Pharmaceutical composition for preventing or treating osteoarthritis

A pharmaceutical composition using mRNA encoding specific proteins addresses the limitations of current osteoarthritis treatments by restoring chondrocyte function, repairing joint structure, and alleviating pain, thereby exhibiting DMOAD properties.

WO2025116441A1PCT designated stage expired Publication Date: 2025-06-05RENHAIM INC
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/018680
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-11-30
Filing Date
2024-11-22
Publication Date
2025-06-05

AI Technical Summary

Technical Problem

Current treatments for osteoarthritis, including pharmacological interventions and reconstructive surgery, are inadequate in effectively preventing or treating the disease, especially in cases of relapse or worsening after surgical intervention.

Method used

A pharmaceutical composition comprising mRNA encoding proteins such as Runx1, Type II Collagen, Aggrecan, Sox9, or combinations thereof, which are administered to restore chondrocyte function, repair joint structure, and alleviate pain.

Benefits of technology

The composition effectively relieves pain, restores joint structure, and demonstrates disease-modifying osteoarthritis drug (DMOAD) properties by promoting anabolic markers and reducing catabolic markers associated with inflammation and pain.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2024018680_05062025_PF_FP_ABST
    Figure KR2024018680_05062025_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure relates to a pharmaceutical composition for preventing or treating osteoarthritis. The pharmaceutical composition for preventing or treating osteoarthritis according to the present disclosure is not only highly stable, thereby exhibiting excellent therapeutic effects, but is also expected to be a disease-modifying osteoarthritis drug (DMOAD)-class therapeutic agent that can prevent and preemptively treat osteoarthritis by overcoming the limitations of cell therapeutic agents through the use of mRNA.
Need to check novelty before this filing date? Find Prior Art

Description

Pharmaceutical composition for the prevention or treatment of osteoarthritis

[0001] This invention claims priority to patent application No. 10-2023-0171781, filed with the Korean Intellectual Property Office on November 30, 2023, the disclosure of which is incorporated herein by reference.

[0002] The present invention relates to a pharmaceutical composition for the prevention or treatment of osteoarthritis. More specifically, the present invention relates to a pharmaceutical composition for the prevention or treatment of osteoarthritis, comprising mRNA encoding a protein capable of i) inducing chondrocyte cell function recovery and differentiation, ii) restoring joint structure, and iii) alleviating pain within a joint.

[0003]

[0004] Osteoarthritis is caused by the production of inflammatory cytokines such as interleukin-1 and tumor necrosis factor-alpha by chondrocytes that form the joints due to aging or trauma. These inflammatory cytokines then induce the synthesis and activation of matrix metalloproteinases (MMPs) that degrade the joint matrix in the joint cells, thereby destroying the joint tissue (cartilage). In addition, osteoarthritis is further aggravated by the production of nitric oxide by inflammatory cytokines and the production of self-amplifying cytokines by the produced nitric oxide, which induces the synthesis of more MMPs and promotes the degradation of the joint matrix. At the same time, inflammatory cytokines increase the production of prostaglandin E2, a lipid metabolite, which induces an inflammatory response in arthritis (J Sokolove & CM Lepus, Ther Adv Musculoskel Dis,, 2013; Blanco, FJ et al., Ann. Rheum. Dis. 2013). Osteoarthritis occurs frequently in the elderly without a specific organic cause, and if it progresses chronically, it is accompanied by movement disorders such as gait disturbance due to deformation of the joint structure.

[0005] Osteoarthritis is diagnosed as grade 1 to 4 based on the Kellgren & Lawrence (KL) index through imaging interpretation using X-RAY, depending on the condition of the cartilage. Each grade has characteristics such as the extent of damage to the joint tissue (cartilage), the intensity of pain, and the presence or absence of joint swelling. The treatment method for each grade is as follows: grade 1 is treated with exercise prescription because the condition is mild, but grades 2 and 3 are treated with exercise, painkillers, and glucocorticoids, and grade 4, in which the joint space is very narrow and the joint tissue (cartilage) is almost lost, usually uses reconstructive surgery.

[0006] Reconstructive surgery for osteoarthritis aims to relieve symptoms and improve the structural characteristics of the diseased joint by replacing part or all of the joint. Other options include surgical correction and realignment of medial and lateral misalignments within the joint, autologous osteochondral grafting (mosaic surgery), xenografts, or implants using biomaterials. However, the problem with surgical resection is that there is no alternative for recurrence or worsening of the disease.

[0007] Most patients with osteoarthritis are prescribed medications, including painkillers like acetaminophen and nonsteroidal anti-inflammatory drugs (NSAIDs). However, these medications are ineffective in improving the condition and, with long-term use, can cause adverse effects on the cardiovascular, gastrointestinal, and renal systems. These issues highlight the need for newer, safer treatments for osteoarthritis, further emphasizing the need to understand the disease's phenotype, underlying molecular endotypes, and target the molecules and pathways involved.

[0008] In general, gene therapy refers to the method of introducing exogenous DNA or RNA into target cells of the human body in a certain manner to correct a patient's genetic defects or suppress abnormally expressed genes to achieve the goal of treating a disease.

[0009] Despite its relative stability and ease of handling compared to RNA, DNA suffers from several drawbacks: low delivery efficiency, the requirement to function within the nucleus, potential for unwanted insertion into the genome, potentially causing genetic damage, and the limited level of protein expression resulting from transcription / translation of administered DNA. Furthermore, DNA expression levels can vary depending on DNA transcription regulators, making it difficult to predict the full effects of DNA.

[0010] On the other hand, unlike DNA, RNA can directly synthesize proteins within the cytoplasm, so there is no risk of genetic damage due to insertion into the genome, and it has a shorter half-life than DNA, so high expression for a short period of time is possible.

[0011] Numerous papers and patents are referenced and cited throughout this specification. The disclosures of these cited papers and patents are incorporated herein by reference in their entirety to provide a clearer understanding of the state of the art and the scope of the invention.

