Small interfering RNA targeting lp(a) and uses thereof

Abstract

This disclosure relates to isolated oligonucleotides comprising duplex regions targeting human LPA mRNA, and delivery systems, kits and compositions comprising the same, and methods of using the same for inhibiting or downregulating Lp(a) gene expression.

Description

SMALL INTERFERING RNA TARGETING LP(A) AND USES THEREOFRELATED APPLICATIONS

[0001] This application claims priority to and the benefit of International Application PCT / CN2023 / 135082, filed on November 29, 2023, the contents of which are incorporated herein by reference in their entirety.BACKGROUND

[0002] Lipoprotein(a) (Lp(a)) is a heterogeneous low density lipoprotein (LDL)-like particle containing a lipid core and apolipoprotein B (apoB-100) with a unique constituent, apolipoprotein (a) (apo(a)), that is attached to apoB-100 through a disulfide bond. The LPA gene is expressed predominantly in the liver and expression is restricted to human and non-human primates. Lp(a) levels in humans are genetically defined and do not change significantly with diet, exercise, or other lifestyle changes.

[0003] Normal Lp(a) levels range from 0. 1-25 mg / dl, with about 25% of the population in the United States of America having Lp(a) levels of 30 mg / dl or higher. Deficiencies or loss-of- function mutations of the Lp(a) may lead to dysregulation and possible overproduction. Analysis of Lp(a) levels in multiple studies have implicated high Lp(a) levels as an independent risk factor for cardiovascular disease, stroke, and other related disorders including atherosclerotic stenosis. In addition, genome-wide association analyses have also implicated LPA as a genetic risk factor for diseases such as atherosclerotic stenosis. When therapeutic lipoprotein apheresis is used to lower both Lp(a) and LDL levels in hyperlipidemic patients, significant reductions of cardiovascular events have been observed. Accordingly, there is a need for therapies for subject having diseases, disorders and symptoms associated with elevated Lp(a) expression levels. The present disclosure provides compositions targeting Lp(a) and methods of reducing Lp(a) expression for treatment of subjects having a disease, disorder or symptom associated with elevated LPA expression level.SUMMARY

[0004] This disclosure provides an isolated oligonucleotide comprising a sense strand and an anti-sense strand, wherein: the sense strand comprises a nucleotide sequence that is substantially identical to a region comprising 19-25 nucleotides between any one of the nucleotide positions selected from: a) 144 to 177; b) 206 to 229; c) 248 to 269; d) 2751 to 2773; e) 2947 to 2972; f) 2991 to 3012, g) 3275 to 3300, h) 3463 to 3484; i) 3570 to 3591; j) 3931 to 3952; and k) 4923 to 4944, from the 5’ end of a human Lipoprotein A { Lp{ a )) mRNA sequence according to SEQ ID NO: 1, and the anti-sense strand is substantially complementary to the sense strand such that the sense strand and the anti -sense strand together form a double stranded region.

[0005] The disclosure also provides an isolated oligonucleotide comprising a sense strand selected from SEQ ID NOs: 2-22 and 42-295 and its corresponding antisense strand selected from SEQ ID NOs: 23-41 and 296-551, as set forth in Table 2.

[0006] In some embodiments of the isolated oligonucleotide, the sense strand comprises a modified sequence of a sequence selected from SEQ ID NOs: 2-22 and 42-295 and its corresponding antisense strand selected from SEQ ID NOs: 23-41 and 296-551, as set forth in Table 2, as set forth in SEQ ID NOs: 552-845, 1372-1378, 1383-1384, 1386-1387, and 1395- 1396 and its corresponding antisense strand comprises a sequence selected from SEQ ID NOs: 573-1 101, 1379-1380, 1385, and 1388, as set forth in Table 6.

[0007] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence selected from SEQ ID NOs: 2-22 and its corresponding antisense strand comprises a sequence selected from 23-41 and 550-551, as set forth in Table 1.

[0008] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence selected from SEQ ID NOs: 2, 6, 16, 18, 552, 556, 568, 566 1377-1378, 1383-1384, 1386-1387, and 1395-1396 and its corresponding antisense strand selected from SEQ ID NOs: 575, 585, 587, 1100, 1379-1380, 1385, and 1388, as set forth in Table 3.

[0009] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence selected from SEQ ID NOs: 2, 6, 18, 552, 556, and 568, and its corresponding antisense strand selected from SEQ ID NOs: 575, 587, 1100, 1379-1380, and 1385, as set forth in Table 4.

[0010] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence selected from SEQ ID NOs: 18, 568 and 1383-1384, and its corresponding antisense strand selected from SEQ ID NOs: 587 and 1380, as set forth in Table 5.

[0011] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence as set forth in SEQ ID NO: 18 and its corresponding antisense strand comprises a sequence as set forth in SEQ ID NO: 37.

[0012] In some embodiments of the isolated oligonucleotide, the sense strand comprises a modified sequence as set forth in SEQ ID NO: 568 and its corresponding antisense strand comprises a modified sequence as set forth in SEQ ID NO: 587.

[0013] In some embodiments of the isolated oligonucleotide, the double stranded region comprises: i) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 2, and a sense strand of nucleic acid sequence according to SEQ ID NO: 550; ii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 3, and a sense strand of nucleic acid sequence according to SEQ ID NO: 551; iii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 4, and a sense strand of nucleic acid sequence according to SEQ ID NO: 23; iv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 5, and a sense strand of nucleic acid sequence according to SEQ ID NO: 24; v) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 6, and a sense strand of nucleic acid sequence according to SEQ ID NO: 25; vi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 7, and a sense strand of nucleic acid sequence according to SEQ ID NO: 26; vii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 8, and a sense strand of nucleic acid sequence according to SEQ ID NO: 27; viii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 9, and a sense strand of nucleic acid sequence according to SEQ ID NO: 28; ix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 10, and a sense strand of nucleic acid sequence according to SEQ ID NO: 29; x) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 1 1 , and a sense strand of nucleic acid sequence according to SEQ ID NO: 30; xi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 12, and a sense strand of nucleic acid sequence according to SEQ ID NO: 31 ; xii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 13, and a sense strand of nucleic acid sequence according to SEQ ID NO: 32; xiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 14, and a sense strand of nucleic acid sequence according toSEQ ID NO: 33; xiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 15, and a sense strand of nucleic acid sequence according to SEQ ID NO: 34; xv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 16, and a sense strand of nucleic acid sequence according to SEQ ID NO: 35; xvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 17, and a sense strand of nucleic acid sequence according to SEQ ID NO: 36; xvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 18, and a sense strand of nucleic acid sequence according to SEQ ID NO: 37, xviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 19, and a sense strand of nucleic acid sequence according to SEQ ID NO: 38; xix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 20, and a sense strand of nucleic acid sequence according to SEQ ID NO: 39; xx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 21, and a sense strand of nucleic acid sequence according to SEQ ID NO: 40; xxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 22, and a sense strand of nucleic acid sequence according to SEQ ID NO: 41 ; xxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 42, and a sense strand of nucleic acid sequence according to SEQ ID NO: 296; xxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 43, and a sense strand of nucleic acid sequence according to SEQ ID NO: 297; xxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 44, and a sense strand of nucleic acid sequence according to SEQ ID NO: 298; xxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 45, and a sense strand of nucleic acid sequence according to SEQ ID NO: 299; xxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 46, and a sense strand of nucleic acid sequence according to SEQ ID NO: 300; xxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 47, and a sense strand of nucleic acid sequence according to SEQ ID NO: 301; xxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 48, and a sense strand of nucleic acid sequence according to SEQ ID NO: 302; xxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 49, and a sense strand of nucleic acid sequence according to SEQ ID NO: 303; xxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 50, and a sense strand of nucleic acid sequence according to SEQ ID NO: 304; xxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 51, and a sense strand of nucleic acid sequence according to SEQ ID NO: 305; xxxii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 52, and a sense strand of nucleic acidsequence according to SEQ ID NO: 306; xxxiii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 53, and a sense strand of nucleic acid sequence according to SEQ ID NO: 307; xxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 54, and a sense strand of nucleic acid sequence according to SEQ ID NO: 308; xxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 55, and a sense strand of nucleic acid sequence according to SEQ ID NO: 309; xxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 56, and a sense strand of nucleic acid sequence according to SEQ ID NO: 310; xxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 57, and a sense strand of nucleic acid sequence according to SEQ ID NO: 311; xxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 58, and a sense strand of nucleic acid sequence according to SEQ ID NO: 312; xxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 59, and a sense strand of nucleic acid sequence according to SEQ ID NO: 313; xl) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 60, and a sense strand of nuclei c acid sequence according to SEQ ID NO: 314; xli) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 61, and a sense strand of nucleic acid sequence according to SEQ ID NO: 315; xlii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 62, and a sense strand of nucleic acid sequence according to SEQ ID NO: 316; xliii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 63, and a sense strand of nucleic acid sequence according to SEQ ID NO: 317; xliv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 64, and a sense strand of nucleic acid sequence according to SEQ ID NO: 318; xlv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 65, and a sense strand of nucleic acid sequence according to SEQ ID NO: 319; xlvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 66, and a sense strand of nucleic acid sequence according to SEQ ID NO: 320; xlvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 67, and a sense strand of nucleic acid sequence according to SEQ ID NO: 321; xlviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 68, and a sense strand of nucleic acid sequence according to SEQ ID NO: 322; xlix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 69, and a sense strand of nucleic acid sequence according to SEQ ID NO: 323; 1) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 70, and a sense strand of nucleic acid sequence according to SEQ ID NO: 324; li) an anti-sense strand of nucleic acid sequence according toSEQ ID NO: 71 , and a sense strand of nucleic acid sequence according to SEQ ID NO: 325; lii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 72, and a sense strand of nucleic acid sequence according to SEQ ID NO: 326; liii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 73, and a sense strand of nucleic acid sequence according to SEQ ID NO: 327; liv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 74, and a sense strand of nucleic acid sequence according to SEQ ID NO: 328; Iv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 75, and a sense strand of nucleic acid sequence according to SEQ ID NO: 329; Ivi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 76, and a sense strand of nucleic acid sequence according to SEQ ID NO: 330; Ivii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 77, and a sense strand of nucleic acid sequence according to SEQ ID NO: 331; Iviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 78, and a sense strand of nucleic acid sequence according to SEQ ID NO: 332; lix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 79, and a sense strand of nucleic acid sequence according to SEQ ID NO: 333; lx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 80, and a sense strand of nucleic acid sequence according to SEQ ID NO: 334; Ixi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 81, and a sense strand of nucleic acid sequence according to SEQ ID NO: 335; Ixii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 82, and a sense strand of nucleic acid sequence according to SEQ ID NO: 336; Ixiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 83, and a sense strand of nucleic acid sequence according to SEQ ID NO: 337; Ixiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 84, and a sense strand of nucleic acid sequence according to SEQ ID NO: 338; Ixv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 85, and a sense strand of nucleic acid sequence according to SEQ ID NO: 339; Ixvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 86, and a sense strand of nucleic acid sequence according to SEQ ID NO: 340; Ixvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 87, and a sense strand of nucleic acid sequence according to SEQ ID NO: 341; Ixviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 88, and a sense strand of nucleic acid sequence according to SEQ ID NO: 342; Ixix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 89, and a sense strand of nucleic acid sequence according to SEQ ID NO: 343; Ixx) an anti-sense strand of nucleic acid sequence according toSEQ ID NO: 90, and a sense strand of nucleic acid sequence according to SEQ ID NO: 344; Ixxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 91, and a sense strand of nucleic acid sequence according to SEQ ID NO: 345, Ixxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 92, and a sense strand of nucleic acid sequence according to SEQ ID NO: 346, Ixxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 93, and a sense strand of nucleic acid sequence according to SEQ ID NO: 347; Ixxiv) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 94, and a sense strand of nucleic acid sequence according to SEQ ID NO: 348; Ixxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 95, and a sense strand of nucleic acid sequence according to SEQ ID NO: 349; Ixxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 96, and a sense strand of nucleic acid sequence according to SEQ ID NO: 350; Ixxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 97, and a sense strand of nucleic acid sequence according to SEQ ID NO: 351; Ixxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 98, and a sense strand of nucleic acid sequence according to SEQ ID NO: 352; Ixxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 99, and a sense strand of nucleic acid sequence according to SEQ ID NO: 353;Ixxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 100, and a sense strand of nucleic acid sequence according to SEQ ID NO: 354; Ixxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 101, and a sense strand of nucleic acid sequence according to SEQ ID NO: 355; Ixxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 102, and a sense strand of nucleic acid sequence according to SEQ ID NO: 356; Ixxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 103, and a sense strand of nucleic acid sequence according to SEQ ID NO: 357; Ixxxi v) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 104, and a sense strand of nucleic acid sequence according to SEQ ID NO: 358; Ixxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 105, and a sense strand of nucleic acid sequence according to SEQ ID NO: 359; Ixxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 106, and a sense strand of nucleic acid sequence according to SEQ ID NO: 360; Ixxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 107, and a sense strand of nucleic acid sequence according to SEQ ID NO: 361 ; Ixxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 108, and a sense strand of nucleic acid sequence according to SEQ ID NO: 362;Ixxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 109, and a sense strand of nucleic acid sequence according to SEQ ID NO: 363; xc) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 1 10, and a sense strand of nucleic acid sequence according to SEQ ID NO: 364; xci) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 111 , and a sense strand of nucleic acid sequence according to SEQ ID NO: 365, xcii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 1 12, and a sense strand of nucleic acid sequence according to SEQ ID NO: 366, xciii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 113, and a sense strand of nucleic acid sequence according to SEQ ID NO: 367; xciv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 114, and a sense strand of nucleic acid sequence according to SEQ ID NO: 368; xcv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 115, and a sense strand of nucleic acid sequence according to SEQ ID NO: 369, xcvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 116, and a sense strand of nucleic acid sequence according to SEQ ID NO: 370, xcvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 117, and a sense strand of nucleic acid sequence according to SEQ ID NO: 371; xcviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 118, and a sense strand of nucleic acid sequence according to SEQ ID NO: 372, xcix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 119, and a sense strand of nucleic acid sequence according to SEQ ID NO: 373; c) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 120, and a sense strand of nucleic acid sequence according to SEQ ID NO: 374; ci) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 121, and a sense strand of nucleic acid sequence according to SEQ ID NO: 375; cii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 122, and a sense strand of nucleic acid sequence according to SEQ ID NO: 376; ciii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 123, and a sense strand of nucleic acid sequence according to SEQ ID NO: 377; civ) an antisense strand of nucleic acid sequence according to SEQ ID NO: 124, and a sense strand of nucleic acid sequence according to SEQ ID NO: 378; cv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 125, and a sense strand of nucleic acid sequence according to SEQ ID NO: 379; cvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 126, and a sense strand of nucleic acid sequence according to SEQ ID NO: 380; evil) an antisense strand of nucleic acid sequence according to SEQ ID NO: 127, and a sense strand ofnucleic acid sequence according to SEQ ID NO: 381; cviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 128, and a sense strand of nucleic acid sequence according to SEQ ID NO: 382; cix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 129, and a sense strand of nucleic acid sequence according to SEQ ID NO: 383; ex) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 130, and a sense strand of nucleic acid sequence according to SEQ ID NO: 384; cxi) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 131, and a sense strand of nucleic acid sequence according to SEQ ID NO: 385; cxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 132, and a sense strand of nucleic acid sequence according to SEQ ID NO: 386; cxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 133, and a sense strand of nucleic acid sequence according to SEQ ID NO: 387; cxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 134, and a sense strand of nucleic acid sequence according to SEQ ID NO: 388; cxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 135, and a sense strand of nucleic acid sequence according to SEQ ID NO: 389; cxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 136, and a sense strand of nucleic acid sequence according to SEQ ID NO: 390; cxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 137, and a sense strand of nucleic acid sequence according to SEQ ID NO: 391; cxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 138, and a sense strand of nucleic acid sequence according to SEQ ID NO: 392; cxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 139, and a sense strand of nucleic acid sequence according to SEQ ID NO: 393; exx) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 140, and a sense strand of nucleic acid sequence according to SEQ ID NO: 394; exxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 141, and a sense strand of nucleic acid sequence according to SEQ ID NO: 395; cxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 142, and a sense strand of nucleic acid sequence according to SEQ ID NO: 396; cxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 143, and a sense strand of nucleic acid sequence according to SEQ ID NO: 397; cxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 144, and a sense strand of nucleic acid sequence according to SEQ ID NO: 398; exxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 145, and a sense strand of nucleic acid sequence according to SEQ ID NO: 399; cxxvi) an anti-sense strand of nucleic acid sequenceaccording to SEQ ID NO: 146, and a sense strand of nucleic acid sequence according to SEQ ID NO: 400; cxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 147, and a sense strand of nucleic acid sequence according to SEQ ID NO: 401 , cxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 148, and a sense strand of nucleic acid sequence according to SEQ ID NO: 402; cxxix) an anti-sense strand of nuclei c acid sequence according to SEQ ID NO: 149, and a sense strand of nucleic acid sequence according to SEQ ID NO: 403; cxxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 150, and a sense strand of nucleic acid sequence according to SEQ ID NO: 404; cxxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 151, and a sense strand of nucleic acid sequence according to SEQ ID NO: 405; cxxxii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 152, and a sense strand of nucleic acid sequence according to SEQ ID NO: 406; cxxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 153, and a sense strand of nucleic acid sequence according to SEQ ID NO: 407; cxxxiv) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 154, and a sense strand of nucleic acid sequence according to SEQ ID NO: 408; cxxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 155, and a sense strand of nucleic acid sequence according to SEQ ID NO: 409; cxxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 156, and a sense strand of nucleic acid sequence according to SEQ ID NO: 410; cxxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 157, and a sense strand of nucleic acid sequence according to SEQ ID NO: 411; cxxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 158, and a sense strand of nucleic acid sequence according to SEQ ID NO: 412; cxxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 159, and a sense strand of nucleic acid sequence according to SEQ ID NO: 413; cxl) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 160, and a sense strand of nucleic acid sequence according to SEQ ID NO: 414, cxli) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 161, and a sense strand of nucleic acid sequence according to SEQ ID NO: 415; cxlii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 162, and a sense strand of nucleic acid sequence according to SEQ ID NO: 416; cxliii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 163, and a sense strand of nucleic acid sequence according to SEQ ID NO: 417; cxliv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 164, and a sense strand of nucleic acid sequence according to SEQ IDNO: 418; cxlv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 165, and a sense strand of nucleic acid sequence according to SEQ ID NO: 419; cxlvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 166, and a sense strand of nucleic acid sequence according to SEQ ID NO: 420; cxlvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 167, and a sense strand of nucleic acid sequence according to SEQ ID NO: 421; cxlviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 168, and a sense strand of nucleic acid sequence according to SEQ ID NO: 422, cxlix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 169, and a sense strand of nucleic acid sequence according to SEQ ID NO: 423; cl) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 170, and a sense strand of nucleic acid sequence according to SEQ ID NO: 424; cli) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 171, and a sense strand of nucleic acid sequence according to SEQ ID NO: 425; clii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 172, and a sense strand of nucleic acid sequence according to SEQ ID NO: 426, cliii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 173, and a sense strand of nucleic acid sequence according to SEQ ID NO: 427; cli v) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 174, and a sense strand of nucleic acid sequence according to SEQ ID NO: 428, civ) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 175, and a sense strand of nucleic acid sequence according to SEQ ID NO: 429; clvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 176, and a sense strand of nucleic acid sequence according to SEQ ID NO: 430; civil) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 177, and a sense strand of nucleic acid sequence according to SEQ ID NO: 431; clviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 178, and a sense strand of nucleic acid sequence according to SEQ ID NO: 432; clix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 179, and a sense strand of nucleic acid sequence according to SEQ ID NO: 433; clx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 180, and a sense strand of nucleic acid sequence according to SEQ ID NO: 434; clxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 181, and a sense strand of nucleic acid sequence according to SEQ ID NO: 435; clxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 182, and a sense strand of nucleic acid sequence according to SEQ ID NO: 436; clxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 183, and a sense i lstrand of nucleic acid sequence according to SEQ ID NO: 437; clxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 184, and a sense strand of nucleic acid sequence according to SEQ ID NO: 438; clxv) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 185, and a sense strand of nucleic acid sequence according to SEQ ID NO: 439; clxvi) an anti-sense strand of nuclei c acid sequence according to SEQ ID NO: 186, and a sense strand of nucleic acid sequence according to SEQ ID NO: 440; clxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 187, and a sense strand of nucleic acid sequence according to SEQ ID NO: 441; clxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 188, and a sense strand of nucleic acid sequence according to SEQ ID NO: 442; clxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 189, and a sense strand of nucleic acid sequence according to SEQ ID NO: 443; clxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 190, and a sense strand of nucleic acid sequence according to SEQ ID NO: 444; clxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 191 , and a sense strand of nucleic acid sequence according to SEQ ID NO: 445, clxxii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 192, and a sense strand of nucleic acid sequence according to SEQ ID NO: 446, clxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 193, and a sense strand of nucleic acid sequence according to SEQ ID NO: 447; clxxi v) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 194, and a sense strand of nucleic acid sequence according to SEQ ID NO: 448; clxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 195, and a sense strand of nucleic acid sequence according to SEQ ID NO: 449, clxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 196, and a sense strand of nucleic acid sequence according to SEQ ID NO: 450, clxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 197, and a sense strand of nucleic acid sequence according to SEQ ID NO: 451; clxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 198, and a sense strand of nucleic acid sequence according to SEQ ID NO: 452; clxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 199, and a sense strand of nucleic acid sequence according to SEQ ID NO: 453; clxxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 200, and a sense strand of nucleic acid sequence according to SEQ ID NO: 454; clxxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 201 , and a sense strand of nucleic acid sequence according to SEQ ID NO: 455; clxxxii) an anti-sensestrand of nucleic acid sequence according to SEQ ID NO: 202, and a sense strand of nucleic acid sequence according to SEQ ID NO: 456; clxxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 203, and a sense strand of nucleic acid sequence according to SEQ ID NO: 457; clxxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 204, and a sense strand of nucleic acid sequence according to SEQ ID NO: 458; clxxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 205, and a sense strand of nucleic acid sequence according to SEQ ID NO: 459, clxxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 206, and a sense strand of nucleic acid sequence according to SEQ ID NO: 460; clxxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 207, and a sense strand of nucleic acid sequence according to SEQ ID NO: 461; clxxxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 208, and a sense strand of nucleic acid sequence according to SEQ ID NO: 462; clxxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 209, and a sense strand of nucleic acid sequence according to SEQ ID NO: 463, cxc) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 210, and a sense strand of nucleic acid sequence according to SEQ ID NO: 464; ex ci) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 211, and a sense strand of nucleic acid sequence according to SEQ ID NO: 465, cxcii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 212, and a sense strand of nucleic acid sequence according to SEQ ID NO: 466; cxciii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 213, and a sense strand of nucleic acid sequence according to SEQ ID NO: 467; cxciv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 214, and a sense strand of nucleic acid sequence according to SEQ ID NO: 468; cxcv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 215, and a sense strand of nucleic acid sequence according to SEQ ID NO: 469; exevi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 216, and a sense strand of nucleic acid sequence according to SEQ ID NO: 470; cxcvii ) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 217, and a sense strand of nucleic acid sequence according to SEQ ID NO: 471; cxcviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 218, and a sense strand of nucleic acid sequence according to SEQ ID NO: 472; exeix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 219, and a sense strand of nucleic acid sequence according to SEQ ID NO: 473; cc) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 220, and a sense strandof nucleic acid sequence according to SEQ ID NO: 474; cci) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 221, and a sense strand of nucleic acid sequence according to SEQ ID NO: 475; ccii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 222, and a sense strand of nucleic acid sequence according to SEQ ID NO: 476; cciii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 223, and a sense strand of nucleic acid sequence according to SEQ ID NO: 477; cciv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 224, and a sense strand of nucleic acid sequence according to SEQ ID NO: 478; ccv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 225, and a sense strand of nucleic acid sequence according to SEQ ID NO: 479; ccvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 226, and a sense strand of nucleic acid sequence according to SEQ ID NO: 480; ccvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 227, and a sense strand of nucleic acid sequence according to SEQ ID NO: 481 ; ccviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 228, and a sense strand of nucleic acid sequence according to SEQ ID NO: 482; ccix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 229, and a sense strand of nucleic acid sequence according to SEQ ID NO: 483; ccx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 230, and a sense strand of nucleic acid sequence according to SEQ ID NO: 484; ccxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 231, and a sense strand of nucleic acid sequence according to SEQ ID NO: 485; ccxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 232, and a sense strand of nucleic acid sequence according to SEQ ID NO: 486; ccxii i) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 233, and a sense strand of nucleic acid sequence according to SEQ ID NO: 487; ccxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 234, and a sense strand of nucleic acid sequence according to SEQ ID NO: 488; ccxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 235, and a sense strand of nucleic acid sequence according to SEQ ID NO: 489; ccxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 236, and a sense strand of nucleic acid sequence according to SEQ ID NO: 490; ccxvii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 237, and a sense strand of nucleic acid sequence according to SEQ ID NO: 491; ccxviii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 238, and a sense strand of nucleic acid sequence according to SEQ ID NO: 492; ccxix) an anti -sense strand of nucleic acidsequence according to SEQ ID NO: 239, and a sense strand of nucleic acid sequence according to SEQ ID NO: 493; ccxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 240, and a sense strand of nucleic acid sequence according to SEQ ID NO: 494; ccxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 241, and a sense strand of nucleic acid sequence according to SEQ ID NO: 495, ccxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 242, and a sense strand of nucleic acid sequence according to SEQ ID NO: 496; ccxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 243, and a sense strand of nucleic acid sequence according to SEQ ID NO: 497; ccxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 244, and a sense strand of nucleic acid sequence according to SEQ ID NO: 498; ccxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 245, and a sense strand of nucleic acid sequence according to SEQ ID NO: 499; ccxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 246, and a sense strand of nucleic acid sequence according to SEQ ID NO: 500; ccxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 247, and a sense strand of nucleic acid sequence according to SEQ ID NO: 501; ccxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 248, and a sense strand of nucleic acid sequence according to SEQ ID NO: 502; ccxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 249, and a sense strand of nucleic acid sequence according to SEQ ID NO: 503; ccxxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 250, and a sense strand of nucleic acid sequence according to SEQ ID NO: 504; ccxxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 251, and a sense strand of nucleic acid sequence according to SEQ ID NO: 505; ccxxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 252, and a sense strand of nucleic acid sequence according to SEQ ID NO : 506; ccxxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 253, and a sense strand of nucleic acid sequence according to SEQ ID NO: 507; ccxxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 254, and a sense strand of nucleic acid sequence according to SEQ ID NO: 508; ccxxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 255, and a sense strand of nucleic acid sequence according to SEQ ID NO: 509; ccxxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 256, and a sense strand of nucleic acid sequence according to SEQ ID NO: 510, ccxxxvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 257, and a sense strand ofnucleic acid sequence according to SEQ ID NO: 511; ccxxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 258, and a sense strand of nucleic acid sequence according to SEQ ID NO: 512; ccxxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 259, and a sense strand of nucleic acid sequence according to SEQ ID NO: 513; ccxl) an anti -sense strand of nuclei c acid sequence according to SEQ ID NO: 260, and a sense strand of nucleic acid sequence according to SEQ ID NO: 514; ccxli) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 261, and a sense strand of nucleic acid sequence according to SEQ ID NO: 515; ccxlii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 262, and a sense strand of nucleic acid sequence according to SEQ ID NO: 516; ccxliii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 263, and a sense strand of nucleic acid sequence according to SEQ ID NO: 517; ccxliv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 264, and a sense strand of nucleic acid sequence according to SEQ ID NO: 518; ccxlv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 265, and a sense strand of nucleic acid sequence according to SEQ ID NO: 519, ccxlvi) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 266, and a sense strand of nucleic acid sequence according to SEQ ID NO: 520, ccxlvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 267, and a sense strand of nucleic acid sequence according to SEQ ID NO: 521; ccxlviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 268, and a sense strand of nucleic acid sequence according to SEQ ID NO: 522; ccxlix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 269, and a sense strand of nucleic acid sequence according to SEQ ID NO: 523, ccl) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 270, and a sense strand of nucleic acid sequence according to SEQ ID NO: 524, cell) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 271, and a sense strand of nucleic acid sequence according to SEQ ID NO: 525; cclii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 272, and a sense strand of nucleic acid sequence according to SEQ ID NO: 526, ccliii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 273, and a sense strand of nucleic acid sequence according to SEQ ID NO: 527; ccliv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 274, and a sense strand of nucleic acid sequence according to SEQ ID NO: 528; cclv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 275, and a sense strand of nucleic acid sequence according to SEQ ID NO: 529; cclvi) an anti-sense strand ofnucleic acid sequence according to SEQ ID NO: 276, and a sense strand of nucleic acid sequence according to SEQ ID NO: 530; cclvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 277, and a sense strand of nucleic acid sequence according to SEQ ID NO: 531; cclviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 278, and a sense strand of nucleic acid sequence according to SEQ ID NO: 532; cclix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 279, and a sense strand of nucleic acid sequence according to SEQ ID NO: 533; cclx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 280, and a sense strand of nucleic acid sequence according to SEQ ID NO: 534; cclxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 281, and a sense strand of nucleic acid sequence according to SEQ ID NO: 535; cclxi i) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 282, and a sense strand of nucleic acid sequence according to SEQ ID NO: 536; cclxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 283, and a sense strand of nucleic acid sequence according to SEQ ID NO: 537; cclxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 284, and a sense strand of nucleic acid sequence according to SEQ ID NO: 538; cclxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 285, and a sense strand of nucleic acid sequence according to SEQ ID NO: 539; cclxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 286, and a sense strand of nucleic acid sequence according to SEQ ID NO: 540; cclxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 287, and a sense strand of nucleic acid sequence according to SEQ ID NO: 541; cclxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 288, and a sense strand of nucleic acid sequence according to SEQ ID NO: 542; cclxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 289, and a sense strand of nucleic acid sequence according to SEQ ID NO: 543, cclxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 290, and a sense strand of nucleic acid sequence according to SEQ ID NO: 544, cclxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 291, and a sense strand of nucleic acid sequence according to SEQ ID NO: 545; cclxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 292, and a sense strand of nucleic acid sequence according to SEQ ID NO: 546; cclxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 293, and a sense strand of nucleic acid sequence according to SEQ ID NO: 547, cclxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 294, and a sense strand of nucleic acid sequenceaccording to SEQ ID NO: 548; or cclxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 295, and a sense strand of nucleic acid sequence according to SEQ ID NO: 549.

