Cellular disease model for inborn errors of immunity and use thereof

By employing expanded potential stem cells derived from individuals with IEI-related gene mutations, the method effectively models disease processes and evaluates candidate agents, addressing the challenges of heterogeneity and sample availability in current IEI treatment approaches.

WO2025113708A1PCT designated stage expired Publication Date: 2025-06-05CENT FOR TRANSLATIONAL STEM CELL BIOLOGY LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/136138
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-01
Filing Date
2024-12-02
Publication Date
2025-06-05

AI Technical Summary

Technical Problem

Current methods lack effective disease models for Inborn Errors of Immunity (IEI), making it difficult to evaluate and screen candidate agents for treatment, especially due to the heterogeneity of disease manifestations and limited availability of fresh patient samples.

Method used

The use of expanded potential stem cells (EPSCs) and cells differentiated therefrom, derived from individuals with IEI-related gene mutations, to model disease processes and evaluate candidate agents. This involves contacting EPSCs with candidate agents and assessing changes in IEI-related gene function or expression.

Benefits of technology

This approach allows for the accurate recapitulation of cellular characteristics related to IEI-specific gene mutations, enabling effective evaluation and screening of candidate agents for treating IEI, thereby facilitating personalized medicine and disease management.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024136138_05062025_PF_FP_ABST
    Figure CN2024136138_05062025_PF_FP_ABST
Patent Text Reader

Abstract

The present application provides a method of evaluating a candidate agent for treating Inborn Errors of Immunity (IEI), comprising: a) contacting a population of expanded potential stem cells (EPSCs) and / or cells differentiated therefrom with the candidate agent, wherein the EPSCs are derived from a cell of an individual comprising a mutation in an IEI-related gene; and b) assessing change ofone or more characteristics indicative ofIEI phenotypes ofthe EPSCs and / or cells differentiated therefrom relative to a population of EPSCs and / or cells differentiated therefrom from a cell ofthe individual without contacting with the candidate agent. Methods of identifying an agent for treating IEI related to a mutation in an IEI-related gene, methods of treating IEI in a subject, and compositions useful for such methods are also provided.
Need to check novelty before this filing date? Find Prior Art

Description

Cellular Disease Model for Inborn Errors of Immunity and Use ThereofCROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the priority benefit of U.S. Provisional Application No. 63 / 605,400, filed December 1, 2023, which is hereby incorporated in its entirety. REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (275162000400SEQLIST. xml; Size: 50,721 bytes; and Date of Creation: November 25, 2024) is herein incorporated by reference in its entirety.FIELD

[0003] The present invention relates to the field of using cultured cells, in particular expanded potential stem cells (EPSCs) and / or cells differentiated therefrom, in modeling disease processes of Inborn Errors of Immunity (IEI) and evaluating and screening for potential candidate agents for treating IEI.BACKGROUND OF THE INVENTION

[0004] Inborn Errors of Immunity (IEI) , also known as primary immune deficiency disease (PID) , are mostly monogenic disorders that lead to susceptibility to infections, autoimmunity, allergy, and malignancy. IEI encompass a group of nearly 500 inherited disorders. To date, there is no effective cure for most IEI.

[0005] IEI patients usually exhibit heterogenous disease-associated gene mutations, resulting in diverse disease manifestations and unpredictable responses to therapy. The International Union of Immunological Societies (IUIS) classification attempt to reflect common presentations associated with each gene defect. However, there are many instances where different pathogenic variants in a single gene cause unique phenotypes; defects in different genes have a similar phenotype due to convergence on a shared critical pathway; or the identical mutation is expressed differently, even in a single family. Furthermore, pathogenic variants can be somatic or mosaic and can present differently than germline variants. Many IEIs are life-threatening with unclear pathophysiology and lack specific disease models or treatments.

[0006] Furthermore, studying or confirming the function of individual mutations remain difficult, especially given the limited availability of fresh patient samples. Patients with IEI inherently suffer from frequent infections or are already receiving immunosuppressants even at the time of initial diagnosis, making them unavailable or unsuitable for frequent blood sampling. Limitations in obtaining fresh samples for functional testing and research further highlights the need for patient-specific ex-vivo platforms. Therefore, there is an unmet need for methods and systems for recapitulating disease processes related to specific IEI gene mutations, and evaluating and screening for candidate agents for treating IEI related to the specific gene mutations. The present disclosure addresses this need and other related needs in the field. BRIEF SUMMARY OF THE INVENTION

[0007] The terms “invention, ” “the invention, ” “this invention” and “the present invention, ” as used in this disclosure, are intended to refer broadly to all of the subject matter of this patent application and the claims below. Statements containing these terms should be understood not to limit the subject matter described herein or to limit the meaning or scope of the patent claims below. Covered embodiments of the invention are defined by the claims, not this summary. This summary is a high-level overview of various aspects of the invention and introduces some of the concepts that are described and illustrated in the present disclosure and the accompanying figures. This summary is not intended to identify key or essential features of the claimed subject matter, nor is it intended to be used in isolation to determine the scope of the claimed subject matter. The subject matter should be understood by reference to appropriate portions of the entire specification, any or all figures and each claim. The present disclosure describes and refers to various embodiments of the invention. No particular embodiment is intended to define the scope of the invention. Rather, the embodiments merely provide non-limiting examples of various methods, compositions, kits, systems etc. that are at least included within the scope of the invention. Some embodiments of the present invention are summarized below, while others are described and shown elsewhere in the present disclosure.

[0008] In some embodiments, provided herein is a method of evaluating a candidate agent for treating Inborn Errors of Immunity (IEI) , comprising: a) contacting a population of expanded potential stem cells (EPSCs) and / or cells differentiated therefrom with the candidate agent, wherein the EPSCs are derived from a cell of an individual comprising a mutation in an IEI-related gene; and b) assessing change of one or more characteristics indicative of IEI phenotypes of the EPSCs and / or cells differentiated therefrom relative to a population of EPSCs and / or cells differentiated therefrom from a cell of the individual without contacting with the candidate agent.

[0009] In some embodiments, the IEI-related gene is selected from the group consisting of: Signal Transducer and Activator of Transcription 1 (STAT1) , STAT6, and SERPING1. In any of the embodiments herein, the mutation can be selected from the group consisting of missense, nonsense, frameshift, deletion, and insertion. In any of the embodiments herein, the cell of the individual can comprise a Signal Transducer and Activator of Transcription 1 (STAT1) Gain-of-Function mutation.

[0010] In any of the embodiments herein, the cell of the individual can be a somatic cell. In some embodiments, the cell of the individual is a peripheral blood mononuclear cell. In some embodiments, the cell of the individual is an erythroblast.

[0011] In any of the embodiments herein, the method can further comprise assessing function or expression of the IEI-related gene in the population of EPSCs and / or cells differentiated therefrom prior to the contacting in a) .

[0012] In any of the embodiments herein, the assessing can further comprise genetically modifying the population of EPSCs and / or cells differentiated therefrom.

[0013] In some embodiments, the population of EPSCs and / or cells differentiated therefrom comprise a reporter molecule or a heterologous nucleic acid encoding a reporter molecule. In some embodiments, the population of EPSCs and / or cells differentiated therefrom comprise a reporter molecule. In some embodiments, the reporter molecule is selected from the group consisting of: a physically activated molecule and a chemically activated molecule.

[0014] In some embodiments, the population of EPSCs and / or cells differentiated therefrom comprise a heterologous nucleic acid encoding a reporter molecule. In some embodiments, the heterologous nucleic acid is integrated into the genome of the population of EPSCs and / or cells differentiated therefrom. In some embodiments, the heterologous nucleic acid is under the control of a promoter of the IEI-related gene or a gene regulated by the IEI-related gene. In some embodiments, the heterologous nucleic acid is introduced into the population of EPSCs and / or cells differentiated therefrom by a gene editing tool. In any of the embodiments herein, the reporter molecule can be selected from the group consisting of Green Fluorescent Protein (GFP) , Red Fluorescent Protein (RFP) , Yellow Fluorescent Protein (YFP) , mCherry, tdTomato, photoconvertible fluorescent proteins, bioluminescence, enzyme assay, antibody-based assays, chloramphenicol acetyltransferase, and biosensors.

[0015] In any of the embodiments herein, the method can further comprise editing the IEI-related gene using a gene editing tool. In some embodiments, the method further comprises assessing the function or expression of the IEI-related gene before and after editing the IEI-related gene using a gene editing tool.

[0016] In any of the embodiments herein, the function or expression of the IEI-related gene can comprise gene expression and / or protein modification after contacting the population of EPSCs and / or cells differentiated therefrom with a stimulating agent. In some embodiments, the stimulating agent is IFNγ. In any of the embodiments herein, the function or expression of the IEI-related gene can comprise STAT1 expression, IRF1 expression, APOL6 expression, OAS1 expression, STAT1 phosphorylation, and / or phospho-STAT1 dephosphorylation. In any of the embodiments herein, the function or expression of the IEI-related gene before editing the IEI-related gene can comprise: i) increased expression of STAT1; ii) increased expression of STAT1-regulated genes; iii) STAT1 hyperphosphorylation; and / or iv) delayed phospho-STAT1 dephosphorylation.

[0017] In any of the embodiments herein, the assessing can comprise quantitative polymerase chain reaction (RT-qPCR) , microarray, RNA sequencing, Western blot, and / or enzyme-linked immunosorbent assay (ELISA) .

[0018] In any of the embodiments herein, the population of EPSCs and / or cells differentiated therefrom can comprise monocytes, macrophages, hepatocytes, keratinocytes, skin organoids, and / or liver organoids.

[0019] In any of the embodiments herein, the contacting in a) can comprise contacting the population of EPSCs and / or cells differentiated therefrom with the candidate agent for about 1 hour to about 72 hours. In any of the embodiments herein, the candidate agent can be selected from the group consisting of: a small molecule, a peptide, a polypeptide, and a nucleic acid. In some embodiments, the candidate agent is a Janus-kinase inhibitor.

[0020] In any of the embodiments herein, the method can further comprise stimulating the EPSCs and / or cells differentiated therefrom before the contacting in a) . In any of the embodiments herein, the method can further comprise stimulating the EPSCs and / or cells differentiated therefrom simultaneously with the contacting in a) . In any of the embodiments herein, the stimulating can comprise contacting the population of EPSCs and / or cells differentiated therefrom with IFNγ. In some embodiments, the stimulating comprises contacting the population of EPSCs and / or cells differentiated therefrom with IFNγfor about 1 hour to about 72 hours.

[0021] In any of the embodiments herein, the function or expression of the IEI-related gene can comprise change of gene expression and / or protein modification. In any of the embodiments herein, the function or expression of the IEI-related gene can comprise change of STAT1 expression, IRF1 expression, APOL6 expression, OAS1 expression, STAT1 phosphorylation and / or phospho-STAT1 dephosphorylation. In any of the embodiments herein, the function or expression of the IEI-related gene relative to a population of EPSCs and / or cells differentiated therefrom from a cell of the individual without contacting with the candidate agent can comprise: i) decreased expression of STAT1; ii) decreased expression of STAT1-regulated genes; iii) decreased or ameliorated STAT1 hyperphosphorylation; and / or iv) non-delayed phospho-STAT1 dephosphorylation. In any of the embodiments herein, the assessing in b) can comprise quantitative polymerase chain reaction (RT-qPCR) , microarray, RNA sequencing, Western blot, and / or enzyme-linked immunosorbent assay (ELISA) .

[0022] In some embodiments, provided herein is a method of identifying a candidate agent for treating IEI related to a mutation in an IEI-related gene, comprising: a) evaluating a plurality of candidate agents according to the method of any of the embodiments herein, wherein the individual comprises a mutation in the IEI-related gene; and b) identifying the candidate agent capable of changing function or expression of the IEI-related gene of the EPSCs and / or cells differentiated therefrom relative to a population of EPSCs and / or cells differentiated therefrom derived from a cell of the individual without contacting with the candidate agent.

[0023] In some embodiments, provided herein is a method of treating IEI in a subject, comprising: a) identifying a candidate agent according to the method of any of the embodiments herein, wherein the subject comprises a mutation in the IEI-related gene, and b) treating the subject with the candidate agent.

[0024] In some embodiments, provided herein is a composition comprising Expanded Potential Stem Cells (EPSCs) , wherein the EPSCs are reprogrammed from a cell of an individual with a genetic disease. In some embodiments, the cell of the individual is a somatic cell. In any of the embodiments herein, the EPSCs can comprise a reporter molecule or a heterologous nucleic acid encoding a reporter molecule. In any of the embodiments herein, the individual can be a human individual. In any of the embodiments herein, the genetic disease can be Inborn Errors of Immunity.

[0025] In any of the embodiments herein, the EPSCs can comprise a mutation in a gene selected from the group consisting of Signal Transducer and Activator of Transcription 1 (STAT1) , STAT6, and SERPING1.

[0026] In any of the embodiments herein, following IFNγstimulation, the EPSCs can exhibit one or more characteristics selected from the group consisting of: i) increased expression of STAT1; ii) increased expression of STAT1-regulated genes; iii) STAT1 hyperphosphorylation; and iv) delayed phospho-STAT1 dephosphorylation.BRIEF DESCRIPTION OF THE DRAWINGS

[0027] FIG. 1 depicts a schematic drawing of the STAT1 gene and loci of gain of function mutations in patient P1 and patient P2.

