequence in Tables 1 or 2 that differ by no more than about 5, 10, 15, 20, 25 or 30% in their ability to inhibit complement system gene expression from a dsRNA comprising the entire sequence are included within the scope of this application.

[0210] The dsRNA described herein may further include one or more single-stranded nucleotide overhangs, for example, 1, 2, 3 or 4 nucleotides. The nucleotide overhangs may comprise nucleotides / nucleoside analogs or combinations thereof, including deoxynucleotides. The overhangs may be on the sense strand, the antisense strand or a combination thereof. In addition, the nucleotides of the overhangs may be present at the 5' end, 3' end or both ends of the antisense strand or the sense strand of the dsRNA. The overhangs may be formed by one chain being longer than the other chain, or by two chains of the same length being staggered and formed. When the overhangs are in the antisense strand and may form a mismatch or complement with the complement system mRNA, or may be another sequence. For example, the overhangs may be at the 3' end of the sense strand, or alternatively, at the 3' end of the antisense strand.

[0211] The dsRNA may also have blunt ends, meaning that there are no unpaired nucleotides at that end of the dsRNA, i.e., no nucleotide overhangs. Blunt ends can be located at the 5' end of the antisense strand and the 3' end of the sense strand, or vice versa, or double-ended blunt ends, which are double-stranded dsRNAs along their entire length, i.e., there are no nucleotide overhangs at either end of the molecule.

[0212] In some embodiments, the sense strand or antisense strand of the dsRNA has a nucleotide overhang at the 3' end, the overhang containing 1, 2, 3, or 4 nucleotides, and the 5' end is blunt.

[0213] In some embodiments, the overhang is present at the 3' end of both the sense strand and the antisense strand, and the overhang contains 1, 2, 3 or 4 nucleotides, including but not limited to TT, UU, AU or UA.

[0214] In some embodiments, the dsRNA is 19, 21, or 23 nucleotides in length and is double-stranded throughout its entire length, ie, there are no nucleotide overhangs at either end of the molecule.

[0215] In some embodiments, the dsRNA is 21 nucleotides in length, and both the sense and antisense strands have a 2-nucleotide overhang at the 3' end.

[0216] To enhance the in vivo stability of the RNA inhibitors described herein, the sense and antisense strands of the RNA inhibitors may be modified without affecting their activity or even enhancing their activity. The nucleotides therein may have modifying groups, and the entire strand or a portion thereof may be modified. In some embodiments, one or more nucleotides on the sense and / or antisense strands are modified to form modified nucleotides.

[0217] In some embodiments, the sense and antisense strands of the RNA inhibitors (e.g., dsRNA) described herein are unmodified. In other embodiments, the sense and antisense strands of the RNA inhibitors described herein are chemically modified or coupled as known in the art and as described herein to enhance stability or other advantageous properties. In other embodiments of the present application, all or substantially all nucleotides of the RNA inhibitors described herein may be modified, i.e., the strands of the RNA inhibitors contain no more than 5, 4, 3, 2, or 1 unmodified nucleotides.

[0218] The sense and antisense strands of the RNA inhibitors described herein can be synthesized and / or modified using methods known in the art, such as those described in "Current protocols in nucleic acid chemistry", Beaucage, SL et al. (eds.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. In the RNA inhibitors provided herein, the sense and antisense strands of the RNA inhibitors do not need to be uniformly modified, and one or more modifications can be incorporated into their individual nucleotides.

[0219] In some embodiments, nucleotide modifications include: 5'-terminal modified nucleotides, 3'-terminal modified nucleotides, base modifications, sugar modifications or sugar replacements, and backbone modifications. 5'-terminal modifications include phosphorylation, conjugation, and reverse ligation. 3'-terminal modifications include conjugation, DNA nucleotides, reverse ligation, etc.; base modifications include: replacement with stabilizing bases, destabilizing bases, or bases that pair with an expanded partner library, removal of bases (abasic nucleotides), or conjugated bases. Sugar modifications are generally at the 2' or 4' position. Backbone modifications include: modification or replacement of phosphodiester bonds.

[0220] Specific nucleotide modifications may include, but are not limited to, 5'-terminal phosphorus-containing nucleotide modifications, vinylphosphonate deoxyribonucleotides, vinylphosphonate-containing nucleotides and cyclopropylphosphonate-containing nucleotides, 3'-terminal deoxythymine (dT) nucleotides, 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy modified nucleotides, 2'-amino modified nucleotides, 2'-O-allyl modified nucleotides, 2'-C-alkyl modified nucleotides, 2'-hydroxy modified nucleotides, 2'-methoxyethyl modified nucleotides, 2'-O-alkyl modified nucleotides, 2-O-(N-methylacetamide) modified nucleotides, 3'-O-methoxy (2' internucleoside linkage) nucleotide, 2'-F-arabino nucleotide, 5'-Me / 2'-fluoro nucleotide, locked nucleotide, unlocked nucleotide, unlocked nucleobase analog, conformationally restricted nucleotide, constrained ethyl nucleotide, abasic nucleotide, morpholino nucleotide, phosphoramidate, nucleotide containing a non-natural base, tetrahydropyran-modified nucleotide, 1,5-anhydrohexanol-modified nucleotide, cyclohexenyl-modified nucleotide, nucleotide containing a methylphosphonate group, thermolabile nucleotide, GNA, deoxyribonucleotide, nucleotide analog, morpholino nucleotide, abasic nucleotide, 3' to 3' linked (inverted) nucleotide, bridged nucleotide, peptide nucleic acid (PNA).

[0221] The 5'-terminal phosphorus-containing group modified nucleotide can be a 5'-phosphate nucleotide or a nucleotide deoxynucleotide containing a 5'-phosphate analog; having, but not limited to: 5'-terminal phosphate (5'-P), 5'-terminal thiophosphate (5'-PS), 5-'-terminal thiophosphate diester (5'-PS2), 5'-terminal vinylphosphonate (5'-VP), 5'-terminal methylphosphonate (MePhos) or 5'-deoxy-5'-C-malonyl. When the 5'-terminal phosphorus-containing group is 5'-terminal vinylphosphonate (5'-VP), 5'-VP can be a 5'-E-VP isomer (i.e., trans vinylphosphonate), a 5'-Z-VP isomer (i.e., cis vinyl phosphate) or a mixture thereof.

[0222] Internucleotide modifications may include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, alkylphosphonates, phosphinates, phosphoramidates, thiocarbonylphosphoramidates, thiocarbonylalkylphosphonates, thiocarbonylalkylphosphotriesters, boranephosphates, and various salts and free acids.

[0223] Terminal modifications of the sense or antisense strand can prevent exonuclease degradation and enhance nuclease stability, such as a cap structure: an inverted deoxy abasic cap (abbreviated as invAb). invAb is well known in the art, and specific performance verification is shown in F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16.

[0224] In some embodiments, the 2' position of the nucleotide sugar moiety at at least two or more even-numbered positions starting from the 5' end of the antisense strand is fluorine.

[0225] In some embodiments, all 2' positions of the nucleotide sugar groups at even-numbered positions starting from the 5' end of the antisense strand are fluorine.

[0226] In some embodiments, at least one of the 2' positions of the sugar moieties at positions 2, 4, 6, 8, 12, and 14 from the 5' end of the antisense strand is fluorine. For example, the 2' positions of the sugar moieties at positions 2, 4, 6, 8, 12, and 14 from the 5' end of the antisense strand are all fluorine.

[0227] In some embodiments, except for the 2nd, 6th, 8th, 10th, 14th, and 16th nucleotides starting from the 5' end of the antisense strand, at least one of the 2' positions of the sugar groups of the remaining nucleotides is a methoxy group.

[0228] In some embodiments, except for the 2nd, 4th, 6th, 8th, 14th, and 16th nucleotides starting from the 5' end of the antisense strand, at least one of the 2' positions of the sugar groups of the remaining nucleotides is a methoxy group.

[0229] In some embodiments, except for the 2nd, 4th, 6th, 8th, 14th, 16th, 18th, and 20th nucleotides starting from the 5' end, at least one of the 2' positions of the sugar groups of the remaining nucleotides of the antisense strand is a methoxy group.

[0230] In some embodiments, at least two or more nucleotide sugar groups at odd-numbered positions starting from the 5' end of the sense strand have fluorine at the 2' position.

[0231] In some embodiments, the 2' positions of the nucleotide sugar groups at odd-numbered positions starting from the 5' end of the sense strand are all fluorine.

[0232] In some embodiments, at least one of the 2' positions of the sugar groups of the 5th, 7th, 8th, and 9th nucleotides starting from the 5' end of the sense strand is fluorine. For example, the 2' positions of the sugar groups of the 5th, 7th, 8th, and 9th nucleotides starting from the 5' end of the sense strand are all fluorine.

[0233] In some embodiments, except for the 5th, 7th, 8th, and 9th nucleotides starting from the 5' end of the sense strand, at least one of the 2' positions of the sugar groups of the remaining nucleotides is a methoxy group.

[0234] In some embodiments, at least one of the 2' positions of the sugar groups of the 7th, 9th, 10th, and 11th nucleotides from the 5' end of the sense strand is fluorine. For example, the 2' positions of the sugar groups of the 7th, 9th, 10th, and 11th nucleotides from the 5' end of the sense strand are all fluorine.

[0235] In some embodiments, except for the 7th, 9th, 10th, and 11th nucleotides starting from the 5' end of the sense strand, at least one of the 2' positions of the sugar groups of the remaining nucleotides is a methoxy group.

[0236] In some embodiments, at least one of the 2' positions of the sugar groups of the nucleotides at positions 3, 5, 7, 9, 10, 11, 13, and 15 starting from the 5' end of the sense strand is fluorine. For example, the 2' positions of the sugar groups of the nucleotides at positions 3, 5, 7, 9, 10, 11, 13, and 15 starting from the 5' end of the sense strand are all fluorine.

[0237] In some embodiments, except for the 3rd, 5th, 7th, 9th, 10th, 11th, 13th, and 15th nucleotides starting from the 5' end of the sense strand, at least one of the 2' positions of the sugar groups of the remaining nucleotides is a methoxy group.

[0238] In some embodiments, except for the 7th, 8th, 9th, and 10th nucleotides starting from the 5' end of the sense strand, at least one of the 2' positions of the sugar groups of the remaining nucleotides is a methoxy group.

[0239] For example, the -OH at the 2' position of some or all of the nucleotide sugar groups of the sense chain and / or antisense chain can be substituted, wherein the substituent group is fluorine or methoxy, preferably the 2' position of the nucleotide sugar groups at positions 9, 10, and 11 from the 5' end of the sense chain is fluorine and the 2' position of the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, and 20 from the 5' end of the antisense chain is fluorine, and the 2' position of the remaining nucleotide sugar groups are all methoxy, or preferably the 2' position of the nucleotides at positions 5, 7, 8, and 9 from the 5' end of the sense chain is fluorine and the 2' position of the nucleotide sugar groups at positions 2, 4, 8, 14, and 16 from the 5' end of the antisense chain is fluorine, and the 2' position of the remaining nucleotide sugar groups are all methoxy.

[0240] In some embodiments, there are at least two consecutive phosphorothioate bonds between nucleotides in the sense strand and / or antisense strand.

[0241] In some embodiments, at least two consecutive phosphorothioate bonds exist between three consecutive nucleotides at at least one end of the sense strand and / or the antisense strand.

[0242] For example, there are at least two consecutive phosphorothioate bonds between three consecutive nucleotides at the 5' end and the 3' end of the sense strand and the antisense strand.

[0243] For another example, the 2' position of the sugar group of the nucleotides at positions 9, 10, and 11 from the 5' end of the sense strand is fluorine, and the 2' position of the sugar group of the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, and 20 from the 5' end of the antisense strand is fluorine, and the 2' position of the sugar group of the remaining nucleotides is methoxy, and there are at least two consecutive phosphorothioate bonds between three consecutive nucleotides at the 5' and 3' ends of the sense and antisense strands.

[0244] In some embodiments, the 2' position of some nucleotides in the sense strand is fluorine or methoxy, and at least three phosphate bonds between adjacent nucleotides at the end of the antisense strand can be thiolated. From the 5' end of the sense strand, the 2' position of nucleotides 5, 7, 8, 9 or 3, 5, 7, 8, 9, 11, 13, and 15 is fluorine, and the 2' position of the remaining nucleotides is methoxy, and at least three phosphate bonds between adjacent nucleotides at the end of the antisense strand can be thiolated.

[0245] In some embodiments, the 2' position of some nucleotides in the sense strand is fluorine or methoxy, and at least three phosphate bonds between adjacent nucleotides at the end of the antisense strand can be thiolated. From the 5' end of the sense strand, the 2' position of nucleotides 9, 10, 11, or 3, 5, 7, 8, 9, 11, 13, 15, and / or 17 is fluorine, and the 2' position of the remaining nucleotides is methoxy, and at least three phosphate bonds between adjacent nucleotides at the end of the antisense strand can be thiolated.

[0246] In some embodiments, the RNA inhibitors of the CFB modified sequence of the present invention are selected from the following Table 2-1, the RNA inhibitors of the C5 modified sequence are selected from the following Table 2-2, and the RNA inhibitors of the C3 modified sequence are selected from the following Table 2-3:

[0247] Table 2-1 RNA inhibitors with CFB modified sequences

[0248] Table 2-2 RNA inhibitors with C5 modified sequences

[0249] Table 2-3 RNA inhibitors with C3 modified sequences

[0250] Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenylate, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Ts = 2'-O-methyl-3'-thiothymidylate, Cs = 2'-O-methyl-3'-thiocytidylate; fG = 2'-fluoroguanylate nucleotides, fA = 2'-fluoroadenylic acid, fU = 2'-fluorouridylic acid, fC = 2'-fluorocytidylic acid, fT = 2'-fluorothymidylic acid; fGs = 2'-fluoro-3'-thioguanylic acid, fAs = 2'-fluoro-3'-thioadenylic acid, fUs = 2'-fluoro-3'-thiouridylic acid, fCs = 2'-fluoro-3'-thiocytidylic acid, T = deoxythymidylic acid, dA = 2'-deoxy-adenylic acid, invAb is an inverted deoxy abasic cap, and Tgn is glycol deoxythymidylic acid.