[0014] In some embodiments of the isolated oligonucleotide, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising 19-25 nucleotides between any one of the nucleotide positions selected from: a) 144 to 177; b) 206 to 229; c) 248 to 269, d) 2751 to 2773; e) 2947 to 2972; f) 2991 to 3012; g) 3275 to 3300; h) 3463 to 3484; i) 3570 to 3591; j) 3931 to 3952; and k) 4923 to 4944, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0015] In some embodiments of the isolated oligonucleotide, the sense strand comprises a nucleotide sequence that is identical to a region comprising 19-25 nucleotides between any one of the nucleotide positions selected from: a) 144 to 177; b) 206 to 229; c) 248 to 269; d) 2751 to 2773; e) 2947 to 2972; f) 2991 to 3012; g) 3275 to 3300; h) 3463 to 3484; i) 3570 to 3591; j) 3931 to 3952, and k) 4923 to 4944, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0016] In some embodiments of the isolated oligonucleotide, the sense strand comprises a nucleotide sequence that is substantially identical to a region between any one of the nucleotide positions selected from: a) 151 to 172; b) 248 to 269; c) 2947 to 2968; d) 2991 to 3012; e) 3463 to 3484; and f) 3931 to 3952, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0017] In some embodiments of the isolated oligonucleotide, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%>, or at least 99% identical to a region between any one of the nucleotide positions selected from: a) 151 to 172, b) 248 to 269; c) 2947 to 2968; d) 2991 to 3012; e) 3463 to 3484; and f) 3931 to 3952, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0018] In some embodiments of the isolated oligonucleotide, the sense strand comprises a nucleotide sequence that is identical to a region between any one of the nucleotide positions selected from: a) 151 to 172; b) 248 to 269; c) 2947 to 2968; d) 2991 to 3012; e) 3463 to 3484; and f) 3931 to 3952, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0019] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence that is substantially identical to a region comprising the sequence between any one of the nucleotide positions selected from: a) 144 to 170; b) 206 to 229; c) 2751 to 2773; d) 2951 to 2972; e) 3275 to 3300; f) 3570 to 3591; and g) 4923 to 4944, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1 ,

[0020] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising the sequence between any one of the nucleotide positions selected from: a) 144 to 170; b) 206 to 229; c) 2751 to 2773; d) 2951 to 2972; e) 3275 to 3300; f) 3570 to 3591; and g) 4923 to 4944, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0021] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence that is identical to a region comprising the sequence between any one of the nucleotide positions selected from: a) 144 to 170; b) 206 to 229; c) 2751 to 2773, d) 2951 to 2972, e) 3275 to 3300; f) 3570 to 3591; and g) 4923 to 4944, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1 ,

[0022] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence that is substantially identical to a region comprising the sequence between nucleotide positions 156 to 177 from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0023] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical a region comprising the sequence between nucleotide positions 156 to 177 from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0024] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence that is identical a region comprising the sequence between nucleotide positions 156 to 177 from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0025] In some embodiments of the isolated oligonucleotide, the isolated oligonucleotide is capable of inducing degradation of the human LPA mRNA.

[0026] In some embodiments of the isolated oligonucleotide, the sense strand is a single stranded RNA molecule, the anti-sense strand is a single stranded molecule or both the sense strand and the anti-sense strand are single stranded RNA molecules.

[0027] In some embodiments of the isolated oligonucleotide, the anti-sense strand comprises a 3’ overhang. In some embodiments of the isolated oligonucleotide, the 3:overhang comprises at least one nucleotide. In some embodiments of the isolated oligonucleotide, the 3’ overhang comprises two nucleotides. In some embodiments of the isolated oligonucleotide, the 3’ overhang comprises any one of thymidine-thymidine (dTd’T), Adenine-Adenine (AA), Cysteine- Cysteine (CC), Guanine-Guanine (GG) or Uracil-Uracil (UU).

[0028] In some embodiments of the isolated oligonucleotide, the sense strand comprises an RNA sequence of at least 20 nucleotides in length. In some embodiments of the isolated oligonucleotide, the sense strand comprises an RNA sequence of 20 nucleotides in length.

[0029] In some embodiments of the isolated oligonucleotide, the anti-sense strand comprises an RNA sequence of at least 22 nucleotides in length. In some embodiments of the isolated oligonucleotide, the anti-sense strand comprises an RNA sequence of 22 nucleotides in length.

[0030] In some embodiments of the isolated oligonucleotide, the double stranded region is between 19 and 21 nucleotides in length. In some embodiments of the isolated oligonucleotide, the double stranded region is 20 nucleotides in length.

[0031] In some embodiments of the isolated oligonucleotide, the anti-sense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 2-11 and 13-22. In some embodiments of the isolated oligonucleotide, the sense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 21-30, 32-41, 550 and 551.

[0032] In some embodiments of the isolated oligonucleotide, the double stranded region comprises: i) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 2, and a sense strand of nucleic acid sequence according to SEQ ID NO: 550; ii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 3, and a sense strand of nucleic acid sequence according to SEQ ID NO: 551; iii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 4, and a sense strand of nucleic acid sequence according to SEQ ID NO: 23; iv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 5, and a sense strand of nucleic acid sequence according to SEQ ID NO: 24; v) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 6, and a sense strand of nucleic acid sequence according toSEQ ID NO: 25; or vi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 7, and a sense strand of nucleic acid sequence according to SEQ ID NO: 26. In some embodiments of the isolated oligonucleotide, the double stranded region comprises: i) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 8, and a sense strand of nucleic acid sequence according to SEQ ID NO: 27; ii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 9, and a sense strand of nucleic acid sequence according to SEQ ID NO: 28; iii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 10, and a sense strand of nucleic acid sequence according to SEQ ID NO: 29; iv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 11, and a sense strand of nucleic acid sequence according to SEQ ID NO: 30; v) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 21, and a sense strand of nucleic acid sequence according to SEQ ID NO: 40; vi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 13, and a sense strand of nucleic acid sequence according to SEQ ID NO: 32; vii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 14, and a sense strand of nucleic acid sequence according to SEQ ID NO: 33; viii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 15, and a sense strand of nucleic acid sequence according to SEQ ID NO: 34; ix) an anti-sense strand of nuclei c acid sequence according to SEQ ID NO: 16, and a sense strand of nucleic acid sequence according to SEQ ID NO: 35; x) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 17, and a sense strand of nucleic acid sequence according to SEQ ID NO: 36; xi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 18, and a sense strand of nucleic acid sequence according to SEQ ID NO: 37; xii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 19, and a sense strand of nucleic acid sequence according to SEQ ID NO: 38; xiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 20, and a sense strand of nucleic acid sequence according to SEQ ID NO: 39; or xiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 22, and a sense strand of nucleic acid sequence according to SEQ ID NO: 41.

[0033] In some embodiments of the isolated oligonucleotide, the isolated oligonucleotide attenuates expression of the human LPA mRNA by at least 50% at a dose of 10 nM. In some embodiments of the isolated oligonucleotide, the double stranded region comprises: i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 8, and a sense strand of nucleic acid sequence according to SEQ ID NO: 27; ii) an anti-sense strand of nucleic acid sequenceaccording to SEQ ID NO: 9, and a sense strand of nucleic acid sequence according to SEQ ID NO: 28; iii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 10, and a sense strand of nucleic acid sequence according to SEQ ID NO: 29, iv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 11, and a sense strand of nucleic acid sequence according to SEQ ID NO: 30; v) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 2 , and a sense strand of nucleic acid sequence according to SEQ ID NO: 550; vi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 7, and a sense strand of nucleic acid sequence according to SEQ ID NO: 26; vii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 13, and a sense strand of nucleic acid sequence according to SEQ ID NO: 32; viii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 3, and a sense strand of nucleic acid sequence according to SEQ ID NO: 551; ix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 14, and a sense strand of nucleic acid sequence according to SEQ ID NO: 33; x) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 22, and a sense strand of nucleic acid sequence according to SEQ ID NO: 41; xi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 4, and a sense strand of nucleic acid sequence according to SEQ ID NO: 23, xii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 5, and a sense strand of nucleic acid sequence according to SEQ ID NO: 24; xiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 15, and a sense strand of nucleic acid sequence according to SEQ ID NO: 34; xiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 16, and a sense strand of nucleic acid sequence according to SEQ ID NO: 35; xv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 17, and a sense strand of nucleic acid sequence according to SEQ ID NO: 36; xvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 18, and a sense strand of nucleic acid sequence according to SEQ ID NO: 37; xvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 6, and a sense strand of nucleic acid sequence according to SEQ ID NO: 25; xviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 19, and a sense strand of nucleic acid sequence according to SEQ ID NO: 38; xix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 20, and a sense strand of nucleic acid sequence according to SEQ ID NO: 39; or xx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 21, and a sense strand of nucleic acid sequence according to SEQ ID NO: 40.

[0034] In some embodiments of the isolated oligonucleotide, the isolated oligonucleotide attenuates expression of the human LPA mRNA by 20% to 50% at a dose of 1.0 nM. In some embodiments of the isolated oligonucleotide, the double stranded region comprises: i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 2, and a sense strand of nucleic acid sequence according to SEQ ID NO: 550; ii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 13, and a sense strand of nucleic acid sequence according to SEQ ID NO: 32; iii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 5, and a sense strand of nucleic acid sequence according to SEQ ID NO: 24; iv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 6, and a sense strand of nucleic acid sequence according to SEQ ID NO: 25; v) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 22, and a sense strand of nucleic acid sequence according to SEQ ID NO: 41; vi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 9, and a sense strand of nucleic acid sequence according to SEQ ID NO: 28; vii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 7, and a sense strand of nucleic acid sequence according to SEQ ID NO: 26; viii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 4, and a sense strand of nucleic acid sequence according to SEQ ID NO: 23; ix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 20, and a sense strand of nucleic acid sequence according to SEQ ID NO: 39; x) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 3, and a sense strand of nucleic acid sequence according to SEQ ID NO: 551 ; xi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 14, and a sense strand of nucleic acid sequence according to SEQ ID NO: 33; xii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 11, and a sense strand of nucleic acid sequence according to SEQ ID NO: 30; xiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 10, and a sense strand of nucleic acid sequence according to SEQ ID NO: 29; or xiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 17, and a sense strand of nucleic acid sequence according to SEQ ID NO: 36.

[0035] In some embodiments of the isolated oligonucleotide, the isolated oligonucleotide attenuates expression of the human LPA mRNA by at least 50% at a dose of 1.0 nM. In some embodiments of the isolated oligonucleotide, the double stranded region comprises: i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 8, and a sense strand of nucleic acid sequence according to SEQ ID NO: 27.

[0036] The disclosure provides an isolated oligonucleotide comprising a sense strand and an anti-sense strand, wherein: the sense strand comprises a nucleotide sequence that is substantially identical to a region comprising 19-25 nucleotides between any one of the nucleotide positions selected from: a) 124 to 176; b) 188 to 233; c) 415 to 436; d) 439 to 464; e) 2683 to 2724; f) 2731 to 2780, g) 2839 to 2860, h) 2927 to 2973; 1) 2992 to 3015; j) 3023 to 3063; k) 3224 to 3245; 1) 3272 to 3302; m) 3319 to 3340; n) 3347 to 3424; o) 3455 to 3485; p) 3518 to 3603; q) 3633 to 3683; r) 3689 to 3710; s) 3761 to 3814, t) 3899 to 3928; u) 3929 to 3964; v) 3991 to 4016; w) 4051 to 4072; x) 4079 to 4108; y) 4179 to 4204; z) 4526 to 4548; and aa) 4922 to 4996, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the anti-sense strand together form a double stranded region.

[0037] In some embodiments of the isolated oligonucleotide, the isolated oligonucleotide attenuates expression of the human LPA mRNA by 20% to 50% at a dose of 10 nM. In some embodiments of the isolated oligonucleotide, the double stranded region comprises: i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 70, and a sense strand of nucleic acid sequence according to SEQ ID NO: 324; ii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 71 , and a sense strand of nucleic acid sequence according to SEQ ID NO: 325; hi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 72, and a sense strand of nucleic acid sequence according to SEQ ID NO: 326; iv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 73, and a sense strand of nucleic acid sequence according to SEQ ID NO: 327; v) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 74, and a sense strand of nucleic acid sequence according to SEQ ID NO: 328; vi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 75, and a sense strand of nucleic acid sequence according to SEQ ID NO: 329; vii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 76, and a sense strand of nucleic acid sequence according to SEQ ID NO: 330; viii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 77, and a sense strand of nucleic acid sequence according to SEQ ID NO: 331; ix) an anti-sense strand of nucleic acid sequence according to SEQ I D NO: 78, and a sense strand of nucleic acid sequence according to SEQ ID NO: 332; x) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 79, and a sense strand of nucleic acid sequence according to SEQ ID NO: 333; xi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 80, and asense strand of nucleic acid sequence according to SEQ ID NO: 334; xii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 81, and a sense strand of nucleic acid sequence according to SEQ ID NO: 335; xiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 82, and a sense strand of nucleic acid sequence according to SEQ ID NO: 336; xiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 83, and a sense strand of nucleic acid sequence according to SEQ ID NO: 337; xv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 84, and a sense strand of nucleic acid sequence according to SEQ ID NO: 338; xvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 85, and a sense strand of nucleic acid sequence according to SEQ ID NO: 339; xvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 86, and a sense strand of nucleic acid sequence according to SEQ ID NO: 340; xviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 87, and a sense strand of nucleic acid sequence according to SEQ ID NO: 341; xix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 88, and a sense strand of nucleic acid sequence according to SEQ ID NO: 342; xx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 89, and a sense strand of nucleic acid sequence according to SEQ ID NO: 343; xxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 90, and a sense strand of nucleic acid sequence according to SEQ ID NO: 344; xxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 91, and a sense strand of nucleic acid sequence according to SEQ I D NO: 345; xxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 92, and a sense strand of nucleic acid sequence according to SEQ ID NO: 346; xxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 93, and a sense strand of nucleic acid sequence according to SEQ ID NO: 347; xxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 94, and a sense strand of nucleic acid sequence according to SEQ ID NO: 348; xxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 95, and a sense strand of nucleic acid sequence according to SEQ ID NO: 349; xxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 96, and a sense strand of nucleic acid sequence according to SEQ ID NO: 350; xxviii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 97, and a sense strand of nucleic acid sequence according to SEQ ID NO: 351; xxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 98, and a sense strand of nucleic acid sequence according to SEQ ID NO: 352; xxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 99, and asense strand of nucleic acid sequence according to SEQ ID NO: 353; xxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 100, and a sense strand of nucleic acid sequence according to SEQ ID NO: 354; xxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 101, and a sense strand of nucleic acid sequence according to SEQ ID NO: 355; xxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 102, and a sense strand of nucleic acid sequence according to SEQ ID NO: 356; xxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 103, and a sense strand of nucleic acid sequence according to SEQ ID NO: 357; xxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 104, and a sense strand of nucleic acid sequence according to SEQ ID NO: 358; xxxvi) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 105, and a sense strand of nucleic acid sequence according to SEQ ID NO: 359; xxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 106, and a sense strand of nucleic acid sequence according to SEQ ID NO: 360; xxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 107, and a sense strand of nucleic acid sequence according to SEQ ID NO: 361; xxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 108, and a sense strand of nucleic acid sequence according to SEQ ID NO: 362, xl) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 109, and a sense strand of nucleic acid sequence according to SEQ ID NO: 363; xli) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 110, and a sense strand of nucleic acid sequence according to SEQ ID NO: 364; xlii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 111, and a sense strand of nucleic acid sequence according to SEQ ID NO: 365; xliii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 112, and a sense strand of nucleic acid sequence according to SEQ ID NO: 366, xliv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 1 13, and a sense strand of nucleic acid sequence according to SEQ ID NO: 367; xlv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 1 14, and a sense strand of nucleic acid sequence according to SEQ ID NO: 368, xlvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 115, and a sense strand of nucleic acid sequence according to SEQ ID NO: 369; xlvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 116, and a sense strand of nucleic acid sequence according to SEQ ID NO: 370; xlviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 117, and a sense strand of nucleic acid sequence according to SEQ ID NO: 371; xlix) an anti-sense strand ofnucleic acid sequence according to SEQ ID NO: 118, and a sense strand of nucleic acid sequence according to SEQ ID NO: 372; 1) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 1 19, and a sense strand of nucleic acid sequence according to SEQ ID NO: 373, li) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 120, and a sense strand of nucleic acid sequence according to SEQ ID NO: 374, lii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 121, and a sense strand of nucleic acid sequence according to SEQ ID NO: 375; liii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 122, and a sense strand of nucleic acid sequence according to SEQ ID NO: 376; liv) an antisense strand of nucleic acid sequence according to SEQ ID NO: 123, and a sense strand of nucleic acid sequence according to SEQ ID NO: 377; Iv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 124, and a sense strand of nucleic acid sequence according to SEQ ID NO: 378; Ivi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 125, and a sense strand of nucleic acid sequence according to SEQ ID NO: 379; Ivii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 126, and a sense strand of nucleic acid sequence according to SEQ ID NO: 380; Iviii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 127, and a sense strand of nucleic acid sequence according to SEQ ID NO: 381 ; lix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 128, and a sense strand of nucleic acid sequence according to SEQ ID NO: 382; lx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO:, and a sense strand of nucleic acid sequence according to SEQ ID NO: 383; Ixi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 130, and a sense strand of nucleic acid sequence according to SEQ ID NO: 384; Ixii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 131, and a sense strand of nucleic acid sequence according to SEQ ID NO: 385; Ixiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 132, and a sense strand of nucleic acid sequence according to SEQ ID NO: 386; Ixiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 133, and a sense strand of nucleic acid sequence according to SEQ ID NO: 387; Ixv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 134, and a sense strand of nucleic acid sequence according to SEQ ID NO: 388; Ixvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 135, and a sense strand of nucleic acid sequence according to SEQ ID NO: 389; Ixvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 136, and a sense strand of nucleic acid sequence according to SEQ ID NO: 390;Ixviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 137, and a sense strand of nucleic acid sequence according to SEQ ID NO: 391; Ixix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 138, and a sense strand of nucleic acid sequence according to SEQ ID NO: 392; Ixx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 139, and a sense strand of nucleic acid sequence according to SEQ ID NO: 393, ixxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 140, and a sense strand of nucleic acid sequence according to SEQ ID NO: 394, Ixxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 141, and a sense strand of nucleic acid sequence according to SEQ ID NO: 395; Ixxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 142, and a sense strand of nucleic acid sequence according to SEQ ID NO: 396; Ixxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 143, and a sense strand of nucleic acid sequence according to SEQ ID NO: 397, Ixxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 144, and a sense strand of nucleic acid sequence according to SEQ ID NO: 398, Ixxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 145, and a sense strand of nucleic acid sequence according to SEQ ID NO: 399; Ixxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO : 146, and a sense strand of nucleic acid sequence according to SEQ ID NO: 400, Ixxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 147, and a sense strand of nucleic acid sequence according to SEQ ID NO: 401; Ixxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 148, and a sense strand of nucleic acid sequence according to SEQ ID NO: 402; or Ixxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 149, and a sense strand of nucleic acid sequence according to SEQ ID NO: 403.