[0012]

[0013] The present inventors have conducted extensive research to develop a therapeutic agent for the treatment of osteoarthritis. As a result, they selected genes proven effective in previous studies on osteoarthritis and developed a formulation combining them to maximize efficacy. They discovered that this formulation effectively alleviates pain and improves joint structure by restoring chondrocyte activity, demonstrating its efficacy as a Disease-Modifying Osteoarthritis Drug (DMOAD) for the treatment of osteoarthritis. This marked the completion of the present invention.

[0014] Accordingly, an object of the present disclosure is to provide a pharmaceutical composition for treating osteoarthritis.

[0015] Other objects and advantages of the present invention will become more apparent from the detailed description, claims and drawings below.

[0016]

[0017] According to one aspect of the present disclosure, the present disclosure provides a pharmaceutical composition for preventing or treating osteoarthritis.

[0018] According to another aspect of the present disclosure, the present disclosure provides a method for treating osteoarthritis, comprising administering to a subject a pharmaceutical composition for preventing or treating osteoarthritis.

[0019] In one embodiment of the present disclosure, the pharmaceutical composition for preventing or treating osteoarthritis of the present disclosure comprises an mRNA encoding a protein selected from:

[0020] i) Runx1, ii) Type II Collagen, iii) Aggrecan, iv) Sox9, or v) a combination of these.

[0021] In one embodiment of the present disclosure, the pharmaceutical composition for preventing or treating osteoarthritis comprises, but is not limited to, mRNA encoding Aggrecan, Type II collagen, or a combination thereof that is effective in repairing joint structure.

[0022] In one embodiment of the present disclosure, the pharmaceutical composition for preventing or treating osteoarthritis includes, but is not limited to, mRNA encoding Runx1, Sox9, or a combination thereof, which is effective in restoring function and inducing differentiation of chondrocytes.

[0023] In one embodiment of the present disclosure, the pharmaceutical composition for preventing or treating osteoarthritis includes, but is not limited to, mRNA encoding TGF-beta 1, which is effective in improving pain.

[0024] In one embodiment of the present disclosure, the pharmaceutical composition comprises an mRNA encoding a protein selected from i) Runx1, ii) Type II Collagen, or iii) a combination thereof.

[0025] In one embodiment of the present disclosure, the Runx1 protein comprises the amino acid sequence of SEQ ID NO: 1.

[0026] In one embodiment of the present disclosure, the Type II Collagen protein comprises an amino acid sequence of SEQ ID NO: 4.

[0027] In one embodiment of the present disclosure, the Aggrecan protein comprises an amino acid sequence of SEQ ID NO: 7.

[0028] In one embodiment of the present disclosure, the Sox9 protein comprises the amino acid sequence of SEQ ID NO: 10.

[0029] In one embodiment of the present disclosure, the mRNA encoding a protein selected from i) Runx1, ii) Type II Collagen, iii) Aggrecan, iv) Sox9, or v) a combination thereof comprises a nucleotide sequence selected from SEQ ID NO: 3, 6, 9, 12, or a combination thereof.

[0030] The mRNA encoding the protein effective in preventing and treating osteoarthritis, corresponding to the active ingredient of the present disclosure, was sequence-optimized to increase stability and translation efficiency in humans. Specifically, the RNA fold, RNA fold thermodynamic ensemble, and RNA structure thermodynamic energy were identified as indicators predicting RNA stability.

[0031] The pharmaceutical composition of the present disclosure may contain a liposome or a lipid nanoparticle (LNP), and the mRNA encoding the protein may be adsorbed or associated to the outside of the liposome or lipid nanoparticle, or encapsulated or encapsulated inside the liposome or lipid nanoparticle.

[0032] Accordingly, in one embodiment of the present disclosure, the pharmaceutical composition comprises a liposome or lipid nanoparticle comprising mRNA encoding a protein selected from:

[0033] i) Runx1, ii) Type II Collagen, iii) Aggrecan, iv) Sox9, or v) a combination of these.

[0034] In one embodiment of the present disclosure, the mRNA is an mRNA encoding a protein selected from i) Runx1, ii) Type II Collagen, or iii) a combination thereof.

[0035] In one embodiment of the present disclosure, the liposome or lipid nanoparticle comprises one type of mRNA. Thus, the liposome or lipid nanoparticle comprises, for example, an mRNA encoding a Runx1 protein or an mRNA encoding a Type II Collagen protein.

[0036] Additionally, in another embodiment of the present disclosure, the pharmaceutical composition may comprise two or more liposomes or lipid nanoparticles comprising one type of mRNA. For example, the pharmaceutical composition may comprise, but is not limited to, a liposome or lipid nanoparticle comprising an mRNA encoding a Runx1 protein and a liposome or lipid nanoparticle comprising an mRNA encoding a Type II Collagen protein.

[0037] In a specific embodiment of the present disclosure, the length of the mRNA contained in the liposome or lipid nanoparticle is 50-20,000 bp, 50-15,000 bp, 50-12,000 bp, 50-10,000 bp, 50-8,000 bp, 50-7,000 bp, 50-6,000 bp, 50-5,000 bp, 50-4,000 bp, 50-3,000 bp, 50-2,000 bp, 50-1,000 bp, 50-800 bp, 50-500 bp, 100-20,000 bp, 100-15,000 bp, 100-12,000 bp, 100-10,000 bp, 100-8,000 bp, 100-7,000 bp, 100-6,000 bp, 100-5,000 bp, 100-4,000 bp, 100-3,000 bp, 100-2,000 bp, 100-1,000 bp, 100-800 bp, 100-500 bp, 200-20,000 bp, 200-15,000 bp, 200-12,000 bp, 200-10,000 bp, 200-8,000 bp, 200-7,000 bp, 200-6,000 bp, 200-5,000 bp, 200-4,000 bp, 200-3,000 bp, 200-2,000 bp, 200-1,000 bp, 200-800 bp, 200-500 bp, 500-20,000 bp, 500-15,000 bp, 500-12,000 bp, 500-10,000 bp, 500-8,000 bp, 500-7,000 bp, 500-6,000 bp, 500-5,000 bp, 500-4,000 bp, 500-3,000 bp, 500-2,000 bp, 500-1,000 bp, 500-800 bp, 1,000-20,000 bp, 1,000-15,000 bp, 1,000-12,000 bp, 1,000-10,000 bp, 1,000-8,000 bp, 1,000-7,000 bp, 1,000-6,000 bp, 1,000-5,000 bp, 1,000-4,000 bp, 1,000-3,000 bp, or 1,000-2,It can be, but is not limited to, 000 bp.