[0028] FIG. 2 depicts a schematic representation of the process of reprogramming PBMC to EPSC.

[0029] FIGs. 3A-3D show features of PBMC and PBMC-expanded EPC from STAT1-GoF patients (P1 and P2) and controls (C1-C3) . FIG. 3A shows morphology of PBMC and PBMC-expanded EPC. FIG. 3B shows expression of CD71 and CD135αby flow cytometry. FIG. 3C shows expanded EPC downregulated the expression of CD19, CD3, CD14 and upregulated the expression of CD71, HBA1, HBB, and HBG1 compared to PBMC. FIG. 3D shows impaired cell proliferation during EPC expansion among patient-derived PBMC vs. controls.

[0030] FIGs. 4A-4D depict EPSC reprogrammed from PBMC-derived EPC from STAT1-GoF patients (P1 and P2) and controls (C1-C3) . FIG. 4A shows cell morphology of EPSC reprogrammed from PBMC-derived EPC from STAT1-GoF patients and controls. FIG. 4B shows representative EPSC morphology during maintenance phase. FIG. 4C shows the reprogrammed cells were clear of viral vectors. FIG. 4D shows patient-specific point mutations in all patient-derived EPSC. (TATAATTTGAAAGTCAA (SEQ ID NO: 43) ; GCTGAATTATAATTTGAAAGTCAAAGTCTTA (SEQ ID NO: 44) ; GCTGAATTATAATTTTAAAGTCAAAGTCTTA (SEQ ID NO: 45) ; CTCCCGAGCGGTTGGGC (SEQ ID NO: 46) ; AGCCAGCTCCCGAGCGGTTGGGCCTCCATC (SEQ ID NO: 47) ; AGCCAGCTCCCGAGGGGTTGGGCCTCCATC (SEQ ID NO: 48) )

[0031] FIGs. 5A-5G depict characterization of pluripotency in STAT1-GoF EPSC (P1 and P2) and control EPSC (C1-C3) . FIG. 5A shows normal karyotypes of STAT1-GoF and control EPSC. FIG. 5B shows immunofluorescence staining of NANOG, OCT4, and TRA-1-60 protein expression. FIG. 5C shows expression of pluripotent marker genes (NANOG, OCT4, SOX2, REX-1 and SALL4) . FIG. 5D shows STAT1-GoF EPSC were more flattened in morphology and exhibited rougher clone boundaries. FIG. 5E shows morphology of patient and control EPSC during maintenance at 100x. FIG. 5F shows morphology of patient and control EPSC during maintenance at 400x. FIG. 5G shows morphology of patient and control EPSC during maintenance at 400x with Tra-1-60 staining.

[0032] FIGs. 6A-6E show EPSC response to IFNγstimulation. FIG. 6A shows expression of STAT1, IFN receptor genes and GATA2 in patient and control EPSC. FIG. 6B shows p-STAT1 detected by immunofluorescence following short-term IFNγstimulation. FIG. 6C shows p-STAT1 measured by Western blot and relative intensity to t-STAT1. FIG. 6D shows proportion of EPSC expressing p-STAT1 at 0 and 15 minutes following stimulation. FIG. 6E shows p-STAT1 from 0 to 60 minutes following stimulation.

[0033] FIGs. 7A-7D show STAT1 dephosphorylation in STAT1-GoF EPSC (P1 and P2) and control EPSC (C1-C3) . FIG. 7A shows p-STAT1, t-STAT1 and p / t-STAT1 ratio among patient and control EPSC following IFNγdeprivation within 1 hour. FIG. 7B shows p-STAT1, t-STAT1 and p / t-STAT1 ratio among patient and control EPSC following IFNγdeprivation within 8 hours. FIG. 7C shows immunoblotting showing delayed dephosphorylation of p-STAT1 in patient EPSC after addition of ruxolitinib following initial IFNγstimulation. FIG. 7D shows flow cytometry results showing delayed dephosphorylation of p-STAT1 in patient EPSC after addition of ruxolitinib following initial IFNγstimulation. “-” : before IFNγstimulation; “+” : 1 hour following stimulation with 50 ng / ml IFNγ; “15” , “30” , “60” and” 120” : minutes following addition of 1uM ruxolitinib.

[0034] FIGs. 8A-8F show effect of JAK inhibition on p-STAT1 and t-STAT1 expression. FIG. 8A shows p-STAT1 and t-STAT1 levels in STAT1-GoF EPSC (P1 and P2) and control EPSC (C) following 24-hour co-incubation with different concentrations of ruxolitinib (Rux) , baricitinib (Bar) and tofacitinib (Tof) as measured by flow cytometry. In the top panel, in each of the C, P1, and P2, shown from left to right are IFNγ-, IFNγ+, IFNγ+1 nM Rux, IFNγ+10 nM Rux, IFNγ+100 nM Rux, and IFNγ+1000 nM Rux. In the middle panel, in each of the C, P1, and P2,shown from left to right are IFNγ-, IFNγ+, IFNγ+1 nM Bar, IFNγ+10 nM Bar, IFNγ+100 nM Bar, and IFNγ+1000 nM Bar. In the bottom panel, in each of the C, P1, and P2, shown from left to right are IFNγ-, IFNγ+, IFNγ+1 nM Tof, IFNγ+10 nM Tof, IFNγ+100 nM Tof, and IFNγ+1000 nM Tof. FIG. 8B shows p-STAT1 and t-STAT1 levels in STAT1-GoF EPSC (P1 and P2) and control EPSC (C1 and C2) following 24-hour co-incubation with different concentrations of ruxolitinib (Rux) , baricitinib (Bar) and tofacitinib (Tof) as measured by Western blot. FIG. 8C shows p-STAT1 expression in primary monocytes from STAT1-GoF patients’ peripheral blood mononuclear cells (P1 and P2) at rest and after stimulation with IFNγin comparison to a control (C) . FIG. 8D shows p-STAT1 expression in primary monocytes from STAT1-GoF patients’ peripheral blood mononuclear cells (P1 and P2) following addition of ruxolitinib (Rux) in comparison to a control (C) . In each of the C, P1, and P2, shown from left to right are IFNγ-, IFNγ+, IFNγ+1 nM Rux, IFNγ+10 nM Rux, IFNγ+100 nM Rux, and IFNγ+1000 nM Rux. FIG. 8E shows p-STAT1 expression in primary monocytes from STAT1-GoF patients’ peripheral blood mononuclear cells (P1 and P2) following addition of baricitinib (Bar) in comparison to a control (C) . In each of the C, P1, and P2, shown from left to right are IFNγ-, IFNγ+, IFNγ+1 nM Bar, IFNγ+10 nM Bar, IFNγ+100 nM Bar, and IFNγ+1000 nM Bar. FIG. 8F shows p-STAT1 expression in primary monocytes from STAT1-GoF patients’ peripheral blood mononuclear cells (P1 and P2) following addition of tofacitinib (Tof) in comparison to a control (C) . In each of the C, P1, and P2, shown from left to right are IFNγ-, IFNγ+, IFNγ+1 nM Tof, IFNγ+10 nM Tof, IFNγ+100 nM Tof, and IFNγ+1000 nM Tof.

[0035] FIGs. 9A-9E show expression of STAT1 and genes regulated by STAT1 following IFNγstimulation with or without addition of JAK inhibitor. FIG. 9A shows mRNA expression of STAT1, IRF1, APOL6, and OAS1 in STAT1-GoF EPSC (P1 and P2) and control EPSC (C1, C2, and C3) with or without 1h IFNγstimulation (indicated by+or-, respectively) . For each gene, shown from left to right are C1-, C1+, C2-, C2+, C3-, C3+, P1-, P1+, P2-, P2+. FIG. 9B shows mRNA expression STAT1, IRF1, APOL6, and OAS1 in STAT1-GoF EPSC (P1 and P2) and control EPSC (C) 24 hours following co-incubation with different concentrations of ruxolitinib (Rux) . For each gene, in each of the C, P1, and P2, shown from left to right are IFNγ-, IFNγ+, IFNγ+1 nM Rux, IFNγ+10 nM Rux, IFNγ+100 nM Rux, and IFNγ+1000 nM Rux. FIG. 9C shows mRNA expression STAT1, IRF1, APOL6, and OAS1 in STAT1-GoF EPSC (P1 and P2) and control EPSC (C) 24 hours following co-incubation with different concentrations of baricitinib (Bar) . For each gene, in each of the C, P1, and P2, shown from left to right are IFNγ-, IFNγ+, IFNγ+1 nM Bar, IFNγ+10 nM Bar, IFNγ+100 nM Bar, and IFNγ+1000 nM Bar. FIG. 9D shows mRNA expression STAT1, IRF1, APOL6, and OAS1 in STAT1-GoF EPSC (P1 and P2) and control EPSC (C) 24 hours following co-incubation with different concentrations of tofacitinib (Tof) . For each gene, in each of the C, P1, and P2, shown from left to right are IFNγ-, IFNγ+, IFNγ+1 nM Tof, IFNγ+10 nM Tof, IFNγ+100 nM Tof, and IFNγ+1000 nM Tof. FIG. 9E shows mRNA expression of non-IFN-regulated genes in STAT1-GoF EPSC (P1 and P2) and control EPSC (C) with or without ruxolitinib (Rux) following IFNγstimulation. For each gene, in each of the C, P1, and P2, shown from left to right are IFNγ-, IFNγ+, IFNγ+1 nM Rux, IFNγ+10 nM Rux, IFNγ+100 nM Rux, and IFNγ+1000 nM Rux.

[0036] FIGs. 10A-10G show characteristics of repaired P1 EPSC (PA_C6, P1_C27, and P1_C46) . FIG. 10A shows Sanger sequencing confirmation of CRISPR / Cas9 repaired P1 EPSC. (TTTCTTTCCAGACTGTTGGTGAAATTGCAAGAGCTGAATTATAATTTGAAAGTCAAA GTCTTATTTGATAAGTAAGAT (SEQ ID NO: 49) ; ATCTTACTTATCAAATAAGACTTTGACTTTCAAATTATAATTCAGCTCTTGCAATTTC ACCAACAGTCTGGAAAGAAA (SEQ ID NO: 50) ; LLVKLQELNYNLKVKVLFDK (SEQ ID NO: 51) ; TTTCTTTCCAGACTTTTAGTGAAATTGCAAGAGCTGAATTATAATTTGAAAGTCAAA GTCTTATTTGATAAGTAAGAT (SEQ ID NO: 52) ; TTTCTTTCCAGACTGTTGGTGAAATTGCAAGAGCTGAATTATAATTTTAAAGTCAAA GTCTTATTTGATAAGTAAGAT (SEQ ID NO: 53) ; CTGTTGGTGAAATTGCAAGAGCTGAATTATAATTTGAAAG (SEQ ID NO: 54) ; CTGTTGGTGAAATTGCAAGAGCTGAATTATAATTTTAAAG (SEQ ID NO: 55) ; CTTTTAGTGAAATTGCAAGAGCTGAATTATAATTTGAAAG (SEQ ID NO: 56) ) FIG. 10B shows Sanger sequencing confirming corrected GoF mutation. FIG. 10C shows p-STAT1 in the repaired P1 EPSC (PA_C6, P1_C27, and P1_C46) compared to P1 EPSC as measured by flow cytometry. FIG. 10D shows p-STAT1 in the repaired P1 EPSC (PA_C6, P1_C27, and P1_C46) compared to P1 EPSC as measured by immunofluorescence staining. FIG. 10E shows p-STAT1 and t-STAT1 in the repaired P1 EPSC (PA_C6, P1_C27, and P1_C46) compared to P1 EPSC as measured by Western blot. FIG. 10F shows expression of both STAT1 and its downstream genes following IFNγstimulation. FIG. 10G shows expression of pluripotent and IFN receptor genes following IFNγstimulation.

[0037] FIG. 11 shows effect of different JAK inhibitors at various concentrations in STAT1-EGFP reporter EPSC line.DETAILED DESCRIPTION OF THE INVENTION

[0038] IEI often lack disease-specific models, limiting translational research and personalized medicine. Signal Transducer and Activator of Transcription 1 (STAT1) gain-of-function (GoF) is an example of IEI with diverse clinical phenotype with unclear pathomechanisms and unpredictable response to therapy.

[0039] The conventional management of many IEI, including STAT1-GoF, includes the use of long term antimicrobial prophylaxis and immunosuppression for autoimmune manifestations. However, use of long-term anti-microbial is associated with development of multi-drug resistance and immunosuppressive therapies may further exacerbate susceptibility to infections or malignancy. More recently, the use of Janus Activating Kinase (JAK) inhibitors (JAKi) has shown promise and demonstrated effectiveness in ameliorating both Candida susceptibility and autoimmunity among STAT1-GoF patients. A variety of JAKi with different selectivity (such as JAK1 / 2-selective ruxolitinib and baricitinib, JAK1 / 3-selective tofacitinib or JAK1-selective itactinib) , have been reported with variable success. Unfortunately, there have also been reports of failed JAKi with subsequent worsening of fungal and viral infections. Given the complexity of STAT1-GoF pathophysiology and patient heterogeneity, individual patients will likely respond differently to discrete JAKi depending on their underlying disease mechanisms. This highlights the need for ex-vivo and patient-specific testing platforms, which would enable evaluation of novel therapies irrespective of what current treatments the patients are already receiving.