[0038] In some embodiments of the isolated oligonucleotide, the isolated oligonucleotide attenuates expression of the human LPA mRNA by at least 50% at a dose of 10 nM. In some embodiments of the isolated oligonucleotide, wherein the double stranded region comprises: i) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 42, and a sense strand of nucleic acid sequence according to SEQ ID NO: 296; ii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 43, and a sense strand of nucleic acid sequence according to SEQ ID NO: 297; iii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 44, and a sense strand of nucleic acid sequence according to SEQ ID NO: 298, iv) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 45, and a sense strand of nucleic acidsequence according to SEQ ID NO: 299; v) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 46, and a sense strand of nucleic acid sequence according to SEQ ID NO: 300; vi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 48, and a sense strand of nucleic acid sequence according to SEQ ID NO: 302; vii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 50, and a sense strand of nucleic acid sequence according to SEQ ID NO: 304; viii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 52, and a sense strand of nucleic acid sequence according to SEQ ID NO: 306; ix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 56, and a sense strand of nucleic acid sequence according to SEQ ID NO: 310; x) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 57, and a sense strand of nucleic acid sequence according to SEQ ID NO: 311; xi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 58, and a sense strand of nucleic acid sequence according to SEQ ID NO: 312, xii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 65, and a sense strand of nucleic acid sequence according to SEQ ID NO: 319; xiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 67, and a sense strand of nucleic acid sequence according to SEQ ID NO: 321 ; xiv) an anti-sense strand of nuclei c acid sequence according to SEQ ID NO: 63, and a sense strand of nucleic acid sequence according to SEQ ID NO: 317; xv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 64, and a sense strand of nucleic acid sequence according to SEQ ID NO: 318; xvi) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 54, and a sense strand of nucleic acid sequence according to SEQ ID NO: 308; xvii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 60, and a sense strand of nucleic acid sequence according to SEQ ID NO: 314; xviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 49, and a sense strand of nucleic acid sequence according to SEQ ID NO: 303; xix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 51, and a sense strand of nucleic acid sequence according to SEQ ID NO: 305; xx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 59, and a sense strand of nucleic acid sequence according to SEQ ID NO: 313; xxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 53, and a sense strand of nucleic acid sequence according to SEQ ID NO: 307; xxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 61, and a sense strand of nucleic acid sequence according to SEQ ID NO: 315; xxiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 47, and a sense strand of nucleicacid sequence according to SEQ ID NO: 301 ; xxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 66, and a sense strand of nucleic acid sequence according to SEQ ID NO: 320; xxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 55, and a sense strand of nucleic acid sequence according to SEQ ID NO: 309; xxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 69, and a sense strand of nucleic acid sequence according to SEQ ID NO: 323; xxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 62, and a sense strand of nucleic acid sequence according to SEQ ID NO: 316; or xxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 68, and a sense strand of nucleic acid sequence according to SEQ ID NO: 322.

[0039] In some embodiments of the isolated oligonucleotide, the isolated oligonucleotide attenuates expression of the human LPA mRNA by 20% to 50% at a dose of 1.0 nM. In some embodiments of the isolated oligonucleotide, the double stranded region comprises: i) an antisense strand of nucleic acid sequence according to SEQ ID NO: 43, and a sense strand of nucleic acid sequence according to SEQ ID NO: 297; ii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 48, and a sense strand of nucleic acid sequence according to SEQ ID NO: 302; iii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 45, and a sense strand of nucleic acid sequence according to SEQ ID NO: 299; iv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 50, and a sense strand of nucleic acid sequence according to SEQ ID NO: 304; v) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 52, and a sense strand of nucleic acid sequence according to SEQ ID NO: 306; vi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 104, and a sense strand of nucleic acid sequence according to SEQ ID NO: 358; vii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 65, and a sense strand of nucleic acid sequence according to SEQ ID NO: 319; viii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 44, and a sense strand of nucleic acid sequence according to SEQ ID NO: 298; ix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 97, and a sense strand of nucleic acid sequence according to SEQ ID NO: 351; x) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 95, and a sense strand of nucleic acid sequence according to SEQ ID NO: 349; xi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 58, and a sense strand of nucleic acid sequence according to SEQ ID NO: 312; xii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 56, and a sense strand of nucleic acid sequenceaccording to SEQ ID NO: 310; xiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 142, and a sense strand of nucleic acid sequence according to SEQ ID NO: 396; xiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 113, and a sense strand of nucleic acid sequence according to SEQ ID NO: 367; xv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 121, and a sense strand of nucleic acid sequence according to SEQ ID NO: 375; xvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 94, and a sense strand of nucleic acid sequence according to SEQ ID NO: 348; xvii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 93, and a sense strand of nucleic acid sequence according to SEQ ID NO: 347; xviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 92, and a sense strand of nucleic acid sequence according to SEQ ID NO: 346; xix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 89, and a sense strand of nucleic acid sequence according to SEQ ID NO: 343; xx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 96, and a sense strand of nucleic acid sequence according to SEQ ID NO: 350, xxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 130, and a sense strand of nucleic acid sequence according to SEQ ID NO: 384; xxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 67, and a sense strand of nucleic acid sequence according to SEQ ID NO: 321; xxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 57, and a sense strand of nucleic acid sequence according to SEQ ID NO: 311; xxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 147, and a sense strand of nucleic acid sequence according to SEQ ID NO: 401 ; xxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 123, and a sense strand of nucleic acid sequence according to SEQ ID NO: 377; xxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 114, and a sense strand of nucleic acid sequence according to SEQ ID NO: 368; xxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 74, and a sense strand of nucleic acid sequence according to SEQ ID NO: 328; xxviii ) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 240, and a sense strand of nucleic acid sequence according to SEQ ID NO: 494; xxix) an antisense strand of nucleic acid sequence according to SEQ ID NO: 78, and a sense strand of nucleic acid sequence according to SEQ ID NO: 332; xxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 87, and a sense strand of nucleic acid sequence according to SEQ ID NO: 341; xxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 127, anda sense strand of nucleic acid sequence according to SEQ ID NO: 381; xxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 105, and a sense strand of nucleic acid sequence according to SEQ ID NO: 359; xxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 81, and a sense strand of nucleic acid sequence according to SEQ ID NO: 335; xxxiv) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 46, and a sense strand of nucleic acid sequence according to SEQ ID NO: 300; xxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 71, and a sense strand of nucleic acid sequence according to SEQ ID NO: 325; xxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 134, and a sense strand of nucleic acid sequence according to SEQ ID NO: 388; xxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 152, and a sense strand of nucleic acid sequence according to SEQ ID NO: 406; xxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 125, and a sense strand of nucleic acid sequence according to SEQ ID NO: 379; xxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 117, and a sense strand of nucleic acid sequence according to SEQ ID NO: 371; xl) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 107, and a sense strand of nucleic acid sequence according to SEQ ID NO: 361 ; xli) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 186, and a sense strand of nucleic acid sequence according to SEQ ID NO: 440; xlii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 120, and a sense strand of nucleic acid sequence according to SEQ ID NO: 374; xliii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 100, and a sense strand of nucleic acid sequence according to SEQ ID NO: 354, xliv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 183, and a sense strand of nucleic acid sequence according to SEQ ID NO: 437, xlv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 158, and a sense strand of nucleic acid sequence according to SEQ ID NO: 412; xlvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 207, and a sense strand of nucleic acid sequence according to SEQ ID NO: 461 , or xlvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 109, and a sense strand of nucleic acid sequence according to SEQ ID NO: 363.

[0040] In some embodiments of the isolated oligonucleotide, the isolated oligonucleotide attenuates expression of the human LPA mRNA by at least 50% at a dose of 1 .0 nM. In some embodiments of the isolated oligonucleotide, the double stranded region comprises: i) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 42, and a sense strand of nucleic acid sequence according to SEQ ID NO: 296.

[0041] In some embodiments of the isolated oligonucleotide, the sense strand or the anti-sense strand or both comprise one or more modified nucleotide(s).

[0042] The disclosure provides vector encoding any one of the isolated oligonucleotides of the disclosure.

[0043] The disclosure provides a delivery system comprising any one of the isolated oligonucleotides of the disclosure.

[0044] The disclosure provides a pharmaceutical composition comprising any one of the isolated oligonucleotides of the disclosure, any one of the vectors of the disclosure, or any one of the deliven- systems of the disclosure, and a pharmaceutically acceptable carrier, diluent or excipient.

[0045] The disclosure provides a kit comprising any one of the isolated oligonucleotides of the disclosure, any one of the vectors of the disclosure, any one of the delivery systems of the disclosure, or any one of the pharmaceutical compositions of the disclosure.

[0046] The disclosure provides a method of inhibiting or downregulating the expression or level of human Lp(a) in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of at least one of any one of the isolated oligonucleotides of the disclosure, any one of the vectors of the disclosure, any one of the delivery' systems of the disclosure, or any one of the pharmaceutical compositions of the disclosure.

[0047] The disclosure provides a method of treating or preventing a disease or disorder associated with aberrant or increased expression or activity of human Lp(a) or a disease or disorder where human Lp(a) plays a role in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of at least one of any one of the isolated oligonucleotides of the disclosure, any one of the vectors of the disclosure, any one of the delivery' systems of the disclosure, or any one of the pharmaceutical compositions of the disclosure.

[0048] The present disclosure also provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the antisense strand is substantially complementary' to the sense strand such that the sense strand and the antisense strand form a double stranded region, wherein the double stranded region comprises: i) an anti-sense strand of nucleic acid sequenceaccording to SEQ ID NO: 2, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1102; ii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 3, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1103; iii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 4, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1104, iv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 5, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1105; v) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 6, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1106; vi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 7, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1107; vii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 8, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1108; viii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 9, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1109; ix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 10, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1110; x) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 11, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1111 ; xi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 12, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1112; xii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 13, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1113; xiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 14, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1114; xiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 15, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1115; xv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 16, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1116; xvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 17, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1117; xvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 18, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1118; xviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 19, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1119; xix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 20, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1120; xx) an anti-sense strand ofnucleic acid sequence according to SEQ ID NO: 21, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1121; xxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 22, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1122; xxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 42, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1 123; xxiii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 43, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1124; xxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 44, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1125; xxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 45, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1126; xxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 46, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1 127; xxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 47, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1128; xxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 48, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1 129; xxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 49, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1 130; xxx) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 50, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1131; xxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 51 , and a sense strand of nucleic acid sequence according to SEQ ID NO: 1132; xxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 52, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1133; xxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 53, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1134; xxxiv) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 54, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1135; xxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 55, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1136; xxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 56, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1137; xxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 57, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1138; xxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 58, and a sense strand of nucleic acid sequenceaccording to SEQ ID NO: 1139, xxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 59, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1140; xl) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 60, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1141; xli) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 61 , and a sense strand of nucleic acid sequence according to SEQ ID NO: 1142; xlii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 62, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1143; xliii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 63, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1144; xliv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 64, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1145; xlv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 65, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1146; xlvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 66, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1147; xlvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 67, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1148, xlviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 68, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1149; xlix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 69, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1150, 1) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 70, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1151; li) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 71, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1152; lii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 72, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1153; liii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 73, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1154; liv) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 74, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1155; Iv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 75, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1156; Ivi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 76, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1157; Ivii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 77, and a sensestrand of nucleic acid sequence according to SEQ ID NO: 1158; I viii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 78, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1 159; lix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 79, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1160; lx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 80, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1161; Ixi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 81, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1162; Ixii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 82, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1163; Ixiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 83, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1164; Ixiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 84, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1165; Ixv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 85, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1166; Ixvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 86, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1167, Ixvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 87, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1168; Ixviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 88, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1169; Ixix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 89, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1170; Ixx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 90, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1171; Ixxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 91, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1172; Ixxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 92, and a sense strand of nuclei c acid sequence according to SEQ ID NO: 1173; Ixxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 93, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1174; Ixxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 94, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1175; Ixxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 95, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1176; Ixxvi) an anti-sense strand of nucleic acidsequence according to SEQ ID NO: 96, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1177; Ixxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 97, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1178; Ixxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 98, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1179, Ixxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 99, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1180, Ixxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 100, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1181; ixxxi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 101, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1182, Ixxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 102, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1 183; Ixxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 103, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1184; Ixxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 104, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1185; Ixxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 105, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1 186; Ixxxv i ) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 106, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1187; Ixxxv ii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 107, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1188; Ixxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 108, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1189; Ixxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 109, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1190; xc) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 110, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1191 ; xci) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 1 1 1, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1192; xcii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 112, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1193, xciii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 113, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1194; xciv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 114, and a sense strand of nucleic acid sequenceaccording to SEQ ID NO: 1195, xcv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 115, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1196; xcvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 116, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1197; xcvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 117, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1198; xcviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 118, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1199, xcix) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 119, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1200; c) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 120, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1201; ci) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 121, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1202; cii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 122, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1203; ciii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 123, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1204; civ) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 124, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1205; cv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 125, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1206; cvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 126, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1207; cvii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 127, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1208; cviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO : 128, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1209; cix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 129, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1210; ex) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 130, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1211; cxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 131, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1212; cxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 132, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1213; cxiii) an anti-sense strand of nucleic acid sequence according toSEQ ID NO: 133, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1214, cxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 134, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1215; cxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 135, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1216, cxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 136, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1217; cxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 137, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1218; cxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 138, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1219, cxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 139, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1220; cxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 140, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1221 ; cxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 141, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1222; cxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 142, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1223; cxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 143, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1224, cxxiv) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 144, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1225; cxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 145, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1226; cxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 146, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1227; cxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 147, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1228, cxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 148, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1229; cxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 149, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1230; cxxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 150, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1231; cxxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 151, and a sensestrand of nucleic acid sequence according to SEQ ID NO: 1232; cxxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 152, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1233; cxxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 153, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1234; cxxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 154, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1235; cxxxv) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 155, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1236; cxxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 156, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1237; cxxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 157, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1238; cxxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 158, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1239; cxxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 159, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1240; cxl) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 160, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1241 ; cxli) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 161, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1242; cxlii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 162, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1243, cxliii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 163, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1244; cxliv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 164, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1245, cxlv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 165, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1246; cxlvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 166, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1247; cxlvii ) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 167, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1248, cxlviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 168, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1249; cxlix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 169, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1250; cl) an anti-sense strand ofnucleic acid sequence according to SEQ ID NO: 170, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1251; cli) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 171, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1252; clii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 172, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1253; cliii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 173, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1254; cliv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 174, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1255; civ) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 175, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1256; clvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 176, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1257; civil) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 177, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1258; clviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 178, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1259; clix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 179, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1260; clx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 180, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1261; clxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 181, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1262; clxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 182, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1263; clxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 183, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1264, clxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 184, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1265; clxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 185, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1266; clxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 186, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1267, clxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 187, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1268; clxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 188, and a sense strand of nucleic acid sequenceaccording to SEQ ID NO: 1269, clxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 189, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1270; clxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 190, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1271; clxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 191, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1272; clxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 192, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1273, clxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 193, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1274; clxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 194, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1275; clxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 195, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1276; clxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 196, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1277; clxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 197, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1278; clxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 198, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1279; clxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 199, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1280; clxxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 200, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1281; clxxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 201, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1282; clxxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 202, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1283; clxxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 203, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1284; clxxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 204, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1285; clxxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 205, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1286; clxxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 206, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1287; clxxxvii) an anti-sense strand of nucleic acid sequenceaccording to SEQ ID NO: 207, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1288; clxxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 208, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1289; clxxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 209, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1290, cxc) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 210, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1291 ; cxci) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 211, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1292; cxcii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 212, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1293, cxciii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 213, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1294; cxciv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 214, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1295; cxcv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 215, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1296; cxcvi) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 216, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1297; cxcvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 217, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1298; cxcviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 218, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1299; cxcix) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 219, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1300; cc) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 220, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1301; cci) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 221, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1302; ccii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 222, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1303; cciii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 223, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1304; cciv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 224, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1305; ccv) an anti-sense strand of nucleic acid sequence according toSEQ ID NO: 225, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1306, ccvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 226, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1307; ccvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 227, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1308, ccviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 228, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1309; ccix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 229, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1310; ccx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 230, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1311 , ccxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 231, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1312; ccxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 232, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1313; ccxiii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 233, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1314; ccxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 234, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1315, ccxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 235, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1316; ccxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 236, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1317; ccxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 237, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1318; ccxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 238, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1319; ccxix) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 239, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1320; ccxx) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 240, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1321; ccxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 241, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1322; ccxxii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 242, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1323; ccxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 243, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1324;ccxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 244, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1325; ccxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 245, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1326; ccxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 246, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1327; ccxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 247, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1328; ccxxvii i) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 248, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1329; ccxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 249, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1330; ccxxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 250, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1331 ; ccxxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 251, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1332, ccxxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 252, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1333; ccxxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 253, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1334; ccxxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 254, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1335; ccxxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 255, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1336; ccxxxvi) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 256, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1337; ccxxxvii) an antisense strand of nuclei c acid sequence according to SEQ ID NO: 257, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1338; ccxxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 258, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1339; ccxxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 259, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1340; ccxl) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 260, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1341; ccxli) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 261, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1342; ccxlii) an anti-sense strand of nucleic acid sequenceaccording to SEQ ID NO: 262, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1343; ccxliii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 263, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1344; ccxliv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 264, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1345; ccxlv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 265, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1346; ccxlvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 266, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1347; ccxlvii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 267, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1348, ccxlviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 268, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1349; ccxlix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 269, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1350; ccl) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 270, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1351; ccli) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 271, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1352; cclii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 272, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1353; ccliii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 273, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1354; ccliv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 274, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1355; cclv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 275, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1356, cclvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 276, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1357; cclvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 277, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1358; cclviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 278, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1359; cclix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 279, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1360; cclx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 280, and a sense strand of nucleic acid sequenceaccording to SEQ ID NO: 1361 , cclxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 281, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1362; cclxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 282, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1363; cclxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 283, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1364; cclxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 284, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1365, cclxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 285, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1366; cclxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 286, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1367; cclxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 287, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1368; cclxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 288, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1369; cclxix) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 289, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1370; cclxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 290, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1371; cclxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 291, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1372; cclxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 292, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1373; cclxxii i) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 293, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1374; cclxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 294, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1375; or cclxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 295, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1376.

[0049] In some embodiments of the isolated oligonucleotide, the sense strand comprises at least one targeting ligand. In some embodiments of the isolated oligonucleotide, the anti-sense strand comprises at least one targeting ligand. In some embodiments of the isolated oligonucleotide, both the sense strand and the anti-sense strand comprise at least one targeting ligand. In some embodiments, the targeting ligand comprises a GalNAc (e.g., GalNAc linked by a Gib).