[0251] In some embodiments, the sense strand or antisense strand of the RNA inhibitor described in the present invention has a sequence of at least 15 consecutive nucleotides identical to the sense strand or antisense strand in Tables 1 to 2, or a sequence that differs by one, two, or three nucleotides.

[0252] In some embodiments, the distribution, targeting, or stability of an RNA inhibitor is altered by introducing a ligand for a target tissue receptor into the vector. For example, a specific ligand can provide enhanced affinity for a selected target (e.g., a molecule, cell or cell type, compartment (e.g., a cell or organ compartment, body tissue, organ, or region)) compared to a species in which the ligand is not present.

[0253] The ligand can include naturally occurring substances such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL) or globulins); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactosamine or hyaluronic acid); or lipids. The ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, for example, a synthetic polyamino acid.

[0254] The ligand can also include a targeting group, such as a cell or tissue targeting agent that binds to a specified cell type such as a kidney cell, such as a lectin, glycoprotein, lipid or protein, such as an antibody. The targeting group can be thyrotropin, melanocyte stimulating hormone, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, multivalent fucose, glycosylated polyamino acids, multivalent galactose, transferrin, bisphosphonates, polyglutamic acid, polyaspartic acid, lipid, cholesterol, steroid, bile acid, folic acid, vitamin B12, vitamin A, biotin or RGD peptide or RGD peptide mimetic. In some embodiments, the ligand is a multivalent galactose, such as N-acetyl-galactosamine.

[0255] The sense and antisense strands of the RNA inhibitors of the present invention can be conveniently and routinely prepared by the well-known techniques of solid phase synthesis. Any other method known in the art for such synthesis, such as liquid phase synthesis or fermentation, can be used additionally or alternatively.

[0256] In some embodiments, in addition to commercially available and conventionally used standard nucleoside phosphoramidite monomers and non-standard nucleoside phosphoramidite monomers, the sense strand and antisense strand comprised by the RNA inhibitor of the present application can be synthesized by an automatic synthesizer using a phosphoramidite method derived from carrier-nucleoside phosphoramidite monomers.

[0257] In some embodiments, the ligand of the present invention is coupled to the 5' end and / or 3' end of the antisense strand, and / or the 5' end and / or 3' end of the sense strand via a carrier structure.

[0258] For example, the carrier structure can be coupled to the 5' end and / or the 3' end of the sense strand; or the carrier structure can be coupled to the 5' end of the antisense strand and the carrier structure can be coupled to the 3' end of the sense strand; or the carrier structure can be coupled to the 3' end of the antisense strand and the ligand can be coupled to the 5' end of the sense strand.

[0259] In some embodiments, the carrier structure includes 5'MVIP and 3'MVIP, wherein the 5'MVIP is coupled to the 5' end of the sense strand and / or antisense strand, and the 3'MVIP is coupled to the 3' end of the antisense strand and / or sense strand. The structure of the 5'MVIP is shown in Formula I, and the structure of the 3'MVIP is shown in Formula II.

[0260] (XL) n -BD-R1-,

[0261] I

[0262] (XL) m -BD-R2-,

[0263] II

[0264] in,

[0265] X is a liver-targeting specific ligand;

[0266] L is a branched chain;

[0267] B is the connector;

[0268] D is the connecting chain;

[0269] R1 and R2 are transfer points;

[0270] The 5'MVIP is connected to the 5' end of the sense strand or the 5' end of the antisense strand through the transfer point R1, and the 3'MVIP is connected to the 3' end of the sense strand or the 3' end of the antisense strand through the transfer point R2. n and m are each independently any integer from 0 to 4, and n+m=an integer from 2 to 6, preferably n+m=2, 3 or 4, and more preferably 4.

[0271] In some embodiments, the connection between R1 or R2 and the sense strand or antisense strand is through phosphate or modified phosphate, and R1 or R2 is preferably connected to the sense strand or antisense strand through phosphate or phosphorothioate.

[0272] In some embodiments, m or n may be 0, ie, there is no 3'MVIP or 5'MVIP.

[0273] In some embodiments, when n=0 (ie, there is no 5'MVIP), the structure of the 3'MVIP may be:

[0274] In some embodiments, when n=1, the structure of the 3'MVIP can be:

[0275] In some embodiments, when n=2, the structure of the 3'MVIP can be:

[0276] In some embodiments, when n=3, the structure of the 3'MVIP can be:

[0277] In some embodiments, when n=4, the structure of the 3'MVIP can be:

[0278] In some embodiments, n refers to the sum of n's in 5'MVIPs placed at the 5' ends of both the sense and antisense strands of the RNA inhibitor, and m refers to the sum of m's in 3'MVIPs placed at the 3' ends of both the sense and antisense strands of the RNA inhibitor.

[0279] In some embodiments, the R1 and R2 structures contain -NH-, -S- and / or -O-, and R1 and R2 are connected to the connecting chain D and the 5' end and 3' end of the sense chain and / or antisense chain respectively through the -NH-, -S- or -O- in the structure, and R1 and R2 are the same or different.

[0280] In some embodiments, R1 and R2 are optionally straight carbon chains, or straight carbon chains with amide, carboxyl or alkyl side chains, or cyclic structures, wherein the cyclic structure includes a saturated or unsaturated aliphatic carbocyclic group, or a five-membered or six-membered heterocyclic group or aromatic hydrocarbon group containing sulfur, oxygen or nitrogen atoms.

[0281] In some embodiments, the R1 and / or R2 is -E1(CH2) x CH2E2-, wherein x is any integer from 3 to 12, and the groups E1 and E2 can be -NH-, -S- or -O-, respectively.

[0282] In some embodiments, the R1 and / or R2 is -E1(CH2) x1 CH(OH)(CH2) x2 E2-, wherein x1 or x2 is each independently any integer from 3 to 10, and E1 and E2 can be -NH-, -S- or -O-.

[0283] In some embodiments, R1 is a heterocyclic or carbocyclic structure containing N, S or O as shown below:

[0284] In some embodiments, the transition point R1 is -NH(CH2) x CH2O-, wherein x is any integer from 3 to 12, preferably any integer from 4 to 6, can be introduced by the following two phosphoramidite monomers.

[0285] i. An -O- or -S- group in the R1 structure is used to synthesize the R1 phosphoramidite monomer, which is then incorporated into the 5' end of the sense or antisense strand of an RNA inhibitor via solid-phase synthesis. The -NH-, -S-, or -O- group in this structure is used to connect to the linker strand D in the 5'MVIP, thereby introducing the liver-targeting-specific ligand X into the 5' end of the sense or antisense strand of the RNA inhibitor. An exemplary structure of a monomer incorporated into the 5' end of the sense or antisense strand of an RNA inhibitor is as follows:

[0286] In some embodiments, the following structures are preferred:

[0287] ii. One -NH-, -S-, or -O- in the R1 structure is first connected to the connecting chain D, and the other -NH-, -S-, or -O- is used to form an ester with the phosphoramidite in the synthesis of the 5'MVIP phosphoramidite monomer. Examples of the structures of the sense chain or antisense chain 5'MVIP phosphoramidite monomer are as follows:

[0288] In some embodiments, the 5'MVIP phosphoramidite monomer of the sense chain or antisense chain preferably has the following structure:

[0289] When n in the general formula is 1-4, the linker B portion in the monomer is branched 1 to 4 times to obtain the corresponding monomer compound. With the help of the monomer compound, the liver-targeting specific ligand X is introduced into the 5' end of the sense chain or antisense chain through solid phase synthesis.

[0290] In some embodiments, the transition point R1 is -NH(CH2) x CH2O-, wherein x can be any integer from 3 to 12, preferably any integer from 4 to 6.

[0291] In some embodiments, the 5'MVIP phosphoramidite monomer structure is selected from the following structures:

[0292] In some embodiments, the transition point R2 is a heterocyclic or carbocyclic structure containing N, S, or O as shown below:

[0293] In some embodiments, the transition point R2 is -NH(CH2) x1 CH(OH)(CH2) x2 CH2O-, wherein x1 is any integer from 1 to 4, and x2 is any integer from 0 to 4.

[0294] The transfer point R2 described in the present application is formed by forming an ester or amide with -NH-, -S- or -O- in the R2 structure through succinic anhydride, and coupling with -NH- in the blank Solid Support to form a 3'MVIP solid spport, and then introducing 3'MVIP into the 3' end of the sense chain or antisense chain through the phosphoramidite solid phase synthesis method.

[0295] In some embodiments, the heterocyclic ring in the transition point R2 structure is a pyrrole ring or a piperidine ring, which is connected to the connecting chain D of 3'MVIP via the nitrogen heteroatom in the ring. The exemplary structure of the introduced 3'MVIP solid spport is as follows:

[0296] When m in the general formula is 1-4, the linker B portion in the monomer is branched 1 to 4 times to obtain the corresponding Solid Support.

[0297] In some embodiments, the transition point R2 is -B4(CH2) x1 CH(OH)(CH2) x2 CH2B5-, wherein x1 is any integer from 1 to 4, x2 is any integer from 0 to 4, B4 and B5 are respectively -NH-, -S- or -O-, and the exemplary structure of the introduced 3'MVIP solid spport is as follows:

[0298] When m in the general formula is 1-4, the linker B portion in the monomer is branched 1 to 4 times to obtain the corresponding Solid Support.

[0299] In some embodiments, R2 is -NHCH2CH(OH)CH2O-, and the exemplary structure of the introduced 3'MVIP solid spport is as follows:

[0300] When m in the general formula is 1-4, the linker B portion in the monomer is branched 1 to 4 times to obtain the corresponding Solid Support.

[0301] In some embodiments, the 3'MVIP solid support structure is as follows:

[0302] In some embodiments, the liver-targeting-specific ligand X is selected from structures used to enhance hepatocyte uptake of RNA inhibitors, and may include lipids, steroids, vitamins, sugars, proteins, peptides, polyamines, and peptide mimetics. In the RNA inhibitors provided herein, the liver-targeting-specific ligands X introduced into the ends of the sense or antisense strands of the RNA inhibitors may be identical or different. For example, some may enhance liver targeting, some may regulate the in vivo pharmacokinetics of the RNA inhibitor, or some may possess in vivo lytic activity. In some embodiments, the liver-targeting-specific ligand X is selected from one or more monosaccharides and their derivatives listed below.

[0303] In some embodiments, the monosaccharide is selected from one or more of the following structures: mannose, galactose, D-arabinose, glucose, fructose, xylose, glucosamine, ribose. The monosaccharide derivative is selected from mannose derivatives, galactose derivatives, glucose derivatives, ribose derivatives and other derivatives.

[0304] In some embodiments, the liver-targeting specific ligand X is selected from galactose, galactosamine, N-acetylgalactosamine and derivatives thereof, and its general structural formula is as follows:

[0305] Wherein, W1 is hydrogen or a hydroxyl protecting group, which may be the same or different; W is -OH, -NHCOOH or -NHCO(CH2) q CH3, wherein q is an integer from 0 to 4; W2 is -NH-, O, S or C.

[0306] In some embodiments, the liver-targeting specific ligand X is N-acetylgalactosamine and its derivatives.

[0307] In some embodiments, the liver-targeting specific ligand X is selected from the following structures:

[0308] Wherein, W is selected from -OH, -NHCOOH or -NHCO(CH2) q One or two of CH3, wherein q is an integer of 0-4.

[0309] In some embodiments, the liver-targeting specific ligand X in the same 5'MVIP or 3'MVIP structure may be the same or different.

[0310] In some embodiments, X between 5'MVIP and 3'MVIP may be the same or different.

[0311] In some embodiments, the branched chain L is a group containing -NH-, -C(=O)-, -O-, -S-, amide, phosphoryl, thiophosphoryl, C4-C 10 aliphatic carbocyclic group, phenyl group or a combination of these groups C4-C 18 Carbon chain.

[0312] In some embodiments, the branched chain L further has a hydroxyethyl or carboxylic acid side chain.

[0313] In some embodiments, the side chain L is a C7-C 18 Carbon chain.

[0314] In some embodiments, the side chain L is selected from one or more of the following structures:

[0315] Wherein, r1 is any integer from 1 to 12, r2 is any integer from 0 to 20, and Z is H, an alkyl group or an amide group, such as a C1-C5 alkyl group.

[0316] In some embodiments, the structure of the linker B is related to the number of Xs that can be introduced. The linker B contains -NH-, C, O, S, amide, phosphoryl, or thiophosphoryl. When n or m is 1, it is a straight carbon chain. When n or m is 2, 3, or 4, the number of forks is 2, 3, or 4, respectively.

[0317] In some embodiments, the linker B is selected from the following structures:

[0318] wherein A1 and A2 are each independently C, O, S, -NH-, carbonyl, amide, phosphoryl or thiophosphoryl, and r is an integer of 0-4.

[0319] In some embodiments, the linker B is selected from the following structures:

[0320] Wherein, r is any integer from 0 to 4.

[0321] In some embodiments, the linker B is selected from the following structures:

[0322] In some embodiments, the linker B is selected from the following structures:

[0323] In some embodiments, the connecting chain D is a group containing -NH-, C=O, O, S, amide, phosphoryl, thiophosphoryl, aromatic hydrocarbon, C4-C 10 aliphatic carbocyclic group, a five-membered or six-membered heterocyclic group containing 1 to 3 nitrogen atoms, or a combination of these groups; 18 Carbon chain.

[0324] In some embodiments, the connecting chain D further has a side chain of a hydroxymethyl group, a methyl tert-butyl group, a methylphenol group, or a C5-C6 aliphatic ring group.

[0325] In some embodiments, the connecting chain D is a C3-C ... 10 Carbon chain.

[0326] In some embodiments, the connecting chain D is a C3-C containing two C=O 10 Carbon chain.

[0327] In some embodiments, the connecting chain D is selected from the following structures:

[0328] Wherein, each p is independently any integer from 1 to 20; s is an integer from 2 to 13; Z1 and Z2 are the same or different substituent groups, such as C3-C 10 alkyl.

[0329] In some embodiments, the connecting chain D is selected from the following structures:

[0330] In some embodiments, the connecting chain D is selected from the following structures:

[0331] In some embodiments, the (XL) in the 5'MVIP structure n -BD- and 3'MVIP structures (XL) m -BD- is selected from one or more of the following structures:

[0332] In some embodiments, the X, L, B, and D are the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP.