[0040] Although various models such as mice or leukemia-derived cell lines with artificially induced STAT1-GoF mutations have been reported, none have yet to recapitulate mutation or patient specific properties, and in the context of the individual patient’s genome.

[0041] Stem cells and differentiated cells therefrom have extremely important prospects in areas such as disease mechanism research, therapeutic decision making, and drug screening. Traditionally, embryonic stem cells are derived from early embryos at about 100 cells, and generally do not have the ability to develop extraembryonic tissues. In recent years, expanded potential stem cells (EPSC) have been reported to be able to differentiate into various types of tissues / cells, including three embryonic germ layers and extraembryonic cell lineages. For example, EPSC demonstrate superior directed differentiation potential to generate functional hepatocytes transcriptionally closer to the primary human hepatocytes compared with embryonic stem cells. They also have a higher proliferation rate and better genetic and epigenetic stability, making them a more suitable platform for human disease modelling.

[0042] The invention described herein relates, in part, to methods for evaluating a candidate agent for treating Inborn Errors of Immunity (IEI) . The invention described herein also relates, in part, to methods for identifying a candidate agent for treating IEI. The invention described herein also relates, in part, to methods for treating IE in a subject. Furthermore, the invention described herein relates, in part, to compositions comprising Expanded Potential Stem Cells (EPSCs) , wherein the EPSCs are reprogrammed from a cell of an individual with a genetic disease (e.g., IEI) . The methods and compositions disclosed herein provide a solution for ex-vivo platforms that can accurately recapitulate cellular characteristics related to IEI-relate gene mutations that are specific to a patient or a group of patients that share similar gene mutations. The methods and compositions disclosed herein can be used to evaluate and screen for candidate agents (e.g., drugs) for treating IEI in that particular patient or group of patients and enable personalized medicine and disease management.

[0043] In some embodiments, the invention described herein comprises a) contacting a population of expanded potential stem cells (EPSCs) and / or cells differentiated therefrom with the candidate agent, wherein the EPSCs are derived from a cell of an individual comprising a mutation in an IEI-related gene; and b) assessing change of function or expression of the IEI-related gene in the EPSCs and / or cells differentiated therefrom relative to a population of EPSCs and / or cells differentiated therefrom derived from a cell of the individual without contacting with the candidate agent. In some embodiments, EPSCs and / or cells differentiated therefrom accurately recapitulate cellular characteristics related to function or expression of the IEI-related gene, and therefore can reflect any effect that the candidate agent might have in a group of IEI patients with the same or similar genetic makeup. In some embodiments, the EPSCs and / or cells differentiated therefrom comprise a reporter molecule, which can be used to indicate function or expression of the IEI-related gene. In some embodiments, the cells differentiated from the EPSCs are of a cell type that is involved in the subject’s specific phenotypes.

[0044] One aspect of the invention relates to a method of evaluating a candidate agent for treating Inborn Errors of Immunity (IEI) , comprising a) contacting a population of expanded potential stem cells (EPSCs) and / or cells differentiated therefrom with the candidate agent, wherein the EPSCs are derived from a cell of an individual comprising a mutation in an IEI-related gene; and b) assessing change of function or expression of the IEI-related gene in the EPSCs and / or cells differentiated therefrom relative to a population of EPSCs or cells differentiated therefrom derived from a cell of the individual without contacting with the candidate agent.

[0045] Another aspect of the invention relates to a method of identifying a candidate agent for treating IEI related to a mutation in a gene, comprising: a) evaluating a plurality of candidate agents according to the method of any one of the embodiments herein, wherein the individual comprises a mutation in the gene; and b) identifying the candidate agent capable of changing one or more characteristics of the EPSCs or cells differentiated therefrom relative to a population of EPSCs or cells differentiated therefrom from a cell of the individual without contacting with the candidate agent.

[0046] Another aspect of the invention relates to a method of treating IEI in a subject, comprising: a) identifying a candidate agent according to the method of any one of the embodiments herein, wherein the subject comprises a mutation in the gene, and b) treating the individual with the candidate agent.

[0047] Yet another aspect of the invention relates to a composition comprising Expanded Potential Stem Cells (EPSCs) , wherein the EPSCs are reprogrammed from a cell of an individual with a genetic disease.

[0048] All publications, including patent documents, scientific articles and databases, referred to in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication were individually incorporated by reference. If a definition set forth herein is contrary to or otherwise inconsistent with a definition set forth in the patents, applications, published applications and other publications that are herein incorporated by reference, the definition set forth herein prevails over the definition that is incorporated herein by reference.

[0049] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. I. Definitions

[0050] A number of terms and concepts are discussed below. They are intended to facilitate the understanding of various embodiments of the invention in conjunction with the rest of the present disclosure and the accompanying figures. These terms and concepts may be further clarified and understood based on the accepted conventions in the fields of the present invention and the description provided throughout the present disclosure and / or the accompanying figures. Some other terms can be explicitly or implicitly defined in other sections of this disclosure and in the accompanying figures and may be used and understood based on the accepted conventions in the fields of the present invention, the description provided throughout the present disclosure and / or the accompanying figures. The terms not explicitly defined can also be defined and understood based on the accepted conventions in the fields of the present invention and interpreted in the context of the present disclosure and / or the accompanying figures.

[0051] As used herein, the terms “a, ” “an, ” and “the” can refer to “one, ” “one or more” or “at least one, ” unless specifically noted otherwise.

[0052] The terms “about” or “approximately” are used herein to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or simply error-tolerance of a value. For example, the terms “about” or “approximately” may mean±1%, ±5%, ±10%, ±15%or±20%variation from a predetermined value.

[0053] As used herein, the terms “isolate, ” “separate” or “purify” and the related terms are not used necessarily to refer to the removal of all materials other than the components of interest from a sample. Instead, in some embodiments, the terms are used to refer to a procedure that enriches the amount of one or more components of interest relative to one or more other components present in the sample. In some embodiments, “isolation, ” “separation” or “purification” may be used to remove or decrease the amount of one or more components from a sample. For example, the expression “an isolated cell” can refer to a cell that has been substantially separated or purified away from other cells of a cell culture or an organism.

[0054] The term “derived” and the related expressions referring to cells or a biological sample indicate that the cell or sample was obtained from the stated source at some point in time. For example, a cell derived from an organism can represent a primary cell obtained directly from the individual (that is, unmodified) , or it can be modified, for example, by introduction of a recombinant vector, by exposure to or culturing under particular conditions, or immortalization. In some cases, a cell derived from a given source will undergo cell division and / or differentiation such that the original cell no longer exists, but the continuing cells will be understood to derive from the same source. The term “derive, ” “derivation” and the related terms and expressions can also be used in this disclosure to refer to creation of a cell population, cell, or culture from a different starting or preceding cell population, cell, or culture. For example, an expanded potential stem cell (EPSC) described in the present disclosure can be described as being derived from an erythroblast.

[0055] The term “comprising” and the related terms ( “comprise, ” “comprises, ” etc. ) , when used in this disclosure to describe various embodiments of the invention, are open-ended, meaning that they do not exclude additional elements and synonymous with terms “including, ” “containing” or “having. ” When an embodiment of the invention is described using the term “comprising, ” it is intended to include the embodiments, in which the term comprising is replaced with the terms “consisting of” or “consisting essentially of” In other words, the description of the embodiments of the invention described in this disclosure using the term “comprising” and the related terms also provides the description of the related embodiments that use“consisting of” or “consisting essentially of” instead of “comprising” . The term “consisting of”excludes any elements (steps, ingredient etc. ) not specified in the description. The term “consisting essentially of” is intended to exclude only those elements not specified in the description that do not materially affect the basic and novel characteristics of the embodiment.

[0056] “Cell potency” describes a cell's ability to differentiate into other cell types. A cell can be designated as a pluripotent cell, a multipotent cell (which can differentiate into several but not all cell types, for example, umbilical cord blood stem cells and mesenchymal stem cells) or an oligopotent cell (having the ability to differentiate into a few cell types, for example, lymphoid cells or vascular cells) . Under current understanding, potency exists on a continuum. Thusly, the boundaries between the divisions of cells based on potency may be fluid and are not necessarily limiting.

[0057] The expression “induced pluripotent stem cell” (iPSC) refers to a pluripotent stem cell artificially derived from a non-pluripotent cell. For example, human iPSCs are artificially derived from a human non-pluripotent cell. iPSCs can be derived by introducing products of specific sets of pluripotency-associated genes, or “reprogramming factors, ” into a given cell type and / or exposing non-pluripotent cells to particular conditions. The reprogramming factors are usually active only transiently until the cells acquire pluripotent characteristics.

[0058] An “adult stem cell, ” which can also be termed “somatic stem cell, ” is a stem cell found, in an organism, among differentiated cells in a tissue or organ and can differentiate to yield some or all of the specialized cell times in the tissue or organ. Somatic stem cells can be grown in culture. When differentiating into specialized cells, they typically generate intermediate cells called “precursor” or “progenitor” cells. Somatic stem cells and progenitor cells can be described as “multipotent” or “oligopotent, ” depending on their degree of potency. Some examples of somatic stem cells are: hematopoietic stem cells that give rise to all the types of blood cells (red blood cells, B lymphocytes, T lymphocytes, natural killer cells, neutrophils, basophils, eosinophils, monocytes and macrophages) ; mesenchymal stem cells that include bone marrow stromal stem cells and skeletal stem cells and can give rise to bone cells (osteoblasts and osteocytes) , cartilage cells (chondrocytes) , fat cells (adipocytes) , and stromal cells that support blood formation; neural stem cells that can give rise to nerve cells (neurons) , astrocytes and oligodendrocytes; epithelial stem cells in the lining of the digestive tract that can give rise to absorptive cells, goblet cells, Paneth cells, and enteroendocrine cells; skin stem cells that occur in the basal layer of the epidermis (and can give rise to keratinocytes) and at the base of hair follicles (and can give rise to both the hair follicle and to the epidermis) . A tissue-specific progenitor cell is a cell devoid of self-renewal potential that is committed to differentiate into cells of a specific organ or tissue. Certain somatic stem cell types can differentiate into cell types seen in organs or tissues other than those expected from the somatic stem cell's origin. This phenomenon is called “transdifferentiation. ”

[0059] The terms “progenitor cell” or “precursor cell, ” as used herein, refers to the cells that can typically differentiate to form one or more kinds of cells. A “precursor cell” or “progenitor cell” can be any cell in a cell differentiation pathway that is capable of differentiating into a more mature cell. Progenitor cells can be primary cells obtained from an organism, cells proliferated in culture or cells derived from stem cells.

[0060] “Differentiation” is the process by which a less specialized cell becomes a more specialized cell type. For example, early development of a multicellular animal is characterized by the rapid proliferation of embryonic cells, which then differentiate to produce the many specialized types of cells that make up the tissues and organs of the multicellular animal. As cells differentiate, their rate of proliferation usually decreases. Some types of differentiated cells never divide again, but many differentiated cells are able to resume proliferation as required to replace cells that have been lost as a result of injury or cell death. Some cells divide continuously throughout life to replace cells that have a high rate of turnover in adult multicellular animals. Examples of differentiated cells include fibroblasts, hepatocytes, cardiomyocytes, myoblasts, neurons, osteoclasts, and lymphocytes.

[0061] The expression “modified cells” and the related terms and expressions encompass all cells that have been or are derived from the cells that have been artificially modified, by any methods, as compared to the original or cells from which they are derived. Modified cells can be produced from primary cells, secondary cells, stem cells, cultured cells and / or other modified cells. Modifications include, but are not limited to, genetic modification or engineering, in which case modified cells can be referred to as “genetically modified” or “genetically engineered. ” Genetic modification can be accomplished by various methods that result in incorporation of foreign or heterologous nucleic acids into the cells being modified. Some examples of such methods are transduction by a virus or a viral vector, or transfection of isolated nucleic acids into cells through transient pores in the cell membrane. Other modifications include exposing the source cells to biological and non-biological molecules or factors or culture conditions. Some examples of modified cells are iPSCs, genetically modified cells, including those used for gene therapies, one example being gene-edited cells, such as those modified using CRISPR / Cas9, TALENs or ZFNs.

[0062] The term “passage, ” “passaging” and the related terms and expressions used in the context of cell culture refer to subculturing, which typically involves transfer of cells from a previous culture into a fresh growth medium. Passaging is performed to ensure propagation of cells in culture. Cell proliferation in culture reduced or ceases when the cells reduce the capacity of the culture vessels and / or media to support further cell growth. For example, cells in adherent cultures may occupy all the available substrate and have no room left for expansion, while cells in suspension cultures exceed the capacity of the medium to support further growth. To keep cells in a culture at an optimal density for continued growth and to stimulate further proliferation, the culture must be expanded and fresh medium supplied. To divide the culture of adherent cells, for example, a monolayer culture of cells, such as cultures of differentiating EPSCs described on the present disclosure, the cells are first dissociated, for example, by enzymatic dissociation. Enzymatic dissociation can be performed by removing the incubation medium from the plates, adding to the plates a buffer, such as PBS and an enzymatic dissociation reagent, such as Accutase, TrypLE or Trypsin (available, for example, from Thermo Fisher Scientific) , incubating the cells with the buffer and dissociation reagent under appropriate conditions, and harvesting the resulting dissociated cells by centrifugation, sedimentation, filtering or other appropriate methods. The dissociated cells are transferred into similar or equivalent reaction vessels with fresh media, to result in a lower cell density.