[0050] The present disclosure also provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand form a double stranded region, wherein the double stranded region comprises: i) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 552, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1100; ii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 553, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1101 ; iii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 554, and a sense strand of nucleic acid sequence according to SEQ ID NO: 573; iv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 555, and a sense strand of nucleic acid sequence according to SEQ ID NO: 574; v) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 556, and a sense strand of nucleic acid sequence according to SEQ ID NO: 575; vi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 557, and a sense strand of nucleic acid sequence according to SEQ ID NO: 576; vii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 558, and a sense strand of nucleic acid sequence according to SEQ ID NO: 577; viii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 559, and a sense strand of nucleic acid sequence according to SEQ ID NO: 578; ix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 560, and a sense strand of nucleic acid sequence according to SEQ ID NO: 579; x) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 561, and a sense strand of nucleic acid sequence according to SEQ ID NO: 580; xi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 562, and a sense strand of nucleic acid sequence according to SEQ ID NO: 581; xii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 563, and a sense strand of nucleic acid sequence according to SEQ ID NO: 582; xiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 564, and a sense strand of nucleic acid sequence according to SEQ ID NO: 583; xiv) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 565, and a sense strand of nucleic acid sequence according to SEQ ID NO: 584; xv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 566, and a sense strand of nucleic acid sequence according to SEQ ID NO: 585; xvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 567, and a sense strand of nucleic acid sequence according to SEQ ID NO: 586, xvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 568, and a sense strand of nucleic acid sequenceaccording to SEQ ID NO: 587; xviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 569, and a sense strand of nucleic acid sequence according to SEQ ID NO: 588; xix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 570, and a sense strand of nucleic acid sequence according to SEQ ID NO: 589; xx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 571, and a sense strand of nucleic acid sequence according to SEQ ID NO: 590; xxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 572, and a sense strand of nucleic acid sequence according to SEQ ID NO: 591; xxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 592, and a sense strand of nucleic acid sequence according to SEQ ID NO: 846; xxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 593, and a sense strand of nucleic acid sequence according to SEQ ID NO: 847; xxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 594, and a sense strand of nucleic acid sequence according to SEQ ID NO: 848; xxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 595, and a sense strand of nucleic acid sequence according to SEQ ID NO: 849; xxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 596, and a sense strand of nucleic acid sequence according to SEQ ID NO: 850; xxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 597, and a sense strand of nucleic acid sequence according to SEQ ID NO: 851; xxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 598, and a sense strand of nucleic acid sequence according to SEQ ID NO: 852; xxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 599, and a sense strand of nucleic acid sequence according to SEQ ID NO: 853; xxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 600, and a sense strand of nucleic acid sequence according to SEQ ID NO: 854; xxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 601 , and a sense strand of nucleic acid sequence according to SEQ ID NO: 855; xxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 602, and a sense strand of nucleic acid sequence according to SEQ ID NO: 856; xxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 603, and a sense strand of nucleic acid sequence according to SEQ ID NO: 857; xxxiv) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 604, and a sense strand of nucleic acid sequence according to SEQ ID NO: 858; xxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 605, and a sense strand of nucleic acid sequence according to SEQ ID NO: 859; xxxvi) an anti-sense strand of nucleic acid sequence according toSEQ ID NO: 606, and a sense strand of nucleic acid sequence according to SEQ ID NO: 860; xxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 607, and a sense strand of nucleic acid sequence according to SEQ ID NO: 861 , xxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 608, and a sense strand of nucleic acid sequence according to SEQ ID NO: 862; xxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 609, and a sense strand of nucleic acid sequence according to SEQ ID NO: 863; xl) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 610, and a sense strand of nucleic acid sequence according to SEQ ID NO: 864; xli) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 611, and a sense strand of nucleic acid sequence according to SEQ ID NO: 865; xlii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 612, and a sense strand of nucleic acid sequence according to SEQ ID NO: 866; xliii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 613, and a sense strand of nucleic acid sequence according to SEQ ID NO: 867; xliv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 614, and a sense strand of nucleic acid sequence according to SEQ ID NO: 868; xlv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 615, and a sense strand of nucleic acid sequence according to SEQ ID NO: 869; xlvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 616, and a sense strand of nucleic acid sequence according to SEQ ID NO: 870; xlvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 617, and a sense strand of nucleic acid sequence according to SEQ ID NO: 871; xlviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 618, and a sense strand of nucleic acid sequence according to SEQ ID NO: 872; xlix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 619, and a sense strand of nucleic acid sequence according to SEQ ID NO: 873, 1) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 620, and a sense strand of nucleic acid sequence according to SEQ ID NO: 874; li) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 621, and a sense strand of nucleic acid sequence according to SEQ ID NO: 875; lii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 622, and a sense strand of nucleic acid sequence according to SEQ ID NO: 876; liii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 623, and a sense strand of nucleic acid sequence according to SEQ ID NO: 877; liv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 624, and a sense strand of nucleic acid sequence according to SEQ ID NO: 878; Iv) an anti-sense strand ofnucleic acid sequence according to SEQ ID NO: 625, and a sense strand of nucleic acid sequence according to SEQ ID NO: 879; Ivi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 626, and a sense strand of nucleic acid sequence according to SEQ ID NO: 880; Ivii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 627, and a sense strand of nucleic acid sequence according to SEQ ID NO: 881; Iviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 628, and a sense strand of nucleic acid sequence according to SEQ ID NO: 882; lix) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 629, and a sense strand of nucleic acid sequence according to SEQ ID NO: 883; lx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 630, and a sense strand of nucleic acid sequence according to SEQ ID NO: 884; Ixi ) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 631, and a sense strand of nucleic acid sequence according to SEQ ID NO: 885; Ixii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 632, and a sense strand of nucleic acid sequence according to SEQ ID NO: 886; Ixiii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 633, and a sense strand of nucleic acid sequence according to SEQ ID NO: 887; Ixiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 634, and a sense strand of nucleic acid sequence according to SEQ ID NO: 888; ixv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 635, and a sense strand of nucleic acid sequence according to SEQ ID NO: 889; Ixvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 636, and a sense strand of nucleic acid sequence according to SEQ ID NO: 890; Ixvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 637, and a sense strand of nucleic acid sequence according to SEQ ID NO: 891 ; Ixviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 638, and a sense strand of nucleic acid sequence according to SEQ ID NO: 892; Ixix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 639, and a sense strand of nucleic acid sequence according to SEQ ID NO: 893; Ixx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 640, and a sense strand of nucleic acid sequence according to SEQ ID NO: 894; Ixxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 641, and a sense strand of nucleic acid sequence according to SEQ ID NO: 895; Ixxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 642, and a sense strand of nucleic acid sequence according to SEQ ID NO: 896; Ixxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 643, and a sense strand of nucleic acid sequence accordingto SEQ ID NO: 897; Ixxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 644, and a sense strand of nucleic acid sequence according to SEQ ID NO: 898; Ixxv) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 645, and a sense strand of nucleic acid sequence according to SEQ ID NO: 899; Ixxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 646, and a sense strand of nucleic acid sequence according to SEQ ID NO: 900; Ixxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 647, and a sense strand of nucleic acid sequence according to SEQ ID NO: 901, Ixxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 648, and a sense strand of nucleic acid sequence according to SEQ ID NO: 902; Ixxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 649, and a sense strand of nucleic acid sequence according to SEQ ID NO: 903; Ixxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 650, and a sense strand of nucleic acid sequence according to SEQ ID NO: 904; Ixxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 651, and a sense strand of nucleic acid sequence according to SEQ ID NO: 905, Ixxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 652, and a sense strand of nucleic acid sequence according to SEQ ID NO: 906; Ixxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 653, and a sense strand of nucleic acid sequence according to SEQ ID NO: 907; Ixxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 654, and a sense strand of nucleic acid sequence according to SEQ ID NO: 908; Ixxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 655, and a sense strand of nucleic acid sequence according to SEQ ID NO: 909; Ixxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 656, and a sense strand of nucleic acid sequence according to SEQ ID NO: 910; Ixxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 657, and a sense strand of nucleic acid sequence according to SEQ ID NO: 911; Ixxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 658, and a sense strand of nucleic acid sequence according to SEQ ID NO: 912; Ixxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 659, and a sense strand of nucleic acid sequence according to SEQ ID NO: 913; xc) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 660, and a sense strand of nucleic acid sequence according to SEQ ID NO: 914; xci) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 661, and a sense strand of nucleic acid sequence according to SEQ ID NO: 915; xcii) an anti-sense strand of nucleic acid sequence according to SEQ IDNO: 662, and a sense strand of nucleic acid sequence according to SEQ ID NO: 916; xciii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 663, and a sense strand of nucleic acid sequence according to SEQ ID NO: 917; xciv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 664, and a sense strand of nucleic acid sequence according to SEQ ID NO: 918; xcv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 665, and a sense strand of nucleic acid sequence according to SEQ ID NO: 919; xcvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 666, and a sense strand of nucleic acid sequence according to SEQ ID NO: 920; xcvii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 667, and a sense strand of nucleic acid sequence according to SEQ ID NO: 921; xcviii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 668, and a sense strand of nucleic acid sequence according to SEQ ID NO: 922; xcix) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 669, and a sense strand of nucleic acid sequence according to SEQ ID NO: 923; c) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 670, and a sense strand of nucleic acid sequence according to SEQ ID NO: 924; ci) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 671, and a sense strand of nucleic acid sequence according to SEQ ID NO: 925; cii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 672, and a sense strand of nucleic acid sequence according to SEQ ID NO: 926; ciii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 673, and a sense strand of nucleic acid sequence according to SEQ ID NO: 927; civ) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 674, and a sense strand of nucleic acid sequence according to SEQ ID NO: 928; cv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 675, and a sense strand of nucleic acid sequence according to SEQ ID NO: 929; cvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 676, and a sense strand of nucleic acid sequence according to SEQ ID NO: 930; cvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 677, and a sense strand of nucleic acid sequence according to SEQ ID NO: 931 , cviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 678, and a sense strand of nucleic acid sequence according to SEQ ID NO: 932; cix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 679, and a sense strand of nucleic acid sequence according to SEQ ID NO: 933; ex) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 680, and a sense strand of nucleic acid sequence according to SEQ ID NO: 934; cxi) an anti-sense strand of nucleic acidsequence according to SEQ ID NO: 681, and a sense strand of nucleic acid sequence according to SEQ ID NO: 935; cxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 682, and a sense strand of nucleic acid sequence according to SEQ ID NO: 936; cxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 683, and a sense strand of nucleic acid sequence according to SEQ ID NO: 937, cxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 684, and a sense strand of nucleic acid sequence according to SEQ ID NO: 938; cxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 685, and a sense strand of nucleic acid sequence according to SEQ ID NO: 939; cxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 686, and a sense strand of nucleic acid sequence according to SEQ ID NO: 940; cxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 687, and a sense strand of nucleic acid sequence according to SEQ ID NO: 941 ; cxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 688, and a sense strand of nucleic acid sequence according to SEQ ID NO: 942; cxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 689, and a sense strand of nucleic acid sequence according to SEQ ID NO: 943; cxx) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 690, and a sense strand of nucleic acid sequence according to SEQ ID NO: 944; cxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 691, and a sense strand of nucleic acid sequence according to SEQ ID NO: 945; cxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 692, and a sense strand of nucleic acid sequence according to SEQ ID NO: 946; cxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 693, and a sense strand of nucleic acid sequence according to SEQ ID NO: 947; cxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 694, and a sense strand of nucleic acid sequence according to SEQ ID NO: 948; cxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 695, and a sense strand of nucleic acid sequence according to SEQ ID NO: 949; cxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 696, and a sense strand of nucleic acid sequence according to SEQ ID NO: 950; cxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 697, and a sense strand of nucleic acid sequence according to SEQ ID NO: 951; cxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 698, and a sense strand of nucleic acid sequence according to SEQ ID NO: 952; cxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 699, and a sense strand of nucleic acid sequence accordingto SEQ ID NO: 953; cxxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 700, and a sense strand of nucleic acid sequence according to SEQ ID NO: 954; cxxxi) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 701, and a sense strand of nucleic acid sequence according to SEQ ID NO: 955; cxxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 702, and a sense strand of nucleic acid sequence according to SEQ ID NO: 956; cxxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 703, and a sense strand of nucleic acid sequence according to SEQ ID NO: 957, cxxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 704, and a sense strand of nucleic acid sequence according to SEQ ID NO: 958; cxxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 705, and a sense strand of nucleic acid sequence according to SEQ ID NO: 959; cxxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 706, and a sense strand of nucleic acid sequence according to SEQ ID NO: 960; cxxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 707, and a sense strand of nucleic acid sequence according to SEQ ID NO: 961, cxxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 708, and a sense strand of nucleic acid sequence according to SEQ ID NO: 962; cxxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 709, and a sense strand of nucleic acid sequence according to SEQ ID NO: 963; cxl) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 710, and a sense strand of nucleic acid sequence according to SEQ ID NO: 964; cxli) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 711, and a sense strand of nucleic acid sequence according to SEQ ID NO: 965; cxlii ) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 712, and a sense strand of nucleic acid sequence according to SEQ ID NO: 966; cxliii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 713, and a sense strand of nucleic acid sequence according to SEQ ID NO: 967; cxliv) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 714, and a sense strand of nucleic acid sequence according to SEQ ID NO: 968; cxlv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 715, and a sense strand of nucleic acid sequence according to SEQ ID NO: 969; cxlvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 716, and a sense strand of nucleic acid sequence according to SEQ ID NO: 970; cxlvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 717, and a sense strand of nucleic acid sequence according to SEQ ID NO: 971; cxlviii) an anti-sense strand of nucleic acid sequence according toSEQ ID NO: 718, and a sense strand of nucleic acid sequence according to SEQ ID NO: 972; cxlix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 719, and a sense strand of nucleic acid sequence according to SEQ ID NO: 973, cl) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 720, and a sense strand of nucleic acid sequence according to SEQ ID NO: 974; cli) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 721, and a sense strand of nucleic acid sequence according to SEQ ID NO: 975; clii) an anti -sense strand of nuclei c acid sequence according to SEQ ID NO: 722, and a sense strand of nucleic acid sequence according to SEQ ID NO: 976; cliii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 723, and a sense strand of nucleic acid sequence according to SEQ ID NO: 977; cliv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 724, and a sense strand of nucleic acid sequence according to SEQ ID NO: 978; civ) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 725, and a sense strand of nucleic acid sequence according to SEQ ID NO: 979; clvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 726, and a sense strand of nucleic acid sequence according to SEQ ID NO: 980; clvii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 727, and a sense strand of nucleic acid sequence according to SEQ ID NO: 981; clviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 728, and a sense strand of nucleic acid sequence according to SEQ ID NO: 982; clix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 729, and a sense strand of nucleic acid sequence according to SEQ ID NO: 983; clx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 730, and a sense strand of nucleic acid sequence according to SEQ ID NO: 984; clxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 731, and a sense strand of nucleic acid sequence according to SEQ ID NO: 985; clxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 732, and a sense strand of nucleic acid sequence according to SEQ ID NO: 986; clxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 733, and a sense strand of nucleic acid sequence according to SEQ ID NO: 987; clxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 734, and a sense strand of nucleic acid sequence according to SEQ ID NO: 988; clxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 735, and a sense strand of nucleic acid sequence according to SEQ ID NO: 989; clxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 736, and a sense strand of nucleic acid sequence according to SEQ ID NO: 990;clxvii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 737, and a sense strand of nucleic acid sequence according to SEQ ID NO: 991; clxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 738, and a sense strand of nucleic acid sequence according to SEQ ID NO: 992; clxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 739, and a sense strand of nucleic acid sequence according to SEQ ID NO: 993, clxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 740, and a sense strand of nucleic acid sequence according to SEQ ID NO: 994, clxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 741, and a sense strand of nucleic acid sequence according to SEQ ID NO: 995; clxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 742, and a sense strand of nucleic acid sequence according to SEQ ID NO: 996; clxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 743, and a sense strand of nucleic acid sequence according to SEQ ID NO: 997, clxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 744, and a sense strand of nucleic acid sequence according to SEQ ID NO: 998, clxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 745, and a sense strand of nucleic acid sequence according to SEQ ID NO: 999; clxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 746, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1000; clxxvii ) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 747, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1001 , clxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 748, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1002; clxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 749, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1003; clxxx) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 750, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1004; clxxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 751, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1005, clxxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 752, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1006; clxxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 753, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1007; clxxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 754, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1008, clxxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 755, and a sensestrand of nucleic acid sequence according to SEQ ID NO: 1009; clxxxvi ) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 756, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1010; clxxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 757, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1011, clxxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 758, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1012; clxxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 759, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1013; cxc) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 760, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1014; cxci) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 761, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1015; cxcii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 762, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1016; cxciii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 763, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1017; cxciv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 764, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1018, cxcv) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 765, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1019; cxcvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 766, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1020; cxcvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 767, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1021 , cxcviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 768, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1022, cxcix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 769, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1023; cc) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 770, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1024, cci) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 771, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1025, ccii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 772, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1026; cciii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 773, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1027; cciv) ananti-sense strand of nucleic acid sequence according to SEQ ID NO: 774, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1028; ccv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 775, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1029; ccvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 776, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1030; ccvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 777, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1031; ccviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 778, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1032; ccix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 779, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1033; ccx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 780, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1034; ccxi) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 781, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1035; ccxii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 782, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1036; ccxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 783, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1037; ccxiv) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 784, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1038; ccxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 785, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1039; ccxvi) an anti -sense strand of nucleic acid sequence according to SEQ I D NO: 786, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1040; ccxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 787, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1041; ccxviii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 788, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1042, ccxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 789, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1043; ccxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 790, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1044; ccxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 791, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1045, ccxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 792, and a sensestrand of nucleic acid sequence according to SEQ ID NO: 1046; ccxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 793, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1047; ccxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 794, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1048; ccxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 795, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1049; ccxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 796, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1050; ccxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 797, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1051; ccxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 798, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1052; ccxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 799, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1053; ccxxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 800, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1054; ccxxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 801, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1055; ccxxxii) an antisense strand of nucleic acid sequence according to SEQ ID NO: 802, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1056; ccxxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 803, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1057; ccxxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 804, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1058; ccxxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 805, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1059; ccxxxvi) an antisense strand of nucleic acid sequence according to SEQ ID NO: 806, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1060; ccxxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 807, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1061; ccxxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 808, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1062; ccxxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 809, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1063; ccxl) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 810, and a sense strand of nucleic acidsequence according to SEQ ID NO: 1064; ccxli) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 811, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1065; ccxlii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 812, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1066; ccxliii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 813, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1067; ccxliv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 814, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1068; ccxlv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 815, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1069; ccxlvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 816, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1070; ccxlvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 817, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1071; ccxlviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 818, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1072; ccxlix) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 819, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1073, ccl) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 820, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1074; ccli) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 821, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1075; cclii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 822, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1076; ccliii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 823, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1077, ccliv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 824, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1078; cclv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 825, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1079; cclvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 826, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1080; cclvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 827, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1081; cclviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 828, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1082; cclix) an anti-sense strand of nucleic acid sequenceaccording to SEQ ID NO: 829, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1083; cclx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 830, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1084; cclxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 831, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1085; cclxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 832, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1086; cclxiii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 833, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1087; cclxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 834, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1088; cclxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 835, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1089; cclxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 836, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1090; cclxvii) an antisense strand of nuclei c acid sequence according to SEQ ID NO: 837, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1091; cclxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 838, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1092; cclxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 839, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1093; cclxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 840, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1094; cclxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 841, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1095; cclxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 842, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1096; cclxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 843, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1097; cclxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 844, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1098; or cclxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 845, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1099.BRIEF DESCRIPTION OF THE DRAWINGS

[0051] FIG. l is a graph showing the efficacy of siRNA compounds listed in Table 2, in silencing human Lp(a) in cultured RT4 cells. The compounds were transfected into cells at 10 nM concentration. Data is presented as % of human LPA mRNA remaining relative to mock transfection when normalized to PPIB mRNA levels (Mean, + / - SEXI). Each bar represents a single compound tested.

[0052] FIG. 2 is a graph showing the efficacy of siRNA compounds listed in Table 2, in silencing human Lp(a) in cultured RT4 cells. The compounds were transfected into cells at 1 nM concentration. Data is presented as % of human LPA mRN A remaining relative to mock transfection when normalized to PPIB mRNA levels (Mean, + / - SEM). Each bar represents a single compound tested.

[0053] FIG. 3 is a graph showing the in vivo potency of a subset of compounds listed in Table 2, in silencing LPA mRNA in 6-8-week-old female BALB / c mice. Mice were administered subcutaneously with a single dose of 1 mg / kg of selected siRNA compounds followed by transient transfection with LPA plasmid by hydrodynamic tail vein injection (HDI). Liver mRNA was extracted and analyzed by RT-QPCR. Data is presented as % of LPA mRNA remaining relative to mock transfection when normalized to PPIB mRNA levels (Mean, + / - SD).

[0054] FIG. 4 is a graph showing the in vivo potency of a subset of compounds listed in Table 2, in silencing LPALPA mRNA in 6-8-week-old female BALB / c mice. Mice were administered subcutaneously with a single dose of 0.3, 1 or 3 mg / kg of selected siRNA compounds followed by transient transfection with LPA plasmid by hydrodynamic tail vein injection (HDI). Liver mRNA was extracted and analyzed by RT-QPCR. Data is presented as % of LPALPA mRNA remaining relative to mock transfection when normalized to PPIB mRNA levels (Mean, + / - SD).

[0055] FIG. 5 is a graph showing the changes in serum human Lp(a) protein levels following a subcutaneous injection of 0.5 mg / kg of the reference or representative compounds in humanized LP A mice.

[0056] FIGs. 6A-6B are graphs showing the change in Lp(a) protein or LPA mRNA levels in cynomolgus monkeys. FIG. 6A shows the change in Lp(a) protein relative to pre-dose baseline on Day 7 (Day-7) following a subcutaneous injection of 3 mg / kg candidate compounds in cynomolgus monkeys. FIG. 6B shows the change in liver LPALPA mRNA levels on Day 28relative to the pre-dose baseline on Day 7 (Day- / ) following a subcutaneous injection of 3 mg / kg of candidate compounds in cynomolgus monkeys.

[0057] FIG. 7 is a graph showing change in serum Lp(a) protein levels relative to the pre-dose baseline on Day 1 following a subcutaneous injection of 3 mg / kg of candidate compounds in cy nomol gus monkey s ,DETAILED DESCRIPTION

[0058] The present disclosure provides isolated oligonucleotides (oligonucleotide(s)) that form a double stranded region, preferably small interfering RNAs (siRNAs), that can decrease LPA mRNA expression, in turn leading to a decrease in the degree of Lp(a) protein expression in target cells. The oligonucleotides disclosed herein can have therapeutic application in regulating the expression of Lp(a), for treatment of a disease or disorder involving Lp(a) such as, but not limited to a stroke, atherosclerosis, lipid metabolism disorders including dyslipidemia, cardiovascular diseases (CVDs) such as coronary heart disease and aortic stenosis, non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH), or any other disorder, pathology or syndrome associated with elevated levels of Lp(a) particles.

[0059] In some aspects, the present invention provides compositions and methods of treating a subject having a disorder that would benefit from the reduction in Lp(a) expression. In some aspects, the methods disclosed herein prevent at least one symptom in a subject having a disease or disorder that would benefit from reduction in Lp(a) expression.

[0060] The present disclosure has identified specific regions within the LPA mRNA, that, provide targets for binding double stranded oligonucleotides, e.g., siRNA, leading to reduction in level of expression of the LPA mRNA.