[0333] In some embodiments, the (XL) in the 5'MVIP structure n -BD- is selected from the structures shown in Table 3:

[0334] Table 3 5'MVIP (XL) n -BD-Structure

[0335] In some embodiments, 5'MVIP may not exist, in which case m may be any integer from 2 to 4.

[0336] In some embodiments, (XL) in the 3'MVIP structure m -BD- is selected from the structures shown in Table 4:

[0337] Table 4 3'MVIP (XL) m -BD-Structure

[0338] In some embodiments, the carrier structure 5'MVIP (XL) n The combinations of -BD- and R1 are shown in Table 5.

[0339] Table 5 5'MVIP Medium (XL) n -BD- and R1 combination

[0340] In some embodiments, 3'MVIP may not exist, in which case n may be any integer from 2 to 4.

[0341] In some embodiments, the carrier structure 3'MVIP (XL) m The combinations of -BD- and R2 are shown in Table 6.

[0342] Table 6 3'MVIP (XL) m -BD- combined with R2

[0343] In some embodiments, the 5'MVIP is selected from any one or more of 5'MVIP01 to 5'MVIP22 in Table 5.

[0344] In some embodiments, the 3'MVIP is selected from any one or more of 3'MVIP01 to 3'MVIP27 in Table 6.

[0345] In some embodiments, a 5'MVIP in Table 5 may be combined with any of the 3'MVIPs in Table 6, where n+m=2, 3, 4, 5, or 6.

[0346] In some embodiments, the sense strand and antisense strand of the CFB RNA inhibitor coupled to the carrier can be selected from the following Table 7-1, the sense strand and antisense strand of the C5 RNA inhibitor coupled to the carrier can be selected from the following Table 7-2, and the sense strand and antisense strand of the C3 RNA inhibitor coupled to the carrier can be selected from the following Table 7-3:

[0347] Table 7-1 Sense or antisense strands coupled to carriers in CFB RNA inhibitors

[0348] Table 7-2 Sense or antisense strands coupled to carriers in C5 RNA inhibitors

[0349] Table 7-3 Sense or antisense strands coupled to carriers in C3 RNA inhibitors

[0350] In some embodiments, the sense strand and antisense strand of the RNA inhibitor described in the present application have a sequence of at least 15 consecutive nucleotides identical to the sense strand and antisense strand in Table 7, or a sequence that differs from the sense strand and antisense strand in Table 7 by one, two, or three nucleotides.

[0351] It should be emphasized that the combination of the sense chain and the antisense chain is not limited to the double-strand combination in Table 7. One of the sense chains in Table 7 can be complementary to any antisense chain; for example, GsUsCUAGfUCfAfAfCUUAAUUGAsGsA (SEQ ID NO: 554) in Table 7-1 can be complementary to UsfCsUfCAfAUfUAAGUUfGAfCUAGACsAsC (SEQ ID NO: 583), UsfCsUfCAfAUfUAAGUUfGAfCUAGsAsC (SEQ ID NO: 584), UsdCsUCdAATUAAGTUfGACUAGACsAsC (SEQ ID NO: 588), UsfCsUCAfAUfUfAAGUUfGAfCUAGACsAsC (SEQ ID NO: 591), UsfCsUfCAfAUfUAAGUUfGAfCUAGACsAsC (SEQ ID NO: 592), and UsfCsUfCAfAUfUAAGUUfGAfCUAGACsAsCTT (SEQ ID NO: 593). NO: 593), UsfCsUCAfAUfUfAAGUUfGAfCUAGACsAsC (SEQ ID NO: 594), any sense chain or antisense chain in the present invention is an independent individual, and the combination method is not limited. At least 85% of the nucleotides can be complementary to each other and can form a double-stranded inhibitor.

[0352] In some embodiments, any sense strand or antisense strand of the present invention can be connected to carriers of different structures. As an example, the 5' end and / or 3' end of any sense strand or antisense strand of the present invention can be connected to 5'MVIP and / or 3'MVIP of different structures. The coupling combination is not limited.

[0353] In some embodiments, the double-stranded RNA inhibitor of the present invention can be optionally conjugated with one or more ligands, and any ligand that can enhance the activity, cellular distribution, or cellular uptake (e.g., entry into cells) of the double-stranded RNA inhibitor can be applied to the double-stranded RNA inhibitor of the present invention. The ligand can be attached to the sense strand, antisense strand, or both strands at the 3' end, the 5' end, or both ends. The vector is not limited to the MVIP listed in the present invention, and may also include, but is not limited to, GalNac vectors of any structure, cationic lipid carriers, viral vectors, lipophilic moieties, amphiphilic moieties, targeting groups, small molecule drugs, proteins, peptides, and antibodies.

[0354] In some embodiments, the antisense strand of the RNA inhibitor of the present invention can be obtained by coupling the antisense strands in Tables 1 and 2 with 5'MVIP and / or 3'MVIP.

[0355] In some embodiments, the antisense strand of the RNA inhibitor described in the present invention has a sequence of at least 15 consecutive nucleotides identical to the antisense strand in Tables 1-2, or a sequence that differs from the antisense strand in Tables 1-2 by one, two, or three nucleotides coupled to 5'MVIP and / or 3'MVIP.

[0356] In some embodiments, the double-stranded RNA inhibitor of the present invention can be optionally conjugated with one or more ligands, and any ligand that can enhance the activity, cellular distribution, or cellular uptake (e.g., entry into cells) of the double-stranded RNA inhibitor can be applied to the double-stranded RNA inhibitor of the present invention. The ligand can be attached to the sense strand, antisense strand, or both strands at the 3' end, the 5' end, or both ends. The vector is not limited to the MVIP listed in the present invention, and may also include, but is not limited to, GalNac vectors of any structure, cationic lipid carriers, viral vectors, lipophilic moieties, amphiphilic moieties, targeting groups, small molecule drugs, proteins, peptides, and antibodies.

[0357] Patent CN113171371B examines in detail the effects of different X, L, B, D, R1 and R2 in the 5'MVIP and / or 3'MVIP structures on the RNA inhibitory activity, and the entire text of this patent is incorporated into the present invention.

[0358] When X is galactose, galactosamine, N-acetylgalactosamine and its derivatives, among the RNA inhibitors provided by the present invention, N-acetylgalactosamine and its derivatives are preferably used as liver-targeting specific ligands, as shown in Table 8:

[0359] Table 8

[0360] The length of L significantly influences the efficacy of RNA inhibitors; the L chain should be neither too short nor too long. When containing -NH-, C=O, O, S, amide, phosphoryl, thiophosphoryl, aliphatic carbocyclic groups such as cyclohexane, or combinations of these groups, or within the same 5'MVIP or 3'MVIP structure, or when the L structures of 5'MVIP and 3'MVIP are different, the activity of the resulting RNA inhibitors is similar within the carbon chain length range of C7-C18, as shown in Table 9.

[0361] Table 9

[0362] In addition to the structural changes in linker B, when X, L, D, and R1 / R2 are consistent with those in the combination 5'MVIP09 / 3'MVIP09, A1 and A2 in the general formula of linker B are each independently C, O, S, -NH-, carbonyl, amide, phosphoryl, or thiophosphoryl, r is any integer from 0 to 4, and when linker B is the same or different between 5'MVIP and 3'MVIP, the resulting RNA inhibitory activity is not much different.

[0363] Table 10

[0364] When the MVIP structure and RNA inhibitor are the same, different connecting chains D will affect the activity of the RNA inhibitor. Among them, the effects of D1, D2, and D4 are similar and better than D3. The D structure is shown in Table 11.

[0365] Table 11

[0366] Different transfer points R1 will affect the activity of RNA inhibitors. Among them, the RNA inhibitor obtained with R1-1 as the transfer point has the best activity. The structure of R1 is shown in Table 12.

[0367] Table 12

[0368] Different transfer points R2 will affect the activity of RNA inhibitors. Among them, R2-1 is the best RNA inhibitor when it is used as the transfer point. The R1 structure is shown in Table 13.

[0369] Table 13

[0370] In some embodiments, n+m in the RNA inhibitors described in the present invention are 2, 3, 4, 5 and 6 respectively. The positions where 5'MVIP and / or 3'MVIP are coupled include the 5' end and / or 3' end of the antisense chain, the 5' end and / or 3' end of the sense chain, the 5' end of the antisense chain and the 3' end of the sense chain, and the 5' end of the sense chain and the 3' end of the antisense chain.

[0371] In some embodiments, n+m in the RNA inhibitors of the present invention is 2, 3, 4, 5, and 6, respectively. The positions to which 5'MVIP and / or 3'MVIP are coupled include the 5' end and / or 3' end of the antisense strand in Tables 1-2, the 5' end and / or 3' end of the sense strand in Tables 1-2, the 5' end of the antisense strand and the 3' end of the sense strand in Tables 1-2, and the 5' end of the sense strand and the 3' end of the antisense strand in Tables 1-2. The obtained 5'MVIP and 3'MVIP combinations are shown in Table 14:

[0372] Table 14 5'MVIP and 3'MVIP combination list

[0373] In some embodiments, n and m are each independently any integer from 0 to 4, preferably each independently an integer from 1 to 3, and n+m=an integer from 2 to 6, preferably n+m=2, 3 or 4, more preferably 4.

[0374] In some embodiments, the RNA inhibitors described herein or pharmaceutically acceptable salts thereof are preferably prepared or synthesized in the form of sodium salts, triethylamine salts or other pharmaceutically acceptable salts.

[0375] In some embodiments, the RNA inhibitor described herein or a pharmaceutically acceptable salt thereof is more preferably a sodium salt or a triethylamine salt thereof.

[0376] On the other hand, the present application also provides a pharmaceutical composition comprising the RNA inhibitor or a pharmaceutically acceptable salt thereof.

[0377] In some embodiments, the present invention provides a pharmaceutical composition comprising the RNA inhibitor or a pharmaceutically acceptable salt thereof and optionally a pharmaceutically acceptable excipient. The present invention also provides use of the RNA inhibitor or a pharmaceutically acceptable salt thereof in the preparation of a medicament for treating and / or preventing diseases associated with elevated complement system levels, including but not limited to lipid metabolism disorders.

[0378] In some embodiments, the complement system regulates plasma triglyceride levels by inhibiting LPL (hepatic lipase) activity in the liver and adipose tissue, limiting the release of fatty acids. This has an impact on insulin resistance, fat metabolism, and overall energy balance. Factors that may inhibit complement system mRNA expression in vivo and / or in vitro include PPARδ, statins, insulin, leptin, thyroid hormone, and lipopolysaccharide, among others. 5-10 The inhibitors of the present invention can be used in combination with these drugs, with the potential to further enhance the therapeutic efficacy of lipid metabolism, glucose metabolism, cardiovascular disease, and other diseases.

[0379] One example approach is to formulate the composition for systemic administration by parenteral delivery, for example, subcutaneous (SC), intramuscular (IM), or intravenous (IV) delivery.The pharmaceutical compositions provided herein can be administered at a dose sufficient to inhibit complement system gene expression.

[0380] A pharmaceutically acceptable "excipient" or "vegetarian" is a pharmaceutically acceptable solvent, suspending agent, or any other pharmaceutically inert vehicle used to deliver one or more nucleic acids to an animal. Excipients can be liquid or solid and are selected based on the intended mode of administration to provide the desired volume, consistency, etc. when combined with the nucleic acid and other components of a given pharmaceutical composition. The RNA inhibitors described herein can be delivered in a manner that targets specific tissues (e.g., hepatocytes).

[0381] In some embodiments, the pharmaceutical composition of the present invention further comprises a delivery vehicle (such as nanoparticles, dendrimers, polymers, liposomes or cationic delivery systems).

[0382] In some embodiments, the delivery vehicle described herein comprises a liposome.

[0383] In some embodiments, the delivery vehicle of the present invention comprises nanolipids, which can form liposome-nucleic acid nanoparticles with nucleic acid molecules.

[0384] In some embodiments, the delivery vehicle described herein comprises the amphiphilic lipid compound M10C1.

[0385] The pharmaceutical compositions provided herein include, but are not limited to, solutions, emulsions, and formulations comprising liposomes. These compositions can be produced from a variety of components, including, but not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semisolids. Such formulations include those targeted to the liver. The pharmaceutical formulations of the present application, which can be conveniently presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of combining the active ingredient with a pharmaceutically acceptable excipient or vehicle.

[0386] use

[0387] On the other hand, the present application provides a method for reducing the expression of complement system mRNA or protein in cells or tissues, which comprises contacting the cells or tissues with an effective amount of the aforementioned RNA inhibitor that inhibits complement system gene expression or a pharmaceutically acceptable salt thereof, and / or the aforementioned pharmaceutical composition.

[0388] Cells suitable for treatment using the methods of the present application can be any cell expressing complement system genes, for example, liver cells, brain cells, gallbladder cells, heart cells or kidney cells, but are preferably liver cells. Cells suitable for use in the methods of the present application can be mammalian cells, and when contacted with cells expressing complement system genes, the RNA inhibitor inhibits the expression of complement system genes (e.g., human, primate, non-primate or rat complement system genes) by at least about 50%, for example, as determined by PCR or branched DNA (bDNA)-based methods, or by protein-based methods such as immunofluorescence analysis, Western blotting or flow cytometry.

[0389] In some embodiments, the tissue is liver tissue.

[0390] In some embodiments, the cells and tissues are ex vivo.

[0391] In some embodiments, the cells and tissues are in a subject.

[0392] As used herein, the term "inhibit" can be used interchangeably with "reduce," "lower," "silence," "downregulate," "suppress," and other similar terms, and encompasses any level of inhibition. The expression of complement system genes can be assessed based on the level or change in level of any variable associated with complement system gene expression, for example, complement system mRNA levels. This level can be analyzed in a single cell or in a population of cells (including, for example, a sample derived from a subject). The control level can be any type of control level employed in the art, for example, a pre-dose baseline level or a level measured from a similar subject, cell, or sample that has not been treated or that has received a control (such as, for example, a buffer-only control or an inactive agent control).