[0063] As used herein, “marker” refers to any molecule that can be observed or detected. For example, a marker can include, but is not limited to, a nucleic acid, such as a transcript of a specific gene, a polypeptide product of a gene, a non-gene product polypeptide, a glycoprotein, acarbohydrate, a glycolipid, a lipid, a lipoprotein or a small molecule (for example, molecules having a molecular weight of less than 10, 000 AMU) . When a presence, absence of amount of a marker can be experimentally observed or detected, such a marker or its amount can be described as “observable” or “detectable. ” The presence or absence of the markers, as applied to the embodiments of the preset invention, means detectable presence or absence of the markers as detected by applicable methods for detecting such markers, and may mean certain detectable or undetectable levels of such markers. In other words, the presence may mean the presence above a certain detectable level, while the absence may mean the absence below a certain detectable level and not necessarily zero detectable level. For most markers described herein, the symbols provided are those developed and / or recognized by HUGO Gene Nomenclature Committee of European Bioinformatics Institute.

[0064] In the context of observable or detectable markers, such as markers of cell development or differentiation, “expression” refers to the production of a gene product (which can be a nucleic acid, such as RNA, or a protein) as well as the level or amount of production of a gene product. Thus, determining the expression of a specific marker refers to detecting either the relative or absolute amount of the marker (which can mean detecting expression of RNA or protein) that is expressed or simply detecting (which can mean detecting expression of RNA or protein) the presence or absence of the marker. If expression of RNA or protein corresponding to the marker is detected, the marker can be said to be “detectably expressed. ” Expression of certain markers can be determined by detecting the presence or absence of the marker in cells, cell culture or cell population. Expression of certain markers can also be determined by measuring the level at which the marker is present in cells, cell culture or cell population. Quantitative, qualitative or semi-quantitative techniques can be used to measure marker expression. For example, marker expression can be detected and / or quantitated through the use of techniques detecting nucleic acids, such as PCR-based detection or RNA (for example, real-time reverse-transcriptase PCR) , RNA sequencing (RNA-seq) , or RNA detection by nucleic acid array-based techniques. In another example, immunochemistry can be used to detect and / or quantitate marker proteins. For example, the expression of a marker gene product can be detected by using antibodies specific for the marker gene product of interest using Western blotting, immunofluorescence, flow cytometry analysis, etc. Various techniques of marker detection can be used in in conjunction to effectively and accurately characterize and identify cell types and determine both the amount and relative proportions of such markers in a subject cell type. The expression of certain markers can be determined by measuring the level at which the marker is present in the cells of the cell culture or cell population as compared to a standardized or normalized control marker. Identification and characterization of cells, cell cultures or cell population can be based on expression of a certain marker or different expression levels and patterns of more than one marker (including the presence or absence, the high or low expression, of one or more the markers) . Also, certain markers can have transient expression, when the marker exhibits higher expression during one or more stages of the processes described in this disclosure and lower expression during other stage or stages. II. Method of evaluating and screening for a candidate agent

[0065] The present application in one aspect provides a method of evaluating a candidate agent for treating Inborn Errors of Immunity (IEI) , comprising: a) contacting a population of expanded potential stem cells (EPSCs) and / or cells differentiated therefrom with the candidate agent, wherein the EPSCs are derived from a cell of an individual comprising a mutation in an IEI-related gene; and b) assessing change of function or expression of the IEI-related gene in the EPSCs and / or cells differentiated therefrom relative to a population of EPSCs or cells differentiated therefrom derived from a cell of the individual without contacting with the candidate agent. In some embodiments, the cell of the individual is an erythroblast. In some embodiments, the IEI-related gene is selected from the group consisting of: Signal Transducer and Activator of Transcription (STAT1) , STAT6, and SERPING1. In some embodiments, the population of EPSCs or cells differentiated therefrom comprise a reporter molecule or a heterologous nucleic acid encoding a reporter molecule. In some embodiments, the candidate agent is a Janus-kinase inhibitor.

[0066] In some embodiments, there is provided a method of evaluating a candidate agent for treating Inborn Errors of Immunity (IEI) , comprising: a) contacting a population of expanded potential stem cells (EPSCs) with the candidate agent, wherein the EPSCs are derived from a cell of an individual comprising a mutation in an IEI-related gene; and b) assessing change of function or expression of the IEI-related gene in the EPSCs relative to a population of EPSCs or cells differentiated therefrom derived from a cell of the individual without contacting with the candidate agent. In some embodiments, the cell of the individual is an erythroblast. In some embodiments, the IEI-related gene is selected from the group consisting of: Signal Transducer and Activator of Transcription 1 (STAT1) , STAT6, and SERPING1. In some embodiments, the population of EPSCs comprise a reporter molecule or a heterologous nucleic acid encoding a reporter molecule. In some embodiments, the candidate agent is a Janus-kinase inhibitor.

[0067] In some embodiments, there is provided a method of evaluating a candidate agent for treating Inborn Errors of Immunity (IEI) , comprising: a) contacting a population of cells differentiated from expanded potential stem cells (EPSCs) with the candidate agent, wherein the EPSCs are derived from a cell of an individual comprising a mutation in an IEI-related gene; and b) assessing change of function or expression of the IEI-related gene in the cells differentiated EPSCs relative to a population of cells differentiated EPSCs derived from a cell of the individual without contacting with the candidate agent. In some embodiments, the cell of the individual is an erythroblast. In some embodiments, the IEI-related gene is selected from the group consisting of: Signal Transducer and Activator of Transcription 1 (STAT1) , STAT6, and SERPING1. In some embodiments, the population of cells differentiated from EPSC comprise a reporter molecule or a heterologous nucleic acid encoding a reporter molecule. In some embodiments, the candidate agent is a Janus-kinase inhibitor.

[0068] In some embodiments, there is provided a method of evaluating a candidate agent for treating Inborn Errors of Immunity (IEI) , comprising: a) contacting a population of expanded potential stem cells (EPSCs) and / or cells differentiated therefrom with the candidate agent, wherein the EPSCs are derived from a cell of an individual comprising a gain-of-function mutation in STAT1; and b) assessing change of function or expression of STAT1 in the EPSCs and / or cells differentiated therefrom relative to a population of EPSCs or cells differentiated therefrom derived from a cell of the individual without contacting with the candidate agent. In some embodiments, the cell of the individual is an erythroblast. In some embodiments, the population of EPSCs comprise a reporter molecule or a heterologous nucleic acid encoding a reporter molecule. In some embodiments, the candidate agent is a Janus-kinase inhibitor.

[0069] In some embodiments, there is provided a method of evaluating a candidate agent for treating Inborn Errors of Immunity (IEI) , comprising: a) contacting a population of expanded potential stem cells (EPSCs) and / or cells differentiated therefrom with the candidate agent, wherein the EPSCs are derived from a somatic cell (such as a peripheral blood mononuclear cell, for example an erythroblast) of an individual comprising a gain-of-function mutation in STAT1; and b) assessing change of function or expression of STAT1 in the EPSCs and / or cells differentiated therefrom relative to a population of EPSCs or cells differentiated therefrom derived from a cell of the individual without contacting with the candidate agent. In some embodiments, the population of EPSCs comprise a reporter molecule or a heterologous nucleic acid encoding a reporter molecule. In some embodiments, the candidate agent is a Janus-kinase inhibitor. 1. EPSCs derivedfrom an individual

[0070] In one aspect, there is provided a method of evaluating a candidate agent for treating Inborn Errors of Immunity (IEI) , comprising a) contacting a population of expanded potential stem cells (EPSCs) and / or cells differentiated therefrom with the candidate agent, wherein the EPSCs are derived from a cell of an individual comprising a mutation in an IEI-related gene; and b) assessing change of function or expression of the IEI-related gene in the EPSCs and / or cells differentiated therefrom relative to a population of EPSCs or cells differentiated therefrom derived from a cell of the individual without contacting with the candidate agent.

[0071] In some embodiments, the IEI-related gene is selected from the group consisting of: Signal transducer and activator of transcription 1 (STAT1) , STAT2, STAT3, STAT6, SERPING1. In some embodiments, the IEI-related gene is selected from the group consisting of: Signal transducer and activator of transcription 1 (STAT1) , STAT6, and SERPING1.

[0072] In some embodiments, the IEI-related gene is STAT1. STAT1 encodes STAT1 protein, a member of the STAT protein family. STAT proteins are activated by the Janus family (JAKs) tyrosine kinases in response to cytokine exposure. Specifically STAT1 can be activated by several ligands such as Interferon alpha (IFNα) , Interferon gamma (IFNγ) , Epidermal Growth Factor (EGF) , Platelet Derived Growth Factor (PDGF) , Interleukin 6 (IL-6) , or IL-27. STAT1 has a key role in many gene expressions that cause survival of the cell, viability or pathogen response.

[0073] STAT1 is involved in upregulating genes due to a signal by either type I, type II, or type III interferons. In response to IFN-γstimulation, STAT1 forms homodimers or heterodimers with STAT3 that bind to the GAS (Interferon-Gamma-Activated Sequence) promoter element; in response to either IFN-αor IFN-βstimulation, STAT1 forms a heterodimer with STAT2 that can bind the ISRE (Interferon-Stimulated Response Element) promoter element. In either case, binding of the promoter element leads to an increased expression of ISG (Interferon-Stimulated Genes) .

[0074] In some embodiments, the IEI-related gene is STAT6. STAT6 encodes STAT6 protein, which is another member in the STAT family. Similarly as other STAT family proteins, STAT6 is also activated by growth factors and cytokines. STAT6 is mainly activated by cytokines interleukin-4 and interleukin-13. Tyrosine phosporylation of STAT6 after stimulation by IL-4 results in the formation of STAT6 homodimers that bind specific DNA elements via a DNA-binding domain. STAT6-mediated signaling pathway is required for the development of T-helper type 2 (Th2) cells and Th2 immune response. In addition, activation of STAT6 signaling pathway is necessary in macrophage function, and is required for the M2 subtype activation of macrophages.

[0075] In some embodiments, the IEI-related gene is SERPING1. SERPING1 encodes a highly glycosylated plasma protein involved in the regulation of the complement cascade. Its encoded protein, C1 inhibitor, inhibits activated C1r and C1s of the first complement component and thus regulates complement activation. It is synthesized in the liver, and its deficiency is associated with hereditary angioneurotic oedema (HANE) .

[0076] In some embodiments, the mutation is selected from the group consisting of missense, nonsense, frameshift, deletion, and insertion. In some embodiments, the mutation is a Gain-of-Function mutation. In some embodiments, the mutation is a Loss-of-Function mutation.

[0077] In some embodiments, the cell of the individual comprises a Signal Transducer and Activator of Transcription 1 (STAT1) Gain-of-Function mutation. STAT1 gain-of-function is a primary immunodeficiency typically characterized by chronic mucocutaneous candidiasis (CMC) , recurrent respiratory infections, and autoimmunity. In some embodiments, the STAT1 Gain-of-Function mutation comprises a mutation selected from the group consisting of R274W, R321S, L358F, T419R, S466R, and N574I. STAT1 Gain-of-Function mutations affect the coiled-coil domain or DNA-binding domain of STAT1. They increase STAT1 phosphorylation by impairing nuclear dephosphorylation and are GOF for the STAT1-dependent cytokines interferonα / β (IFN-α / β) , IFN-γ, and IL-27, and STAT3-dependent IL-6 and IL-21.

[0078] In some embodiments, the cell of the individual comprises a STAT6 Gain-of-Function (STAT6-GoF) mutation. Most of the reported STAT6-GOF germline variants cluster in the DNA-binding domain.

[0079] In some embodiments, the cell of the individual comprises a mutation in the SERPING1 gene causing a defect in the C1 inhibitor (C1-INH) . When the function of C1-INH has failed, circulating kallikrein–kinin system (KKS) is insufficiently controlled, with subsequent prekallikrein to plasma kallikrein conversion and the production of BK, a vasoactive peptide that causes increased vascular permeability with an activation of the B2 BK receptor. Together with KKS, complement and fibrinolysis are under C1-INH control, all systems sharing many inflammatory features are mediated by the vascular system.

[0080] In some embodiments, the cell of the individual from which the population of EPSC is derived is a somatic cell. In some embodiments, the cell of the individual is a peripheral blood mononuclear cell. Human peripheral blood mononuclear cells (PBMCs) are isolated from peripheral blood and identified as any blood cell with a round nucleus. In some embodiments, the cell of the individual is an erythroid progenitor cell. In some embodiments, the cell of the individual is an erythroblast. In some embodiments, the cell of the individual expresses one or more markers selected from the group consisting of CD36, CD71 and glycophorin. In some embodiments, the cell of the individual is expanded in vitro. Methods for isolating and expanding erythroid progenitor cells are known in the art (See, e.g., Filippone et al., PLoS One. 2010 Mar 2; 5 (3) : e9496. doi: 10.1371 / journal. pone. 0009496) .

[0081] In some embodiments, the cell of the individual (e.g., an erythroblast) is reprogrammed into an EPSC. Methods of obtaining EPSC is known in the art. For example, US20210230556A1 discloses in vitro conversion of cells from mouse or human, or pluripotent cells into expanded potential stem cells (EPSCs) , the content of which is incorporated herein in its entirety. In some embodiments, the method of reprogramming the cell of the individual (e.g., an erythroblast) comprises reprogramming the cell into an induced pluripotent stem cells (iPSCs) and then culturing the iPSC in an EPSC medium (EPSCM) .