[0061] The LPA mRNA sequence described herein, is an mRNA sequence encoded by a Lp(a) gene according to GenBank Accession No. NM 005577.4:>NM 005577 . 4 Homo sapiens lipoprotein ( a ) ( LPA) , mRNA GTAAGTCAACAATGTCCTGGGATTGGGACACACTTTCTGGGCACTGCTGGCCAGTCCCAAAATGGAACAT AAGGAAGTGGTTCTTCTACTTCTTTTATTTCTGAAATCAGCAGCACCTGAGCAAAGCCATGTGGTCCAGG ATTGCTACCATGGTGATGGAC_AGAGTTATCGAGGCACGTACTCC_ACCACTGTC_ACAGGAAGGACCTGCC_A AGCTTGGTCATCTATGACACCACATCAACATAATAGGACCACAGAAAACTACCCAAATGCTGGCTTGATC ATGAACTACTGCAGGAATCCAGATGCTGTGGCAGCTCCTTATTGTTATACGAGGGATCCCGGTGTCAGGTGGGAGTACTGCAACCTGACGCAATGCTCAGACGCAGAAGGGACTGCCGTCGCGCCTCCGACTGTTACCCCGGTTCCAAGCCTAGAGGCTCCTTCCGAACAAGCACCGACTGAGCAAAGGCCTGGGGTGCAGGAGTGCTAC CATGGTAATGGACAGAGTTATCGAGGCACATACTCCACCACTGTCACAGGAAGAACCTGCCAAGCTTGGT CATCTATGACACCACACTCGCATAGTCGGACCCCAGAATACTACCCAAATGCTGGCTTGATCATGAACTACTGCAGGAATCCAGATGCTGTGGCAGCTCCTTATTGTTATACGAGGGATCCCGGTGTCAGGTGGGAGTACTGCAACCTGACGCAATGCTCAGACGCAGAAGGGACTGCCGTCGCGCCTCCGACTGTTACCCCGGTTCCAA GCCTAGAGGCTCCTTCCGAACAAGCACCGACTGAGCAAAGGCCTGGGGTGCAGGAGTGCTACCATGGTAA TGGACAGAGTTATCGAGGCACATACTCCACCACTGTCACAGGAAGAACCTGCCAAGCTTGGTCATCTATG ACACCACACTCGCATAGTCGGACCCCAGAATACTACCCAAATGCTGGCTTGATCATGAACTACTGCAGGA ATCCAGATGCTGTGGCAGCTCCTTATTGTTATACGAGGGATCCCGGTGTCAGGTGGGAGTACTGCAACCT GACGCAATGCTCAGACGCAGAAGGGACTGCCGTCGCGCCTCCGACTGTTACCCCGGTTCCAAGCCTAGAG GCTCCTTCCGAACAAGCACCGACTGAGCAGAGGCCTGGGGTGCAGGAGTGCTACCACGGTAATGGACAGA GTTATCGAGGCACATACTCCACCACTGTCACTGGAAGAACCTGCCAAGCTTGGTCATCTATGACACCACACTCGCATAGTCGGACCCCAGAATACTACCCAAATGCTGGCTTGATCATGAACTACTGCAGGAATCCAGATGCTGTGGCAGCTCCTTATTGTTATACGAGGGATCCCGGTGTCAGGTGGGAGTACTGCAACCTGACGCAAT GCTCAGACGCAGAAGGGACTGCCGTCGCGCCTCCGACTGTTACCCCGGTTCCAAGCCTAGAGGCTCCTTC CGAACAAGCACCGACTGAGCAAAGGCCTGGGGTGCAGGAGTGCTACCATGGTAATGGACAGAGTTATCGAGGCACATACTCCACCACTGTCACAGGAAGAACCTGCCAAGCTTGGTCATCTATGACACCACACTCGCATAGTCGGACCCCAGAATACTACCCAAATGCTGGCTTGATCATGAACTACTGCAGGAATCCAGATGCTGTGGC AGCTCCTTATTGTTATACGAGGGATCCCGGTGTCAGGTGGGAGTACTGCAACCTGACGCAATGCTCAGAC GCAGAAGGGACTGCCGTCGCGCCTCCGACTGTTACCCCGGTTCCAAGCCTAGAGGCTCCTTCCGAACAAG CACCGACTGAGCAAAGGCCTGGGGTGCAGGAGTGCTACCATGGTAATGGACAGAGTTATCGAGGCACATA CTCCACCACTGTCACAGGAAGAACCTGCCAAGCTTGGTCATCTATGACACCACACTCGCATAGTCGGACC CCAGAATACTACCCAAATGCTGGCTTGATCATGAACTACTGCAGGAATCCAGATGCTGTGGCAGCTCCTT ATTGTTATACGAGGGATCCCGGTGTCAGGTGGGAGTACTGCAACCTGACGCAATGCTCAGACGCAGAAGG GACTGCCGTCGCGCCTCCGACTGTTACCCCGGTTCCAAGCCTAGAGGCTCCTTCCGAACAAGCACCGACT LIAGUAAALIGGG'I GGGGT GGAGGALI'I'GG'I AC CAT GG]? AA'l'uGACAGAuTT A'I UGAGLIGAUAT AC-'l'GGAuC A CTGTCACAGGAAGAACCTGCCAAGCTTGGTCATCTATGACACCACACTCGCATAGTCGGACCCCAGAATA CTACCCAAATGCTGGCTTGATCATGAACTACTGCAGGAATCCAGATGCTGTGGCAGCTCCTTATTGTTAT ACGAGGGATCCCGGTGTCAGGTGGGAGTACTGCAACCTGACGCAATGCTCAGACGCAGAAGGGACTGCCGTCGCGCCTCCGACTGTTACCCCGGTTCCAAGCCTAGAGGCTCCTTCCGAACAAGCACCGACTGAGCAGAG GCCTGGGGTGCAGGAGTGCTACCACGGTAATGGACAGAGTTATCGAGGCACATACTCCACCACTGTCACT GGAAGAACCTGCCAAGCTTGGTCATCTATGACACCACACTCGCATAGTCGGACCCCAGAATACTACCCAA ATGCTGGCTTGATCATGAACTACTGCAGGAATCCAGATCCTGTGGCAGCCCCTTATTGTTATACGAGGGA TCCCAGTGTCAGGTGGGAGTACTGCAACCTGACACAATGCTCAGACGCAGAAGGGACTGCCGTCGCGCCTCCAACTATTACCCCGATTCCAAGCCTAGAGGCTCCTTCTGAJYCAAGCACCAACTGAGCAAAGGCCTGGGGTGCAGGAGTGCTACCACGGAAATGGACAGAGTTATCAAGGCACATACTTCATTACTGTCACAGGAAGAACCTGCCAAGCTTGGTCATCTATGACACCACACTCGCATAGTCGGACCCCAGCATACTACCCAAATGCTGGCTTGATCAAGAACTACTGCCGAAATCCAGATCCTGTGGCAGCCCCTTGGTGTTATACAACAGATCCCAGTGTCAGGTGGGAGTACTGCAACCTGACACGATGCTCAGATGCAGAATGGACTGCCTTCGTCCCTCCGAATGTTATTCTGGCTCCAAGCCTAGAGGCTTTTTTTGAACAAGCACTGACTGAGGAAACCCCCGGGGTACAGGACTGCTACTACCATTATGGACAGAGTTACCGAGGCACATACTCCACCACTGTCACAGGAAGAACTTGCCAAGCTTGGTCATCTATGACACCACACCAGCATAGTCGGACCCCAGAAAACTACCCAAATGCTGGCCTGACCAGGAACTACTGCAGGAATCCAGATGCTGAGATTCGCCCTTGGTGTTACACCATGGATCCCAGTGTCAGGTGGGAGTACTGCAACCTGACACAATGCCTGGTGACAGAATCAAGTGTCCTTGCAACTCTCACGGTGGTCCCAGATCCAAGCACAGAGGCTTCTTCTGAAGAAGCACCAACGGAGCAAAGCCCCGGGGTCCAGGATTGCTACCATGGTGATGGACAGAGTTATCGAGGCTCATTCTCTACCACTGTCACAGGAAGGACATGTCAGTCTTGGTCCTCTATGACACCACACTGGCATCAGAGGACAACAGAATATTATCCAAATGGTGGCCTGACCAGGAACTACTGCAGGAATCCAGATGCTGAGATTAGTCCTTGGTGTTATACCATGGATCCCAATGTCAGATGGGAGTACTGCAACCTGACACAATGTCCAGTGACAGAATCAAGTGTCCTTGCGACGTCCACGGCTGTTTCTGAACAAGCACCAACGGAGCAAAGCCCCACAGTCCAGGACTGCTACCATGGTGATGGACAGAGTTATCGAGGCTCATTCTCCACCACTGTTACAGGAAGGACATGTCAGTCTTGGTCCTCTATGACACCACACTGGCATCAGAGAACCACAGAATACTACCCAAATGGTGGCCTGACCAGGAACTACTGCAGGAATCCAGATGCTGAGATTCGCCCTTGGTGTTATACCATGGATCXCAGTGTCAGATGGGAGTACTGCAACCTGACGCAArGTCCAGTGATGGAATCAACTCTCCTCACAACTCCCACGGTGGTCCCAGTTCCAAGCACAGAGCTTCCTTCTGAAGAAGCACCAA.CTGAAAACAGCACTGGGGTCCAGGACTGCTACCGAGGTGATGGACAGAGTTATCGAGGCACACTCTCCACCACTATCACAGGAAGAACATGTCAGTCTTGGTCGTCTATGACACCACATTGGCATCGGAGGATCCCATTATACTATCCAAATGCTGGCCTGACCAGGAACTACTGCAGGAATCCAGATGCTGAGATTCGCCCTTGGTGTTACACCATGGATCCCAGTGTCAGGTGGGAGTACTGCAACCTGACACGATGTCCAGTGACAGAATCGAGTGTCCTCACAACTCCCACAGTGGCCCCGGTTCCAAGCACAGAGGCTCCTTCTGAACAAGCACCACCTGAGAAAAGCCCTGTGGTCCAGGATTGCTACCATGGTGATGGACGGAGTTATCGAGGCATATCCTCCACCACTGTCACAGGAAGGACCTGTCAATCTTGGTCATCTATGATACCACACTGGCATCAGAGGACCCCAGAAAACTACCCAAATGCTGGCCTGAiCCGAGAACTACTGCAGGAATCCAGAiTTCTGGGAAACAACCCTGGTGTTACACAACCGATCCGTGTGTGAGGTGGGAGTACTGCAATCTGACACAATGCTCAGAAACAGAATCAGGTGTCCTAGAGACTCCCACTGTTGTTCCAGTTCCAAGCATGGAGGCTCATTCTGAAGCAGCACCAACTGAGCAAACCCCTGTGGTCCGGCAGTGCTACCATGGTAATGGCCAGAGTTATCGAGGCACATTCTCCACCACTGTCACAGGAAGGACATGTCAATCTTGGTCATCCATGACACCACACCGGCATCAGAGGACCCCAGAAAACTACCCAAATGATGGCCTGACAATGAACTACTGCAGGAATCCAGATGCCGATACAGGCCCTTGGTGTTTTACCATGGACCCCAGCATCAGGTGGGAGTACTGCAACCTGACGCGATGCTCAGACACAGAAGGGACTGTGGTCGCTCCTCCGACTGTCATCCAGGTTCCAAGCCTAGGGCCTCCTTCTGAACAAGACTGTATGTTTGGGAATGGGAZ\AGGATACCGGGGCAAGAAGGCAA.CCACTGTTACTGGGACGCCATGCCAGGAATGGGCTGCCCAGGAGCCCCATAGACACAGC ACGTTCATTCCAGGGACAAATAAATGGGCAGGTCTGGAAAASAATTACTGCCGTAACCCTGATGGTGACA TCAATGGTCCCTGGTGCTACACAATGAATCCAAGAAAACTTTTTGACTACTGTGATATCCCTCTCTGTGC ATCCTCTTCATTTGATTGTGGGAAGCCTCAAGTGGAGCCGAAGAAATGTCCTGGAAGCATTGTAGGGGGG TGTGTGGCCCACCCACATTCCTGGCCCTGGCAAGTCAGTCTCAGAACAAGGTTTGGAAAGCACTTCTGTG GAGGCACCTTAATATCCCCAGAGTGGGTGCTGACTGCTGCTCACTGCTTGAAGAAGTCCTCAAGGCCTTC ATCCTACAAGGTCATCCTGGGTGCACACCAAGAAGTGAACCTCGAATCTCATGTTCAGGAAATAGAAGTG TCTAGGCTGTTCTTGGAGCCCACACAAGCAGATATTGCCTTGCTAAAGCTAAGCAGGCCTGCCGTCATCA CTGACAAAGTAATGCCAGCTTGTCTGCCATCCCCAGACTACATGGTCACCGCCAGGACTGAATGTTACAT CACTGGCTGGGGAGAAACCCAAGGTACCTTTGGGACTGGCCTTCTCAAGGAAGCCCAGCTCCTTGTTATT GAGAATGAAGTGTGCAATCACTATAAGTATATTTGTGCTGAGCATTTGGCCAGAGGCACTGACAGTTGCC AGGGTGACAGTGGAGGGCCTCTGGTTTGCTTCGAGAAGGACAAATACATTTTACAAGGAGTCACTTCTTG GGGTCTTGGCTGTGCACGCCCCAATAAGCCTGGTGTCTATGCTCGTGTTTCAAGGTTTGTTACTTGGATT GAGGGAATGATGAGAAATAATTAATTGGACGGGAGACAGAGTGAAGCATCAACCTACTTAGAAGCTGAAA CGTGGGTAAGGATTTAGCATGCTGGAAATAATAGACAGCAATCAAACGAAGACACTGTTCCCAGCTACCA GCTATGCCAZkACCTTGGCATTTTTGGTATTTTTGTGTATAAGCTTTTAAGGTCTGACTGACAAATTCTGT ATTAAGGTGTCATAGCTATGACATTTGTTAAAAATAAACTCTGCACTTATTTTGATTTGAA (SEQ ID NO: 1)

[0062] The present disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence that is substantially identical to a region comprising 19-25 nucleotides between any one of the nucleotide positions selected from: a) 144 to 177, b) 206 to 229; c) 248 to 269; d) 2751 to 2773; e) 2947 to 2972; f) 2991 to 3012; g) 3275 to 3300; h) 3463 to 3484; i) 3570 to 3591; j) 3931 to 3952, and k) 4923 to 4944, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: I, and the antisense strand is substantially complementary' to the sense strand such that the sense strand and the antisense strand together form a double stranded region.

[0063] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising 19-25 nucleotides between any one of the nucleotide positions selected from: a) 144 to 177; b) 206 to 229; c) 248 to 269; d) 2751 to 2773; e) 2947 to 2972; f) 2991 to 3012; g) 3275 to 3300; h) 3463 to 3484; i) 3570 to 3591 , j) 3931 to 3952; and k) 4923 to 4944, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0064] hi some embodiments of the isoiated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence that is identical to a region comprising 19-25 nucleotides between any one of the nucleotide positions selected from: a) 144 to 177; b) 206 to 229; c) 248 to 269; d) 2751 to 2773; e) 2947 to 2972; f) 2991 to 3012; g) 3275 to 3300; h) 3463 to 3484, i) 3570 to 3591; j) 3931 to 3952; and k) 4923 to 4944, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0065] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence that is substantially identical to a region between any one of the nucleotide positions selected from: a) 151 to 172; b) 248 to 269; c) 2947 to 2968; d) 2991 to 3012; e) 3463 to 3484; and f) 3931 to 3952, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0066] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region between any one of the nucleotide positions selected from: a) 151 to 172; b) 248 to 269; c) 2947 to 2968; d) 2991 to 3012; e) 3463 to 3484; and f) 3931 to 3952, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: I .

[0067] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence that is identical to a region between any one of the nucleotide positions selected from: a) 151 to 172; b) 248 to 269; c) 2947 to 2968; d) 2991 to 3012, e) 3463 to 3484; and f) 3931 to 3952, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1 .

[0068] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence that is substantially identical to a region comprising the sequence between any one of the nucleotide positions selected from: a) 144 to 170; b) 206 to 229; c) 2751 to 2773; d) 2951 to 2972; e) 3275 to 3300; f) 3570 to 3591; and g) 4923 to 4944, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0069] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising the sequence between any one of the nucleotide positions selected from: a) 144 to 170; b) 206 to 229; c) 2751 to 2773; d) 2951 to 2972; e) 3275to 3300; f) 3570 to 3591 , and g) 4923 to 4944, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0070] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence that is identical to a region comprising the sequence between any one of the nucleotide positions selected from: a) 144 to 170; b) 206 to 229, c) 2751 to 2773; d) 2951 to 2972; e) 3275 to 3300; f) 3570 to 3591; and g) 4923 to 4944, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: I .

[0071] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence that is substantially identical to a region comprising the sequence between any one of the nucleotide positions 156 to 177 from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0072] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising the sequence between any one of the nucleotide positions 156 to 177, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0073] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence that is identical to a region comprising the sequence between any one of the nucleotide positions 156 to 177, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0074] The LPA mRNA sequence according to SEQ ID NO: 1 , as described herein, is any heterologous mRNA sequence with sufficient identity to a Lpfa) according to Accession No. NM 005577.4, as described herein, that all ows binding to the antisense strand of the oligonucleotides of the present disclosure.

[0075] In some embodiments of the isolated oligonucleotide of the present disclosure, the isolated oligonucleotide is capable of inducing degradation of the LPA mRNA.

[0076] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand is a single stranded RNA molecule. In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand is a single stranded RNA molecule. In some embodiments of the isolated oligonucleotide of the present disclosure, both the sense strand and the antisense strand are single stranded RNA molecules.

[0077] hi some embodiments, the isolated oligonucleotide of the present disclosure is a small interfering RNA (siRNA). Accordingly, the disclosure provides siRNAs, wherein the siRNA comprises a sense region and antisense region complementary to the sense region that together form an RNA duplex, and wherein the sense region comprises a sequence at least 70% to 100% identical to a LPA mRNA sequence.Definitions

[0078] “RNAi” or “RNA interference” refers to the process of sequence-specific post- transcriptional gene silencing, mediated by double-stranded RN A (dsRNA). Duplex RNA siRNA (small interfering RNA), niiRNA (micro RNA), shRNA (short hairpin RNA), ddRNA (DNA- directed RNA), piRNA (Piwi-interacting RNA), or rasiRNA (repeat associated siRNA) and modified forms thereof are all capable of mediating RNA interference. These dsRNA molecules may be commercially available or may be designed and prepared based on known sequence information, etc. The antisense strand of these molecules can include RNA, DNA, PNA, or a combination thereof These DNA / RNA chimera polynucleotide includes, but is not limited to, a double-strand polynucleotide composed of DNA and RN A that inhibits the expression of a target gene. These dsRNA molecules can also include one or more modified nucleotides, as described herein, which can be incorporated on either strand.

[0079] In the RNAi gene silencing or knockdown process, dsRNA comprising a first (antisense) strand that is complementary to a portion of a target gene and a second (sense) strand that is fully or partially complementary' to the first antisense strand is introduced into an organism. After introduction into the organism, the target gene-specific dsRNA is processed into relatively small fragments (siRNAs) and can subsequently become distributed throughout the organism, decrease messenger RNA of target gene, leading to a phenotype that may come to closely resemble the phenotype arising from a complete or partial deletion of the target gene.

[0080] Certain dsRNAs in cells can undergo the action of Dicer enzyme, a ribonuclease III enzyme. Dicer can process the dsRNA into shorter pieces of dsRNA, i.e. siRNAs. RNAi also involves an endonuclease complex known as the RNA induced silencing complex (RISC). Following cleavage by Dicer, siRNAs enter the RISC complex and direct cleavage of a single stranded RNA target having a sequence complementary to the antisense strand of the siRNA duplex. The other strand of the siRNA is the passenger strand. Cleavage of the target RNA takes place in the middle of the region complementary to the antisense strand of the siRNA duplex.'llsiRNAs can thus down regulate or knock down gene expression by mediating RNA interference in a sequence-specific manner.

[0081] As used herein, “target gene” or “target sequence” refers to a gene or gene sequence whose corresponding RNA is targeted for degradation through the RNAi pathway using dsRNAs or siRNAs as described herein. To target a gene, for example using an siRNA, the siRNA comprises an antisense region complementary to, or substantially complementary to, at least a portion of the target gene or sequence, and sense strand complementary to the antisense strand. Once introduced into a cell, the siRNA directs the RISC complex to cleave an RNA comprising a target sequence, thereby degrading the RNA.

[0082] As used herein, “oligonucleotide”, “nucleic acid,” “nucleotide sequence,” and “polynucleotide” are used interchangeably and encompass both RNA and DNA, including cDNA, genomic DNA, mRNA, synthetic (e.g., chemically synthesized) DNA or RNA and chimeras of RNA and DNA. The term polynucleotide, nucleotide sequence, or nucleic acid refers to a chain of nucleotides without regard to length of the chain. The nucleic acid can be doublestranded or single-stranded. Where single-stranded, the nucleic acid can be a sense strand or an antisense strand. The nucleic acid can be synthesized using oligonucleotide analogs or derivatives (e.g., inosine or phosphorothioate nucleotides). Such oligonucleotides can be used, for example, to prepare nucleic acids that have altered base-pairing abilities or increased resistance to nucleases. The present disclosure further provides a nucleic acid that is the complement (which can be either a full complement or a partial complement) of a nucleic acid, nucleotide sequence, or polynucleotide of this disclosure. When dsRNA is produced synthetically, less common bases, such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine and others can also be used for antisense, dsRNA, and ribozyme pairing. Other modifications, such as modification to the phosphodiester backbone, or the 2’-fluoro, the 2'- hydroxy or 2’0-methyl in the ribose sugar group of the RNA can also be made,

[0083] The term “isolated” can refer to a. nucleic acid, nucleotide sequence or polypeptide that is substantially free of cellular material, viral material, and / or culture medium (when produced by recombinant DNA techniques), or chemical precursors or other chemicals (when chemically synthesized). Moreover, an “isolated fragment” is a fragment of a nucleic acid, nucleotide sequence or polypeptide that is not naturally occurring as a fragment and would not be found in the natural state. “Isolated” does not mean that the preparation is technically pure(homogeneous), but it is sufficiently pure to provide the polypeptide or nucleic acid in a form in which it can be used for the intended purpose.

[0084] The term “region” or “fragment” is used interchangeably and as applied to an oligonucleotide.

[0085] The LPA mRNA sequence, as described herein, will be understood to mean a full length LPA mRNA nucleotide sequence, unless indicated otherwise. In some embodiments, the LPA mRNA sequence can be a nucleotide sequence of reduced length relative to a reference nucleic acid or nucleotide sequence of the LPA mRNA sequence comprising, consisting essentially of, and / or consisting of a nucleotide sequence of contiguous nucleotides identical or almost identical (e.g., 60%, 70%, 80%, 90%, 92%, 95%, 98% or 99% identical) to the reference nucleic acid or nucleotide sequence. Such a nucleic acid fragment according to the disclosure may be, where appropriate, included in a larger polynucleotide of which it is a constituent. In some embodiments, such fragments can comprise, consist essentially of, and / or consist of oligonucleotides having a length of at least about. 8, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200, or more consecutive nucleotides of a nucleic acid or nucleotide sequence according to the disclosure.

[0086] As used herein, “complementary” polynucleotides are those that are capable of base pairing according to the standard Watson-Crick complementarity rules. Specifically, purines will base pair with pyrimidines to form a combination of guanine paired with cy tosine (G:C) and adenine paired with either thymine (A:T) in the case of DNA, or adenine paired with uracil (A:U) in the case of RNA. For example, the sequence “A-G-T” binds to the complementary sequence “T-C-A.” It is understood that two polynucleotides may hybridize to each other even if they are not completely complementary to each other, provided that each has at least one region that is substantially complementary to the other.