[0038] In one embodiment of the present disclosure, the liposome or lipid nanoparticle may comprise two or more different mRNAs.

[0039] For example, the liposome or lipid nanoparticle may comprise, but is not limited to, mRNA encoding Type II Collagen (COL2A1) protein and mRNA encoding Runx1 protein.

[0040] In one embodiment of the present disclosure, the two or more different mRNAs may have different lengths.

[0041] For example, when the liposome or lipid nanoparticle contains two types of mRNA, the ratio of the length (bp) of one type of mRNA to the other type of mRNA may be, but is not limited to, 1:0.5 to 1:5, 1:1.25 to 1:5, 1:1.5 to 1:5, 1:1.75 to 1:5, 1:2 to 1:5, 1:2.5 to 1:5, 1:3 to 1:5, 1:3.5 to 1:5, or 1:4 to 1:5.

[0042] In one embodiment of the present disclosure, the mRNA encoding the Type II Collagen protein and the mRNA encoding the Runx1 protein may be included in the liposome or lipid nanoparticle at a weight ratio (w / w) of, but not limited to, 1:0.25 to 1:1.25, 1:0.75 to 1:1.25, 1:1 to 1:1.25, 1:0.75, 1:1, or 1:1.25.

[0043] In one embodiment of the present disclosure, the liposome or lipid nanoparticle comprises a cationic lipid, a neutral lipid, cholesterol, or a combination thereof.

[0044] The cationic lipids include ionizable lipids or amino lipids.

[0045] In another embodiment of the present disclosure, the liposome or lipid nanoparticle may comprise a cationic lipid, a neutral lipid, and cholesterol.

[0046] In one embodiment of the present disclosure, the liposome or lipid nanoparticle comprises a cationic lipid and a neutral lipid in a weight ratio of 1:100 to 100:1. More specifically, the weight ratio is, but is not limited to, 1:1 to 1:4, 1:1 to 1:3, 1:1 to 1:2, 1:1 to 1:0.5, 1:1 to 1:0.3, or 1:1 to 1:0.25.

[0047] In one embodiment of the present disclosure, the liposome or lipid nanoparticle comprises a cationic lipid and a cholesterol-based lipid in a weight ratio of 1:30 to 30:1, 1:30 to 30:1, or more specifically, a weight ratio of, but not limited to, 10:1 to 1:1, 8:1 to 1:1, 5:1 to 1:1, 4:1 to 1:1, 3:1 to 1:1, 25:1 to 1:1, 2:1 to 1:1, or 1.5:1 to 1:1.

[0048] In one embodiment of the present disclosure, the liposome or lipid nanoparticle comprises cationic lipid, neutral lipid and cholesterol in a weight ratio of 1 to 100:1 to 100:1 to 30.

[0049] More specifically, 25 to 50:25 to 50: 10 to 50, 30 to 50:30 to 50: 10 to 40, 40 to 50:40 to 50: 10 to 30, 40 to 50:40 to 50: 10 to 25, 40 to 50:40 to 50: 10 to 20, 30 to 45:30 to 45: 10 to 40, 35 to 45:35 to 45: 10 to 30, 40 to 45:40 to 45: 10 to 20, 40 to 50:40 to 50: 10 to 20, 30 to 50:30 to 50: 10 to 30, 25 to 50:25 It may be included in a weight ratio of, but is not limited to, 50:20 to 40, 25 to 50:25 to 50:20, 30 to 50:30 to 50:20, 40 to 50:40 to 50:20, 40 to 50:40 to 50:20, 40 to 50:40 to 50:20, 30 to 45:30 to 45:20, 35 to 45:35 to 45:20, 40 to 45:40 to 45:20, 40 to 50:40 to 50:20, 30 to 50:30 to 50:20, or 25 to 50:25 to 50:20.

[0050] In one embodiment of the present disclosure, the N / P ratio of the liposome or lipid nanoparticle and mRNA may be 0.1 to 0.6, 0.2 to 0.4, 0.25 to 0.4, 0.3 to 0.4, 0.35 to 0.4, 0.3, or 0.4. The N / P ratio refers to a value obtained by dividing the number of nitrogens that will have a positive charge of the cationic lipid by the number of phosphate groups of the mRNA.

[0051] In addition, in one embodiment of the present disclosure, the pharmaceutical composition for preventing or treating osteoarthritis may further include hyaluronic acid, hyaluronate, a hyaluronic acid salt (e.g., sodium hyaluronate), etc. Since the hyaluronic acid, hyaluronate, and hyaluronic acid salt have a lubricating effect, it is expected to alleviate pain at the site of administration and have effects such as improved function and reduced stiffness. The hyaluronic acid, hyaluronate, and hyaluronic acid salt included in the present embodiment may have a density of 1 MDa to 10 MDa, for example, 2 MDa to 8 MDa, 3 MDa to 7 MDa, 4 MDa to 6 MDa, 1 MDa to 5 MDa, 1 MDa to 4 MDa, 1 MDa to 3 MDa, but is not limited thereto.