[0082] Induced pluripotent stem cells (iPSCs) are typically derived by introducing a specific set of pluripotency-associated genes, or “reprogramming factors, ” into an adult cell type. The original set of reprogramming factors (also called Yamanaka factors) are the genes Oct4 (Pou5f1) , Sox2, cMyc, and Klf4. There are multiple methods to generate iPSCs, including retrovirus or lentivirus-mediated gene transduction and chemical induction. To generate the iPSCs, each of the pluripotency factors can be also replaced by related transcription factors, miRNAs or small molecules (Ghaedi et al., Methods Mol Biol. 2019; 1576: 55-92) .

[0083] In some embodiments, after gene transduction or chemical induction, iPSCs are cultured in EPSCM. In some embodiments, the EPSCM comprises one or more of CHIR99021, XAV939, Endo-IWR-1, and A419259. In some embodiments, the EPSCM comprises 10mM CHIR99021, 50mM XAV939, 50mM Endo-IWR-1, and 3mM A419259. An exemplary workflow of obtaining EPSC from erythroblast isolated from PBMC is shown in FIG. 2.

[0084] In some embodiments, the EPSCs are differentiated into cell types such as monocytes, macrophages, hepatocytes, keratinocytes, skin organoids, and liver organoids. Methods of inducing EPSCs to differentiate into various cell types are known in the art (See, e.g., Wang et al., 2020, “Generation of human hepatocytes from extended pluripotent stem cells” , Cell Res 30, 810–813; Vinel et al., 2021"Comparative epigenetic analysis of tumour initiating cells and syngeneic EPSC-derived neural stem cells in glioblastoma. " Nature Communications, 12 (1) , 6130; Xu et al., “Derivation of trophoblast stem cells from human expanded potential stem cells. ” STAR protocols, 4 (2) , 102354; Chao et al., 2023, “Organoid-based single-cell spatiotemporal gene expression landscape of human embryonic development and hematopoiesis. ” Signal Transduction and Targeted Therapy, 8 (1) , 230; Cao et al., 2024, “PD-L1 regulates inflammatory programs of macrophages from human pluripotent stem cells. ” Life Science Alliance, 7 (2) . ; WANG et al., “Investigating the Effectiveness of Organoids-Based Chimeric Antigen Receptor Macrophage Immunotherapy against Hepatocellular Carcinoma” , the content of each of which is incorporated herein in its entirety) .

[0085] In some embodiments, the cells differentiated from the EPSCs are of a cell type that is particularly affected by the mutation of the IEI-related gene. For instance, since STAT1 gain-of-function mutations affect monocytes, macrophages, hepatocytes, keratinocytes, and skin cells, EPSCs derived from a cell of an individual with a STAT1 gain-of-function mutation may be differentiated into monocytes, macrophages, hepatocytes, keratinocytes, and skin organoids, which can recapitulate phenotypes related to the STAT1 gain-of-function mutation. For STAT6 gain-of-function mutations, EPSCs may be differentiated into monocytes, keratinocytes, and skin organoids, since these cell types are affected by STAT6 gain-of-function mutations. For mutations in the SERPING1 gene, EPSCs may be differentiated into hepatocytes, and liver organoids to recapitulate phenotypes related to such mutations.

[0086] In some embodiments, the method discloses herein further comprises assessing function or expression of the IEI-related gene in the population of EPSCs or cells differentiated therefrom prior to the contacting in a) . This step can help determine that the EPSCs or cells differentiated therefrom recapitulate the phenotypes of the individual.

[0087] In some embodiments, the assessing comprises determining the genotype of the EPSCs or cells differentiated therefrom. Determining the genotype of the EPSCs or cells differentiated therefrom can be conducted by a variety of methods, such as Sanger sequencing. In some embodiments, the assessing comprises comparing the genotype of the EPSCs or cells differentiated therefrom to the genotype of the cell of the individual.

[0088] In some embodiments, the population of EPSCs or cells differentiated therefrom comprise a reporter molecule or a heterologous nucleic acid encoding a reporter molecule, and assessing function or expression of the IEI-related gene relates to detection / measurement of the reporter molecule.

[0089] In some embodiments, the population of EPSCs or cells differentiated therefrom comprise a reporter molecule. Examples of reporter molecules include physically activated molecules and chemically activated molecules. The reporter molecule could be fluorescent or non-fluorescent. Examples of physically activated molecules include but are not limited to light activated sensing molecules, such as GFP, RFP, mCherry, photoconvertible fluorescent proteins, etc. Examples of chemically activated molecules include but are not limited to: 1) enzyme-activated sensing molecules, such as bioluminescence (e.g., luciferase) and enzyme assays (e.g., β-galactosidase, β-glucuronidase, andβ-lactamase) ; 2) antibody-based assays, such as IF antibody assays; 3) chloramphenicol acetyltransferase; and 4) biosensors (e.g., probes) .

[0090] In some embodiments, the population of EPSCs or cells differentiated therefrom comprise a heterologous nucleic acid encoding a reporter molecule. The heterologous nucleic acid may be integrated into the genome of the EPSCs or cells differentiated therefrom by techniques such as gene editing. For instance, in some embodiments, the EPSCs or cells differentiated therefrom comprise a heterologous nucleic acid and the heterologous nucleic acid is introduced into the EPSCs or cells differentiated therefrom by a gene editing tool. Examples of gene editing tools include but are not limited to (1) clustered regularly interspaced short palindromic repeats (CRISPR) -CRISPR-associated protein (Cas) , (2) transcription activator-like effector nucleases (TALENs) , (3) zinc-finger nucleases (ZFNs) , and (4) homing endonucleases or meganucleases.

[0091] In some embodiments, the heterologous nucleic acid is under the control of a promoter of the IEI-related gene or a gene regulated by the IEI-related gene. As a result, if the promoter is being actively expressed within the cell, the reporter gene will also be expressed, which can be detected / measured. Reporter genes can produce a protein that has little obvious or immediate effect on the cell culture or organism. They are ideally not present in the native genome to be able to isolate reporter gene expression as a result of the gene of interest's expression. Reporter genes can be incorporated genetically into the host DNA of individual cells.

[0092] In some embodiments, reporter genes replace the stop codon of the gene of interest to create a gene fusion, so that they can be expressed with the gene of interest (e.g., the IEI-related gene or a gene regulated by the IEI-related gene) . Also, in building the reporter gene system, a segment of DNA coding for a flexible polypeptide linker region such as T2A and IRES is usually inserted right in front of the reporter genes. This method is an example of using cis-acting elements where the two genes are under the same promoter elements and are transcribed into a single messenger RNA molecule. The mRNA is then translated into protein, and linker region like T2A or IRES mediates co-translational cleavage. In this way, both proteins be able to properly fold into their active conformations instead of becoming a fusion protein. . The reporter and the product of the gene of interest will only minimally interfere with one another.

[0093] Reporter genes can also be under the control of a transcriptional regulatory complex (e.g. a promoter) that is inducible, with the transcriptional regulatory elements responding to endogenous cell signals (e.g., transcription factors and transcription-regulating complexes) or exogenous chemical or physical conditions that can initiate and regulate reporter gene expression.

[0094] A reporter system typically includes 2 components: a specific gene and regulatory complex, and a specific substrate that interacts with the gene product. The reporter gene product is a protein-either an enzyme that catalyzes a chemical reaction or a protein that fluoresces on exposure to light. Examples of commonly used reporter system pairs include radionuclide-based pairs (e.g., HSV1-tk [herpes simplex virus type 1 thymidine kinase] and 124 / 131I-FIAU [5-iodo-2′-fluoro-2′deoxy-1-β-d-arabinofuranosyluracil] or 18F-FEAU [2′-deoxy-2′-18F-fluoro-5-ethyl-1-β-d-arabinofuranosyluracil] ) , bioluminescent pairs (e.g., firefly luciferase [FLuc] and d-luciferin) , and fluorescent pairs (e.g., green fluorescent protein [GFP] and activating blue light) , plus sensors exploiting fluorescence resonance energy transfer between 2 mutant GFP molecules.

[0095] In some embodiments, the reporter molecule is selected from the group consisting of Green Fluorescent Protein (GFP) , Red Fluorescent Protein (RFP) , Yellow Fluorescent Protein (YFP) , mCherry, tdTomato and photoconvertible fluorescent proteins. When expressed, the reporter molecule can be detected using methods such as fluorescent microscopy and flow cytometry (See, e.g., Kremers et al., J Cell Sci. 2011, 124 (2) : 157–160; Chudakov et al., Physiol Rev. 2010, 90 (3) : 1103-63. )

[0096] In some embodiments of the method disclosed herein, the EPSCs or cells differentiated therefrom may each comprise more than one reporter molecule or more than one heterologous nucleic acid encoding a reporter molecule, or a combination thereof. For example, an EPSC used in the method disclosed herein may comprise a first heterologous nucleic acid encoding a Green Fluorescent Protein under the control of a promoter of gene A and a second heterologous nucleic acid encoding a Red Fluorescent Protein under the control of a promoter of gene B. The expression of gene A and gene B can be assessed by the intensity of the Green Fluorescent Protein and the Red Fluorescent Protein, respectively.

[0097] In some embodiments, assessing function or expression of the IEI-related gene in the population of EPSCs or cells differentiated therefrom prior to the contacting in a) further comprises editing the IEI-related gene using a gene editing tool. For instance, in some embodiments, the EPSCs or cells differentiated are edited to “correct” the mutation in the IEI-related gene. In some embodiments, the method further comprises assessing the function or expression of the IEI-related gene before and after genetically modifying the population of EPSCs or cells differentiated therefrom (e.g., before and after the mutation is corrected) . Examples of gene editing tools include but are not limited to (1) clustered regularly interspaced short palindromic repeats (CRISPR) -CRISPR-associated protein (Cas) , (2) transcription activator-like effector nucleases (TALENs) , (3) zinc-finger nucleases (ZFNs) , and (4) homing endonucleases or meganucleases. In some embodiments, the method further comprises assessing the function or expression of the IEI-related gene before and after genetically modifying the population of EPSCs or cells differentiated therefrom.

[0098] CRISPR is a family of DNA sequences found in the genomes of prokaryotic organisms such as bacteria and archaea. These sequences are derived from DNA fragments of bacteriophages that had previously infected the prokaryote. They are used to detect and destroy DNA from similar bacteriophages during subsequent infections. CRISPR-Cas systems are composed of CRISPR repeat-spacer arrays, which can be further transcribed into CRISPR RNA (crRNA) and trans-activating CRISPR RNA (tracrRNA) , and a set of CRISPR-associated (cas) genes which encode Cas proteins with endonuclease activity. CRISPR-Cas systems can be classified into 2 classes (Class 1 and Class 2) , 6 types (I to VI) and several subtypes, with multi-Cas protein effector complexes in Class 1 systems (Type I, III, and IV) and a single effector protein in Class 2 systems (Type II, V, and VI) . Type II CRISPR-Cas9 system derived from Streptococcus pyogenes (SpCas9) is one of the best characterized and most commonly used category in numerous CRISPR-Cas systems. The main components of CRISPR-Cas9 system are RNA-guided Cas9 endonuclease and a single-guide RNA (sgRNA) . The Cas9 protein possesses two nuclease domains, named HNH and RuvC, and each cleaves one strand of the target double-stranded DNA. A single-guide RNA (sgRNA) is a simplified combination of crRNA and tracrRNA. The Cas9 nuclease and sgRNA form a Cas9 ribonucleoprotein (RNP) , which can bind and cleave the specific DNA target. Furthermore, a protospacer adjacent motif (PAM) sequence is required for Cas9 protein’s binding to the target DNA.

[0099] ZFNs are fusions between a custom-designed Cys2-His2 zinc-finger protein and the cleavage domain of the FokI restriction endonuclease. ZFNs function as dimers, with each monomer recognizing a specific “half site” sequence-typically nine to 18 base pairs (bps) of DNA-via the zinc-finger DNA-binding domain.

[0100] TALENs are structurally similar to ZFNs. Both methods use the Fokl nuclease to cut DNA and require dimerization to function, however, the DNA binding domains differ. TALENs use transcription activator-like effectors (TALEs) , tandem arrays of 33-35 amino acid repeats. The amino acid repeats possess single-nucleotide recognition, thereby increasing targeting capabilities and specificity compared to ZFNs.

[0101] Homing endonucleases, also known as meganucleases are a collection of naturally occurring enzymes that recognize and cleave long DNA sequences (14–40 bps) . These enzymes make extensive sequence-specific contacts with their DNA substrate and thus typically show exquisite specificity.

[0102] Base editing is a relatively new method of genome editing derived from CRISPR-Cas9. Unlike traditional CRISPR systems, base editors (BEs) do not induce double-stranded breaks in the genome. Base editing systems, use a ‘catalytically dead’ Cas9 (dCas9) , which cannot cleave DNA, fused to bacterial enzymes called DNA deaminases. Cytidine deaminases, which induce C to T substitutions, are naturally occurring in bacteria, while adenine deaminases, which induce A to G substitutions, were engineered from bacterial enzymes specifically for base editing purposes. Fusing dCas9 to either a cytidine deaminase (CBEs) or an adenine deaminase (ABEs) and providing a sgRNA to direct it to the target sequence, allows researchers to introduce substitutions in DNA.