[0393] Inhibition of complement system gene expression can be manifested by a decrease in the amount of mRNA expressed by a first cell or cell population (such cells can be present, for example, in a sample derived from a subject) in which complement system genes are transcribed and which have been treated (e.g., by contacting one or more cells with an RNA inhibitor of the present disclosure, or by administering an RNA inhibitor of the present disclosure to a subject in which such cells are present) such that expression of the complement system genes is inhibited, compared to a second cell or cell population that is substantially identical to the first cell or cell population but has not been so treated (control cells not treated with the RNA inhibitor or with an RNA inhibitor targeting the gene of interest).

[0394] In a preferred embodiment, the assay is performed by administering siRNA at appropriate concentrations in cell lines that highly express the complement system, and expressing the mRNA levels in the treated cells as a percentage of the mRNA levels in non-treated control cells.

[0395] In other embodiments, inhibition of complement system gene expression can be assessed by a decrease in a parameter functionally associated with complement system gene expression, e.g., the level of complement system in the blood or serum of a subject. Complement system gene inhibition can be measured in any cell expressing the complement system (either endogenous or exogenous from an expression construct) and by any assay known in the art.

[0396] Inhibition of complement system expression can be manifested by a decrease in the level of complement system expressed by a cell or cell population or a sample from a subject (eg, protein levels in a blood sample derived from a subject).

[0397] Control cells, cell populations, or subject samples that can be used to evaluate complement system gene inhibition include cells, cell populations, or subject samples that have not been contacted with the RNA inhibitors of the present application. For example, control cells, cell populations, or subject samples can be derived from a single subject (e.g., a human or animal subject) or an appropriately matched population control prior to treatment with the RNA inhibitor.

[0398] The level of complement system mRNA expressed by a cell or cell population can be measured using any method known in the art for evaluating mRNA expression. For example, qRT-PCR can be used to evaluate a decrease in gene expression. A decrease in protein production can be evaluated by any method known in the art, such as ELISA. In some embodiments, a liver biopsy sample is used as the tissue material for monitoring a decrease in complement system gene expression. In other embodiments, a blood sample is used as a subject sample for monitoring a decrease in complement system expression.

[0399] On the other hand, the present application provides the use of the aforementioned RNA inhibitor for inhibiting complement system gene expression or a pharmaceutically acceptable salt thereof, or the aforementioned pharmaceutical composition in the preparation of a medicament for preventing and / or treating a disease or condition or reducing the risk of a disease or condition.

[0400] On the other hand, the present application provides a method for preventing and / or treating a disease or condition, comprising administering to a subject in need thereof an effective amount of the aforementioned RNA inhibitor for inhibiting complement system gene expression or a pharmaceutically acceptable salt thereof, and / or the aforementioned pharmaceutical composition.

[0401] The in vivo method of the present application may comprise administering to a subject a pharmaceutical composition comprising an RNA inhibitor, wherein the RNA inhibitor comprises a nucleotide sequence complementary to at least a portion of an mRNA of the complement system of a mammal to which the RNA inhibitor is administered. The pharmaceutical composition of the present invention may be administered in any manner known in the art, including but not limited to: oral, intraperitoneal or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal and topical (including buccal and sublingual) administration. In some embodiments, the pharmaceutical composition is administered by intravenous infusion or injection. In some embodiments, the pharmaceutical composition is administered by subcutaneous injection. In some embodiments, the composition is administered by intramuscular injection.

[0402] The RNA inhibitors provided herein can also be administered as "free RNA inhibitors." Free RNA inhibitors are administered in the absence of a pharmaceutical composition. Naked RNA inhibitors can be in a suitable buffer. The buffer can contain acetate, citrate, prolamin, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer is phosphate-buffered saline (PBS). The pH and osmotic pressure of the buffer containing the RNA inhibitor can be adjusted so that it is suitable for administration to a subject.

[0403] Alternatively, the RNA inhibitors provided herein can be administered as a pharmaceutical composition, such as a liposomal formulation.

[0404] The pharmaceutical compositions provided herein can be administered in a dosage sufficient to inhibit complement system gene expression. Typically, a suitable dose of the RNA inhibitors described herein is in the range of about 0.001 to about 200.0 mg per kilogram of subject body weight per day, typically in the range of about 1 to 50 mg per kilogram of body weight per day. Typically, a suitable dose of the RNA inhibitors described herein is in the range of about 0.1 mg / kg to about 5.0 mg / kg, for example, in the range of about 0.3 mg / kg to about 3.0 mg / kg.

[0405] In some embodiments, the method further comprises determining the level of the complement system in a sample from the subject.

[0406] For example, the method further comprises determining the level of the complement system in a blood sample, serum sample, or urine sample from the subject.

[0407] In another aspect, the present application provides a cell comprising the aforementioned RNA inhibitor for inhibiting complement system gene expression or a pharmaceutically acceptable salt thereof.

[0408] On the other hand, the present application provides a drug kit comprising the aforementioned RNA inhibitor for inhibiting complement system gene expression or a pharmaceutically acceptable salt thereof, or the aforementioned pharmaceutical composition.

[0409] Without intending to be bound by any theory, the following examples are merely intended to illustrate the RNA inhibitors, preparation methods, and uses provided by the present application, and are not intended to limit the scope of the present invention.

[0410] Example

[0411] illustrate:

[0412] The Chinese name of DMSO is dimethyl sulfoxide;

[0413] The Chinese name of DMF is N,N-dimethylformamide;

[0414] The Chinese name of HOBt is 1-hydroxybenzotriazole;

[0415] The Chinese name of HBTU is O-benzotriazole-tetramethyluronium hexafluorophosphate;

[0416] The Chinese name of DIPEA (DIEA) is N,N-diisopropylethylamine;

[0417] The Chinese name of DCM is dichloromethane;

[0418] The Chinese name of DMAP is 4-dimethylaminopyridine;

[0419] The Chinese name of DMT-CL is 4,4'-dimethoxytriphenylmethane;

[0420] The Chinese name for MEOH is methanol;

[0421] The Chinese name of TBTU is O-benzotriazole-N,N,N',N'-tetramethyluronium tetrafluoroborate;

[0422] The name of the solid phase carrier is macroporous aminomethyl resin (Resin).

[0423] Example 1 Synthesis of RNA Inhibitors

[0424] The sense and antisense strands of the uncoupled carrier structure are synthesized using a standard solid-phase phosphoramidite method using a multi-channel solid-phase synthesizer, and then the sense strands are complementary annealed with the corresponding antisense strands to prepare the corresponding RNA inhibitors.

[0425] The basic steps of the solid phase phosphoramidite method include:

[0426] 1) Deprotection: removing the Solid Support hydroxyl protecting group (DMTr) in the starting monomer;

[0427] 2) Coupling: Add the first phosphoramidite monomer and the coupling reaction occurs in the 3' to 5' direction;

[0428] 3) Oxidation: oxidizing the resulting nucleoside phosphite to a more stable nucleoside phosphate (i.e., oxidation of trivalent phosphorus to pentavalent phosphorus);

[0429] 4) Blocking: Cap the 5'-OH group of the nucleotide sequence that failed in the previous step to prevent it from further participating in the reaction; repeat the above steps until the last phosphoramidite monomer is added; then use methylamine aqueous solution and ammonia water to cleave the ester bond between the Solid Support and the starting monomer, and remove the protecting groups on each base and phosphate on the resulting nucleotide sequence; after HPLC separation and purification, filter sterilization, and lyophilization to obtain the corresponding sense chain or antisense chain.

[0430] Description of the synthesis process of RNA inhibitors:

[0431] Reconstitute the sense and antisense strand lyophilized powders separately and mix them in equal moles. Add an appropriate amount of water for injection and an appropriate amount of TRIS buffer. Gently shake the solution for approximately 1–2 minutes to mix thoroughly. Heat a water bath to 92–95°C. Heat the reaction mixture in a water bath for 3–5 minutes, gently shaking to ensure even heating. Cool naturally to room temperature. A colorless or slightly yellowish transparent liquid is obtained. Sample the solution for analysis and concentration determination.

[0432] Example 2-1 In vitro inhibition of complement system gene expression by CFB and C5 RNA inhibitors

[0433] The RNA inhibitors of this example are selected from Table 1-1 and Table 1-2 and are prepared by the method described in Example 1.

[0434] Hep3B and huh7 cells were digested with trypsin and adjusted to an appropriate density before being seeded into 96-well plates. The viable cell concentration was 0.2 × 10 6Cells were transfected with test or control siRNA using Lipofectamine RNAiMax (Invitrogen-13778150) at the same time as the inoculation. siRNAs were tested in triplicate at the following concentrations: 0.1 nM, 0.02 nM, 0.015 nM, 0.001 nM, 10 nM, 1 nM, and 0.01 nM. A no-siRNA control group and a positive control group containing only cells and RNAiMax were also established.

[0435] 24 hours after transfection, the culture medium was removed and the cells were harvested for RNA extraction. Total RNA was extracted using a 96-channel automated nucleic acid extraction and purification instrument or a Promega total RNA extraction kit.

[0436] According to the manual, use cDNA synthesis was performed using the II All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) Kit. The target cDNA was detected by qPCR, with GAPDH cDNA used in parallel as an internal control. Quantitative PCR was performed using a Thermo QuantStudio 1 instrument as follows: 95°C for 30 seconds, followed by 40 cycles of 95°C for 10 seconds and 60°C for 30 seconds.

[0437] Data Analysis:

[0438] The target gene mRNA expression level in each sample was calculated based on the Ct value of each sample using the ΔΔCt relative quantification method. The relative expression of the target gene was calculated using 2 -ΔΔCt express.

[0439] The equations are listed below:

[0440] ΔCT = target gene average Ct - GAPDH average Ct

[0441] ΔΔCT = ΔCT (sample) - ΔCT (random control or Lipofectamine RNAiMax control);

[0442] Relative quantification of target gene mRNA = 2 (-ΔΔCT)

[0443] Inhibition % = (relative quantification of control - relative quantification of sample) / relative quantification of control x 100%.

[0444] The results of the CFB RNA inhibitor transfection test in Hep3B cells are shown in Tables 15-1 to 15-4 below.

[0445] The results of the C5 RNA inhibitor transfection test in Hep3B cells are shown in Tables 15-5 to 15-11 below.

[0446] Table 15-1 Inhibitory effect of 0.1nM CFB RNA inhibitor on Hep3B cells

[0447] Table 15-2 Inhibitory effect of 0.02nM CFB RNA inhibitor on Hep3B cells

[0448] Table 15-3 Inhibitory effect of 0.015nM CFB RNA inhibitor on Hep3B cells

[0449] Table 15-4 Inhibitory effect of 0.1CFB RNA inhibitor on Hep3B cells

[0450] Table 15-5 Inhibitory effect of 1nM C5 RNA inhibitor on Huh7 cells

[0451] Table 15-6 1. Inhibitory effect of 0.1 nM C5RNA inhibitor on huh7 cells

[0452] Table 15-7 Inhibitory effect of 0.01nM C5 RNA inhibitor on Hep3B cells

[0453] Table 15-8 Inhibitory effect of 0.01nM C5 RNA inhibitor on Hep3B cells

[0454] Example 2-2 In vitro test on the inhibition of C3 gene expression by RNA inhibitors

[0455] The RNA inhibitors of this example are shown in Tables 1-3. Plasmid DNA (C3_PSICHECK(TM)-2 plasmid) was transferred into Hep3B and Huh7 cells using Fugene HD. The transfected cells were seeded into 96-well plates at a density of 10,000 cells per well, with 100 μL of culture medium per well. The cells were cultured in a 5% CO2, 37°C incubator overnight. The RNA inhibitors were then prepared with PBS to prepare nanolipid-encapsulated RNA inhibitor sample solutions of corresponding concentrations. RNAiMAX / Opti-MEM was added to each well at the corresponding position, and the diluted RNA inhibitor sample solutions of the corresponding concentrations were added to the wells, mixed and incubated, and the incubated mixture was mixed evenly with DMEM containing 10% FBS. The culture medium in each well was aspirated, and then new culture medium containing the sample was added. After addition, the plates were cultured in a 5% CO2, 37°C incubator. The final concentration of the sample test was 0.01 nM.

[0456] Remove the cells from the incubator, discard the supernatant, add fresh culture medium and detection reagent, shake in the dark, and after the cells are fully lysed, transfer the sample to an opaque white plate to detect the luminescent signal of fireflies; add & Add the assay reagent, shake in the dark, and measure the Renilla luciferase signal. Calculate the ratio of the primary reporter gene to the internal reference reporter gene signal in each well. The test results are shown in Table 15-9 below.

[0457] Table 15-9 Inhibitory effect of 0.01 nM RNA inhibitor on C3 mRNA in Hep3B cells

[0458] Based on the screening results of the primary sequence, parts are selected for modification and carriers are added to further screen inhibitors.

[0459] Example 3 Synthesis of carrier structure

[0460] When the 3' end of the sense or antisense strand of the RNA inhibitor of the present invention is coupled with the support structure 3'MVIP, the solid support of 3'MVIP serves as the starting monomer for solid-phase synthesis. When the 5' end of the sense or antisense strand of the RNA inhibitor of the present invention is coupled with the support structure 5'MVIP, the 5'MVIP phosphoramidite monomer serves as the last monomer for solid-phase synthesis.

[0461] The solid spport formula of 3'MVIP is as follows:

[0462] When m is 1-4, the linker B in the general formula is branched 1 to 4 times to obtain the corresponding Solid Support of 3'MVIP.

[0463] The general formula of 5'MVIP phosphoramidite monomer is as follows:

[0464] When n is 1-4, the linker B in the general formula is branched 1 to 4 times to obtain the corresponding 5"MVIP phosphoramidite monomer.