[0052] In one embodiment of the present disclosure, the cationic lipid is dimethyldioctadecylammonium bromide (DDA), 1,2-dioleoyl-3-trimethylammoniumpropane (DOTAP), 3β-[N-(N',N'-dimethylaminoethane) carbamoyl cholesterol (DC-Chol), 1,2-dioleoyloxy-3-dimethylammoniumpropane (DODAP), 1,2-di-O-octadecenyl-3-trimethylammonium propane (DOTMA), 1,2-dimyristoleoyl-sn-glycero-3-ethylphosphocholine (14:1 Etyle PC), 1-palmitoyl-2-oleoyl-sn-glycero-3-ethylphosphocholine (16:0-18:1 Ethyl PC), 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine (18:1 Ethyl PC), 1,2-distearoyl-sn-glycero-3-ethylphosphocholin (18:0 Ethyl PC), 1,2-dipalmitoyl-sn-glycero-3-ethylphosphocholine (16:0 Ethyl PC), 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (14:0 Ethyl PC), 1,2-dilauroyl-sn-glycero-3-ethylphosphocholin (12:0 Ethyl PC),N1-[2-((1S)-1-[(3-aminopropyl)amino]-4-[di(3-aminopropyl)amino]butylcarboxamido)ethyl]-3,4-di[oleyloxy]-benzamide (MVL5), 1,2-dimyristoyl-3-dimethylammoniumpropane (14:0 DAP), 1,2-dipalmitoyl-3-dimethylammonium-propane (16:0 DAP), 1,2-distearoyl-3-dimethylammonium-propane (18:0 DAP), N-(4-carboxybenzyl)-N,N-dimethyl-2,3-bis(oleoyloxy)propan-1-aminium (DOBAQ), 1,2-stearoyl-3-trimethylammonium-propane (18:0 TAP), 1,2-dipalmitoyl-3-trimethylammoniumpropane (16:0 TA), One or more selected from the group consisting of, but not limited to, 1,2-dimyristoyl-3-trimethylammonium-propane (14:0 TAP) and N4-cholesteryl-spermine (GL67).

[0053] In one embodiment of the present disclosure, the neutral lipid is 1,2-dimyristoyl-sn-glycero-3-phosphorylcholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), One or more selected from the group consisting of, but not limited to, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), phosphatidylserine (PS), phosphoethanolamine (PE), phosphatidylglycerol (PG), phosphoric acid (PA), and phosphatidylcholine (PC).

[0054] In one embodiment of the present disclosure, the cholesterol lipid is at least one selected from the group consisting of cholesterol, 5α-cholestanol, 5β-coprostanol, cholesteryl-(2'-hydroxy)-ethyl ether, cholesteryl-(4'-hydroxy)-butyl ether, 6-ketocholestanol, 5α-cholestane, cholestanone, 5α-cholestanone, 5β-cholestanone, and cholesteryl decanoate, but is not limited thereto.

[0055] In this specification, “cholesterol” is a general term for a type of lipid and an organic substance of the steroid series with hydrophobic properties. The cholesterol may include various analogs based on the cholesterol structure and compounds that can be obtained by chemically changing a portion of cholesterol. Specifically, it may include, but is not limited to, bile acid (cholic acid, deoxycholic acid, lithocholic acid, chenodeoxycholic acid), Vitamin D, steroid hormones (testosterone, estradiol, cortisol, aldosterone, prednisolone, prednisone), etc.

[0056] In one embodiment of the present disclosure, the cationic lipid, neutral lipid, and cholesterol lipid may be pegylated.

[0057] In addition, in one embodiment of the present disclosure, the liposome or lipid nanoparticle may further comprise one or more delivery factors selected from the group consisting of protamine, albumin, transferrin, protein transduction domains (PTD), cell penetrating peptide (CPP), polyethylene glycol (PEG), pegylated lipid, metal ion-bound lipid, and macrophage targeting moiety.

[0058] As used herein, the term "pegylated lipid" refers to a molecule that is a derivative of poly(ethylene glycol) conjugated to a lipid moiety, and comprises both a lipid portion and a poly(ethylene glycol) portion.

[0059] In one embodiment of the present disclosure, the pegylated lipid is pegylated diacylglycerol lipid (PEG-DAG), pegylated ceramide lipid (PEG-Cer), pegylated phosphatidylethanolamine lipid (PEG-PE), pegylated succinate diacylglycerol lipid (PEG-S-DAG), pegylated dialkoxypropylcarbamate lipid, 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol ("PEG-DMG" or "DMG-PEG") and 1,2-dicapryl-rac-glycero-3-methylpolyoxyethylene glycol (C 10 It may be at least one PEG lipid selected from the group consisting of diacylglycerol PEG), and more specifically, 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG 2000), but is not limited thereto.

[0060] In one embodiment of the present disclosure, the liposome complex or lipid nanoparticle, which is an effective ingredient of the present disclosure, can be lyophilized.

[0061] In one embodiment of the present disclosure, the freeze-drying process involves freezing the target material, a liposome or lipid nanoparticle, and then removing the frozen solvent by sublimation in a vacuum environment. The freeze-drying process may optionally include excipients or freeze-drying protectants to enhance the storage stability of the freeze-dried product.

[0062] The excipients or lyoprotectants include, but are not limited to, polymers such as dextran and polyethylene glycol; sugars such as mannitol, sucrose, glucose, trehalose, and lactose; surfactants such as polysorbates; and amino acids such as glycine, arginine, and serine, preferably mannitol, sucrose, or trehalose.

[0063] In one embodiment of the present disclosure, the nanoparticles of the present disclosure can be administered as a pharmaceutical composition by one of the following routes: intra-articular, etc.

[0064] In one embodiment of the present disclosure, the pharmaceutical composition of the present disclosure may be administered within a range of 10 to 1500 μg based on mRNA, but is not limited thereto, and the dosage may be increased or decreased according to the clinical judgment of a physician.