[0103] In some embodiments, the function or expression of the IEI-related gene to be assessed in the population of EPSCs or cells differentiated therefrom prior to the contacting in a) comprise gene expression, and / or protein modification after contacting the population of EPSCs or cells differentiated therefrom with a stimulating agent. The stimulating agent to be used may vary depending on the IEI-related gene. For instance, in some embodiments of the method disclosed herein, the IEI-related gene is STAT1, and the stimulating agent is IFNγ. In some embodiments, the IEI-related gene is STAT6, and the stimulating agent is IL-4 and / or IL-13. In some embodiments, the population of EPSCs or cells differentiated therefrom is contacted with the stimulating agent for about 30 minutes, about 1 hour, about 2 hours, about 4 hours, about 6 hours, about 12 hours, about 18 hours, about 24 hours, about 36 hours, about 48 hours. In some embodiments, the population of EPSCs or cells differentiated therefrom is contacted with the stimulating agent for about 24 hours.

[0104] In some embodiments, the IEI-related gene is STAT1, and the function or expression of the IEI-related gene comprise expression of STAT1 and STAT1-related genes (such as IRF1, APOL6, and OAS1) , STAT1 phosphorylation, and / or phospho-STAT1 dephosphorylation.

[0105] In some embodiments, the IEI-related gene is STAT6, and the function or expression of the IEI-related gene comprise expression of STAT6 and STAT6-related genes (such as Gata3, Batf, Ig1, CD86, Fcer2, and Maf) , STAT6 phosphorylation, and / or phospho-STAT6 dephosphorylation.

[0106] In some embodiments, the population of EPSCs or differentiated cells therefrom show changes in function or expression of the IEI-related gene before editing the IEI-related gene such as increased expression of STAT1, increased expression of STAT1-regulated genes, STAT1 hyperphosphorylation, and delayed phospho-STAT1 dephosphorylation, compared to EPSCs or differentiated cells therefrom derived from a cell of an individual that does not comprise a mutation in an IEI-related gene. In some embodiments, one or more of these changes in function or expression of the IEI-related gene is reversed after editing the IEI-related gene (e.g., lowered expression of STAT1 and STAT1-regulated genes) .

[0107] The function or expression of the IEI-related gene can be assessed by a variety of methods, including but are not limited to, quantitative polymerase chain reaction (RT-qPCR) , microarray, RNA sequencing, Western blot, and enzyme-linked immunosorbent assay (ELISA) .

[0108] In some embodiments, the method comprises using a population of cells differentiated from EPSCs, wherein the EPSCs are derived from a cell of an individual comprising a mutation in an IEI-related gene. In some embodiments, the cells differentiated from EPSCs comprise monocytes, macrophages, hepatocytes, keratinocytes, skin organoids, and / or liver organoids. In some embodiments, the cells differentiated from EPSCs are of a cell type that is affected by the mutation in the IEI-related gene in the individual wherein the EPSCs are derived from. For instance, in some embodiments of the method disclosed herein, the IEI-related gene is STAT1, and the cells differentiated from EPSCs are monocytes, macrophages, hepatocytes, keratinocytes, or skin organoids. In some embodiments, the IEI-related gene is STAT6, and the cells differentiated from EPSCs are monocytes, keratinocytes, or skin organoids. In some embodiments, the IEI-related gene is SERPING1, and the cells differentiated from EPSCs are Hepatocytes or liver organoids. 2. Contacting step

[0109] In some embodiments, the contacting in a) comprises contacting the population of EPSCs and / or cells differentiated therefrom with the candidate agent for about 1 hour to about 72 hours. In some embodiments, the contacting in a) comprises contacting the population of EPSCs and / or cells differentiated therefrom with the candidate agent for about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours, about 10 hours, about 20 hours, about 30 hours, about 40 hours, about 50 hours, about 60 hours, about 70 hours, about 72 hours. In some embodiments, the contacting in a) comprises contacting the population of EPSCs and / or cells differentiated therefrom with the candidate agent for about 2 hours.

[0110] In some embodiments, the contacting in a) comprises contacting the population of EPSCs and / or cells differentiated therefrom with the candidate agent at varying concentrations. In some embodiments, the candidate agent is added at from about 1nM to about 1000nM. In some embodiments, the candidate agent is added at about 1nM, about 10 nM, about 100 nM, about 200 nM, about 300 nM, about 400 nM, about 500 nM, about 600 nM, about 700 nM, about 800 nM, about 900 nM, or about 1000 nM.

[0111] In some embodiments, the candidate agent is selected from the group consisting of: asmall molecule, a peptide, a polypeptide, and a nucleic acid. In some embodiments, the candidate agent is a polypeptide. In some embodiments, the candidate agent is a Janus-kinase inhibitor. In some embodiment, the Janus-kinase inhibitor is ruxolitinib. In some embodiment, the Janus-kinase inhibitor is baricitinib. In some embodiment, the Janus-kinase inhibitor is tofacitinib.

[0112] In some embodiments, the method further comprises stimulating the EPSCs and / or cells differentiated therefrom before the contacting in a) . For example, the EPSCs and / or cells differentiated therefrom may be stimulated about 1 hour, about 2 hours, about 6 hours, about 12 hours, about 18 hours, or about 24 hours before the contacting in a) . In some embodiments, the method further comprises stimulating the EPSCs and / or cells differentiated therefrom simultaneously with the contacting in a) .

[0113] In some embodiments, the stimulating comprises contacting the population of EPSCs and / or cells differentiated therefrom with a stimulating agent. The stimulating agent to be used may vary depending on the IEI-related gene. For instance, in some embodiments of the method disclosed herein, the IEI-related gene is STAT1, and the stimulating agent is IFNγ. In some embodiments, the IEI-related gene is STAT6, and the stimulating agent is IL-4 and / or IL-13. In some embodiments, the population of EPSCs or cells differentiated therefrom is contacted with the stimulating agent for about 30 minutes, about 1 hour, about 2 hours, about 4 hours, about 6 hours, about 12 hours, about 18 hours, about 24 hours, about 36 hours, about 48 hours, about 60 hours, or about 72 hours. In some embodiments, the population of EPSCs or cells differentiated therefrom is contacted with the stimulating agent for about 24 hours. 3. Assessing step

[0114] The method disclosed herein comprises assessing change of function or expression of the IEI-related gene in the EPSCs and / or cells differentiated therefrom relative to a population of EPSCs or cells differentiated therefrom derived from a cell of the individual without contacting with the candidate agent after or during contacting the population of expanded potential stem cells (EPSCs) and / or cells differentiated therefrom with the candidate agent.

[0115] In some embodiments, function or expression of the IEI-related gene comprise change of gene expression and / or protein modification.

[0116] In some embodiments, the IEI-related gene is STAT1, and the function or expression of the IEI-related gene comprise expression of STAT1 and STAT1-related genes (such as IRF1, APOL6, and OAS1) , STAT1 phosphorylation, and / or phospho-STAT1 dephosphorylation.

[0117] In some embodiments, the IEI-related gene is STAT6, and the function or expression of the IEI-related gene comprise expression of STAT6 and STAT6-related genes (such as Gata3, Batf, Ig1, CD86, Fcer2, and Maf) , STAT6 phosphorylation, and / or phospho-STAT6 dephosphorylation.

[0118] In some embodiments, change of function or expression of the IEI-related gene in the EPSCs and / or cells differentiated therefrom relative to a population of EPSCs or cells differentiated therefrom derived from a cell of the individual without contacting with the candidate agent comprise decreased expression of STAT1 and STAT1-regulated genes, decreased or ameliorated STAT1 hyperphosphorylation, and non-delayed phospho-STAT1 dephosphorylation.

[0119] In some embodiment, the expression of STAT1 is decreased by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, or about 90%relative to a population of EPSCs or cells differentiated therefrom derived from a cell of the individual without contacting with the candidate agent.

[0120] In some embodiment, the expression of STAT1-regulated genes is decreased by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, or about 90%relative to a population of EPSCs or cells differentiated therefrom derived from a cell of the individual without contacting with the candidate agent.

[0121] In some embodiment, STAT1 phosphorylation is decreased by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, or about 90%relative to a population of EPSCs or cells differentiated therefrom derived from a cell of the individual without contacting with the candidate agent.

[0122] The function or expression of the IEI-related gene can be assessed by a variety of methods, including but are not limited to, quantitative polymerase chain reaction (RT-qPCR) , microarray, RNA sequencing, Western blot, and enzyme-linked immunosorbent assay (ELISA) .

[0123] In another aspect, there is provided a method of identifying a candidate agent for treating IEI related to a mutation in a gene, comprising: a) evaluating a plurality of candidate agents according to the method disclosed herein, wherein the individual comprises a mutation in the gene; and b) identifying the candidate agent capable of changing function or expression of the IEI-related gene of the EPSCs or cells differentiated therefrom relative to a population of EPSCs or cells differentiated therefrom from a cell of the individual without contacting with the candidate agent. 4. Composition

[0124] One aspect of the disclosed invention provides a composition comprising Expanded Potential Stem Cells (EPSCs) , wherein the EPSCs are reprogrammed from a cell of an individual with a genetic disease. In some embodiments, the individual is a human individual. In some embodiments, the cell of the individual is a somatic cell (such as an erythroblast) . The methods of described herein make use of such compositions.

[0125] In some embodiments, the composition further comprises cells differentiated from the EPSCs. In some embodiments, the EPSCs and / or cells differentiated from the EPSCs comprise a reporter molecule or a heterologous nucleic acid encoding a reporter molecule. In some embodiments, the cells differentiated from the EPSCs comprise monocytes, macrophages, hepatocytes, keratinocytes, skin organoids, and / or liver organoids.

[0126] In some embodiments, the genetic disease is Inborn Errors of Immunity. In some embodiments, the EPSCs and / or cells differentiated from the EPSCs comprise an IEI-related genetic mutation in a gene selected from the group consisting of: Signal Transducer and Activator of Transcription 1 (STAT1) , STAT6, and SERPING1.

[0127] In some embodiments, the EPSCs and / or cells differentiated from the EPSCs comprise a mutation in STATA1. In some embodiments, following IFNγstimulation, the EPSCs and / or cells differentiated from the EPSCs exhibit one or more characteristics selected from the group consisting of: i) increased expression of STAT1; ii) increased expression of STAT1-regulated genes; iii) STAT1 hyperphosphorylation; and iv) delayed phospho-STAT1 dephosphorylation. III. Method of Treating

[0128] The present application in one aspect provides a method of treating IEI in a subject, comprising: a) identifying a candidate agent according to the method of identifying a candidate agent disclosed herein, wherein the subject comprises a mutation in the gene, and b) treating the subject with the candidate agent.

[0129] In some embodiments, the subject to be treated is the same individual from which the EPSCs are derived. In some embodiments, the subject to be treated is different from the individual from which the EPSCs are derived. In some embodiments, the subject to be treated comprises a mutation in the same IEI-related gene as the individual from which the EPSCs are derived. In some embodiments, the subject to be treated comprises the same mutation in the same IEI-related gene as the individual from which the EPSCs are derived. The method may also include a step of assessing the phenotypes of the subject and comparing them to the phenotypes of the individual from which the EPSCs are derived. In some embodiments, the phenotypes of the subject are similar or the same to phenotypes of the individual from which the EPSCs are derived. In some embodiment, the method disclosed herein further comprises genotyping the subject to be treated. EXAMPLES Example 1: Methods 1.1 Patient selection

[0130] Peripheral blood mononuclear cells (PBMC) were isolated from peripheral blood from STAT1-GoF patients and healthy controls for processing. All blood donors gave informed consent and the study was approved by the Institutional Review Board of the University of Hong Kong / Hospital Authority Hong Kong West Cluster. 1.2 EPSC reprogramming, maintenance and characterization

[0131] EPSC reprogramming was performed from patient or control PBMC-derived EPC by CytoTune iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific) according to the manufacturer’s protocol with slight modifications. Briefly, 1x106 PBMC were cultured in EPC expansion medium containing StemSpanTM SFEM II (STEMCELL Technologies) basal medium and 1x StemSpanTM Erythroid Expansion Supplement (STEMCELL Technologies) , with medium changed every 2 days. Day 9 EPC-expanded culture with>90%cells expressing EPC maker CD71 was used for EPSC reprogramming. 3x105 EPC were transduced by spinoculation with three Sendai viruses (5 MOI each) that contained polycistronic Klf4–Oct3 / 4–Sox2, cMyc, and Klf4. Transduced EPC was then cultured in EPC expansion medium in a 48-well plate for 24 hours before removal of viruses in culture medium. Cells were cultured in EPC expansion medium for 2 more days, and then transferred to a 6-well feeder plate coated with irradiated mouse embryonic fibroblasts. The culture continued in StemSpanTM SFEM II medium for another 6 days with fresh medium change every other day. On day-9 post-transduction, half of the culture medium was replaced with EPSC culture medium (EPSCM: 10mM CHIR99021, 50mM XAV939, 50mM Endo-IWR-1, and 3mM A419259) and cultured for another day. The culture then continued with daily full change of EPSCM. EPSC colonies were picked from day-17 to day-20 for maintenance and characterization.