[0087] As used herein, the term "substantially complementary" is at least 90% (e.g., 91, 92, 93, 94, 95, 96, 97, 98 or 99%) complementary to the sense strand that is substantially identical to the nucleotide sequence within the defined regions in SEQ ID NO: 1. As used herein, the term “substantially complementary” means that two nucleic acid sequences are complementary at least at about 90%, 95% or 99% of their nucleotides.

[0088] In some embodiments, the two nucleic acid sequences can be complementary' at least at 90%, 95%, 96%, 97%, 98%, 99% or more of their nucleotides. In some embodiments, the twonucleic acid sequences can be between 90% to 95% complementary, between 70% to 100% complementary, between 95% and 96% complementary, between 90% and 100% complementary, between 96% to 97% complementary', between 60% to 80% complementary, between 97% and 98% complementary, between 70% and 90% complementary, between 98% and 99% complementary, between 80% and 100% complementary, or between 99% and 100% complementary.

[0089] The term “substantially complementary'” can also mean that, two nucleic acid sequences, sense strand and antisense strand have sufficient complementarity7that allows binding between the sense strand and antisense strand to form a double stranded region comprising of between 19-25 nucleotides in length. The term “substantially complementary” can also mean that two nucleic acid sequences can hybridize under high stringency conditions, and such conditions are well known in the art.

[0090] As used herein, the term "substantially identical" or “sufficient identity” used interchangeably herein, is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% (e.g., between 70% to 805, 8-% to 90% or 90% to 95% or 95% to 99% or 99% to 100%) identical to the nucleotide sequence within the defined regions in SEQ ID NO: 1.

[0091] As used herein, the term “identity” means that sequences are compared with one another as follows. In order to determine the percentage identity of two nucleic acid sequences, the sequences can first be aligned with respect to one another in order subsequently to make a comparison of these sequences possible. For this e.g., gaps can be inserted into the sequence of the first nucleic acid sequence and the nucleotides can be compared with the corresponding position of the second nucleic acid sequence. If a position in the first nucleic acid sequence is occupied by the same nucleotide as is the case at a position in the second sequence, the two sequences are identical at this position. The percentage identity between two sequences is a function of the number of identical positions divided by the number of all the positions compared in the sequences investigated.

[0092] A “percent identity” or “% identity” as used interchangeably herein, for aligned segments of a test sequence and a reference sequence is the percent of identical components which are shared by the two aligned sequences divided by the total number of components in reference sequence segment, i.e., the entire reference sequence or a smaller defined part of the reference sequence.

[0093] “Nucleotide sequence” and “nucleic acid sequence” are used interchangeably herein, unless indicated otherwise.

[0094] The percentage identity of two sequences can be determined with the aid of a mathematical algorithm. A preferred, but not limiting, example of a mathematical algorithm which can be used for comparison of two sequences is the algorithm of Karlin et al. (1993), PNAS USA, 90:5873-5877. Such an algorithm is integrated in the NBLAST program, with which sequences which have a desired identity to the sequences of the present disclosure can be identified. In order to obtain a gapped alignment, as described here, the “Gapped BLAST” program can be used, as is described in Altschul et al. (1997), Nucleic Acids Res, 25:3389-3402. If BLAST and Gapped BLAST programs are used, the preset parameters of the particular program (e.g. NBLAST) can be used. The sequences can be aligned further using version 9 of GAP (global alignment program ) of the “Genetic Computing Group” using the preset (BLOSUM62) matrix (values -4 to +11) with a gap open penalty of "12 (for the first zero of a gap) and a gap extension penalty of -4 (for each additional successive zero in the gap). After the alignment, the percentage identity is calculated by expressing the number of agreements as a percentage content of the nucleic acids in the sequence claimed. The methods described for determination of the percentage identity of two nucleic acid sequences can also be used correspondingly, if necessary’, on the coded amino acid sequences.

[0095] Useful methods for determining sequence identity are also disclosed in Guide to Huge Computers (Martin J. Bishop, ed., Academic Press, San Diego (1994)), and Carillo, H., and Lipton, D (Applied Ma.th48: 1073(1988)). More particularly, preferred computer programs for determining sequence identity include but are not limited to the Basic Local / Alignment Search Tool (BLAST) programs which are publicly available from National Center Biotechnology Information (NCBI) at the National Library' of Medicine, National Institute of Health, Bethesda, Md. 20894, see BLAST Manual, Altschul et al., NCBI, NUM, NIH; (Altschul et al., J. Mol.Biol. 215:403-410 (1990)); version 2.0 or higher of BLAST programs allows the introduction of gaps (deletions and insertions) into alignments; for peptide sequence BLASTX can be used to determine sequence identity; and, for polynucleotide sequence BLASTN can be used to determine sequence identity. Percent identity can be 70% identity or greater, e.g., at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 98% identity, at least 99% identity or 100% identity’.

[0096] As used herein, “heterologous” refers to a nucleic acid sequence that either originates from another species or is from the same species or organism but is modified from either its original form or the form primarily expressed in the cell. Thus, a nucleotide sequence derived from an organism or species different from that of the cell into which the nucleotide sequence is introduced, is heterologous with respect to that cell and the cell's descendants. In addition, a heterologous nucleotide sequence includes a nucleotide sequence derived from and inserted into the same natural, original cell type, but which is present in a n on-natural state, e.g., a different copy number, and / or under the control of different regulatory sequences than that found in nature.

[0097] Double Stranded RNAs Targeting Human Lipoprotein(a) (Lp(a))

[0098] The disclosure provides isolated oligonucleotides comprising a double stranded RNAs (dsRNAs) duplex region which target a LPA mRNA sequence for degradation. The double stranded RNA molecule of the disclosure may be in the form of any type of RNA interference molecule known in the art. In some embodiments, the double stranded RNA molecule is a small interfering RNA (siRNA). In other embodiments, the double stranded RNA molecule is a short hairpin RNA (shRNA) molecule. In other embodiments, the double stranded RNA molecule is a Dicer substrate that is processed in a cell to produce an siRNA. In other embodiments the double stranded RNA molecule is part of a microRNA precursor molecule.

[0099] In some embodiments, the dsRNA is a small interfering RNA (siRNA) which targets a LPA mRNA sequence for degradation. In some embodiments, the siRNA targeting Lp(a) is packaged in a delivery system described herein (e.g., nanoparticle).

[0100] The isolated oligonucleotides of the present disclosure targeting Lp(a) for degradation can comprise a sense strand at least 70% identical to any fragment of a LPA mRNA, for example the LPA mRNA of SEQ ID NO: 1. In some embodiments, the sense strand comprises or consists essentially of a sequence at least 70%, at least 80%, at least 90%, at least 95% or is 100% identical to any fragment of SEQ ID NO: 1. The siRNAs targeting Lp(a) for degradation can comprise an antisense strand at least 70% identical to a sequence complementary’ to any fragment of a LPA mRNA, for example the LPA mRNA of SEQ ID NO: I . In some embodiments, the antisense strand comprises or consists essentially of a sequence at least 70%, at least 80%, at least 90%, at least 95% or is 100% identical to a sequence complementary-’ to any fragment of SEQ ID NO: 1. In some embodiments, the sense region and antisense regions arecomplementary, and base pair to form an RNA duplex structure. The fragment of the LPA mRNA that has percent identity to the sense region of the siRNA, and which is complementary to the antisense region of the siRNA, can be protein coding sequence of the mRNA, an untranslated region (UTR) of the mRNA (5’ UTR or 3’ UTR), or both.

[0101] In some embodiments, the isolated oligonucleotides of the present disclosure compri ses a sense region and antisense region complementary'’ to the sense region that together form an RNA duplex, and the sense region comprises a sequence at least 70% identical to a LPA mRNA sequence. In some embodiments, the sense region is identical to a LPA mRNA sequence.

[0102] As used herein, the term ‘"sense strand” or “sense region” refers to a nucleotide sequence of an siRNA molecule that is partially or fully complementary' to at least a portion of a corresponding antisense strand or antisense region of the siRNA molecule. The sense strand of an isolated oligonucleotides of the present disclosure molecule can include a nucleic acid sequence having some percentage identity’ with a target nucleic acid sequence such as a LPA mRNA sequence. In some cases, the sense region may have 100% identity, i.e., complete identity or homology, to the target nucleic acid sequence. In other cases, there may be one or more mismatches between the sense region and the target nucleic acid sequence. For example, there may be 1, 2, 3, 4, 5, 6, or 7 mismatches between the sense region and the target nucleic acid sequence.

[0103] As used herein, the term “antisense strand” or “antisense region” refers to a nucleotide sequence of the isolated oligonucleotides of the present disclosure, that is partially or fully complementary to at least a portion of a target nucleic acid sequence. The antisense strand of an isolated oligonucleotides of the present disclosure molecule can include a nucleic acid sequence that is complementary to at least a portion of a corresponding sense strand of the isolated oligonucleotides.

[0104] In some embodiments, the sense region comprises a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% identical or 100% identical to a sequence of SEQ ID NO: I or a region of SEQ ID NO: 1, as disclosed herein. In some embodiments, the sense region consists essentially of a sequence that is at least 70% identical, at least 75% identical, at least. 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% identical or 100% identical to a sequence ofSEQ ID NO: I or a region of SEQ ID NO: I, as disclosed herein. In some embodiments, the sense region comprises a sequence that is identical to a sequence of SEQ ID NO: 1 or a region of SEQ ID NO: 1, as disclosed herein. In some embodiments, the sense region consists essentially of a sequence that is identical to a sequence of SEQ ID NO: 1 or a region of SEQ ID NO: 1, as disclosed herein.

[0105] In some embodiments, the sense region of the isolated oligonucleotides of the present disclosure targeting Lp(a) has one or more mismatches between the sequence of the isolated oligonucleotides and the Lp(a) sequence. For example, the sequence of the sense region may have 1, 2, 3, 4 or 5 mismatches between the sequence of the sense region of the isolated oligonucleotides and the Lp(a) sequence. In some embodiments, the Lp(a) sequence is a Lp(a) 3’ untranslated region sequence (3’ UTR). Without wishing to be bound by theory', it is thought that siRNAs targeting the 3’ UTR have elevated mismatch tolerance when compared to mismatches in the isolated oligonucleotides targeting coding regions of a gene. Further, the isolated oligonucleotides RNAs may be tolerant of mismatches outside the seed region. As used herein, the “seed region” of the isolated oligonucleotides refers to base pairs 2-8 of the antisense region of the isolated oligonucleotides, i.e., the strand of the isolated oligonucleotides that is complementary' to and hybridizes to the target mRNA.

[0106] In some embodiments, the antisense region comprises a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% identical or 100% identical to a sequence complementary to a sequence of SEQ ID NO: 1 or a region of SEQ ID NO: I, as disclosed herein. In some embodiments, the antisense region consists essentially of a sequence that is at least 70% identical, at least 75% identical, at least. 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% or 100% identical to a sequence complementary to a sequence of SEQ ID NO: I or a region of SEQ ID NO: I . In some embodiments, the antisense region comprises a sequence that is identical to a sequence complementary' to a sequence of SEQ ID NO: 1 or a region of SEQ ID NO: 1. In some embodiments, the sense region consists essentially of a sequence that is complementary to a sequence of SEQ ID NO: 1 or a region of SEQ ID NO: 1.

[0107] The antisense region of the Lp(a) targeting isolated oligonucleotide of the present disclosure is complementary' to the sense region. In some embodiments, the sense region and theantisense region are fully complementary (no mismatches). In some embodiments the antisense region is partially complementary to the sense region, i.e., there are 1, 2, 3, 4 or 5 mismatches between the sense region and the antisense region.

[0108] In general, isolated oligonucleotide of the present disclosure comprise an RNA duplex that is about 16 to about 25 nucleotides in length. In some embodiments, the RNA duplex is between about 17 and about 24 nucleotides in length, between about 18 and about 23 nucleotides in length, or between about. 19 and about 22 nucleotides in length. In some embodiments, the RNA duplex is 19 nucleotides in length. In some embodiments, the RNA duplex is 20 nucleotides in length.

[0109] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand is a single stranded RNA molecule. In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand is a single stranded RNA molecule. In some embodiments, both the sense strand and the antisense strand are single stranded RNA molecules. In some embodiments, the isolated oligonucleotide of the present disclosure is an siRNA targeting Lp(a) that comprises two different single stranded RNAs, the first comprising the sense region and the second comprising the antisense region, which hybridize to form an RNA duplex.

[0110] In some embodiments, the isolated oligonucleotide of the present disclosure can have one or more overhangs from the duplex region. In some embodiments, the overhangs, which are non-base-paired, single strand regions, can be from one to eight nucleotides in length, or longer. In some embodiments, the overhang can be a 3’ overhang, wherein the 3 ’-end of a strand has a single strand region of from one to eight nucleotides. In some embodiments, the overhang can be a 5’ overhang, wherein the 5 ‘-end of a strand has a single strand region of from one to eight nucleotides. In some embodiments, the overhangs of the isolated oligonucleotide are the same length. In some embodiments, the overhangs of the isolated oligonucleotide are different lengths.

[0111] In some embodiments of the isolated oligonucleotide of the present disclosure, the single stranded RNA molecule of the sense strand comprises a 3’ overhang. In some embodiments, the 3’ overhang of the single stranded RNA molecule of the sense strand comprises at least one nucleotide. In some embodiments, the 3’ overhang of the single stranded RNA molecule of the sense strand comprises two nucleotides.

[0112] hi some embodiments of the isoiated oligonucleotide of the present disclosure, the single stranded RNA molecule of the antisense strand comprises a 3’ overhang. In some embodiments, the 3’ overhang of the single stranded RNA molecule of the antisense strand comprises at least one nucleotide. In some embodiments, the 3’ overhang of the single stranded RNA molecule of the antisense strand comprises two nucleotides.

[0113] In some embodiments of the isolated oligonucleotide of the present disclosure, both ends of isolated oligonucleotide have an overhang, for example, a 3’ dinucleotide overhang on each end. In some embodiments, the overhangs at the 5'- and 3 '-ends are of different lengths. In some embodiments, the overhangs at the 5'- and 3 '-ends are of the same length.

[0114] In some embodiments of the isolated oligonucleotide of the present disclosure, the overhang can contain one or more deoxyribonucleotides, one or more ribonucleotides, or a combination of deoxyribonucleotides and ribonucleotides. In some embodiments, one, or both, of the overhang nucleotides of an siRNA may be 2'-deoxyribonucleotides.

[0115] In some embodiments of the isolated oligonucleotide of the present disclosure, the first single stranded RNA molecule comprises a first 3’ overhang. In some embodiments, the second single stranded RNA molecule comprises a second 3’ overhang. In some embodiments, the first and second 3’ overhangs comprise a dinucleotide.

[0116] In some embodiments of the isolated oligonucleotide of the present disclosure, the 3’ overhang comprises any one of thymidine-thymidine (dTdT), .Adenine- Adenine (AA), Cysteine- Cysteine (CC), Guanine-Guanine (GG) or Uracil-Uracil (UU). In some embodiments, the isolated oligonucleotide of the present disclosure, the 3’ overhang comprises a thymidinethymidine (dTdT) or a Uracil-Uracil (UU) overhang. In some embodiments, the 3’ overhang comprises a Uracil-Uracil (UU) overhang. Without wishing to be bound by theory, it is thought that 3’ overhangs, such as dinucleotide overhangs, enhance siRNA mediated niRNA degradation by enhancing siRNA-RISC complex formation, and / or rate of cleavage of the target mRNA by the siRNA-RISC complex.

[0117] In some embodiments, the isolated oligonucleotide of the present disclosure can have one or more blunt ends, in which the duplex region ends with no overhang, and the strands are base paired to the end of the duplex region. In some embodiments, the isolated oligonucleotide of the present disclosure can have one or more blunt ends, or can have one or more overhangs, or can have a combination of a blunt end and an overhang end. For example, the 5’ end of thesiRNA can be blunt and the 3’ end of the same isolated oligonucleotide comprise an overhang, or vice versa.

[0118] In some embodiments, both ends of the isolated oligonucleotide of the present disclosure are blunt ends.

[0119] In some embodiments of the isolated oligonucleotide of the present disclosure, the double stranded region comprises an antisense strand and a sense strand, according to any one of the pairs of antisense strand and sense strand sequences in Tables 1-6, as described below.

[0120] Accordingly, the isolated oligonucleotides disclosed in the present disclosure are useful in treating or preventing a disease or disorder associated with aberrant or increased expression or activity of Lp(a) or a disease or disorder where Lp(a) plays a role. Exemplary isolated oligonucleotides of the present disclosure are described in Tables 1-6. In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence selected from any one of the group of sense strand / passenger strand sequences listed in Tables 1- 6. In some embodiments, the antisense strand comprises a sequence selected from any one of the group of antisense strand / guide strand sequences listed in Tables 1-6. In some embodiments, the sense and antisense regions comprise complementary sequences selected from the group listed in Tables 1-6.

[0121] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 2-11 and 13-22.

[0122] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 23-30, 32- 41 , 550 and 551 .

[0123] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 2-11 and 13-22; and the sense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 23-30, 32-41, 550 and 551, wherein the antisense strand and the sense strand sequences have sufficient complementarity to allow formation of a double stranded region between the antisense and the sense strand.

[0124] The disclosure also provides an isolated oligonucleotide comprising a sense strand selected from SEQ ID NOs: 2-22 and 42-295 and its corresponding antisense strand selected from SEQ ID NOs: 23-41 and 296-551, as set forth in Table 2.

[0125] In some embodiments of the isolated oligonucleotide, the sense strand comprises a modified sequence of a sequence selected from SEQ ID NOs: 2-22 and 42-295 and its corresponding antisense strand selected from SEQ ID NOs: 23-41 and 296-551, as set forth in Table 2, as set forth in SEQ ID NOs: 552-845, 1372-1378, 1383-1384, 1386-1387, and 1395- 1396 and its corresponding antisense strand comprises a sequence selected from SEQ ID NOs: 573-1101, 1379-1380, 1385, and 1388, as set forth in Table d.

[0126] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence selected from SEQ ID NOs: 2-22 and its corresponding antisense strand comprises a sequence selected from 23-41 and 550-551, as set forth in Table 1.

[0127] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence selected from SEQ ID NOs: 2, 6, 16, 18, 552, 556, 568, 566 1377-1378, 1383-1384, 1386-1387, and 1395-1396 and its corresponding antisense strand selected from SEQ ID NOs: 575, 585, 587, 1100, 1379-1380, 1385, and 1388, as set forth in Table 3.

[0128] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence selected from SEQ ID NOs: 2, 6, 18, 552, 556, and 568, and its corresponding antisense strand selected from SEQ ID NOs: 575, 587, 1 100, 1379-1380, and 1385, as set forth in Table 4.

[0129] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence selected from SEQ ID NOs: 18, 568 and 1383-1384, and its corresponding antisense strand selected from SEQ ID NOs: 587 and 1380, as set forth in Table 5.

[0130] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence as set forth in SEQ ID NO: 18 and its corresponding antisense strand comprises a sequence as set forth in SEQ ID NO: 37.

[0131] In some embodiments of the isolated oligonucleotide, the sense strand comprises a modified sequence as set forth in SEQ ID NO: 568 and its corresponding antisense strand comprises a modified sequence as set forth in SEQ ID NO: 587.