[0065] In one embodiment of the present disclosure, the nanoparticles of the present disclosure may include a solid, liquid, semi-solid, or gaseous excipient, such as:

[0066] The above solid pharmaceutical excipients include starch, cellulose, talc, glucose, lactose, sucrose, gelatin, malt, rice, flour, silica gel, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, dried skim milk, and the like.

[0067] The liquid and semi-solid excipients may be selected from glycerol, propylene glycol, water, ethanol, and various oils of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, etc. Preferred liquid carriers, particularly those for injectable solutions, include water, saline, aqueous dextrose, and glycols. Other suitable pharmaceutical excipients and their formulations are described in Remington's Pharmaceutical Sciences, edited by E.W. Martin (Mack Publishing Company, 18th ed., 1990).

[0068] In one embodiment of the present disclosure, the pharmaceutical composition of the present disclosure comprises COL2A1 mRNA and RUNX1 mRNA as active ingredients, and the formulation thereof may be a mixture of naked mRNA; a mixture of a liposome complex comprising COL2A1 mRNA and a liposome complex comprising RUNX1 mRNA (singlex, SCR); or a liposome complex comprising both COL2A1 mRNA and RUNX1 mRNA (minglex, MCR).

[0069] In one embodiment of the present disclosure, the pharmaceutical composition of the present disclosure induces an increase in the expression of anabolic markers and a decrease in the expression of catabolic markers associated with inflammation and pain in an osteoarthritis condition.

[0070] In the present disclosure, Type II collagen is one of the basic components that constitute cartilage tissue and is a factor that plays an important role in maintaining the structure and function of cartilage. Therefore, the effect of the pharmaceutical composition of the present invention in increasing the expression of Type II Collagen in treating osteoarthritis is important not only in structural repair and regeneration of cartilage, but also in functional recovery.

[0071] In one embodiment of the present disclosure, the pharmaceutical composition of the present disclosure is preferably administered at least once, more specifically at least twice, or at least three times at intervals of less than four weeks, but is not limited thereto.

[0072]

[0073] The present disclosure provides a pharmaceutical composition for the treatment of osteoarthritis. The pharmaceutical composition for the treatment of osteoarthritis of the present disclosure not only exhibits excellent therapeutic efficacy due to its high stability, but also overcomes the limitations of cell therapy due to its use of mRNA, and is expected to become a DMOAD (Disease-Modifying Osteoarthritis Drug) treatment capable of preventing and preemptively treating osteoarthritis.

[0074]

[0075] Figures 1a to 1d are graphs showing particle size and dispersion measured using dynamic light scattering analysis equipment (Malvern) for liposome complexes manufactured according to the NP ratio of the present invention.

[0076] Figure 2 shows the results of transfecting a human chondrocyte cell line (C20A4) with the composition of the present invention and confirming the maintenance status of mRNA delivered into the cell by time-dependent qPCR.

[0077] Figure 3 shows the results of transfecting the liposome formulation (lipoplex) of the present disclosure into a human chondrocyte cell line (C20A4) to confirm the difference in protein expression ability according to the mixing ratio of two mRNAs of different lengths, the formulation preparation method, and the time.

[0078] Figure 4 is a diagram showing the expression of luciferase after intra-articular administration of a liposome containing mRNA encoding luciferase to an animal model in which osteoarthritis was induced by various methods.

[0079] Figure 5 is a diagram showing the results of quantifying biomarkers (aggrecan, Type II collagen, and MMP13) by qPCR according to the mixing ratio of COL2A1 and RUNX1 mRNA in the liposome formulation after administering the liposome formulation (lipoplex) of the present disclosure to the ACLT+MNX model (Rat) (X-axis: mixing ratio of COL2A1:RUNX1).

[0080] Figure 6 shows the results of observing the tissue condition using Safranin O staining 4 weeks after administering the liposome formulation of the present disclosure once into the joint cavity of an osteoarthritis model (ACLT+MNX Model).

[0081] Figure 7 shows the results of observing the effect of improving mobility (reducing the number of electric shocks) for 4 weeks by measuring mobility (number of electric shocks) once a week on a treadmill after administering the liposome formulation of the present disclosure into the joint cavity of an osteoarthritis model (ACLT+MNX Model) (Control is OA Model).

[0082]

[0083] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples, in accordance with the gist of the present invention.

[0084]

[0085] Example

[0086]

[0087] Throughout this specification, "%" used to indicate the concentration of a particular substance is (weight / weight) % for solid / solid, (weight / volume) % for solid / liquid, and (volume / volume) % for liquid / liquid, unless otherwise noted.

[0088]

[0089] Example 1: Selection of mRNA sequences

[0090] The present inventors selected four genes encoding antigens effective in treating osteoarthritis and conducted in silico base sequence optimization to design mRNA sequences for these genes.

[0091] i) RUNX1, ii) Type II Collagen, iii) Aggrecan, and iv) Sox9

[0092] The above optimization work used the COPT-S v1.0 (Arontier Co., Ltd.) program to select the codon with a high frequency of use in the human body among the three codons that express each amino acid in the sequence, and the codon optimization process that controls the GC content, and predicted the secondary structure of mRNA that affects ribosome binding and translation initiation during the protein expression process. From this, the final mRNA sequence was selected with reference to the analysis values ​​such as (a) the value measuring the ratio of G and C in the sequence (GC Content), (b) the value comparing the synonymous codon usage bias for DNA / RNA sequences, i.e. the similarity with the reference sequence (original sequence) (Codon adaptation index), and (c) Free Energy.

[0093] The amino acid sequences, nucleic acid sequences, and mRNA sequences of the selected genes are shown in SEQ ID NOs: 1 to 12.

[0094] mRNA sequences selected for each gene were used in CleanCap ® It was synthesized through in vitroTranscription using the manufacturer's recommended method using (Trilink) (JM. Henderson et al., Current Protocols, 2021).