[0132] To maintain EPSC, the picked single EPSC colony was digested into single cells by TrypLETM Express Enzyme (GibcoTM) , then seeded in a 48-well feeder plate and cultured in EPSCM for 5 days. EPSC was then gradually passaged to a 24-well and then a 12-well feeder plate for expansion and maintenance. A feeder system was used to allow EPSC to be maintained for long-term culture. Single-colony picking for subcloning was performed 3-4 times to derive EPSC clones from each individual. Disappearance of viral vector was verified by PCR using recommended primer sets of the Sendai Reprogramming Kit. To verify the genotype of EPSC from each individual, the DNA binding domain on STAT1 cDNA was amplified by PCR and followed by Sanger sequencing. To characterize the pluripotency of reprogrammed EPSC, the expression of pluripotent markers was checked by quantitative real-time PCR (qRT-PCR) and immunofluorescence staining. 1.3 RNA isolation and quantitative real-time PCR

[0133] RNA analysis was performed to determine gene expression levels. Experiments were repeated at least two times with technical triplicate for each gene. To determine gene expression in EPSC, cells were grown in EPSCM with or without IFNγ (STEMCELL Technologies 78020.1) stimulation, and treated with JAKi and harvested at indicated time points (normally reaching 70–80%confluence in a 24-or 12-well plate) . Cellular RNA was extracted using Trizol (Invitrogen) according to the recommended procedure. 1ug of RNA was reverse-transcribed using PrimeScriptTM RT Master Mix (Takara) following the manufacturer’s protocol. qRT-PCR using PowerUpTM SYBRTM Green Master Mix (Thermo Fisher Scientific) was performed on an QuantStudioTM7 Flex Real-Time PCR System, 384-well, desktop (Applied BiosystemsTM) . Quantification of pluripotent genes (NANOG, OCT4, SOX2, REX1 and SALL4) , IFN receptor genes (IFNGR1, IFNGR2, IFNAR1 and IFNAR2) , STAT1, and STAT1 downstream genes (IRF1, APOL6, OAS1, etc. ) was performed using primers listed in Table E1A, and normalized to the expression of the housekeeping gene GAPDH. The relative expression levels were compared using the 2-ΔCt method. 1.4 Immunofluorescence staining

[0134] Expression of EPSC pluripotent markers and level of phosphorylated STAT1 (p-STAT1) following IFNγstimulation were determined by immunofluorescence staining. Cells were then stimulated for 1 hour with 50ng / ml IFNγ. 70-80%confluent EPSC cultures were fixed with 4%formaldehyde (Servicebio) for 10 minutes, permeabilized by 0.2%Triton-X 100 (Sigma-Aldrich) in PBS for 10 minutes, washed with PBST and blocked for an hour in blocking solution (Servicebio) . Cells were then incubated in blocking buffer with primary antibodies at 1:200 (Rabbit anti-Mouse / Human Oct4, StemAbTM09-0023; Rabbit anti-Mouse / Human Nanog, StemAbTM09-0020; Alexa FluorTM488 conjugated TRA-1-60, InvitrogenTM A25618) overnight at 4℃. After washing, cells were stained with a secondary antibody (Alexa FluorTM594 conjugated donkey anti-Rabbit IgG, Invitrogen A32754) at 1: 1000 for 1 hour at room temperature. Cells were then thoroughly washed and imaged using Ts2-FL Compact Inverted Microscope for Fluorescence (Nikon) .

[0135] For p-STAT1 expression assays, EPSC were seeded in a 24-well feeder plate at 2x105 / well and cultured for 4 days. Cells were then stimulated for 1 hour with 50ng / ml IFNγ, followed by fixation for 10 minutes. Cells were then permeabilized using ice-cold methanol and kept at-20℃ for 30 minutes, followed by washing and blocking as above. Staining was performed using rabbit anti-p-STAT1 (Cell signaling Technology 7649S) primary antibody and the above-mentioned secondary antibody. Image was taken by PE Spinning Disc Ultraview or Ts2-FL Compact Inverted Microscope for Fluorescence. Acquired images were analyzed using ImageJ (NIH, Version 2.1.0 / 1.53c) . The mean fluorescence intensity from more than 10 nuclei was quantified for each group.

[0136] Table E1A. Primers (5’ to 3’ ) 1.5 Immunoblotting

[0137] Immunoblotting was used to determine p-STAT1 and total STAT1 (t-STAT1) protein levels. To examine p-STAT1 levels of EPSC following stimulation, 70-80%confluent EPSC were stimulated with or without 50ng / ml IFNγfor 1 hour and harvested. To determine STAT1 dephosphorylation, EPSC was first stimulated with 50ng / ml IFNγfor 1 hour, then immediately washed with PBS, and further incubated with fresh medium (for IFNγwithdrawal) or fresh medium containing 1uM ruxolitinib (Selleck S1378) and harvested at indicated time points. To compare responses between different JAKi on p-STAT1 inhibition during IFNγstimulation, EPSC were stimulated with 50 ng / ml IFNγwith or without the presence of 1, 10, 100, or 1000 nM of JAKi [baricitinib (MedChemExpress, HY-15315) , ruxolitinib, and tofacitinib (MedChemExpress, HY-40354) ] for 24 hours. Untreated EPSC was used as a control.

[0138] For immunoblotting analysis, cells were lysed in RIPA Lysis and Extraction Buffer (Thermo ScientificTM) supplemented with 1x HaltTM Protease and Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific) for 30 minutes on ice. Lysates were then centrifuged at 12, 000 x g for 10 minutes at 4℃. Protein concentrations were determined using the PierceTM BCA Protein Assay Kit (Thermo Fisher Scientific) . Samples were then prepared by the addition of NuPAGETM LDS Sample Buffer (4x) (Thermo Fisher Scientific) followed by boiling at 95℃ for 5 minutes. Samples were subjected to SDS-PAGE separation by running 10μg protein on a 15-well 10%Bis-Tri gel (InvitrogenTM) , transferred to a nitrocellulose membrane (Bio-Rad) . Membranes were blocked in 5%milk (Bio-Rad) in TBST (Sigma-Aldrich) for 2 hours at room temperature, followed by incubation with rabbit anti-p-STAT1 (Cell signaling Technology, 7649S) or anti-β-actin antibodies (Cell signaling Technology, 4967S) at 4℃ overnight. Membranes were then washed and incubated for 1 hour at room temperature with HRP-conjugated goat anti-rabbit IgG secondary antibody (Invitrogen 31460) . Membranes were imaged using Uvitec Alliance Q9 Advanced imaging system and analyzed with ImageJ. Stat1 (D1K9Y) Rabbit mAb (Cell signaling Technology 14994) was used to blot t-STAT1 after stripping out the p-STAT1 primary antibody on the same membrane for each experiment. 1.6 Flow cytometry

[0139] Flow cytometry was used to quantify p-STAT1 and t-STAT1 levels. To test the dynamic change of p-STAT1 in EPSC during IFNγstimulation, EPSC were cultured in a 24-well plate as above and stimulated with 50 ng / ml IFNγ. Cells were harvested at 0, 15, 30, and 60 minutes for intracellular staining. To test STAT1 dephosphorylation, EPSC were treated and harvested as in immunoblotting. To compare responses between different JAKi on p-STAT1 and t-STAT1 inhibition during IFNγstimulation, EPSC or patient fresh blood leukocytes were seeded and stimulated with or without JAKi for 24 hours as in immunoblotting. To compare the p-STAT1 levels between original and repaired GoF EPSC following stimulation, EPSC were stimulated for 1 hour with 50 ng / ml IFNγ. For flow cytometry analysis, cells were fixed using 4%FPA for 10 minutes and permeabilized using ice-cold methanol at-20℃ for 30 minutes. Cells were then washed 2 times using flow cytometry staining buffer (2%FBS in PBS) and stained using Alexa 488 anti-Oct4 (Biolegend 653706) together with Alexa 647 anti-STAT1 Phospho (Tyr701) (Biolegend 666410) or Alexa 647 Mouse anti-Total Stat1 (BD Bioscience 558560) for 1 hour at 4℃. Data was acquired with BD FACSymphonyTM A3 Cell Analyzer and analyzed using FlowJoTM v10. EPSC was identified as Oct4-positive cells. p-STAT1 and t-STAT1 quantification was measured as mean fluorescence intensity. 1.7 Repair of GoF mutation in STAT1-GoF EPSC

[0140] CRISPR / Cas9 editing was used to repair the pathogenic STAT1-GoF mutation in EPSC of patient 1 (P1) . Briefly, EPSC were cultured to 80%~90%confluence and digested to single cells for electroporation using the NeonTM Transfection System. 2x105 cells were used in each 10μL Neon transfection reaction. 5μg Cas9 (ThermoFisher A36499) and 1.5μg sgRNA were gently mixed and left for complexing at room temperature for 15-20 minutes prior to cell electroporation. EPSC were resuspended in Resuspension Buffer R, gently mixed with 3.5μg ssODN and left at room temperature for 3 minutes. The cell-ssODN suspension was then mixed with Cas9-sgRNA complex, and further incubated for 3-5 minutes. The electroporation was then conducted using a 10μL Neon Tip on NeonTM Transfection System with pulse conditions of voltage: 1250 v, width: 20 ms, and pulse number: 2. Cells were immediately transferred to EPSCM with 10μM Y27632 (MedChemExpress HY-10583) in a 12-well feeder plate and incubated at 37℃ in a humidified CO2 incubator with daily full change of EPSCM. EPSC colonies emerged were picked and screened by genotyping. Sequences of ssRNA, ssODN and STAT1 genotyping primers were listed in Table E1B.

[0141] Table E1B. Sequences of ssRNA, ssODN and STAT1 genotyping primers (5’ to 3’) (SEQ ID NOs: 31-42) 1.8. Construction of reporter cell line

[0142] CRISPR / Cas9 editing was used to construct a STAT1-EGFP reporter cell line. As described above, EPSC of patient 1 (P1) were modified to comprise a EGFP coding sequence under the control of the promoter of STAT1 immediately following the coding sequence of STAT1. 1.9 Statistical analysis

[0143] Statistical analysis was performed using GraphPad Prism 9 (version 9.3.1) . The ordinary one-way ANOVA test or 2-way ANOVA Dunnett's multiple comparisons test was used to determine differences among groups. Statistical significance was represented as: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Example 2: EPSC derived from STAT1-GoF patients

[0144] This example shows that EPSC derived from STAT1-GoF patients recapitulate cellular phenotypes related to STAT1-GoF.

[0145] Two individual patients with confirmed STAT1-GoF mutations and variable clinical severity were selected. Patients were labeled as P1 and P2 and their clinical features are listed in Table E2A. The specific mutations and loci of P1 and P2 are depicted in FIG. 1.

[0146] Table E2A. Clinical features of P1 and P2

[0147] To avoid EPSC being reprogrammed from lymphocytes or other undesired cell types, PBMC from patients and controls were first expanded to EPC (FIG. 2) . After 9 days of expansion, small lymphocytes were replaced by large, round, and middle brown cells (FIG. 3A) with more than 90%expressing the EPC markers CD71 and / or CD235αby flow cytometry (FIG. 3B) . Expanded EPC downregulated gene expression of B lymphocyte (CD19) , T lymphocyte (CD3) , and monocyte (CD14) markers; and upregulated expression of CD71, HBA1, HBB, and HBG1 (FIG. 3C) . In comparison to controls, patient derived PBMC demonstrated impaired cell proliferation during EPC expansion (FIG. 3D) .

[0148] PBMC-derived EPC were reprogrammed to EPSC by the Sendai programming kit as described in Example 1. EPSC were successfully reprogrammed at day 12 and were ready to be picked from day 15 to day 20 during reprogramming (FIG. 4A) . All picked EPSC demonstrated self-renewal capabilities and could be maintained in EPSCM in vitro (FIG. 4B) . Single-colonies were picked to derive homogenous clones for each cell line. Viral vector clearance was confirmed by RT-PCR and qRT-PCR (FIG. 4C) . To ensure that individual EPSC cell lines were derived from the correct patients and controls, sequence of the DNA binding domain of STAT1 cDNA and gDNA for all EPSC cell lines was verified by Sanger sequencing. Patient-specific point mutations were confirmed for all patient-derived EPSC (FIG. 4D) , while control-derived EPSC demonstrated normal genotype.

[0149] STAT1-GoF EPSC expressed same pluripotent makers as controls but were morphologically different. Patient and control EPSC demonstrated normal karyotypes (FIG. 5A) . EPSC pluripotency was confirmed by immunofluorescence staining of NANOG, OCT4, and TRA-1-60 protein expression (FIG. 5B) . Similarly, qRT-PCR demonstrated that STAT1-GoF EPSC expressed comparable levels of critical pluripotent marker genes (NANOG, OCT4, SOX2, REX-1 and SALL4) compared to controls (FIG. 5C) . Although demonstrating comparable self-renewal capability and pluripotency with controls, STAT1-GoF EPSC were more flattened in morphology, exhibited rougher clone boundaries and were easier to be dissociated when compared to controls (FIGs. 5D-5G) .

[0150] All EPSC expressed STAT1, and type I (IFNAR1 and IFNAR2) and type II (IFNGR1 and IFNGR2) IFN receptor genes at relatively high levels in comparison to lineage markers (such as GATA2) at rest, suggesting potential response to IFN stimulation (FIG. 6A) . Therefore, we stimulated EPSC as described in Example 1 which led to significant increase in p-STAT1 as detected by immunofluorescence (FIG. 6B) . Overall, quantification by immunoblotting demonstrated that STAT1-GoF EPSC expressed significantly higher p-STAT1 levels compared to controls (except the difference between P2 and C3 p-STAT1 did not reach statistical significance) .