[0132] In some embodiments of the isolated oligonucleotide, the double stranded region comprises: i) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 2 (5’UUCGAUAACUCUGUCCAUCACC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 550 (5’ UGAUGGACAGAGUOAOCGAA 3’); ii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 3 (5’ UCAUUUGGGUAGUUUUCUGUGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 551 (5’ ACAGAAAACUACCCAAAUGA 3’); iii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 4 (5’ UUGGUGUCAUAGAUGACCAAGC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 23 (5’ UUGGUCAUCUAUGACACCAA 3’), iv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 5 (5’ UAAGCCAGCAUUUGGGUAGUAU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 24 (5’ ACUACCCAAAUGCUGGCUUA 3’); v) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 6 (5’ UAGACUGACAUGUCCUUCCUGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 25 (5’ AGGAAGGACAUGUCAGUCUA 3’); vi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 7 (5’ UAGUUGCAAGGACACUUGAUUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 26 (5’ AUCAAGUGUCCUUGCAACUA 3’); vii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 8 (5’UCGAUAACUCUGUCCAUCACCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 27 (5’ GUGAUGGACAGAGUUAUCGA 3’); viii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 9 (5’ UUAACUCUGUCCAUCACCAUGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 28 (5’ AUGGUGAUGGACAGAGUUAA 3’); ix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 10 (5’ UUGAGCAUUGUGUCAGGUUGCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 29 (5’ CAACCUGACACAAUGCUCAA 3’); x) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 11 (5’ UGAUAACUCUGUCCAUCACCAU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 30 (5’ GGUGAUGGACAGAGUUAUCA 3 ’); xi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 12 (5’ UAUAACUCUGUCCAUUACCGUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 31 (5’ CGGUAAUGGACAGAGUUAUA 3’); xii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 13 (5’ UUCAUAGAUGACCAAGCUUGGC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 32 (5’ CAAGCUUGGUCAUCUAUGAA3’); xiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 14 (5’ UAUAACUCUGUCCAUCACCAUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 33 (5’ UGGUGAUGGACAGAGUUAUA 3’); xiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 15 (5’ UUGUCAUAGAUGACCAAGCUUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 34 (5’ AGCUUGGUCAUCUAUGACAA 3’); xv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 16 (5’ UAAUGUGCCUCGAUAACUCUGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 35 (5’ AGAGUUAUCGAGGCACAUUA 3’); xvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 17 (5’ UGAGCAUUGUGUCAGGUUGCAG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 36 (5’ GCAACCUGACACAAUGCUCA 3’); xvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 18 (5’ UGAUGACCAAGCUUGGCAAGUU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 37 (5’ CUUGCCAAGCUUGGUCAUCA 3’); xviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 19 (5’ UACCAAGCUUGGCAAGUUCUUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 38 (5’ AGAACUUGCCAAGCUUGGUA 3’); xix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 20 (5’ UAGUGUGGUGUCAUAGAUGACC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 39 (5’ UCAUCUAUGACACCACACUA 3’); xx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 21 (5’ UCUCUGUCCAUCACCAUGGUAG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 40 (5’ ACCAUGGUGAUGGACAGAGA 3’); xxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 22 (5’ UGUGCCUCGAUAACUCUGUCCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 41 (5’ GACAGAGUUAUCGAGGCACA 3’); xxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 42 (5’ UGUGGUGUCAUAGAUGACCAAG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 296 (5’ UGGUCAUCUAUGACACCACA 3’), xxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 43 (5’ UAGUGGUGGAGAAUGAGCCUCG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 297 (5’ AGGCUCAUUCUCCACCACUA 3’); xxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 44 (5’UCCUCGAU / AACUCUGUCCAUCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 298 (5’ AUGGACAGAGUUAUCGAGGA 3’); xxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 45 (5’ UUAGAUGACCAAGCUUGGCAGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 299 (5’ UGCCAAGCUUGGUCAUCUAA 3’); xxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 46 (5’ UAGCAUUGUGUCAGGUUGCAGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 300 (5’ UGCAACCUGACACAAUGCUA 3’); xxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 47 (5’ UAGAAUGUGCCUCGAUAACUCU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 301 (5’ AGUUAUCGAGGCACAUUCUA 3’), xxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 48 (5’ UGUCAUAGAUGACCAAGCUUGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 302 (5’ AAGCUUGGUCAUCUAUGACA 3’); xxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 49 (5’UAACUCUGUCCAUCACCAUGGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 303 (5’ CAUGGUGAUGGACAGAGUUA 3’), xxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 50 (5’ UGCCUCGAUAACUCUGUCCAUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 304 (5’ UGGACAGAGUUAUCGAGGCA 3’); xxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 51 (5’ UAGUAGUUCCUGGUCAGGCCAG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 305 (5’ GGCCUGACCAGGAACUACUA 3’); xxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 52 (5’ UCUUUUCUC AGGUGGUGCUUGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 306 (5’ AAGCACCACCUGAGAAAAGA 3’); xxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 53 (5’UGAAUGUGCCUCGAUAACUCUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 307 (5’ GAGUUAUCGAGGCACAUUCA 3’); xxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 54 (5’ UAUGACCAAGCUUGGCAGGUCC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 308 (5’ ACCUGCCAAGCUUGGUCAUA 3’); xxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 55 (5’ UUGACCAAGCUUGGCAAGLJUCU3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 309 (5’ AACUUGCCAAGCUUGGUCAA 3’); xxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 56 (5’ UGCCACAGGAUCUGGAUUUCGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 310 (5’ GAAAUCCAGAUCCUGUGGCA 3’); xxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 57 (5’ UCUGAGCAUUGUGUCAGGUUGC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 31 1 (5’ AACCUGACACAAUGCUCAGA 3’); xxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 58 (5’ UACUCUGUCCAUCACCAUGGUA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 312 (5’ CCAUGGUGAUGGACAGAGUA 3’); xxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 59 (5’ UAUGUGCCUCGAUAACUCUGGC 3’), and a sense strand of nucleic acid sequence according to SEQ I D NO: 313 (5’ CAGAGUUAUCGAGGCACAUA 3’); xl) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 60 (5:UUAGAUGACCAAGCUUGGCAAG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 314 (5’ UGCCAAGCUUGGUCAUCUAA 3’); xli) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 61 (5’ UGAGUUGCAAGGACACUUGAUU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 315 (5’ UCAAGUGUCCUUGCAACUCA 3’); xlii) an anti-sense strand of nucleic acid sequence according to SEQ I D NO: 62 (5’ UGAGUGUGGUGUCAUAGAUGAC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 316 (5’ CAUCUAUGACACCACACUCA 3’); xliii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 63 (5’ UUGACCAAGCUUGGCAGGUUCU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 317 (5’ AACCUGCCAAGCUUGGUCAA 3’); xliv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 64 (5’ UGCUCAGUCGGUGCUUGUUCGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 318 (5’ GAACAAGCACCGACUGAGCA 3' ); xlv) an anti-sense strand of nucleic acid sequence according to SEQ I D NO: 65 (5’ UGAGAAUGAGCCUCGAUAACUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 319 (5’ GUUAUCGAGGCUCAUUCUCA 3’); xlvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 66 (5’UUUGCAAGGACACUUGAUUCUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 320 (5’ GAAUCAAGUGUCCUUGCAAA 3’); xlvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 67 (5’ UUGCAGUACUCCCAUCUGACAC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 321 (5’ GUCAGAUGGGAGUACUGCAA 3’); xlviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 68 (5’ UACAGUGGUGGAGAAUGUGCCU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 322 (5’ GCACAUUCUCCACCACUGUA 3’); xlix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 69 (5’ UAUAGAUGACCAAGCUUGGCAG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 323 (5’ GCCAAGCUUGGUCAUCUAUA 3’); 1) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 70 (5’ UAUUGUGUCAGGUIJGCAGUACU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 324 (5’ UACUGCAACCUGACACAAUA 3’); li) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 71 (5’ UGUCCAUCACCAUGGUAGCAAU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 325 (5’ UGCUACCAUGGUGAUGGACA 3’); lii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 72 (5’ UUGGUGUCAUGGAUGACCAAGA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 326 (5’ UUGGUCAUCCAUGACACCAA 3’); liii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 73 (5’ UAUCAAGCCAGCAUUUGGGUAG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 327 (5’ ACCXiAAAIJGCdJGGCIJUGAIJA 3’); liv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 74 (5’UCACCAUGGUAGCAAUCCUGGA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 328 (5’ CAGGAUUGCUACCAUGGUGA 3’); Iv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 75 (5’ UAGUAGUUCCUGGUCAGGCCAC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 329 (5’ GGCCUGACCAGGAACUACUA 3’); Ivi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 76 (5’ UCCAAGCUUGGCAGGUCCUUCC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 330 (5’ AAGGACCUGCCAAGCUUGGA 3’); Ivii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 77 (5’ UAGUCGGUGCUUGUUCGGAAGG 3’), and a sense strand of nucleic acid sequenceaccording to SEQ ID NO: 331 (5’ UUCCG / AACAAGCACCGACUA 3’), Iviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 78 (5’UCGUCAGGUUGCAGUACUCCCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 332 (5’ GGAGUACUGCAACCUGACGA 3’); lix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 79 (5’ UACUGACAUGUCCUUCCUGUAA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 333 (5’ ACAGGAAGGACAUGLJCAGUA 3’); lx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 80 (5’ UUUUUCUCAGGUGGUGCUUGUU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 334 (5’ CAAGCACCACCUGAGAAAAA 3’); Ixi) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 81 (5’ UCUGCGUCUGAGCAUUGUGUCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 335 (5’ ACACAAUGCUCAGACGCAGA 3’); Ixii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 82 (5’UAAGACUGACAUGUCCUUCCUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 336 (5’ GGAAGGACAUGUCAGUCUUA 3’); Ixiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 83 (5’ UAACAAUAAGGGGCUGCCACAG 3’), and a sense strand of nucleic acid sequence according to SEQ I D NO: 337 (5’ GUGGCAGCCCCUUAUUGUUA 3’); Ixiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 84 (5’ UAACACCAAGGGCGAAUCUCAG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 338 (5’ GAGAUUCGCCCUUGGUGUUA 3’); Ixv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 85 (5’ UUGCAGUACUCCCAUCUGACAU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 339 (5’ GUCAGAUGGGAGUACUGCAA 3’); Ixvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 86 (5’ UCUGCAGUAGUUCCUGGUCAGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 340 (5’ UGACCAGGAACUACUGCAGA 3 ’); Ixvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 87 (5’ UUCAGUUGGUGCUUCUUCAGAA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 341 (5’ CUGAAGAAGCACCAACUGAA 3’); Ixviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 88 (5’ UGUACUCCCACCUG ACACUGGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 342 (5’ CAGUGUCAGGUGGGAGUACA 3’); ixix) an anti-sense strand ofnucleic acid sequence according to SEQ ID NO: 89 (5’ UAGGUUGCAGUACUCCCAUCUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 343 (5’ GAUGGGAGUACUGCAACCUA 3’); ixx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 90 (5’ UCUCGAUAACUCUGUCCAUCAC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 344 (5’ GAUGGACAGAGUUAUCGAGA 3’); Ixxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 91 (5’ UCAAGACUGACAUGUCCUUCCU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 345 (5’ GAAGGACAUGUCAGUCUUGA 3’); Ixxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 92 (5’ UACUUGAUUCUGUCACUGGACA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 346 (5’ UCCAGUGACAGAAUCAAGUA 3’); Ixxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 93 (5’ UAAUAUUCTJGUUGUCCUCUGAU 3 ). and a sense strand of nucleic acid sequence according to SEQ ID NO: 347 (5’ CAGAGGACAACAGAAUAUUA 3’); Ixxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 94 (5’ UGUAUAACAAUAAGGGGCUGCC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 348 (5’ CAGCCCCUUAUUGUUAUACA 3’), Ixxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 95 (5’ UUCAGGCCACCAUUUGGGUAGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 349 (5’ UACCCAAAUGGUGGCCUGAA 3’); Ixxv i ) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 96 (5’ UAUAAUAUUCUGUUGUCCUCUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 350 (5’ GAGGACAACAGAAUAUUAUA 3’); Ixxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 97 (5’ UAUGAGCCUCGAUAACUCUGUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 351 (5’ CAGAGUUAUCGAGGCUCAUA 3’); Ixxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 98 (5’ UCUCUAGGCUUGGAACCGGGGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 352 (5’ CCCGGUUCCAAGCCUAGAGA 3’); Ixxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 99 (5’ UGAUAAUAUUCUGUUGUCCUCU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 353 (5’ AGGACAACAGAAUAUUAUCA 3’); Ixxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 100 (5’UUGCAGUACUCCCACCUGACAC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 354 (5’ GUCAGGUGGGAGUACUGCAA 3’); Ixxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 101 (5’ IJACAUGUCCUIJCCUGUGACAGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 355 (5’ UGUCACAGGAAGGACAUGUA 3’); Ixxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 102 (5’ UCAAUAAGGGGCUGCCACAGGA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 356 (5’ CUGUGGCAGCCCCUUAUUGA 3’); Ixxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 103 (5’ UUGUGGUGUCAUAGAGGACCAA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 357 (5’ GGUCCUCUAUGACACCAC / AA 3’), Ixxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 104 (5’ UCCGUUGGUGCUUCUUCAGAAG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 358 (5’ UCUGAAGAAGCACCAACGGA 3’); Ixxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 105 (5’ UACCAAGACUGACAUGUCCUUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 359 (5’ AGGACAUGUCAGUCUUGGUA 3’); Ixxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 106 (5’ UAGAAUGAGCCUCGAUAACUCU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 360 (5’ AGUUAUCGAGGCUCAUUCUA 3’); Ixxxv ii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 107 (5’ UCUUGGCAGGUUCUUCCUGUGA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 361 (5’ ACAGGAAGAACCUGCCAAGA 3’); Ixxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 108 (5’ UUGCUCCGUUGGUGCUUCUUCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 362 (5’ AAGAAGCACCAACGGAGCAA 3’); Ixxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 109 (5’ UAUUCUGIJUGUCCUCUGAUGCC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 363 (5’ CAUCAGAGGACAACAGAAUA 3’); xc) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 110 (5’ UAAGCUUGGCAAGUUCUUCCUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 364 (5’ GGAAGAACUUGCCAAGCUUA 3’); xci) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 111 (5’ UCUGUCCAUCACCAUGGUAGCA 3’), and a sense strand of nucleic acid sequence accordingto SEQ ID NO: 365 (5’ CUACCAUGGUGAUGGACAGA 3’); xcii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 112 (5’ UCCAAGACUGACAUGUCCUUCC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 366 (5’ AAGGACAUGUCAGUCUUGGA 3’); xciii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 113 (5’ UCAAGCUUGGCAAGUUCUUCCU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 367 (5’ GAAGAACUUGCCAAGCUUGA 3’); xciv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 114 (5’ UGAGGACCAAGACUGACAUGUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 368 (5’ CAUGUCAGUCUUGGUCCUCA 3’); xcv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 115 (5’ UAGAUGACCAAGCUUGGCAAGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 369 (5’ UUGCCAAGCUUGGUCAUCUA 3’); xcvi) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 116 (5’ UAGGUUGC AGUACUCCCACCUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 370 (5’ GGUGGGAGUACUGCAACCIJA 3’); xcvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 117 (5’ UCAUAGAGGACCAAGACUGACA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 371 (5’ UCAGUCUUGGUCCUCUAUGA 3’); xcviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 118 (5’ UGAGAAUGUGCCUCGAUAACUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 372 (5’ GUUAUCGAGGCACAUUCUCA 3’); xcix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 119 (5’ UAUUGACAUGUCCUUCCUGUGA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 373 (5’ ACAGGAAGGACAUGUCAAUA 3’); c) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 120 (5’ UAUAUUCUGUUGUCCUCUGAUG 3’), and a sense strand of nucleic aci d sequence according to SEQ ID NO: 374 (5’ UCAGAGGACAACAGAAUAUA 3’); ci) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 121 (5’ UGCCACCAUUUGGGUAGUAUUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 375 (5’ AUACUACCCAAAUGGUGGCA 3’); cii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 122 (5’ UGUAGUUUUCUGGGGUCCGACU 3’), and a sense strand of nucleic acid sequenceaccording to SEQ ID NO: 376 (5’ UCGGACCCCAGAAAACUACA 3’); ciii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 123 (5’ UCACUGGACAUUGUGUCAGGUU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 377 (5’ CCUGACACAAUGUCCAGUGA 3’); civ) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 124 (5’ UCCAGUGUGGUGUCAUAGAGGA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 378 (5’ CUCUAUGACACCACACUGGA 3’); cv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 125 (5’ UGGACACUUGAUUCUGUCACCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 379 (5’ GUGACAGAAUCAAGUGUCCA 3’); cvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 126 (5’ UGUUGCAAGGACACUUGAUUCU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 380 (5’ AAUCAAGUGUCCUUGCAACA 3’); cvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 127 (5’ UGCAAUCCUGGACCACAUGGCU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 381 (5’ CCAUGUGGUCCAGGAUUGCA 3’); cviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 128 (5’ UCAAGCUUGGCAGGUUCUUCCU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 382 (5’ GAAGAACCUGCCAAGCUUGA 3’); cix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 129 (5’ UGAUCCAUGGUGUAACACCAAG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 383 (5’ UGGUGUUACACCAUGGAUCA 3’); ex) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 130 (5’ UUAAUAUUCUGUUGUCCUCUGA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 384 (5’ AGAGGACAACAGAAUAUUAA 3’); cxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 131 (5’ UUAACACCAAGGGGCUGCCACA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 385 (5’ UGGCAGCCCCUUGGUGUU / AA 3’), cxii ) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 132 (5’ UCCAUCACCAUGGUAGCAAUCC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 386 (5’ AUUGCUACCAUGGUGAUGGA 3’); cxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 133 (5’ UCUCAGCAUCUGGAUUCCUGCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 387 (5’ CAGGAAUCCAGAUGCUGAGA3’); cxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 134 (5’ UCACAGGAUCUGGAUUCCUGCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 388 (5’ CAGGAAUCCAGAUCCUGUGA 3’), cxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 135 (5’ UGGCAGGUCCUUCCUGUGACAG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 389 (5’ GUCACAGGAAGGACCUGCCA 3’); cxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 136 (5’ UGACUGACAUGUCCUUCCUGUA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 390 (5’ CAGGAAGGACAUGUCAGUCA 3’); cxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 137 (5’ UAUUCCUGCAGUAGUUCCUGGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 391 (5’ CAGGAACUACUGCAGGAAUA 3’); cxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 138 (5’ UCAUUGUGUCAGGUUGCAGUAC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 392 (5’ ACUGCAACCUGACACAAUGA 3’); cxix) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 139 (5’ UCAAGCCAGCAUUUGGGUAGUA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 393 (5’ CUACCCAAAUGCUGGCUUGA 3’); cxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 140 (5’ UGACACUGGGAUCCAUGGUGUA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 394 (5’ CACCAUGGALTCCCAGUGLTCA 3’); cxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 141 (5’ UGACCAAGCUUGGCAAGUUCUU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 395 (5’ GAACUUGCCAAGCUUGGUCA 3’); cxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 142 (5’ UUCUGAGCAUUGUGUCAGGUUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 396 (5’ ACCUGACACAAUGCUCAGAA 3’); cxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 143 (5’ UGCAUUGUGUCAGGUUGCAGUA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 397 (5’ CUGCAACCUGACACAAUGCA 3’); cxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 144 (5’ LJIJUGCUC7AGIJUGGUGCUUGUUC 3’), and a sense strand of nucleic acid sequenceaccording to SEQ ID NO: 398 (5’ ACAAGCACCAACUGAGCAAA 3’); cxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 145 (5’ UCAUGGUAUAACACCAAGGGCG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 399 (5’ CCCUUGGUGUUAUACCAUGA 3’); cxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 146 (5’ UAACUCUGUCCAUAAUGGUAGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 400 (5’ UACCAUUAUGGACAGAGUUA 3’), cxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 147 (5’ UCAGGAUCUGGAUUUCGGCAGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 401 (5’ UGCCGAAAUCCAGAUCCUGA 3’); cxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 148 (5’ UGAAUCUCAGCAUCUGGAUUCC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 402 (5’ AAUCCAGAUGCUGAGAUUCA 3’); cxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 149 (5’ UUGGUGGAGAAUGUGCCUCGALJ 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 403 (5’ CGAGGCACAUUCUCCACCAA 3’), cxxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 150 (5’ UUCAGGCCAGCAUUUGGGUAGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 404 (5’ UACCCAAAUGCUGGCCUGAA 3’); cxxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 151 (5’ UGCAUCUGGAUUCCUGCAGUAG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 405 (5’ ACUGCAGGAAUCCAGAUGCA 3’); cxxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 152 (5’ UUGCCUCGAUAACUCUGUCCAU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 406 (5’ GGACAGAGUUAUCGAGGCAA 3’); cxxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 153 (5’ UAGUCCCUUCUGCGUCUGAGCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 407 (5’ CUCAGACGCAGAAGGGACUA 3’); cxxxi v) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 154 (5’ UGGAUUUCGGCAGUAGUUCUUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 408 (5’ AGAACUACUGCCGAAAUCCA 3’); cxxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 155 (5’ UGUGUCAUAGAUGACCAAGCUU 3’), and a sense strand of nucleic acid sequenceaccording to SEQ ID NO: 409 (5’ GCUUGGUCAUCUAUGACACA 3’); cxxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 156 (5’ UCUGACAUGUUCUUCCUGUGAU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 410 (5’ CACAGGAAGAACAUGUCAGA 3’); cxxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 157 (5’ UCUGGUCAGGCCAGCAULTJGGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 411 (5’ CAAAUGCUGGCCUGACCAGA 3’); cxxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 158 (5’L TGL Fl JUUCAGUl JC IGUGCl JUCl JUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 412 (5’ AGAAGCACCAACUGAAAACA 3’); cxxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 159 (5’ UCUCUGAUGCCAGUGUGGUGUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 413 (5’ CACCACACUGGCAUCAGAGA 3’); cxl) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 160 (5’ UAUCACCAUGGUAGCAAUCCUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 414 (5’ GGAUUGCUAGCAUGGUGAUA 3’); cxli) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 161 (5’ UGUGGAGAAUGAGCCUCGAUAA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 415 (5’ AUCGAGGCUCAUUCUCCACA 3’); cxlii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 162 (5' UUUCUGUUGUCCUCUGAUGCCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 416 (5’ GCAUCAGAGGACAACAGAAA 3’); cxliii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 163 (5’ UCUGUCACUGGACAUUGUGUCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 417 (5’ ACACAAUGUCCAGUGACAGA 3’); cxliv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 164 (5’ UUGCUUGUUCAGAAGGAGCCUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 418 (5’ GGCUCCUUCUGAACAAGCAA 3’); cxlv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 165 (5’ UCUUUGCUCAGUCGGUGCUUGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 419 (5' AAGCACCGACUGAGCAAAGA 3’); cxlvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 166 (5’UCUGUUGUCCUCUGAUGCCAGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 420 (5’ UGGCAUCAGAGGACAACAGA 3Q; cxlvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 167 (5’ UCCAAGCUUGGCAAGUUCUUCC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 421 (5’ AAGAACUUGCCAAGCUUGGA 3’); cxlviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 168 (5’ UAUGGUAGCAAUCCUGGACCCC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 422 (5’ GGUCCAGGAUUGCUACCAUA 3’); cxlix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 169 (5’ UGUAUAACACCAAGGGCGAAUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 423 (5’ UUCGCCCUUGGUGUUAUACA 3’); cl) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 170 (5’ UGACACUGGGAUCCAUGGUAUA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 424 (5’ UACCAUGGAUCCCAGUGUCA 3’); cli) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 171 (5’ UCUIJCCUGUGACAGUGGUGGAG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 425 (5’ CCACCACUGUCACAGGAAGA 3’); clii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 172 (5’UUCCCACCLTGACACUGGGALTCC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 426 (5’ AUCCCAGUGUCAGGUGGGAA 3’); cliii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 173 (5’ UGCAUUUGGGUAGUUUUCUGGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 427 (5’ CAGAAAACUACCCAAAUGCA 3’); cliv) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 174 (5’ UGAUCAAGCCAGCAUUUGGGUA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 428 (5’ CCCAAAUGCUGGCUUGAUCA 3’); civ) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 175 (5’ UGUAGCACUCCUGCACCCCAGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 429 (5’ UGGGGUGCAGGAGUGCUACA 3’); clvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 176 (5’ UUUGGGUAGUUUUCUGGGGUCC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 430 (5’ ACCCCAGAAAACUACCCAAA 3’), clvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 177 (5’ UGUCUGAGCAUUGUGUCAGGUU 3’), and a sense strandof nucleic acid sequence according to SEQ ID NO: 431 (5’ CCUGACACAAUGCUCAGACA 3’); clviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 178 (5’ UGAUCCAIJGGUAUAACACCAAG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 432 (5’ UGGUGUUAUACCAUGGAUCA 3’); clix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 179 (5’ UACCUGACACUGGGAUCCAUGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 433 (5’ AUGGAUCCCAGUGUCAGGUA 3’); clx) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 180 (5’ UGUGCUUCUUCAGAAGAAGCCU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 434 (5’ GCUUCUUCUGAAGAAGCACA 3’); cixi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 181 (5’ UUUUUCUGGGGUCCGACUAUGC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 435 (5’ AUAGUCGGACCCCAGAAAAA 3’); clxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 182 (5’ UGACAUUGGGAUCCAUGGUAUA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 436 (5’ UACCAUGGAUCCCAAUGUCA 3’); clxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 183 (5’ UUAUUCUGUUGUCCUCUGAUGC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 437 (5’ AUCAGAGGACAACAGAAUAA 3' ); clxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 184 (5’ UGACCACCGUGGGAGUUGUGAG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 438 (5’ CACAACUCCCACGGUGGUCA 3’); clxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 185 (5’UCUUGUUCGGAAGG AGCCUCUA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 439 (5’ GAGGCUCCUUCCGAACAAGA 3’); clxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 186 (5’ UGGACAUUGUGUCAGGUUGCAG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 440 (5’ GCAACCUGACACAAUGUCCA 3’); clxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 187 (5’ UALTAAGGGGCUGCCACAGGALTC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 441 (5’ UCCUGUGGCAGCCCCUUAUA 3’); clxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 188 (5’UGCUUGGCAGGUCCUUCCUGUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 442 (5’ CAGGAAGGACCUGCCAAGCA 3’); clxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 189 (5’ UCUGCCACAGGAUCUGGAUUCC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 443 (5’ AAUCCAGAUCCUGUGGCAGA 3’); clxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 190 (5’ UUCAAGCCAGCAUUUGGGUAGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 444 (5’ UACCCAAAUGCUGGCUUGAA 3’); clxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 191 (5’ UUGCCUUGAUAACUCUGUCCAU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 445 (5’ GGACAGAGUUAUCAAGGCAA 3’); clxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 192 (5’ UCCCCAGGCCUUUGCUCAGUCG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 446 (5’ ACUGAGCAAAGGCCUGGGGA 3’); clxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 193 (5’ UCGACUAUGCUGGUGUGGUGUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 447 (5’ CACCACACCAGCAUAGUCGA 3’); clxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 194 (5’ UGGGCGAAUCUCAGCAUCUGGA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 448 (5’ CAGAUGCUGAGAUUCGCCCA 3’); clxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 195 (5’ UGCCUUUGCUCAGUUGGUGCUU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 449 (5’ GCACCAACUGAGCAAAGGCA 3’); clxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 196 (5’ UUAUGCUGGUGUGGUGUCAU AG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 450 (5’ AUGACACCACACCAGCAUAA 3’); clxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 197 (5’ UUUUUCAGUUGGUGCUUCUUCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 451 (5’ AAGAAGCACCAACUGAAAAA 3’); clxxviii) an anti-sense strand of nucleic acid sequence according to SEQ I D NO: 198 (5’ UGAGCCUCUAGGCUUGGAACCG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 452 (5’ GUUCCAAGCCUAGAGGCUCA 3’); clxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 199 (5’ UCUGAGCAUCGCGUCAGGUUGC3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 453 (5’ AACCUGACGCGAUGCUCAGA 3’); clxxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 200 (5’ UAUGACCAAGCUUGGCAAGUUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 454 (5’ ACUUGCCAAGCUUGGUCAUA 3’); clxxxi) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 201 (5’ UUGUCCUCUGAUGCCAGUGUGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 455 (5’ ACACUGGCAUCAGAGGACAA 3’); clxxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 202 (5’ UGUUCCUGGUCAGGCCAGCAUU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 456 (5’ UGCUGGCCUGACCAGGAACA 3’); clxxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 203 (5’ UCUGGGAUCCAUGGUAUAACAC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 457 (5’ GUUAUACCAUGGAUCCCAGA 3’); clxxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 204 (5’ UCCAGGCCUUUGCUCAGUUGGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 458 (5’ CAACUGAGCAAAGGCCUGGA 3’); clxxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 205 (5’ UGUUGCAGUACUCCCACCUGAU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 459 (5’ CAGGUGGGAGUACUGCAACA 3’); clxxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 206 (5’ UGGAGAAUGUGCCUCGAUAACU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 460 (5’ UUAUCGAGGCACAIJUCUCCA 3’); clxxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 207 (5’ UCUGGACCCCGGGGCUUUGCUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 461 (5’ GCAAAGCCCCGGGGUCCAGA 3’); clxxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 208 (5’ UCACAUGGCUUUGCUCAGGUGC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 462 (5’ ACCUGAGCAAAGCCAUGUGA 3’), clxxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 209 (5’ UCUGCAUCUGAGCAUCGUGUCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 463 (5’ ACACGAUGCUCAGAUGCAGA 3’); cxc) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 210 (5’ UUGACCAAGAUUGACAUGUCCU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 464 (5’ GACAUGUCAAUCUUGGUCAA3’); cxci) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 211 (5’ UGGGGCUGCCACAGGAUCUGGA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 465 (5’ CAGAUCCUGUGGCAGCCCCA 3’); cxcii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 212 (5’ UACCGUGGGAGUUGUGAGGAGA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 466 (5’ UCCUCACAACUCCCACGGUA 3’); cxciii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 213 (5’ UCAGAAGGAGCCUCUAGGCUUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 467 (5’ AGCCUAGAGGCUCCUUCUGA 3’); cxciv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 214 (5’ UUCCUGCAGUAGUUCAUUGUCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 468 (5’ ACAAUGAACUACUGCAGGAA 3’); cxcv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 215 (5’UGG ACACUUGAUUCUGUCACUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 469 (5’ GUGACAGAAUCAAGUGUCCA 3’); cxcvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 216 (5’ UGGUCCUUCCUGUGACAGUGGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 470 (5’ CACUGUCACAGGAAGGACCA 3' ): cxcvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 217 (5’ UGUGUCAUAGAGGACCAAGACU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 471 (5’ UCUUGGUCCUCUAUGACACA 3’); cxcviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 218 (5’ UCCUUCUGCGUCUGAGCAUUGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 472 (5’ AAUGCUCAGACGCAGAAGGA 3’); cxcix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 219 (5’ UGGAUUCCUGCAGUAGUUCAUU 3’), and a sense strand of nucleic acid sequence according to SEQ I D NO: 473 (5’ UGAACUACUGCAGGAAUCCA 3’); cc) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 220 (5’ UGGUAGCAAUCCUGGACCACAU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 474 (5’ GUGGUCCAGGAUUGCUACCA 3’); cci) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 221 (5’ UUGGUAGCACUCCUGCACCCCA 3’), and a sense strand of nucleic acid sequence accordingto SEQ ID NO: 475 (5’ GGGUGCAGGAGUGCUACCAA 3’); ccii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 222 (5’ UCUGGUGUGGUGUCAUAGAUGA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 476 (5’AUCU AUG AC ACC AC ACC AG A 3’); cciii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 223 (5’ UGUCUCUAGGACACCUGA.UUCU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 477 (5’ AAUCAGGUGUCCUAGAGACA 3’); cciv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 224 (5’ UCCAUGGUAGCAAUCCUGGACC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 478 (5’ UCCAGGAUUGCUACCAUGGA 3’); ccv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 225 (5’ UGACCACAUGGCUUUGCUCAGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 479 (5’ UGAGCAAAGCCAUGUGGUCA 3’); ccvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 226 (5’ UAUCUGGAUUUCGGCAGUAGUU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 480 (5’ CUACUGCCGAAAUCCAGAUA 3’); ccvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 227 (5’ UCACCCCAGGCCUUUGCUCAGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 481 (5’ UGAGCAAAGGCCUGGGGUGA 3’); ccviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 228 (5’ UUGCACCCCAGGCCUUUGCUCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 482 (5’ AGCAAAGGCCUGGGGUGCAA 3’); ccix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 229 (5’ UUGGAUGACCA AGAUUGAC AUG 3 ’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 483 (5’ UGUCAAUCUUGGUCAUCCAA 3’); ccx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 230 (5’ UCUGUUUUCAGUUGGUGCUUCU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 484 (5’ AAGCACCAACUGAAAACAGA 3’); ccxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 231 (5’ UCUGUACCCCGGGGGUUUCCUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 485 (5’ GGAAACCCCCGGGGUACAGA 3’); ccxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 232 (5’ UGGGUAGUUUUCUGGGGUCCUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 486 (5’ GGACCCCAGAAAACUACCCA 3’); ccxiii) an anti-sense strand of nucleic acid sequenceaccording to SEQ ID NO: 233 (5’ UGGUGUGGUGUCAUGGAUGACC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 487 (5’ UCAUCCAUGACACCACACCA 3’); ccxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 234 (5’ LTJGUACCCCGGGGGUUUCCUCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 488 (5’ AGGAAACCCCCGGGGUACAA 3’); ccxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 235 (5’ UCCAAGGGCGAAUCUCAGCAUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 489 (5’ UGCUGAGAUUCGCCCUUGGA 3’); ccxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 236 (5’ UUGUGGUGLTCALTAGAUGACCAA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 490 (5’ GGUCAUCUAUGACACCACAA 3’); ccxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 237 (5’ UUUGGGAUCCAUGGUAUAACAC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 491 (5’ GUUAUACCAUGGAUCCCAAA 3’); ccxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 238 (5’ UAGGCCUUUGCUCAGUCGGUGC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 492 (5’ ACCGACUGAGCAAAGGCCUA 3’); ccxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 239 (5’ UGGAUCUGGAUUCCUGCAGUAG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 493 (5’ ACUGCAGGAAUCCAGAUCCA 3’); ccxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 240 (5’ UCUGGGAUCCAUGGUGUAACAC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 494 (5’ GUUACACCAUGGAUCCCAGA 3’); ccxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 241 (5’ UUUGGUGCUUCUUCAGAAGGAA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 495 (5’ CCUUCUGAAGAAGCACCAAA 3’); ccxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 242 (5’ UCUGUCCAUAAUGGUAGUAGCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 496 (5’ CUACUACCAUUAUGGACAGA 3’); ccxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 243 (5’ UCAUAGAUGACCAAGCUUGGCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 497 (5’ CCAAGCUUGGUCAUCUAUGA 3’); ccxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 244 (5’UGGGGUCCAUGGUAAAACACCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 498 (5’ GUGUUUUACCAUGGACCCCA 3’); ccxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 245 (5’ UCUCCUGCACCCCAGGCCUUUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 499 (5’ AAGGCCUGGGGUGCAGGAGA 3’); ccxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 246 (5’ UGCUUGGAACUGGGACCACCGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 500 (5’ GGUGGUCCCAGUUCCAAGCA 3’); ccxxvii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 247 (5’ UAGCACUCCUGCACCCCAGGCC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 501 (5’ CCUGGGGUGCAGGAGUGCUA 3’); ccxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 248 (5’ UAGUUUUCUGGGGUCCUCUGAU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 502 (5’ CAGAGGACCCCAGAAAACUA 3’); ccxxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 249 (5’UUCCCUUCUGUGUCUGAGCAUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 503 (5’ UGCUCAGACACAGAAGGGAA 3’); ccxxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 250 (5’ UCAUGGUGUAACACCAAGGGCG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 504 (5’ CCCUUGGUGUUACACCAUGA 3’), ccxxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 251 (5’ UGUGUAACACCAAGGGCGAAUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 505 (5’ UUCGCCCUUGGUGUUACACA 3’); ccxxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 252 (5’ UGG ACCACAUGGCUUUGCLTCAG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 506 (5’ GAGCAAAGCCAUGUGGUCCA 3’); ccxxxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 253 (5’ UGUCCUUCCUGUGACAGUGGUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 507 (5’ CCACUGUCACAGGAAGGACA 3’); ccxxxiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 254 (5’ UGUUCCUGGUCAGGCCACCAUU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 508 (5’ UGGUGGCCUGACCAGGAACA 3’); ccxxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 255 (5’ UAUAGAUGACCAAGCUUGGCAA 3’), and a sense strand of nucleic acid sequenceaccording to SEQ ID NO: 509 (5’ GCC / \AGCUUGGUCAUCUAUA 3’); ccxxxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 256 (5’ UCGUGGUAGCACUCCUGCACCC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 510 (5’ GUGCAGGAGUGCUACCACGA 3’); ccxxxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 257 (5’ UUUCGGAAGGAGCCUCUAGGCU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 511 (5’ CCUAGAGGCUCCUUCCGAAA 3’); ccxxxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 258 (5’ UCACAGGGCUUUUCUCAGGUGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 512 (5’ ACCUGAGAAAAGCCCUGUGA 3’); ccxxxix) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 259 (5’ UUAUAACACCAAGGGGCUGCCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 513 (5’ GCAGCCCCUUGGUGUUAUAA 3’), ccxl) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 260 (5’ UAUUUGGGUAGUUUUCUGGGGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 514 (5’ CCCAGAAAACUACCCAAAUA 3’); ccxli) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 261 (5’ UGGUGCUUGUUCGGAAGGAGCC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 515 (5’ CUCCUUCCGAACAAGCACCA 3’); ccxlii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 262 (5’ UCUCUAGGACACCUGAUUCUGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 516 (5’ AGAAUCAGGUGUCCUAGAGA 3’); ccxliii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 263 (5’ UGCCAGCAUUUGGGUAGUUUUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 517 (5’ AAACUACCCAAAUGCLJGGCA 3’), ccxliv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 264 (5’ UAUCUGGAUUCCUGCAGUAGUU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 518 (5’ CUACUGCAGGAAUCCAGAUA 3’); ccxlv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 265 (5’ UGAAGGAGCCUCUAGGCUUGGA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 519 (5’ CAAGCCUAGAGGCUCCUUCA 3’), ccxlvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 266 (5’UCAAGAUUGACAUGUCCUUCCU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 520 (5’ GAAGGACAUGUCAAUCUUGA 3’); ccxlvii) an anti-sense strand ofnucleic acid sequence according to SEQ ID NO: 267 (5’ UUUCCUGUGACAGUGGUGGAGA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 521 (5’ UCCACCACUGUCACAGGAAA 3’); ccxlviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 268 (5’ UGUCAUGGAUGACCAAGAUUGA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 522 (5’ AAUCUUGGUCAUCCAUGACA 3’); ccxlix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 269 (5’ UCAAUGCUUCCAGGACAUUUCU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 523 (5’ AAAUGUCCUGGAAGCAUUGA 3’); ccl) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 270 (5’ UGGUCCGACUAUGCUGGUGUGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 524 (5’ ACACCAGCAUAGUCGGACCA 3’); ccli) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 271 (5’ UCUACAAUGCUUCCAGGACAUU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 525 (5’ UGUCCUGGAAGCAUUGUAGA 3’); cclii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 272 (5’ UGAUGCCAGUGUGGUGUCAUAG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 526 (5’ AUGACACCACACUGGCAUCA 3’); ccliii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 273 (5’ UUCCAUGGUAAAACACCAAGGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 527 (5’ CUUGGUGUUUUACCAUGGAA 3’); ccliv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 274 (5’ UUUCUGCAUCUGAGCAUCGUGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 528 (5’ ACGAUGCUCAGAUGCAGAAA 3’); cclv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 275 (5’ UAUCCUGGACCACAUGGCUUUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 529 (5’ AAGCCAUGUGGUCCAGGAUA 3’); cclvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 276 (5’ UCGCGUCAGGUUGCAGUACUCC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 530 (5’ AGUACUGCAACCUGACGCGA 3’), cclvii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 277 (5’ UCUGGAUUCCUGCAGUAGUUCC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 531 (5’ AACUACUGCAGGAAUCCAGA 3’); cclviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 278 (5’UGCAUCGCGUCAGGUUGCAGUA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 532 (5’ CUGCAACCUGACGCGAUGCA 3’); cclix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 279 (5’ UUUCUGGGGUCCUCUGAUGCCG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 533 (5’ GCAUCAGAGGACCCCAGAAA 3’); cclx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 280 (5’ UGACACCUGAUUCUGUUUCUGA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 534 (5’ AGAAACAGAAUCAGGUGUCA 3’); cclxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 281 (5’ UACAGUCCCUUCUGUGUCUGAG 3Q, and a sense strand of nucleic acid sequence according to SEQ ID NO: 535 (5’ CAGACACAGAAGGGACUGUA 3’); cclxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 282 (5’ UUGUUCAGAAGGAGCCUCUAGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 536 (5’ UAGAGGCUCCUUCUGAACAA 3’); cclxiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 283 (5’ UCACUCCUGCACCCCAGGCCUU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 537 (5’ GGCCUGGGGUGCAGGAGUGA 3’); cclxiv) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 284 (5’ UAUAGAUGACCAAGAUUGACAG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 538 (5’ GUCAAUCUUGGUCAUCUAUA 3’); cclxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 285 (5’ UUGUGACAGUGGUGGAGAAUGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 539 (5’ AUUCUCCACCACUGUCACAA 3’); cclxvi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 286 (5’ UUGUCAGGUUGCAGUACUCCCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 540 (5’ GGAGUACUGCAACCUGACAA 3’); cclxvii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 287 (5’ UGAUUCUGUCACUGGACAUUGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 541 (5’ AAUGUCCAGUGACAGAAUCA 3’); cclxviii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 288 (5’ UUCCUGGACCACAUGGCUUUGC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 542 (5’ AAAGCCAUGUGGUCCAGGAA 3’); cclxix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 289 (5’ LTJUUAGCAAGGCAAUAUCUGCU 3’), and a sense strand of nucleic acid sequenceaccording to SEQ ID NO: 543 (5’ CAGAUAUUGC'CUUGCU / \A / \A 3’), cclxx) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 290 (5’ UCCUGCACCCCAGGCCUUUGCU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 544 (5’ CAAAGGCCUGGGGUGCAGGA 3’); cclxxi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 291 (5’ UGACCACAGUCCCUUCUGUGUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 545 (5’ CACAGAAGGGACUGUGGUCA 3’); cclxxii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 292 (5’ UUUCUGUGUCUGAGCAUCGCGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 546 (5’ GCGAUGCUCAGACACAGAAA 3’); cclxxi ii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 293 (5’ UUCAGGUUGCAGUACUCCCACC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 547 (5’ UGGGAGUACUGCAACCUGAA 3’); cclxxi v) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 294 (5’ UGUGUCUGAGCAUCGCGUCAGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 548 (5’ UGACGCGAUGCUCAGACACA 3’); or cclxxv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 295 (5’ UUGGUAAAACACCAAGGGCCUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 549 (5’ GGCCCUUGGUGUUUUACCAA 3’).