[0095]

[0096] Example 2: Preparation of liposomes

[0097] The inventors of the present invention performed the production of a carrier using a film method: DOTAP (Merck), DOPE (Avanti Polar Lipid), and cholesterol (Avanti Polar Lipid) were mixed with chloroform (Merck) at a weight % ratio of 40, 40, and 20, respectively, to completely dissolve the lipids, and the three lipid solutions were poured into a round-bottom flask to produce a lipid mixture having a final concentration of 3 mg / mL.

[0098] A round-bottom flask containing a lipid mixture was placed in a rotary evaporator (Buchi) with a double-bath temperature set to 60°C, and the rotary evaporator was operated for 90 minutes under conditions of a vacuum of 50 mbar and a rotation speed of 70 rpm to vaporize chloroform and form a lipid film on the bottom of the flask.

[0099] The lipid membrane was dissolved by adding 20 mM HEPES buffer (pH 7.4) containing 4% (w / v) sucrose to the lipid membrane at 60°C, and then liposomes with uniform particle size were prepared using a microfluidizer (high-pressure homogenizer, Avestin). The prepared liposomes were stored at 4°C until testing.

[0100]

[0101] Example 3: Preparation of liposome complex (lipoplex)

[0102] mRNA and liposomes prepared in Examples 1 and 2 were mixed at a constant NP ratio in 20 mM HEPES (pH 7.4) containing 4% sucrose to prepare mRNA liposome complexes (lipoplexes).

[0103] The size, zeta potential, and dispersion of the liposome complex (lipoplex) manufactured according to the mixing ratio (N / P ratio) of liposomes and mRNA were confirmed using a dynamic light scattering analyzer (Malvern).

[0104] At this time, lipoplex, which adsorbs a single mRNA to a single liposome, Minglex, which adsorbs two or more different mRNAs to a single liposome simultaneously, and Singlex, which mixes two types of lipoplexes, each of which adsorbs different mRNAs, were manufactured to confirm the stability of the formulation.

[0105] As a result of the measurement, it was confirmed that when manufacturing Lipoplexes each composed of mRNAs with different lengths, regardless of the length of the mRNA, the polydiversity index (PDI) was maintained at 0.3 or less, which is within the appropriate range, at an N / P ratio of 0.6 or less at a concentration of less than 0.5 mg / ml (Fig. 1a).

[0106] In addition, as shown in Figures 1a to 1c, when the length of mRNA is 1500 bp or less, aggregation occurs at a ratio of 0.6 or higher in lipoplex as the concentration of mRNA increases, but when mixed with mRNA as long as 4000 bp (Minglex), a stable characteristic was confirmed (Figure 1d).

[0107]

[0108] Example 4: Confirmation of gene transfer ability by formulation

[0109] In order to determine the mRNA mixing method for manufacturing the Lipoplex formulation, the following experiments were performed.

[0110] In the production of a mixed formulation containing two types of mRNA, Minglex and Singlex containing mRNAs of different lengths in a certain ratio were prepared, and the delivery ability was confirmed by transfecting these into cells using the following method.

[0111]

[0112] 4-1. Confirmation of mRNA delivery efficiency by qPCR

[0113] C20A4 cells were seeded at 80% density in a 6-well plate, cultured for 24 hours, and transfected with minglex and Singlex, each containing two types of mRNA, under Opti-MEM medium conditions containing 2% FBS. After 4 hours, the medium was replaced with DMEM medium containing 2% FBS, and cells were harvested after 24 and 96 hours of culture.

[0114] 5 μg of total RNA from cells was used as TOPscript TM The mixture was mixed to a maximum of 20 μl in an RT DryMIX (dT18) tube, and cDNA was synthesized using (Q)-PCR (CFX Connect, Bio-Rad) by incubating at 50°C for 60 minutes and at 95°C for 5 minutes.

[0115] The synthesized cDNA was used as a template for the osteoarthritis biomarker and housekeeping gene GAPDH with Forward / Reverse primers (100 pmol / μl) and TOPreal TM SYBR Green qPCR PreMIX (Enzynomics) was mixed to a total volume of 200 μl per tube, and denaturing was performed at 95°C for 10 min. mRNA was synthesized by repeating 50 cycles of 95°C for 10 s, 60°C for 15 s, and 72°C for 30 s. After the reaction was completed, the Ct value for each sample was used to analyze the mRNA expression status.

[0116] mRNASequence (5'-> 3')Sequence number COL2A1 Forward: CGCTAATGTGCAGATGACCT Reverse: GCTGCGGATGCTCTCAATCT SEQ ID NO: 13 SEQ ID NO: 14 RUNX1 Forward: CCCAGCTACCACCTGTACTA Reverse: TGGTGGGGCTATTACTGTGA SEQ ID NO: 15 SEQ ID NO: 16 GAPDH Forward: CATCACTGCCACCCAGAAGACTG Reverse: ATGCCAGTGAGCTTCCCGTTCAG SEQ ID NO: 17 SEQ ID NO: 18

[0117] As a result, it was found that the mRNA delivery efficiency by Minlgex (MX 1:1) and Singlex (SX 1:1) was superior to that by Lipoplex (LX1 or LX2), and in particular, it was confirmed that a significant amount of mRNA delivered into the cells existed even up to 96 hours (Fig. 2).

[0118]

[0119] 4-2. Comparison of protein expression by formulation using Western Blot

[0120] To compare the protein expression patterns of each formulation in normal cells and IL-1beta-treated inflammatory cells, Western blot was performed by mixing the two types of mRNA at a certain ratio.

[0121] Using the method of Example 4-1, inflammation-inducing cells were cultured for 24 hours on C20A4 cells, and then treated for 24 hours with a mixture of 10 ng / mL IL-1beta in DMEM medium containing 2% FBS to induce inflammation.