[0465] The following are only illustrative examples of the chemical synthesis processes of several 3'MVIP Solid Support and 5'MVIP phosphoramidite monomers. By referring to the methods described in the examples, those skilled in the art can easily synthesize the remaining 3'MVIP Solid Support and 5'MVIP phosphoramidite monomers involved in the present invention. The synthetic process is described as follows:

[0466] 3.1 Synthesis of 3'MVIP Solid Support

[0467] 3.1.1 Synthesis of 3'MVIP09 Solid Support

[0468] 3'MVIP09's Solid Support

[0469] Description of the synthesis process:

[0470] 3.1.1.1 Synthesis of ERC-01-c1

[0471] Weigh 5.0 g of 2-amino-1,3-propanediol (54.9 mmol), add 50 mL of DMSO and 5 mL of sodium hydroxide solution (1 g / mL), cool to 0°C, and add tert-butyl acrylate (20 mL, 137.8 mol) dropwise over 2 hours. Let react at room temperature for 48 hours, then add petroleum ether (100 mL). Wash twice with saturated brine, and dry the organic layer. Pass the mixture through a chromatography column (eluent: ethyl acetate:petroleum ether = 25%-75%). Add 0.05% triethylamine to the column to obtain 6.2 g of a colorless oil.

[0472] 3.1.1.2 Synthesis of ERC-01-c2

[0473] Weigh ERC-01-c1 (6.2 g, 17.9 mmol), add 50 mL of dichloromethane and 23 mL of sodium carbonate solution (25%), and add benzyl chloroformate (8.2 mL, 57.4 mmol) dropwise at room temperature for 2 hours. React at room temperature overnight, wash three times with saturated brine, dry over anhydrous sodium sulfate, evaporate the solvent, and pass through a chromatography column (ethyl acetate: petroleum ether = 5%-30%) to obtain 4.0 g of an oil.

[0474] 3.1.1.3 Synthesis of ERC-01-c3

[0475] Take ERC-01-c2 (4.0 g, 8.3 mmol), add 12 mL of formic acid, react at room temperature overnight, and evaporate the solvent under reduced pressure to obtain 2.8 g of the product.

[0476] 3.1.1.4 Synthesis of ERCd-01-c1

[0477] Compounds ERC-01-c3 (1.11 g, 3.0 mmol) and dlSANC-c4 (3.6 g, 8.04 mmol) were added to DMF (60 mL), followed by HOBt (2.24 g) and HBTU (3.36 g), and then DIEA (4.16 mL) was slowly added. The reaction mixture was stirred at room temperature for 3 hours. Water was then added, and the aqueous layer was extracted with dichloromethane (2 x 10 mL). The organic layers were combined and washed sequentially with saturated sodium bicarbonate (80 mL), water (2 x 60 mL), and saturated brine (60 mL). The mixture was dried over anhydrous sodium sulfate, evaporated to dryness under reduced pressure, and purified by silica gel column chromatography (eluent: 3-15% MeOH in DCM). 3.24 g of a pale yellow solid was obtained.

[0478] 3.1.1.5 Synthesis of ERCd-01-c2

[0479] ERCd-01-c1 (3.24 g, 2.6 mmol) was dissolved in methanol (60 mL), and 10% palladium on carbon (0.3 g) and acetic acid (2.0 mL) were added. Hydrogenation was then added under normal pressure, and the reaction was allowed to proceed overnight. The reaction solution was filtered through celite, and the filtrate was evaporated to dryness under reduced pressure to obtain 2.9 g of ERCd-01-c2 as an oil. Its high-resolution mass spectrum is shown in Figure 1.

[0480] 3.1.1.6 Synthesis of 3'MVIP09-c1

[0481] SANCd-01-c0 (0.824 g, 1.5 mmol) and ERCd-01-c2 (1.09 g, 1.0 mmol) were added to the reaction flask in sequence, and then 10 mL of DCM was added and stirred to dissolve. TBTU (0.963 g) and DIPEA (0.517 g) were added in sequence, and the reaction was allowed to proceed overnight. Water was added and the mixture was extracted with DCM. The organic phase was washed with saturated brine, dried, filtered, concentrated, and finally purified by silica gel column to obtain 1.3 g of the product.

[0482] 3.1.1.7 Synthesis of 3'MVIP09-c2

[0483] 3'MVIP09-c1 (1.62 g, 1 μmol) and 10 mL of DCM were added to the reaction flask in sequence, stirred at room temperature to dissolve, and then DMAP (0.366 g) and succinic anhydride (0.2 g, 3 μmol) were added in sequence. The reaction was stirred at room temperature and analyzed by TLC. If the reaction was qualified, DCM was concentrated and water was added. The mixture was extracted with DCM, and the organic phase was washed with saturated brine. The organic phase was dried over anhydrous sodium sulfate, filtered, concentrated, and finally purified by silica gel column to obtain 1.55 g of the product.

[0484] 3.1.1.8 Solid Support Synthesis of 3'MVIP09

[0485] 3'MVIP09-c2 (0.86 g, 0.5 μmol) and 10 mL of DMF were added to the reaction flask in sequence and dissolved. HBTU (0.19 g), DIPEA (0.194 g), and macroporous aminomethyl resin (2.0 g) were then added in sequence. The mixture was shaken for 24 h and filtered. The resin was washed with 10% methanol / DCM and capped with 25% acetic acid / pyridine. The degree of substitution was 150 μmol / g.

[0486] 3.1.2 Synthesis of the Solid Support of 3'MVIP17

[0487] 3'MVIP17 Solid Support

[0488] 3.1.2.1 Synthesis of SANC-01-c1

[0489] The synthesis steps refer to 3.1.1.1. Synthesis of ERC-01-c1.

[0490] 3.1.2.2 Synthesis of SANC-01-c2

[0491] The synthesis steps refer to 3.1.1.2. Synthesis of ERC-01-c2.

[0492] 3.1.2.3 Synthesis of SANC-01-c3

[0493] The synthesis steps refer to 3.1.1.3. Synthesis of ERC-01-c3.

[0494] 3.1.2.4 Synthesis of SANCd-01-c1

[0495] The synthesis steps refer to 3.1.1.4. Synthesis of ERCd-01-c1.

[0496] 3.1.2.5 Synthesis of SANCd-01-c2

[0497] The synthesis steps refer to 3.1.1.5. Synthesis of ERCd-01-c2.

[0498] 3.1.2.6 Synthesis of 3'MVIP17-c1

[0499] The synthesis steps refer to the synthesis of 3'MVIP09-c1 in 3.1.1.6., and the high-resolution mass spectrum of the synthesized 3'MVIP17-c1 is shown in Figure 2.

[0500] 3.1.2.7 Synthesis of 3'MVIP17-c2

[0501] The synthesis steps refer to 3.1.1.7 Synthesis of 3'MVIP09-c2.

[0502] 3.1.2.8 Solid Support Synthesis of 3'MVIP17

[0503] The synthesis steps refer to 3.1.1.8 Solid Support Synthesis of 3'MVIP09.

[0504] 3.1.3 Synthesis of 3'MVIP01 Solid Support:

[0505] 3'MVIP01 Solid Support

[0506] Description of the synthesis process:

[0507] 3.1.3.1 Synthesis of 3'MVIP01-c1

[0508] The synthesis steps refer to 3.1.1.6.3'MVIP09-c1 synthesis.

[0509] 3.1.3.2 Synthesis of 3'MVIP01-c2

[0510] The synthesis steps refer to 3.1.1.7.3'MVIP09-c2 synthesis.

[0511] 3.1.3.3 Solid Support Synthesis of 3'MVIP01

[0512] The synthesis steps refer to 3.1.1.8.3'Solid Support Synthesis of MVIP09.

[0513] 3.2 Synthesis of 5'MVIP phosphoramidite monomer

[0514] 3.2.1 Synthesis of 5'MVIP09 phosphoramidite monomer:

[0515] 5'MVIP09 phosphoramidite monomer

[0516] 3.2.1.1 Synthesis of 5'MVIP09-ERCd-PFP-c1

[0517] ERCd-01-c2 (2.18 g, 2.0 mmol) was weighed and dissolved in DMF (50 mL). Benzyl glutarate (0.53 g, 2.4 mmol), DIPEA (0.78 g) and TBTU (0.84 g) were added and stirred at room temperature overnight. The mixture was quenched with water (50 mL) and extracted with DCM (30 mL*3). The mixture was washed with 10% citric acid (50 mL*3), saturated sodium bicarbonate (50 mL) and pyridine (100 mL). The mixture was dried over anhydrous sodium sulfate, filtered, rotary evaporated, and purified by column chromatography to obtain the product 5'MVIP09-ERCd-PFP-c1 (2.15 g).

[0518] 3.2.1.2 Synthesis of 5'MVIP09-ERCd-PFP-c2

[0519] 5'MVIP09-ERCd-PFP-c1 (2.15 g, 1.66 mmol) and 10% palladium on carbon (0.21 g) were weighed, methanol (50 mL) was added, and hydrogenation was carried out at room temperature with stirring overnight. After the reaction, the palladium on carbon was filtered through celite and rotary evaporation was performed to obtain a crude product of 5'MVIP09-ERCd-PFP-c2 (1.9 g). Its high-resolution mass spectrum is shown in Figure 3.

[0520] 3.2.1.3 Synthesis of 5'MVIP09-ERCd-PFP

[0521] The crude product of 5'MVIP09-ERCd-PFP-c2 (1.9 g, 1.58 mmol) was weighed and dissolved in DCM (60 mL). DIPEA (1.33 g) was added and cooled. Pentafluorophenol trifluoroacetate (2.21 g, 7.9 mmol) was added and stirred at room temperature for 2 h. The product was then rotary evaporated and dissolved in DCM (60 mL). The product was washed with saturated sodium bicarbonate (30 mL*3), 10% citric acid (30 mL*1), and saturated brine (50 mL*1). The product was dried over anhydrous sodium sulfate, filtered, and rotary evaporated to obtain the crude product of 5'MVIP09-ERCd-PFP (2.35 g). The product was dried and used directly in the next reaction without purification.

[0522] 3.2.1.4 Synthesis of 5'MVIP09 Phosphoramidite Monomer-c1

[0523] The crude 5'MVIP09-ERCd-PFP product (2.35 g, 1.58 mmol) was dissolved in DCM (60 mL) and DIPEA (0.82 g, 6.32 mmol) and 6-amino-1-hexanol (0.37 g, 3.16 mmol) were added. The mixture was stirred at room temperature overnight. 10% citric acid (30 mL) was added and the mixture was extracted with DCM (30 mL x 3). The product was washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, rotary evaporated, and purified by column chromatography to obtain 5'MVIP09 monomer-c1 (1.73 g).

[0524] 3.2.1.5 5'MVIP09 phosphoramidite monomer

[0525] 5'MVIP09 phosphoramidite monomer-c1 (1.3 g, 1.0 mmol) was weighed and dissolved in acetonitrile (30 mL). Diisopropylamine triazole (0.22 g) was added, and bis-(diisopropylamino)(2-cyanoethoxy)phosphine (0.36 g, 1.2 mmol) was added dropwise under ice bath. The reaction was carried out at room temperature for 4 h. The reaction was controlled by HPLC. After the reaction was qualified, the product 5'MVIP09 monomer (1.2 g) was concentrated and purified by column.

[0526] 3.2.2 Synthesis of 5'MVIP01 phosphoramidite monomer:

[0527] 5'MVIP01 phosphoramidite monomer

[0528] 5'MVIP01 phosphoramidite monomer YICd-01-c2 (1.12 g, 2.0 mmol) was weighed, and the remaining operations were carried out according to 3.2.1.1. to 3.2.1.5.

[0529] Example 4 Synthesis of carrier-coupled RNA inhibitors

[0530] Synthesis description of the antisense strand of the coupled carrier (3'MVIP 09 coupling): Purge the reagent bottle with argon for at least 2 minutes. Add the phosphoramidite monomer or acetonitrile to the reagent bottle in sequence, tighten the bottle cap, and shake until the solid is completely dissolved by visual inspection. Then add 3A molecular sieves and let it stand for at least 8 hours before use. Purge the reagent bottle with argon for at least 2 minutes. Add hydrogenated xanthan gum and dry pyridine to the reagent bottle in sequence, tighten the bottle cap, and shake until the solid is completely dissolved by visual inspection. Store it for use. Confirm that the following operations are performed at room temperature of 20-30℃: Weigh the 3'MVIP Solid Support and add it to the reagent bottle. Then add acetonitrile, shake to mix thoroughly, transfer it to the synthesis column, and use acetonitrile to elute the remaining part of the reagent bottle and transfer it to the synthesis column. After elution, fill the synthesis column with acetonitrile and record the amount of acetonitrile used. Install and fix the synthesis column according to the instrument instructions.

[0531] The prepared monomer solution, CAP A, CAP B, oxidant, thiolation agent, activator, decapping agent and acetonitrile were connected to the corresponding pipelines of AKTA PILOT100, ensuring that the pipelines were inserted into the bottom of the reagent bottles.

[0532] Once the synthesis method is set up and the instrument is ready, click Run to begin the synthesis. Observe and record the area of ​​each detritylation peak online. During the synthesis, add additional deprotection reagent based on the actual amount used.

[0533] After the synthesis is completed, argon is purged into the synthesis column for ≥2h, and the synthesis column is unloaded according to the operating procedures. The solid phase carrier in the synthesis column is transferred to the reaction bottle, methylamine aqueous solution and ammonia water are added, and the reaction bottle is placed in a shaker at 35°C for 2-3 hours. The solution is filtered into a round-bottom flask, and the residual solid phase is washed with 50% ethanol aqueous solution, filtered again and combined with the previous filtrate, the round-bottom flask is connected to a rotary evaporator, the water temperature is set to 50°C and evaporated until no distillate is produced, ethanol is added to the round-bottom flask, mixed, and evaporated again until no distillate is produced. Repeat the operation until white powder appears at the bottom of the bottle. The obtained white powder is prepared into a solution, purified using a reverse chromatography column, and samples are taken to detect OD260 and purity. The purified antisense chain solution is divided into vials and freeze-dried for use, and the product is sealed and stored in a -20°C refrigerator.

[0534] The synthesis of the sense strand (5'MVIP09-coupled) is similar to the antisense strand, except that the Solid Support used for the column is the Universal support. Add DIPEA to the resulting intermediate to create a solution. Add the 5'MVIP phosphoramidite monomer and mix thoroughly. Place the reaction flask in a shaker at 35°C for 2-3 hours.