[0151] Furthermore, similar findings were observed when p-STAT1 was detected by Western blot, with all STAT1-GoF EPSC demonstrating significantly higher increase in p / t-STAT1 ratios following IFN stimulation (FIG. 6C) . The kinetics of p-STAT1 induction on EPSC were measured by flow cytometry at 0, 15, 30, and 60 minutes following IFNγstimulation. To avoid unwanted signals from MEF cells (which were used as feeders for EPSC maintenance) , only OCT4-positive cells were gated for quantification. At 15 minutes post-stimulation, 68.0%and 55.0%of EPSC derived from P1 and P2 expressed p-STAT1, respectively. This was significantly higher than the control EPSC (FIG. 6D) . Both the level and rate of STAT1 phosphorylation were greater among STAT1-GoF EPSC compared to controls across repeat experiments, with p-STAT1 levels about 3-fold higher for P1 EPSC and 1.5 to 2-fold higher for P2 EPSC when compared to control EPSC (FIG. 6E) . Example 3: Evaluation of candidate agent for treating IEI

[0152] This example shows that EPSC derived from STAT1-GoF patients can be used in evaluating candidate agents for treating IEI.

[0153] For STAT1 dephosphorylation, p-STAT1 was measured after IFNγstimulation following with either withdraw of IFNγ (by removal medium and washing with PBS then replaced by fresh medium) or addition of 1 uM ruxolitinib. No obvious decrease of p-STAT1 was detected up to one hour after IFNγwithdraw (FIG. 7A) , although there was increase in t-STAT1 detected following 2 and up to 8 hours following IFNγwithdraw (FIG. 7B) . In contrast, a progressive decrease in p-STAT1 was observed following addition of 1uM ruxolitinib in all EPSC within 2 hours (FIGs. 7C-7D) . Compared to control EPSC, STAT1-GoF EPSC demonstrated a significantly delayed decrease in p-STAT1 (FIGs. 7C-7D) .

[0154] To further investigate differential effects of specific JAKi during EPSC stimulation, JAKi were added at varying concentrations (1, 10, 100, and 1000 nM) together with 50 ng / ml IFNγinto EPSC culture. p-STAT1 and t-STAT1 expression were then quantified by flow cytometry after 24-hour co-incubation. We noted differential patient-specific responses to different JAKi among different EPSC. Among STAT1-GoF EPSC, prolonged co-incubation with ruxolitinib and baricitinib resulted in significantly lower p-STAT1 at higher concentrations. However, there was no significant change in p-STAT1 following co-incubation with tofacitinib (FIG. 8A) . Concurrently, there was reduction of t-STAT1 expression following incubation of all three JAKi among both control (C) and STAT1-GoF EPSC (P1 and P2) . Similar findings were demonstrated when experiments were repeated with p-STAT1 and t-STAT1 expression measured by Western blot (FIG. 8B) . Viability of cells were confirmed in all experiments, and β-actin was also quantified for comparison. These findings were similarly found when co-incubating JAKi with primary blood leukocytes from patient PBMC (FIGs. 8C-8F) . In addition to p-STAT1 and t-STAT1 levels, we also noted a significantly increased expression of STAT1 and its downstream genes (IRF1, APOL6, and OAS1) following IFNγstimulation (FIG. 9A) . Similar to previous protein expression results, we observed concordant changes of mRNA gene expression after co-incubation with specific JAKi as per previous, i.e. co-incubation with ruxolitinib and baricitinib resulted in marked reduction in the expression of STAT1, IRF1, APOL6 and OAS1, which was not observed to the same extent after co-incubation with tofacitinib (FIGs. 9B-9D) . In contrast, expression of non-IFN-regulated genes (PEG3, NLRP4, and SOCS1, CD74) did not exhibit such changes following JAKi co-incubation (FIG. 9E) .

[0155] To further confirm the pathogenic function of the mutation in P1 (p. L358F) and evaluate the robustness of our EPSC platform, we repaired the STAT1 GoF mutation on P1 ESPC by CRISPR / Cas9 editing as described in Example 1. Three successfully repaired EPSC cell lines with 2 CRISPR / Cas9-blocking synonymous mutations (i.e. did not alter STAT1 protein sequence) were created and reconfirmed by Sanger sequencing (FIGs. 10A-10B) . We then examined the STAT1 phosphorylation levels of these repaired EPSC lines following IFNγstimulation and compared them to the original P1-derived EPSC (rather than control EPSC, as p-STAT1 levels would not be directly comparable) . All functional tests including flow cytometry, immunofluorescence staining and Western blot demonstrated significantly lower p-STAT1 expression in all 3 repaired EPSC cell lines compared to original P1-derived EPSC (FIGs. 10C-10E) . Similarly, qPCR also demonstrated lower expression of both STAT1 and its downstream genes following IFNγstimulation (FIG. 10F) , with no obvious change in pluripotent and IFN receptor gene expression (FIG. 10G) . All experiments were repeated two times to ensure consistent results. Example 4: Reporter EPSC cell line

[0156] The STAT1-EGFP reporter cell line was used to test different JAKi at various concentrations as described in Example 1.

[0157] As shown in FIG. 11, the GFP intensity was significantly lower in cells treated with ruxolitinib and baricitinib, even at low concentrations, indicating that STAT1 expression reduced by ruxolitinib and baricitinib. This is consistent with the results in Example 3, thereby demonstrating that the constructed reporter cell line can accurately reflect effects on the EPSCs by candidate agents.

Claims

1.A method of evaluating a candidate agent for treating Inborn Errors of Immunity (IEI) , comprising:a) contacting a population of expanded potential stem cells (EPSCs) and / or cells differentiated therefrom with the candidate agent, wherein the EPSCs are derived from a cell of an individual comprising a mutation in an IEI-related gene; andb) assessing change of one or more characteristics indicative of IEI phenotypes of the EPSCs and / or cells differentiated therefrom relative to a population of EPSCs and / or cells differentiated therefrom from a cell of the individual without contacting with the candidate agent.2.The method of claim 1, wherein the IEI-related gene is selected from the group consisting of: Signal Transducer and Activator of Transcription 1 (STAT1) , STAT6, and SERPING1.3.The method of claim 1 or 2, wherein the mutation is selected from the group consisting of missense, nonsense, frameshift, deletion, and insertion.4.The method of any one of claims 1-3, wherein the cell of the individual comprises a Signal Transducer and Activator of Transcription 1 (STAT1) Gain-of-Function mutation.5.The method of any one of claims 1-4, wherein the cell of the individual is a somatic cell.6.The method of claim 5, wherein the cell of the individual is a peripheral blood mononuclear cell.7.The method of claim 6, wherein the cell of the individual is an erythroblast.8.The method of any one of claims 1-7, wherein the method further comprises assessing function or expression of the IEI-related gene in the population of EPSCs and / or cells differentiated therefrom prior to the contacting in a) .9.The method of any one of claims 1-8, wherein the assessing further comprises genetically modifying the population of EPSCs and / or cells differentiated therefrom.10.The method of claim 9, wherein the population of EPSCs and / or cells differentiated therefrom comprise a reporter molecule or a heterologous nucleic acid encoding a reporter molecule.11.The method of claim 10, wherein the population of EPSCs and / or cells differentiated therefrom comprise a reporter molecule.12.The method of claim 11, wherein the reporter molecule is selected from the group consisting of: a physically activated molecule and a chemically activated molecule.13.The method of claim 10, wherein the population of EPSCs and / or cells differentiated therefrom comprise a heterologous nucleic acid encoding a reporter molecule.14.The method of claim 13, wherein the heterologous nucleic acid is integrated into the genome of the population of EPSCs and / or cells differentiated therefrom.15.The method of claim 14, wherein the heterologous nucleic acid is under the control of a promoter of the IEI-related gene or a gene regulated by the IEI-related gene.16.The method of claim 15, wherein the heterologous nucleic acid is introduced into the population of EPSCs and / or cells differentiated therefrom by a gene editing tool.17.The method of any one of claims 13-16, wherein the reporter molecule is selected from the group consisting of: Green Fluorescent Protein (GFP) , Red Fluorescent Protein (RFP) , Yellow Fluorescent Protein (YFP) , mCherry, tdTomato, photoconvertible fluorescent proteins, bioluminescence, enzyme assay, antibody-based assays, chloramphenicol acetyltransferase, and biosensors.18.The method of any one of claims 9-17, further comprising editing the IEI-related gene using a gene editing tool.19.The method of claim 18, wherein the method further comprises assessing the function or expression of the IEI-related gene before and after editing the IEI-related gene using a gene editing tool.20.The method of any one of claims 8-19, wherein the function or expression of the IEI-related gene comprise gene expression and / or protein modification after contacting the population of EPSCs and / or cells differentiated therefrom with a stimulating agent.21.The method of claim 20, wherein the stimulating agent is IFNγ.22.The method of claim 20 or 21, wherein the function or expression of the IEI-related gene comprise STAT1 expression, IRF1 expression, APOL6 expression, OAS1 expression, STAT1 phosphorylation, and / or phospho-STAT1 dephosphorylation.23.The method of any one of claims 18-22, wherein the function or expression of the IEI-related gene before editing the IEI-related gene comprise:i) increased expression of STAT1;ii) increased expression of STAT1-regulated genes;iii) STAT1 hyperphosphorylation; and / oriv) delayed phospho-STAT1 dephosphorylation.24.The method of any one of claims 8-23, wherein the assessing comprises quantitative polymerase chain reaction (RT-qPCR) , microarray, RNA sequencing, Western blot, and / or enzyme-linked immunosorbent assay (ELISA) .25.The method of any one of claims 1-24, wherein the population of EPSCs and / or cells differentiated therefrom comprise monocytes, macrophages, hepatocytes, keratinocytes, skin organoids, and / or liver organoids.26.The method of any one of claims 1-25, wherein the contacting in a) comprises contacting the population of EPSCs and / or cells differentiated therefrom with the candidate agent for about 1 hour to about 72 hours.27.The method of any one of claims 1-26, wherein the candidate agent is selected from the group consisting of: a small molecule, a peptide, a polypeptide, and a nucleic acid.28.The method of claim 27, wherein the candidate agent is a Janus-kinase inhibitor.29.The method of any one of claims 1-28, wherein the method further comprises stimulating the EPSCs and / or cells differentiated therefrom before the contacting in a) .30.The method of any one of claims 1-29, wherein the method further comprises stimulating the EPSCs and / or cells differentiated therefrom simultaneously with the contacting in a) .31.The method of claim 29 or 30, wherein the stimulating comprises contacting the population of EPSCs and / or cells differentiated therefrom with IFNγ.32.The method of claim 31, wherein the stimulating comprises contacting the population of EPSCs and / or cells differentiated therefrom with IFNγfor about 1 hour to about 72 hours.33.The method of any one of claims 1-32, wherein the function or expression of the IEI-related gene comprise change of gene expression and / or protein modification.34.The method of any one of claims 1-33, wherein the function or expression of the IEI-related gene comprise change of STAT1 expression, IRF1 expression, APOL6 expression, OAS1 expression, STAT1 phosphorylation and / or phospho-STAT1 dephosphorylation.35.The method of any one of claims 1-34, wherein the function or expression of the IEI-related gene relative to a population of EPSCs and / or cells differentiated therefrom from a cell of the individual without contacting with the candidate agent comprise:i) decreased expression of STAT1;ii) decreased expression of STAT1-regulated genes;iii) decreased or ameliorated STAT1 hyperphosphorylation; and / oriv) non-delayed phospho-STAT1 dephosphorylation.36.The method of any one of claims 1-35, wherein the assessing in b) comprises quantitative polymerase chain reaction (RT-qPCR) , microarray, RNA sequencing, Western blot, and / or enzyme-linked immunosorbent assay (ELISA) .37.A method of identifying a candidate agent for treating IEI related to a mutation in an IEI-related gene, comprising:a) evaluating a plurality of candidate agents according to the method of any one of claims 1-36, wherein the individual comprises a mutation in the IEI-related gene; andb) identifying the candidate agent capable of changing function or expression of the IEI-related gene of the EPSCs and / or cells differentiated therefrom relative to a population of EPSCs and / or cells differentiated therefrom derived from a cell of the individual without contacting with the candidate agent.38.A method of treating IEI in a subject, comprising:a) identifying a candidate agent according to the method of claim 37, wherein the subject comprises a mutation in the IEI-related gene, andb) treating the subject with the candidate agent.39.A composition comprising Expanded Potential Stem Cells (EPSCs) , wherein the EPSCs are reprogrammed from a cell of an individual with a genetic disease.40.The composition of claim 39, wherein the cell of the individual is a somatic cell.41.The composition of claim 39 or 40, wherein the EPSCs comprise a reporter molecule or a heterologous nucleic acid encoding a reporter molecule.42.The composition of any one of claims 39-41, wherein the individual is a human individual.43.The composition of any one of claims 39-42, wherein the genetic disease is Inborn Errors of Immunity.44.The composition of any of claims 39-43, wherein the EPSCs comprise a mutation in a gene selected from the group consisting of: Signal Transducer and Activator of Transcription 1 (STAT1) , STAT6, and SERPING1.45.The composition of any of claims 39-44, wherein following IFNγstimulation, the EPSCs exhibit one or more characteristics selected from the group consisting of:i) increased expression of STAT1;ii) increased expression of STAT1-regulated genes;iii) STAT1 hyperphosphorylation; andiv) delayed phospho-STAT1 dephosphorylation.