[0122] After transfection, cells were cultured for a certain period of time, harvested, and proteins were lysed using RIPA lysis buffer (25 mM Tris·HCl pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS) containing protease inhibitors and phosphatase inhibitors. Proteins were quantified using BCA protein assay, and the expression levels of Type II Collagen and RUNX1 proteins were confirmed by western blotting. For western blotting, size markers and samples were loaded onto Novex Tris-Glycine Mini Protein Gels (4-20%, 1.0 mm, Invitrogen), run at 225 V and 200 mA for 50 minutes, and then transferred to PVDF (polyvinylidene difluoride) membranes. The transferred membrane was blocked with EveryBlot Blocking Buffer (BIORAD) and incubated with the primary antibody at a ratio of 1:500 overnight. The membrane was then washed with TBS-T solution and incubated with the secondary antibody for 2 hours at room temperature, after which chemiluminescence was confirmed using an ECL substrate.

[0123] As a result, it was confirmed that the gene expression efficiency by Minglex (MX) was superior to that by Singlex (SX) (Fig. 3).

[0124]

[0125]

[0126] Example 5: Preparation of an animal model of osteoarthritis

[0127] To create an appropriate model for implementing osteoarthritis, various procedures were used, and finally, an animal model of osteoarthritis was created through ACLT+MNX (anterior cruciate ligament / medial meniscus resection) in rats and used for efficacy evaluation.

[0128]

[0129] 5-1. ACLT+MNX model (rat) manufacturing and formulation administration method

[0130] An animal model in which osteoarthritis was induced by performing anterior cruciate ligament transection (ACLT) and medial meniscectomy (MNX) on rats (SD rats, 6 weeks old, female) was prepared using the following method (K Naito, et al., J. Orthopedic Research, 2010; BA. Besler et al., Bone, 2021).

[0131] The area around the knee joint of a rat anesthetized with isoflurane (Hana Pharmaceutical) was shaved and the surgical site was disinfected with ethanol (Supelco). After confirming the location of the knee joint space, the outer skin was incised with surgical scissors. After confirming the location of the patellar ligament, the ligament was incised with a surgical blade, and the cruciate ligament and meniscus between the joints were severed with orbital scissors. The upper and lower ligaments were sutured using black silk sutures, the outer skin was sutured, and the animal was transferred to a cage for recovery.

[0132] The occurrence of osteoarthritis in animals that underwent combined ACLT and MNX procedures was verified by Safranin O staining (data not shown).

[0133] To administer Lipoplex to the surgical site 4 weeks after ACLT and MNX procedures, a rat with osteoarthritis was anesthetized using isofurane (Hana Pharmaceutical), and then the injection site was disinfected with ethanol. Then, 50 μL of the formulation disclosed in the present invention was administered into the joint space using an insulin syringe.

[0134]

[0135] 5-2. Local expression distribution (Luciferase) following intra-articular administration

[0136] In order to confirm the distribution of protein expression when the mRNA formulation is administered intra-articularly, four types of osteoarthritis animal models using rats were created using the manufacturing methods of the meniscus transection model (MNX), cruciate ligament transection model (ACLT), Monosodium Iodoacetate Induced Model (MIA), and Collagenase II induced Model (CIOA), which are commonly used to prepare osteoarthritis models, and lipoplex consisting of luciferase mRNA and liposomes was administered to them.

[0137] Specifically, for each animal model, inhalation anesthesia was performed using Isoflurane (induction dose 5%, maintenance dose 2%, Hana Pharmaceutical), and the area around both knees was cleanly shaven. Then, 10 μg of renilla luciferase mRNA and cationic liposomes (KR 2022-0126235 A) consisting of DOTAP:DOPE:Chol=40:40:20 (wt%) were mixed to give an NP ratio of 0.4, and 20 μl of lipoplex was administered into the joint space using a 30G syringe.

[0138] After administration, the animal model was anesthetized with avertin (250 mg / kg) and then injected with renilla luciferase substrate stock solution (ViviRen TM) was intravenously injected with 200 ㎕ of a substrate prepared at 0.15 ㎍ / ㎕ by adding 2.4 mL of 1X PBS. Immediately after administration, the mouse was placed in the IVIS equipment (Ami-HTX, USA), and the exposure time was set to 60 seconds to photograph the mouse (Xenogen IVIS-200). The expression level of luciferase at the injection site (Region of interest, ROI) was quantified using Aura Imaging Software (Spectral Instruments Imaging, USA). As a result, it was confirmed that luciferase was concentrated and expressed only at the joint site (Fig. 4). Therefore, from the above results, it was confirmed that the liposome (Lipoplex) formulation including the mRNA of the present invention had excellent efficiency in delivering mRNA to the arthritis site due to the effect of staying at the injection site for a long time.

[0139]

[0140] Example 6: Method for confirming efficacy in an animal model of osteoarthritis

[0141] 6-1. Comparison of efficacy according to mRNA mixing ratio (qPCR)

[0142] When the Minglex formulation manufactured in Example 4 was administered into the joint cavity in the ACLT+MNX Model, the changes in anabolic factors (Aggrecan, type II Collagen) and catabolic factors (MMP-13) after 48 hours according to the mRNA mixing ratio (1:0.25 to 1:1.5, w / w) were analyzed by qPCR using the primers in Table 2 below.

[0143] After the administration experiment, the rats were sacrificed, and only the knee cartilage was extracted, washed with PBS (Phosphate Buffered Saline), placed in a tube, and rapidly frozen using liquid nitrogen or dry ice for storage.

[0144] Liquid nitrogen was added to the frozen knee cartilage tissue, pulverized using a rod, transferred to a 50 mL conical tube, 1 to 2 mL of RiboEx Buffer (GeneALL) was added, and homogenized using a Homogenizer (Daihan). 200 μl of chloroform was added to the homogenate, vortexed, and centrifuged at 12,000 rpm, 4°C, for 15 min to obtain the supernatant. Total RNA was then extracted using Hybrid-R (RNA prep kit, GeneALL). The RNA was stored at -80°C until use.