[0535] Description of the synthetic annealing process of RNA inhibitors:

[0536] Take the obtained positive and antisense chains, mix them in a reaction bottle in a 1:1 equimolar ratio, and after 5 minutes in a water bath at 95°C, turn off the power of the water bath and let it cool naturally to below 40°C. Add 3M sodium acetate aqueous solution to the double-stranded solution, mix evenly, then add an appropriate volume of anhydrous ethanol, mix evenly, and place the reaction solution in a -20°C refrigerator for 45 minutes. Set the refrigerated high-speed centrifuge to 4°C for pre-cooling. After the temperature is reached, add the double-stranded solution and start the centrifuge. Take out the double-stranded solution after centrifugation, remove the supernatant, add ultrapure water to completely dissolve the solid, take samples to test OD260 and purity, and obtain the RNA inhibitors in Table 14. The purified finished solution is divided into syringe bottles and freeze-dried for use, and the product is sealed and stored in a -20°C refrigerator.

[0537] The above examples illustrate only the synthesis of RNA inhibitors with 5'MVIP09 / 3'MVIP09 couplings. All RNA inhibitors described herein but not listed here are subject to this same principle: when the 3' end of the sense or antisense strand of an RNA inhibitor is coupled to the support structure 3'MVIP, the 3'MVIP solid support serves as the starting monomer for solid-phase synthesis; when the 5' end of the sense or antisense strand of an RNA inhibitor is coupled to the support structure 5'MVIP, the 5'MVIP phosphoramidite monomer serves as the final monomer for solid-phase synthesis. By referring to the methods described in this example, those skilled in the art can readily synthesize the remaining RNA inhibitors of the present invention.

[0538] Example 5 Screening experiment of CFB inhibitors and C5 inhibitors in PHH cells:

[0539] The RNA inhibitors of this example were selected from Tables 1-7, and the inhibitory effects of the RNA inhibitors were verified by free uptake by PHHs cells.

[0540] Verification method: Day 0, plate PHHs cells, use RNAiMAX transfected the compound into the cells. 48 hours after transfection, Total RNA was extracted using the Super Total RNA Extraction Kit (Promega-LS1040), and cDNA was synthesized using One-Step gDNA Removal. qPCR detection was performed using Green qPCR SuperMix (+Dye I).

[0541] Data Analysis: The target gene mRNA expression level in each sample was calculated based on the Ct value of each sample using the ΔΔCt relative quantification method. The relative expression of the target gene is expressed as 2-ΔΔCT. The calculation formula is as follows: ΔCT = mean Ct value of the target gene - mean Ct value of the reference gene; ΔΔCT = ΔCT (drug-treated group) - ΔCT (control group); relative expression of the target gene mRNA = 2-ΔΔCT; inhibition rate of the target gene = (1-value of sample / mean value of RNAiMAX Control) × 100%. Results are expressed as mean ± SD of triplicate wells. The inhibitory effects of RNA inhibitors on complement system mRNA expression in PHH cells were investigated at concentrations of 500 nM, 100 nM, 10 nM, 1 nM, 0.02 nM, and 10 nM, 1 nM, and 0.1 nM. The results of the inhibitory effects of CFB RNA inhibitors on PHH cells are shown in Table 16-1.

[0542] Table 16-1 Inhibitory effect of CFB RNA inhibitors on PHH cells

[0543] Example 6 In vitro inhibition of complement system gene expression by CFB, C5, and C3 modified sequence RNA inhibitors

[0544] The RNA inhibitors of this example are selected from Table 7.

[0545] Example 6-1: An RNA inhibitor was prepared using the method described in Example 4. Using the same experimental method as in Example 2, the inhibitor's inhibitory effects on CFB mRNA, C5 mRNA, and C3 mRNA in Hep3B cells were investigated at concentrations of 1 nM and 0.01 nM. The experimental results are shown in Tables 17-1 to 17-5.

[0546] Table 17-1 Inhibitory effect of RNA inhibitors on C5 mRNA in Hep3B cells

[0547] Table 17-2 Inhibitory effect of RNA inhibitors on C5 mRNA in Hep3B cells

[0548] Table 17-3 Inhibitory effect of RNA inhibitors on C5 mRNA in Hep3B cells

[0549] Table 17-4 Inhibitory effect of RNA inhibitors on C3 mRNA in Hep3B cells in vitro

[0550] Example 6-2 Experimental determination of the EC50 of RNA inhibitors for inhibiting C3 gene in vitro

[0551] The RNA inhibitors in this example are selected from Table 7. The inhibitory effects of the RNA inhibitors Kylo-27-DS8201, Kylo-27-DS8771, and Kylo-27-DS8141 on C3 mRNA expression in Hep3B cells at various concentrations were investigated. Three inhibition rates were measured for each concentration, and the average was taken. Inhibition rate-concentration curves were plotted based on the experimental data, and the corresponding EC50, EC75, EC85, and EC95 values ​​were calculated. The experimental results are shown in Tables 18-1 and 18-2.

[0552] Table 18-1 Inhibitory effect of RNA inhibitors on C3 mRNA in Hep3B cells

[0553] Table 18-2 EC values ​​of RNA inhibitors for C3 mRNA inhibition in Hep3B cells

[0554] Example 7 Evaluation of the in vivo activity of RNA inhibitors using mice

[0555] The RNA inhibitors of this example were selected from Table 7, and the inhibitory effects of the RNA inhibitors were verified using humanized CFB mice.

[0556] Example 7-1: Inhibitory Effect of Kylo-17 Inhibitors on Protein Levels in Humanized CFB Mice

[0557] After the experimental animals were acclimated to feeding, they were randomly divided into a saline group, a Kylo-17-DS2761 group, a Kylo-17-DS2821 group, a Kylo-17-DS2811 group, a Kylo-17-DS2751 group, and a Kylo-17-DS2861 group based on plasma hCFB protein levels on Day 1. Each group consisted of five animals. The animals were administered via a single subcutaneous injection at a dose of 3 mg / kg in a 5 mL / kg volume, at a concentration of 0.6 mg / mL. The day of administration was designated Day 0. Animals were individually identified using ear tags. Cage identification was performed by hanging cage tags.

[0558] Testing time: Approximately 200 μL of blood was collected from the inner canthus of the eye on Day 1 before dosing and on Days 7, 14, 21, 28, 35, and 42 after dosing. Whole blood samples were incubated in a 37°C water bath for 1 hour before centrifugation at 3000 rpm for 10 minutes. The supernatant was collected as the fresh serum sample for hCFB protein detection.

[0559] Method for detecting hCFB protein level: ELISA kit was used for detection (single well); serum samples were prepared by centrifugation of whole blood samples and tested fresh.

[0560] The experimental data are expressed as mean ± standard deviation (mean ± SD) and converted into the inhibitory effect on mouse hCFB protein (%, mean ± SD). Statistical analysis was performed using a T-test, with P < 0.05 indicating statistical significance. The experimental results are shown in Table 19 and Figure 4:

[0561] Table 19 Effect of hCFB administration on hCFB protein inhibition rate in mouse serum (%, Mean ± SD) Note: Compared with the saline group, "*" indicates P ≤ 0.05, "**" indicates P ≤ 0.01, and "***" indicates P ≤ 0.001

[0562] Example 7-2: Inhibitory effect of Kylo-19 inhibitors on protein levels in humanized C5 mice

[0563] After the experimental animals were acclimated to feeding, they were randomly divided into a saline group, a Kylo-19-DS7511 group, a Kylo-19-DS7901 group, a Kylo-19-DS7891 group, a Kylo-19-DS7921 group, and a Kylo-19-DS8001 group based on serum hC5 protein levels on Day 3, with five mice per group. Mice were administered via a single subcutaneous injection at a dose of 3 mg / kg in a 5 mL / kg volume at a concentration of 0.6 mg / mL. The day of administration was designated Day 0. Animals were individually identified using ear tags. Cages were identified by hanging cage cards.

[0564] Testing Time: Approximately 200 μL of blood was collected from the inner canthus of the eye on Day 3 before dosing and on Days 7, 14, 21, 28, 35, 42, and 49 after dosing. Whole blood samples were incubated in a 37°C water bath for 1 hour before centrifugation at 3000 rpm for 10 minutes. The supernatant was collected as the fresh serum sample for hC5 protein detection.

[0565] Experimental data are presented as mean ± standard deviation (mean ± SD) and converted to the inhibitory effect on mouse hC5 protein (%, mean ± SD). Data were statistically analyzed using a T-test, with P < 0.05 indicating statistical significance. The experimental results are shown in Table 20 and Figure 5:

[0566] Table 20 Effect of hC5 administration on the hC5 protein inhibition rate in mouse serum (%, Mean ± SD) Note: Compared with the normal control group, "*" indicates P ≤ 0.05, "**" indicates P ≤ 0.01, and "***" indicates P ≤ 0.001

[0567] Example 7-3: Inhibitory effect of Kylo-19 inhibitors on protein levels in humanized C5 mice

[0568] After the experimental animals were acclimated to feeding, they were randomly divided into a saline group, a Kylo-19-DS7871 group, or a Kylo-19-DS7881 group based on serum hC5 protein levels on Day 3, with five mice in each group. A single subcutaneous injection of 3 mg / kg was administered in a 5 mL / kg volume at a concentration of 0.6 mg / mL. The day of administration was designated Day 0. Animals were individually identified using ear tags. Cages were identified by hanging cage cards.

[0569] Testing Time: Approximately 200 μL of blood was collected from the inner canthus of the eye on Day 3 before dosing and on Days 7, 14, 21, 28, 35, 42, and 49 after dosing. Whole blood samples were incubated in a 37°C water bath for 1 hour before centrifugation at 3000 rpm for 10 minutes. The supernatant was collected as the fresh serum sample for hC5 protein detection.

[0570] Experimental data are expressed as mean ± standard deviation (mean ± SD) and converted to the inhibitory effect on mouse hC5 protein (%, mean ± SD). Data were statistically analyzed using a T-test, with P < 0.05 indicating statistical significance. The experimental results are shown in Table 21 and Figure 6:

[0571] Table 21 Effect of hC5 administration on the hC5 protein inhibition rate in mouse serum (%, Mean ± SD) Note: Compared with the normal control group, "*" indicates P ≤ 0.05, "**" indicates P ≤ 0.01, and "***" indicates P ≤ 0.001

[0572] Inhibitors with significant inhibitory effects were selected and optimized before conducting experiments in cynomolgus monkeys.

[0573] Example 8 Evaluation of the in vivo activity of RNA inhibitors using cynomolgus monkeys

[0574] Example 8-1 Pharmacodynamic activity verification experiment of CFB inhibitor in NHP cynomolgus monkeys

[0575] The RNA inhibitors of this example were selected from Table 7. The inhibitory effects of the positive reference group and the Kylo-17-DS2911 inhibitor on serum CFB protein expression and CFB mRNA levels in NHP cynomolgus monkeys were evaluated. The inhibitor selected for the positive reference group was: sense strand: AsAsGAGAfAGfUfCfGUUUCAUUCAU-L96, antisense strand: AsfUsGAAfUGfAfAACGAfCUfUCUCUUsGsU.

[0576] After healthy cynomolgus macaques were acclimated to feeding, blood was collected on Day 1 to test for CFB protein levels in serum. Animals were then divided into a normal control group, a positive reference group, and Kylo-17-DS2911 based on CFB protein levels. The dose was 6 mg / kg. The normal control group consisted of two animals, one male and one female; the positive reference group and the G3 group consisted of three animals, two males and one female. The drug was administered via a single subcutaneous injection (injected into the back of the neck) at a volume of 1 mL / kg, with the day of administration designated as Day 0. Venous blood was collected weekly on Day 2 before dosing, and on Days 7, 14, 21, and 28 after dosing, until the endpoint of the study, Day 91, to test CFB protein levels in the serum of NHP cynomolgus macaques.

[0577] CFB protein levels were measured using an ELISA kit (single well). Serum samples were freshly collected from whole blood samples after centrifugation. Venous blood samples were collected weekly on Day 1 before dosing and on Days 7, 14, 21, and 28 after dosing, and until the study endpoint. Approximately 2 mL of blood was collected each time. Whole blood samples were allowed to stand at room temperature for 1 hour before centrifugation. Centrifuge at 3000 rpm for 10 minutes, and the supernatant was collected as the fresh serum sample for CFB protein testing.

[0578] Method for detecting CFB mRNA levels in liver tissue: Liver biopsy was performed on cynomolgus monkeys, and the mRNA level of the target in the liver was determined using the probe-based qPCR method.

[0579] The experimental data are expressed as mean ± standard deviation (mean ± SD) and analyzed using GraphPad Prism 8.3 software. Statistical analysis was performed using the T test, with P < 0.05 indicating statistical significance.

[0580] The results of the CFB protein level test are shown in Table 23 and Figure 8; the results of the CFB mRNA level test are shown in Table 24 and Figure 9:

[0581] Table 23 Effect of CFB RNA inhibitors on the inhibition rate of CFB protein in NHP cynomolgus monkeys (%, Mean ± SD)

[0582] Table 23

[0583] Table 24 Effects of CFB RNA inhibitors on CFB mRNA levels in cynomolgus monkey liver tissue

[0584] As shown in the experimental results in Table 23, regarding CFB protein levels, the inhibition rate rose rapidly on D28 after administration, and CFB protein levels were continuously suppressed from D28 to D63 (inhibition rates ranged from 78.8% to 89.52%, P < 0.05, P < 0.01, or P < 0.001, respectively). The inhibition rates ranged from 64.23% to 72.18% from D70 to D91. Starting from D21, the inhibition rate of Kylo-17-DS2911 surpassed that of Yang Shen, demonstrating a significant inhibitory effect. The inhibition rates from D21 to D91 indicate a stable inhibitory effect. The comparison of Kylo-17-DS2911 inhibition rates with Yang Shen from D70 to D91 indicates that the inhibitor of the present invention has a more stable inhibitory effect.

[0585] The experimental results in Table 24 show that Kylo-17-DS2911 significantly decreased CFB mRNA levels in liver tissue on Day 35 after administration, with an inhibition rate of 96.5%. Kylo-17-DS2911 also maintained stable and effective inhibition of CFB mRNA expression on Days 67 and 84, with inhibition rates of 89.66% and 89.17%, respectively. Compared with Yangshen, Kylo-17-DS2911 demonstrated more significant CFB mRNA inhibition, with more stable and sustained inhibition.

[0586] Example 8-2 Effect of C5 Inhibitors on C5 Protein Content and CH50 Activity in NHP Cynomolgus Monkey Serum

[0587] The RNA inhibitors of this example are selected from Table 7, and the positive reference group (sense chain: AsAsfGCfAAfGAfUfAfUUfUUUfAUfAAUA-L96, antisense chain: UsfAsfUUfAUAfAAfAAUAfUCfUUfGCUUsUsUdTdT) and the effects of the Kylo-19-DS7881 inhibitor on serum C5 protein content and CH50 activity in NHP cynomolgus monkeys were verified by cynomolgus monkeys.

[0588] After healthy cynomolgus monkeys were adapted to feeding, blood was collected on Day 2 to detect the C5 protein content in the serum. The animals were divided into normal control group G1, positive reference group G2, and Kylo-19-DS7881G3 according to the C5 protein content. The dosage was 6 mg / kg. The normal control group consisted of 2 animals, 1 male and 1 female; the G2 and G3 groups consisted of 3 animals each, 2 females and 1 male. A single subcutaneous injection (neck back injection) was administered with a volume of 1 mL / kg, and the day of administration was recorded as Day 0. Venous blood was collected once a week on Day 2 before administration, Day 7, Day 14, Day 21, and Day 28 after administration until the end of the experiment, D91, to detect the C5 protein level in the serum of NHP cynomolgus monkeys.

[0589] Venous blood was collected weekly until the study endpoint, on Day 1 before dosing, and on Days 7, 14, 21, and 28 after dosing. Approximately 2 mL of blood was collected each time. Whole blood samples were allowed to stand at room temperature for 1 hour before centrifugation. The supernatant was collected as fresh serum for C5 protein testing. C5 protein levels were measured using a single-well ELISA kit. Serum samples were prepared fresh from whole blood samples after centrifugation.

[0590] CH50 activity was measured in serum samples on Day 2 before administration and on Days 14, 28, 42, 49, 56, 63, 70, and 77 after administration. CH50 activity was measured using an ELISA kit (single well). Serum samples were obtained by centrifugation of whole blood samples.

[0591] The experimental data are expressed as mean ± standard deviation (mean ± SD) and analyzed using GraphPad Prism 8.3 software. Statistical analysis was performed using the T test, with P < 0.05 indicating statistical significance.

[0592] The results of C5 protein inhibition rate are shown in Table 24 and Figure 10; the results of CH50 activity level test are shown in Table 25 and Figure 11:

[0593] Table 24 Effect of C5 RNA inhibitors on the inhibition rate of C5 protein in NHP cynomolgus monkeys (%, Mean ± SD) Note: Compared with the normal control group, "*" indicates P ≤ 0.05, "**" indicates P ≤ 0.01, and "***" indicates P ≤ 0.001

[0594] Table 24 Note: Compared with the normal control group, "*" indicates P ≤ 0.05, "**" indicates P ≤ 0.01, and "***" indicates P ≤ 0.001

[0595] Table 25 Effect of C5 RNA Inhibitor on the Retention Level of CH50 Activity in NHP Cynomolgus Monkeys (Mean ± SD)

[0596] Table 25

[0597] As can be seen from Table 24 and Figure 10, serum C5 protein levels significantly decreased on D7 after administration of Kylo-19-DS7881 of the present invention, with an inhibition rate of 71.4%. This decreased further on D14, and the expression of serum C5 protein levels continued to be stably suppressed from D14 to D77 (inhibition rates ranged from 89.2% to 100%, P < 0.05, P < 0.01, or P < 0.001, respectively). Protein levels rebounded on D84 after administration, with inhibition rates of 83.4% and 79.4% on D84 and D91, respectively. Compared to the positive control, the inhibitory ability was significantly better after D56, and the inhibitory effect was more stable and long-lasting than the positive control.

[0598] As can be seen from Table 25 and Figure 11, the serum CH50 activity of Kylo-19-DS7881 of the present invention decreased significantly on D14 after administration, and the CH50 activity retention level was 35%. The serum CH50 activity continued to steadily decrease from D28 to D63 (the retention levels ranged from 38.8% to 40.3%, P<0.05). The CH50 activity rebounded on D70 after administration, and the CH50 activity retention levels on D70 and D77 were 48.7% and 58.4%, respectively. Compared with the positive reference, the effect of reducing CH50 activity was better and the reduction effect was more persistent.

[0599] Example 8-3 Effect of C3 Inhibitors on C3 Protein Levels in NHP Cynomolgus Monkey Serum

[0600] The RNA inhibitors of this example are selected from Table 7, and the inhibitory effects of Kylo-27-DS8141 and Kylo-27-DS8201 on the expression of serum C3 protein levels in NHP cynomolgus monkeys were evaluated.

[0601] After acclimating to feeding, healthy cynomolgus macaques were bled on Day 1 for serum C3 protein assay. Animals were then divided into a normal control group, Kylo-27-DS8141, Kylo-27-DS8131, Kylo-27-DS8201, and Kylo-27-DS8211 groups based on C3 protein levels. Each group consisted of three animals (two males and one female) at a dose of 6 mg / kg. Administration was via a single subcutaneous injection (injected into the back of the neck) at a volume of 1 mL / kg. The day of administration was designated Day 0.

[0602] Venous blood was collected weekly until the end of the study, on Day 1 before dosing and on Days 7, 14, 21, 28, 35, and 42 after dosing. Approximately 2 mL of blood was collected each time. Whole blood samples were allowed to stand at room temperature for 1 hour before centrifugation. They were then centrifuged at 3000 rpm for 10 minutes. The supernatant was collected as the fresh serum sample for C3 protein detection.

[0603] C3 protein level detection method: ELISA kit detection (single well); serum samples are prepared by centrifugation of whole blood samples and tested fresh.

[0604] The experimental data are expressed as mean ± standard deviation (mean ± SD) and analyzed using GraphPad Prism 8.3 software. Statistical analysis was performed using the T test, with P < 0.05 indicating statistical significance. The experimental results are shown in Table 26 and Figure 12.

[0605] Table 26 Effect of C3 RNA Inhibitor on C3 Protein Inhibition Rate in NHP Cynomolgus Monkeys (%, Mean ± SD)

[0606] Table 26 Note: Compared with the normal control group, "*" indicates P ≤ 0.05, "**" indicates P ≤ 0.01, and "***" indicates P ≤ 0.001

[0607] [Corrected 20.01.2025 according to Rule 91] As shown in Table 26 and Figure 12, Kylo-27-DS8141 and Kylo-27-DS8201 showed significant and sustained inhibition of C3 protein. Kylo-27-DS8141 consistently and stably suppressed serum C3 protein levels from D14 to D70 (inhibition rates ranged from 79.6% to 91.6%, respectively, P < 0.05 or P < 0.01), with inhibition rates maintained at 74.3% and 67.9% on D77 and D84, respectively, demonstrating excellent persistence. Kylo-27-DS8201 also consistently and stably suppressed serum C3 protein levels from D14 to D98, reaching 96.8% on D42 and maintaining 85.1% on D98, demonstrating excellent persistence.

Claims

1. An RNA inhibitor for inhibiting complement system gene expression or a pharmaceutically acceptable salt thereof, characterized in that: The RNA inhibitor is formed by base pairing of a sense strand and an antisense strand with a chain length of 15-30, preferably 19-23, wherein the antisense strand includes a region complementary to an mRNA encoding a complement system, and wherein the complementary region comprises at least 15 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from the antisense strand of any one of Tables 1-1, 1-2, and 1-3.

2. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 1, characterized in that: The RNA inhibitor is an RNA inhibitor for inhibiting CFB gene expression, wherein the antisense strand includes a region complementary to a target sequence, the target sequence is: 5'gucuagucaacuuaauugaga 3' SEQ ID NO: 25, the starting position in NM_001710.5 is at position 1157, and there is at least 85% base complementarity between the sense strand and the antisense strand.

3. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 1, characterized in that: The RNA inhibitor is an RNA inhibitor for inhibiting C5 gene expression, wherein the antisense strand includes a region complementary to a target sequence, the target sequence is: 5'uugucccaguauucuauguuu 3' SEQ ID NO: 826, the starting position in NM_001735.3 is at position 3073, and there is at least 85% base complementarity between the sense strand and the antisense strand.

4. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 1, characterized in that: The RNA inhibitor is an RNA inhibitor for inhibiting C3 gene expression, wherein the antisense strand includes a region complementary to a target sequence, wherein the target sequence is: 5'gguguugacagauacaucu 3' SEQ ID NO: 1952, the starting position in NM_000064.4 is 4329; 5'ggagccuacagagaaauucua 3' SEQ ID NO: 2039, the starting position in NM_000064.4 is 771; the target sequence is: 5'agaaauucuacuacaucuaua 3' SEQ ID NO: 2048, the starting position in NM_000064.4 is 782; the target sequence is: 5'gcugaggagaauugcuucaua 3' SEQ ID NO: NO: 2240, the starting position in NM_000064.4 is 4603; the target sequence is: 5'ggagaauugcuucauacaaaa 3' SEQ ID NO: 2245, the starting position in NM_000064.4 is 4608; there is at least 85% base complementarity between the sense strand and the antisense strand.

5. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 2, characterized in that: The antisense strand is selected from the following sequences: 5'ucucaauuaaguugacuagacac 3' SEQ ID NO: 293; or a sequence having at least 15 consecutive nucleotides identical to SEQ ID NO: 293, or a sequence differing from SEQ ID NO: 293 by one, two or three nucleotides, Among them, g = guanylate, a = adenylate, u = uridylate, c = cytidine, t = thymidine deoxyribonucleotide.

6. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 2, characterized in that: The sense strand is selected from the following sequences: 5'gucuagucaacuuaauugaga 3' SEQ ID NO: 25; or a sequence having at least 15 consecutive nucleotides identical to the sequence of SEQ ID NO: 25, or a sequence differing from the sequence of SEQ ID NO: 25 by one, two or three nucleotides, Among them, g = guanylate, a = adenylate, u = uridylate, c = cytidine.

7. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 3, characterized in that: The antisense strand is selected from the following sequences: 5'aaacauagaauacugggacaacg 3' SEQ ID NO: 1278; or a sequence having at least 15 consecutive nucleotides identical to SEQ ID NO: 1278, or a sequence differing from SEQ ID NO: 1278 by one, two or three nucleotides, Among them, g = guanylate, a = adenylate, u = uridylate, c = cytidine, t = thymidine deoxyribonucleotide.

8. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 3, characterized in that: The sense strand is selected from the following sequences: 5'uugucccaguauucuauguuu 3' SEQ ID NO: 826; or a sequence having at least 15 consecutive nucleotides identical to the sequence of SEQ ID NO: 826, or a sequence differing from the sequence of SEQ ID NO: 826 by one, two or three nucleotides, Among them, g = guanylate, a = adenylate, u = uridylate, c = cytidine.

9. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 4, characterized in that: The antisense strand is selected from the following sequences: 5'agauguaucugucaacaccau 3' SEQ ID NO.2543; 5'uagaauuucucugaggcuccac 3' SEQ ID NO.2630; 5'uauagauguaguagaauuucucu 3' SEQ ID NO.2639; 5'uaugaagcaauucuccagcac 3' SEQ ID NO.2831; 5'uuuuguaugaagcaaucuccuc 3' SEQ ID NO.2590; or a sequence having at least 15 consecutive nucleotides identical to the above sequence, or a sequence differing from the above sequence by one, two or three nucleotides, Among them, g = guanylate, a = adenylate, u = uridylate, c = cytidine, t = thymidine deoxyribonucleotide.

10. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 4, characterized in that: The sense strand is selected from the following sequences: 5'gguguugacagauacaucu 3' SEQ ID NO.1952; 5'ggagccuacagagaaauucua 3' SEQ ID NO.2039; 5'agaaauucuacuacaucuaua 3' SEQ ID NO.2048; 5'gcugaggagaauugcuucua 3' SEQ ID NO.2240; 5'ggagaauugcuucauacaaaa 3' SEQ ID NO.2245; or a sequence having at least 15 consecutive nucleotides identical to the above sequence, or a sequence differing from the above sequence by one, two or three nucleotides, Among them, g = guanylate, a = adenylate, u = uridylate, c = cytidine.

11. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 2, characterized in that: The sense strand is SEQ ID NO: 25 or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence differing therefrom by one, two or three nucleotides; and the antisense strand is SEQ ID NO: 293 or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence differing therefrom by one, two or three nucleotides: Sense strand: 5'gucuagucaacuuaauugaga 3' SEQ ID NO: 25; Antisense strand: 5'ucucaauuaaguugacuagacac 3' SEQ ID NO: 293; Among them, g = guanylate, a = adenylate, u = uridylate, c = cytidine, t = thymidine deoxyribonucleotide.

12. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 3, characterized in that: The sense strand is SEQ ID NO: 826, or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence differing therefrom by one, two, or three nucleotides; and the antisense strand is SEQ ID NO: 1278, or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence differing therefrom by one, two, or three nucleotides: Sense strand: 5'uugucccaguauucuauguuu 3' SEQ ID NO: 826; Antisense strand: 5'aaacauagaauacugggacaacg 3' SEQ ID NO: 1278; Among them, g = guanylate, a = adenylate, u = uridylate, c = cytidine, t = thymidine deoxyribonucleotide.

13. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 4, characterized in that: The sense strand is SEQ ID NO: 2048 or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence differing therefrom by one, two or three nucleotides; and the antisense strand is SEQ ID NO: 2639 or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence differing therefrom by one, two or three nucleotides: Sense strand: 5'agaaauucuacuacaucuaua 3' SEQ ID NO: 2048; Antisense strand: 5'uauagauguaguagaauuucucu 3' SEQ ID NO: 2639; Among them, g = guanylate, a = adenylate, u = uridylate, c = cytidine, t = thymidine deoxyribonucleotide.

14. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 4, characterized in that: The sense strand is SEQ ID NO: 2639 or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence differing therefrom by one, two or three nucleotides; and the antisense strand is SEQ ID NO: 2831 or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence differing therefrom by one, two or three nucleotides: Sense strand: 5'gcugaggagaauugcuucaua 3' SEQ ID NO: 2240; Antisense strand: 5'uaugaagcaauucuccucagcac 3' SEQ ID NO: 2831; Among them, g = guanylate, a = adenylate, u = uridylate, c = cytidine, t = thymidine deoxyribonucleotide.

15. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to any one of claims 1, characterized in that: At least one nucleotide of the RNA inhibitor is modified.

16. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 15, characterized in that: The modifications include: 2'-fluoro modification, 2'-methoxy modification, thiophosphate modification, invAb modification, glycerol nucleotide, 3' terminal deoxythymine (dT) nucleotide, locked nucleotide, unlocked nucleotide, conformationally restricted nucleotide, constrained ethyl nucleotide, 2'-amino modified nucleotide, 2'-O-allyl modified nucleotide, 2'-C-alkyl modified nucleotide, 2'-hydroxyl modified nucleotide, 2'-methoxyethyl modified nucleotide, 2'-O-alkyl modified nucleotide, 2' phosphate modification or 2-O-(N-methylacetamide) modification, morpholino nucleotide, aminophosphoryl, abasic nucleotide, abasic deoxynucleotide, nucleotide containing non-natural base, tetrahydropyran modified nucleotide, 1,5-anhydrohexitol modified nucleotide, cyclohexenyl modified nucleotide, methylphosphonate modification, 5'-phosphate modification, 5'-phosphate analog modification, thermally unstable nucleotide, nucleotide analogs, one or a combination of several thereof.

17. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 16, characterized in that: The RNA inhibitor is an RNA inhibitor that inhibits the expression of the CFB gene, and the antisense strand is selected from the following sequences: 5'UsdCsUCdAATUAAGTUfGACUAGACsAsC 3' SEQ ID NO: 588; Among them, G=2'-O-methylguanylate, A=2'-O-methyladenylate, U=2'-O-methyluridylate, C=2'-O-methylcytidine; Gs=2'-O-methyl-3'-thioguanylate, As=2'-O-methyl-3'-thioadenylate, Cs=2'-O-methyl-3'-thiocytidine; fG=2'-fluoroguanylate, fA=2'-fluoroadenylate, fU=2'-fluorouridylate, fC=2'-fluorocytidine; fGs=2'-fluoro-3'-thioguanylate, T=2'-deoxy-thymidylate, dA=2'-deoxy-adenylate, dG=2'-deoxy-guanylate.

18. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 16, characterized in that: The RNA inhibitor is an RNA inhibitor that inhibits the expression of the C5 gene, and the antisense strand is selected from the following sequences: 5'AsdAsACdAUdAGAAUdACfUGGGACAAsCsG 3' SEQ ID NO: 1598; Among them, G=2'-O-methylguanylate, A=2'-O-methyladenylate, U=2'-O-methyluridylate, C=2'-O-methylcytidine; Gs=2'-O-methyl-3'-thioguanylate, As=2'-O-methyl-3'-thioadenylate, Cs=2'-O-methyl-3'-thiocytidine; fG=2'-fluoroguanylate, fA=2'-fluoroadenylate, fU=2'-fluorouridylate, fC=2'-fluorocytidine; fGs=2'-fluoro-3'-thioguanylate, T=2'-deoxy-thymidylate, dA=2'-deoxy-adenylate, dG=2'-deoxy-guanylate.

19. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 16, characterized in that: The RNA inhibitor is an RNA inhibitor that inhibits the expression of the C3 gene, and the antisense strand is selected from the following sequences: 5'UsdAsUAdGATGUAGTAfGAAUUUCUsCsU 3' SEQ ID NO: 1665; 5'UsfAsUGAfAGfCAAUUCfUCfCUCAGCsAsC 3' SEQ ID NO: 1671; Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenylate, U = 2'-O-methyluridylate, C = 2'-O-methylcytidine; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'-O-methyl-3'-thiocytidine; fG = 2'-fluoroguanylate, f A = 2'-fluoroadenylic acid, fU = 2'-fluorouridylic acid, fC = 2'-fluorocytidylic acid; fGs = 2'-fluoro-3'-thioguanylic acid, fAs = 2'-fluoro-3'-thioadenylic acid, fUs = 2'-fluoro-3'-thiouridylic acid, fCs = 2'-fluoro-3'-thiocytidylic acid, T = 2'-deoxy-thymidylic acid, dG = 2'-deoxy-guanylic acid, dAs = 2'-deoxy-3'-thioadenylic acid.

20. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 16, characterized in that: The RNA inhibitor is an RNA inhibitor that inhibits the expression of the CFB gene, and the sense strand is selected from the following sequences: 5'GsUsCUAGfUCfAfAfCUUAAUUGAsGsA 3' SEQ ID NO: 559; Among them, G = 2'-O-methylguanylate, A = 2'-O-methyladenylate, U = 2'-O-methyluridylate, C = 2'-O-methylcytidine; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'-O-methyl-3'-thiocytidine; fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidine.

21. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 16, characterized in that: The RNA inhibitor is an RNA inhibitor that inhibits the expression of the C5 gene, and the sense strand is selected from the following sequences: 5'UsUsGUCCfCAfGfUfAUUCUAUGUsUsU 3' SEQ ID NO: 1537; Among them, G = 2'-O-methylguanylate, A = 2'-O-methyladenylate, U = 2'-O-methyluridylate, C = 2'-O-methylcytidine; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'-O-methyl-3'-thiocytidine; fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidine.

22. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 16, characterized in that: The RNA inhibitor is an RNA inhibitor that inhibits the expression of the C3 gene, and the positive strand is selected from the following sequences: 5'AsGsAAAUfUCfUfAfCUACAUCUAsUsA 3' SEQ ID NO: 1645; 5'GsCsUGAGfGAfGfAfAUUGCUUCAsUsA 3' SEQ ID NO: 1651; Among them, G = 2'-O-methylguanylate, A = 2'-O-methyladenylate, U = 2'-O-methyluridylate, C = 2'-O-methylcytidine; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'-O-methyl-3'-thiocytidine; fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidine.

23. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 16, characterized in that: The RNA inhibitor is an RNA inhibitor that inhibits CFB gene expression, the sense strand is SEQ ID NO: 559 or a sequence that differs therefrom by one, two or three nucleotides, and the antisense strand is SEQ ID NO: 588 or a sequence that differs therefrom by one, two or three nucleotides: Sense strand: 5'GsUsCUAGfUCfAfAfCUUAAUUGAsGsA 3' SEQ ID NO: 559; Antisense strand: 5'UsdCsUCdAATUAAGTUfGACUAGACsAsC 3' SEQ ID NO: 588; Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenylate, U = 2'-O-methyluridylate, C = 2'-O-methylcytidine; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'-O-methyl-3'-thiocytidine; fG = 2'-fluoroguanylate, f A = 2'-fluoroadenylic acid, fU = 2'-fluorouridylic acid, fC = 2'-fluorocytidylic acid; fGs = 2'-fluoro-3'-thioguanylic acid, fAs = 2'-fluoro-3'-thioadenylic acid, fUs = 2'-fluoro-3'-thiouridylic acid, fCs = 2'-fluoro-3'-thiocytidylic acid, T = 2'-deoxy-thymidylic acid, Ts = 2'-deoxy-3'-thiothymidylic acid, dA = 2'-deoxy-adenylic acid.

24. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 16, characterized in that: The RNA inhibitor is an RNA inhibitor that inhibits C5 gene expression, the sense strand is SEQ ID NO: 1537 or a sequence that differs therefrom by one, two or three nucleotides, and the antisense strand is SEQ ID NO: 1598 or a sequence that differs therefrom by one, two or three nucleotides: Sense strand: 5'UsUsGUCCfCAfGfUfAUUCUAUGUsUsU 3' SEQ ID NO: 1537; Antisense strand: 5'AsdAsACdAUdAGAAUdACfUGGGACAAsCsG 3' SEQ ID NO: 1598; Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenylate, U = 2'-O-methyluridylate, C = 2'-O-methylcytidine; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'-O-methyl-3'-thiocytidine; fG = 2'-fluoroguanylate, f A = 2'-fluoroadenylic acid, fU = 2'-fluorouridylic acid, fC = 2'-fluorocytidylic acid; fGs = 2'-fluoro-3'-thioguanylic acid, fAs = 2'-fluoro-3'-thioadenylic acid, fUs = 2'-fluoro-3'-thiouridylic acid, fCs = 2'-fluoro-3'-thiocytidylic acid, T = 2'-deoxy-thymidylic acid, Ts = 2'-deoxy-3'-thiothymidylic acid, dA = 2'-deoxy-adenylic acid.

25. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 16, characterized in that: The RNA inhibitor is an RNA inhibitor that inhibits C3 gene expression, the sense strand is SEQ ID NO: 1651 or a sequence that differs therefrom by one, two or three nucleotides, and the antisense strand is SEQ ID NO: 1671 or a sequence that differs therefrom by one, two or three nucleotides: Sense strand: 5'AsGsAAAUfUCfUfAfCUACAUCUAsUsA 3' SEQ ID NO: 1645; Antisense strand: 5'UsdAsUAdGATGUAGTAfGAAUUUCUsCsU 3' SEQ ID NO: 1665; Alternatively, the sense strand is SEQ ID NO: 1645 or a sequence differing therefrom by one, two or three nucleotides, and the antisense strand is SEQ ID NO: 1665 or a sequence differing therefrom by one, two or three nucleotides: Sense strand: 5'GsCsUGAGfGAfGfAfAUUGCUUCAsUsA 3' SEQ ID NO: 1651; Antisense strand: 5'UsfAsUGAfAGfCAAUUCfUCfCUCAGCsAsC 3' SEQ ID NO: 1671; Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenylate, U = 2'-O-methyluridylate, C = 2'-O-methylcytidine; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'-O-methyl-3'-thiocytidine; fG = 2'-fluoroguanylate, f A = 2'-fluoroadenylic acid, fU = 2'-fluorouridylic acid, fC = 2'-fluorocytidylic acid; fGs = 2'-fluoro-3'-thioguanylic acid, fAs = 2'-fluoro-3'-thioadenylic acid, fUs = 2'-fluoro-3'-thiouridylic acid, fCs = 2'-fluoro-3'-thiocytidylic acid, T = 2'-deoxy-thymidylic acid, dG = 2'-deoxy-guanylic acid, dAs = 2'-deoxy-3'-thioadenylic acid.

26. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 25, characterized in that: The RNA inhibitor further contains carrier structures 5'MVIP and 3'MVIP, and the structure of the RNA inhibitor is shown in Formula Ia, Ib or Ic: in, The 5'MVIP is composed of a transfer point R1, a connecting chain D, a linker B, a side chain L and a liver-targeting specific ligand X, which is connected to the 5' end of the sense chain or the 5' end of the antisense chain through the transfer point R1, and its structure is shown in general formula I: (X-L) n -B-D-R1- I The 3'MVIP is composed of a transfer point R2, a connecting chain D, a linker B, a side chain L and a liver-targeting specific ligand X, which is connected to the 3' end of the sense chain or the 3' end of the antisense chain through the transfer point R2, and its structure is shown in general formula II: (X-L) m -B-D-R2- II in, n and m are each independently any integer of 0-4, each independently preferably an integer of 1-3, and n+m=an integer of 2-6, preferably n+m=2, 3 or 4, more preferably 4; The transition point R1 is a heterocyclic or carbocyclic structure containing N, S or O as shown below: Alternatively, the R1 is -NH(CH2) x CH2O-, wherein x is any integer from 3 to 12, preferably any integer from 4 to 6; The transition point R2 is a heterocyclic or carbocyclic structure containing N, S or O as shown below: Alternatively, the transition point R2 is -NH(CH2) x1 CH(OH)(CH2) x2 CH2O-, wherein x1 is any integer from 1 to 4, and x2 is any integer from 0 to 4; The liver-targeting specific ligand X is the same or different within each of 5'MVIP and 3'MVIP or between 5'MVIP and 3'MVIP, and is selected from monosaccharides and their derivatives, preferably N-acetylgalactosamine and its derivatives, and more preferably selected from the following structures: Wherein W is selected from -OH, -NHCOOH and -NHCO(CH2) q One or two of CH3, wherein q is an integer of 0-4; The branched chain L is the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP, and is selected from one or more of the following structures: Wherein, r1 is any integer from 1 to 12, r2 is any integer from 0 to 20, and Z is H, an alkyl group or an amide group, wherein the alkyl group is, for example, a C1-C5 alkyl group; The linker B is the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP, and is selected from the following structures: wherein A1 and A2 are each independently C, O, S, -NH-, carbonyl, amide, phosphoryl or thiophosphoryl, and r is any integer from 0 to 4; The connecting chain D is the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP, and is selected from the following structures: Wherein, each p is independently any integer from 1 to 20; s is any integer from 2 to 13; and Z1 and Z2 are the same or different substituent groups.

27. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 26, characterized in that: The 5'MVIP is 5'MVIP01 or 5'MVIP09 as shown below, and the 3'MVIP is 3'MVIP01, 3'MVIP09 or 3'MVIP17 as shown below:

28. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 27, characterized in that: The combination of the sense strand 5'MVIP and the antisense strand 3'MVIP is 5'MVIP01 / 3'MVIP01, 5'MVIP01 / 3'MVIP17 or 5'MVIP09 / 3'MVIP09, or the combination of the sense strand 5'MVIP and the antisense strand 3'MVIP is 5'MVIP01 / 3'MVIP09 or 5'MVIP09 / 3'MVIP01.

29. The CFB RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 1, characterized in that: The RNA inhibitor is selected from Kylo-17-DS2911.

30. The C5 RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 1, characterized in that: The RNA inhibitor is selected from Kylo-19-DS7881.

31. The C3 RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 1, characterized in that: The RNA inhibitor is selected from Kylo-27-DS8201 and Kylo-27-DS8141.

32. Use of the RNA inhibitor or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 31 in the preparation of a medicament for treating and / or preventing diseases associated with increased levels of the complement system, characterized in that: The diseases include, but are not limited to, lipid metabolism disorders.

33. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the RNA inhibitor according to any one of claims 1 to 31 or other therapeutic agents for treating or preventing diseases related to the complement system.

34. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the RNA inhibitor or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 31 and a pharmaceutically acceptable adjuvant, and the dosage form is an oral agent, an intravenous injection, or a subcutaneous or intramuscular injection, preferably a subcutaneous injection.

Images