[0145] qPCR was performed on 5 μg of tissue-derived total RNA using the method of Example 4-1 and the following primers.

[0146] Primers for detection of osteoarthritis biomarkers and housekeeping genes (Rat) Primer Sequence (5'-> 3') Sequence number Anabolic marker Type II Collagen Forward: CGCTAATGTGCAGATGACCT Reverse: GGCTCTGATTTCCACGTCAT SEQ ID NO:19 SEQ ID NO:20 Aggrecan Forward: CATCCGGATCTCTTGATGTC Reverse: AATTCCAGACCCTTCTCCAC SEQ ID NO:21 SEQ ID NO:22 Catabolic Marker MMP-13 Forward: ACTGAGAGGCTCCGAGAAATG Reverse: GAACCCCGCATCTTGGCTT SEQ ID NO:23 SEQ ID NO:24 Housekeeping Gene GAPDH Forward: CCATCAACGACCCCTTCATT Reverse: CACGACATACTCAGCACCAGC SEQ ID NO:25 SEQ ID NO:26

[0147] As a result, when COL2A1 and RUNX1 mRNA were mixed at a mixing ratio (w / w) of 1:0.75 to 1:1.25, the effects of increasing Type II Collagen and decreasing MMP13, which play the most important role in improving osteoarthritis symptoms, were confirmed (Fig. 5).

[0148]

[0149] 6-2. Confirmation of therapeutic efficacy through tissue staining (Safranin O staining)

[0150] The rats administered with the formulation of the present invention were humanely sacrificed, and the extent of tissue damage was determined through safranin O staining of the extracted knee joint tissues to confirm the cartilage regeneration efficacy.

[0151] The extracted tissues were placed in 5 ml or 50 ml tubes appropriate for the size of the tissue and fixed with 4% paraformaldehyde (T&I) in a 4℃ cold and warm room for 3 to 7 days. After fixation, decalcification, paraffin blocking, slide preparation, and safranin O staining were performed by Labcore Co., Ltd. (Gasan-dong, Geumcheon-gu, Seoul).

[0152] As a result, it was confirmed that the most significant improvement in cartilage surface irregularities, loss of cartilage thickness (red-stained region), and abnormalities in chondrocyte arrangement, which are representative phenomena of osteoarthritis, were observed in tissues administered with Minglex (MCR) of COL2A1 and RUNX1. (Fig. 6)

[0153]

[0154] 6-3. Confirmation of improved mobility (Treadmill)

[0155] The present inventors performed a treadmill test to evaluate the improvement in motility following a single administration of each formulation of COL2A1 and RUNX1 (Singlex, SCR; Minglex, MCR, COL2A1 lipoplex, LC; RUNX1 lipoplex, LR).

[0156] Before starting this experiment, the animal models of osteoarthritis prepared by ACLT+MNX treatment were acclimated by walking on a treadmill (Jeongdo BNP) for a total of 10 minutes at a speed of 10 m / min for a total of 3 days, and the electric shock was set to 50 V. During the acclimation training, the number of electric shocks was constant, and only individuals walking at a similar speed were selected to conduct a locomotion test for a total of 15 minutes at a speed of 10 m / min, and a counter was used to record the number of electric shocks administered to the experimental individuals and the distance traveled.

[0157] As a result, it was confirmed that the number of electric shocks was significantly reduced and motility was improved after administration of the formulation of the present invention (Fig. 7).

[0158]

[0159] While specific aspects of the present invention have been described in detail above, it is clear to those skilled in the art that these specific descriptions are merely preferred implementation examples and that the scope of the present invention is not limited thereto.

Claims

1. A pharmaceutical composition for preventing or treating osteoarthritis, comprising mRNA encoding a protein selected from the following: i) Runx1, ii) Type II Collagen, iii) Aggrecan, iv) Sox9, or v) a combination of these.

2. A pharmaceutical composition according to claim 1, wherein the Runx1 protein comprises an amino acid sequence of sequence number 1.

3. A pharmaceutical composition according to claim 1, wherein the Type II Collagen protein comprises an amino acid sequence of sequence number 4.

4. A pharmaceutical composition according to claim 1, wherein the Aggrecan protein comprises an amino acid sequence of sequence number 7.

5. A pharmaceutical composition according to claim 1, wherein the Sox9 protein comprises an amino acid sequence of sequence number 10.

6. A pharmaceutical composition according to claim 1, wherein the mRNA encoding a protein selected from i) Runx1, ii) Type II Collagen, iii) Aggrecan, iv) Sox9, or v) a combination thereof comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 3, 6, 9, and 12.

7. A pharmaceutical composition according to claim 1, further comprising a liposome or lipid nanoparticle.

8. A pharmaceutical composition according to claim 7, wherein the liposome or lipid nanoparticle comprises one type of mRNA.

9. A pharmaceutical composition according to claim 7, wherein the liposome or lipid nanoparticle contains two or more types of mRNA.

10. A pharmaceutical composition according to claim 7, wherein the liposome or lipid nanoparticle comprises a cationic lipid, a neutral lipid, cholesterol, or a combination thereof.

11. A pharmaceutical composition according to claim 7, wherein the liposome or lipid nanoparticle comprises a cationic lipid and a neutral lipid in a weight ratio of 1:100 to 100:

1.

12. A pharmaceutical composition according to claim 7, wherein the liposome or lipid nanoparticle comprises a cationic lipid and a cholesterol-based lipid in a weight ratio of 1:30 to 30:

1.

13. A pharmaceutical composition according to claim 7, wherein the liposome or lipid nanoparticle comprises cationic lipid, neutral lipid and cholesterol lipid in a weight ratio of 1 to 100:1 to 100:1 to 30.

Citation Information

Patent Citations

  • LNP compositions comprising an mRNA therapeutic and an effector molecule

    US20230173104A1

  • Method and pharmaceutical composition for treating a cartilage damage using SOX9 gene

    US20240408237A1