[0133] The present disclosure provides an isolated oligonucleotide comprising a sense and an antisense strand, wherein the sense strand comprises a nucleotide sequence that is substantially identical to a region between any one of the nucleotide positions selected from: a) 144 to 177; b) 206 to 229; c) 248 to 269; d) 2751 to 2773; e) 2947 to 2972; f) 2991 to 3012; g) 3275 to 3300; h) 3463 to 3484, i) 3570 to 3591; j) 3931 to 3952, and k) 4923 to 4944, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: I, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double stranded region.

[0134] The present disclosure provides an isolated oligonucleotide comprising a sense and an antisense strand, wherein the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising 19-25 nucleotides between any one of the nucleotide positions selected from: a) 144 to 177; b) 206 to 229; c) 248 to 269; d) 2751 to 2773; e) 2947 to 2972; f) 2991 to 3012; g) 3275 to 3300; h) 3463to 3484; i) 3570 to 3591; j) 3931 to 3952; and k) 4923 to 4944, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0135] The present disclosure provides an isolated oligonucleotide comprising a sense and an antisense strand, wherein the sense strand comprises a nucleotide sequence that is identical to a region comprising 19-25 nucleotides between any one of the nucleotide positions selected from: a) 144 to 177; b) 206 to 229; c) 248 to 269; d) 2751 to 2773; e) 2947 to 2972; f) 2991 to 3012; g) 3275 to 3300; h) 3463 to 3484; i) 3570 to 3591 ; j) 3931 to 3952; and k) 4923 to 4944, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0136] The present disclosure provides an isolated oligonucleotide comprising a sense and an antisense strand, wherein the sense strand comprises a nucleotide sequence that is substantially identical to a region between any one of the nucleotide positions selected from: a) 151 to 172; b) 248 to 269; c) 2947 to 2968; d) 2991 to 3012, e) 3463 to 3484; and f) 3931 to 3952, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0137] The present disclosure provides an isolated oligonucleotide comprising a sense and an antisense strand, wherein the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region between any one of the nucleotide positions selected from: a) 151 to 172; b) 248 to 269; c) 2947 to 2968; d) 2991 to 3012; e) 3463 to 3484; and f) 3931 to 3952, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0138] The present disclosure provides an isolated oligonucleotide comprising a sense and an antisense strand, wherein the sense strand comprises a nucleotide sequence that is identical to a region comprising the sequence between any one of the nucleotide positions selected from: a) 151 to 172; b) 248 to 269; c) 2947 to 2968; d) 2991 to 3012; e) 3463 to 3484, and t) 3931 to 3952, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0139] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a nucleotide sequence that is identical to a region between any one of the nucleotide positions selected from: a) 151 to 172; b) 248 to 269; c) 2947 to 2968; d) 2991 to 3012; e) 3463 to 3484; and f) 3931 to 3952, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1, the double stranded region comprises: i) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 2 (5’ UUCGAUAACUCUGUCCAUCACC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 550 (5’UGAUGGACAGAGUUAUCGAA 3’); ii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 3 (5’ LTAULHJGGGUAGUUUUCUGUGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 551 (5’ ACAGAAAACUACCCAAAUGA 3’); iii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 4 (5’ UUGGUGUCAUAGAUGACCAAGC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 23 (5’ UUGGUCAUCUAUGACACCAA 3’); iv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 5 (5’ UAAGCCAGCAUUUGGGUAGUAU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 24 (5’ ACUACCCAAAUGCUGGCUUA 3’); v) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 6 (5’ UAGACUGACAUGUCCUUCCUGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 25 (5’ AGGAAGGACALTGLTCAGUCUA 3’); or vi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 7 (5’ UAGUUGCAAGGACACUUGAUUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 26 (5’ AUCAAGUGUCX'UUGCAACUA 3’).

[0140] The present disclosure provides an isolated oligonucleotide comprising a sense and an antisense strand, wherein the sense strand comprises a sequence that is substantially identical to a region comprising the sequence between any one of the nucleotide positions selected from: a) 144 to 170; b) 206 to 229; c) 2751 to 2773; d) 2951 to 2972; e) 3275 to 3300; f) 3570 to 3591; and g) 4923 to 4944, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0141] The present disclosure provides an isolated oligonucleotide comprising a sense and an antisense strand, wherein the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising the sequence between any one of the nucleotide positions selected from: a) 144 to 170; b) 206 to 229; c) 2751 to 2773; d) 2951 to 2972; e) 3275 to 3300; f) 3570 to 3591 ; and g) 4923 to 4944, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1 .

[0142] The present disclosure provides an isolated oligonucleotide comprising a sense and an antisense strand, wherein the sense strand comprises a nucleotide sequence that is identical to a region comprising the sequence between any one of the nucleotide positions selected from: a) 144 to 170; b) 206 to 229, c) 2751 to 2773; d) 2951 to 2972; e) 3275 to 3300; f) 3570 to 3591;and g) 4923 to 4944, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0143] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a nucleotide sequence that is identical to a region comprising the sequence between any one of the nucleotide positions selected from : a) 144 to 170, b) 206 to 229; c) 2751 to 2773; d) 2951 to 2972; e) 3275 to 3300; f) 3570 to 3591; and g) 4923 to 4944, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1, the double stranded region comprises: i) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 8 (5’ UCGAUAACUCUGUCCAUCACCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 27 (5’ GUGAUGGACAGAGUUAUCGA 3’); ii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 9 (5’ UUAACUCUGUCCAUCACCAUGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 28 (5’ AUGGUGAUGGACAGAGUUAA 3’); iii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 10 (5’ UUGAGCAUUGUGUCAGGUUGCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 29 (5’ CAACCUGACACAAUGCUCAA 3’); iv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 11 (5’ UGAUAACUCUGUCCAUCACCAU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 30 (5’ GGUGAUGGACAGAGUUAUCA 3’); v) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 21 (5’ UCUCUGUCCAUCACCAUGGUAG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 40 (5’ ACCAUGGUGAUGGACAGAGA 3’); vi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 13 (5’ UUCAUAGAUGACCAAGCUUGGC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 32 (5’ CAAGCUUGGUCAUCUAUGAA 3’); vii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 14 (5’ UAUAACUCUGUCCAUCACCAUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 33 (5’ UGGUGAUGGACAGAGUUAUA 3’); viii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 15 (5’ UUGUCAUAGAUGACCAAGCUUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 34 (5’ AGCUUGGUCAUCUAUGACAA 3’); ix) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 16 (5’ UAAUGUGCCUCGAUAACUCUGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 35 (5’ AGAGUUAUCGAGGCACAUUA3’); x) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 17 (5’ UGAGCAUUGUGUCAGGUUGCAG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 36 (5’ GCAACCUG ACACAAUGCUCA 3’); xi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 18 (5’UGAUG ACCAAGCUUGGCAAGUU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 37 (5’ CUUGCCAAGCUUGGUCAUCA 3’); xii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 19 (5’ UACCAAGCUUGGCAAGUUCUUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 38 (5’ AGAACUUGCCAAGCUUGGUA 3’); or xiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 20 (5’ UAGUGUGGUGUCAUAGAUGACC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 39 (5’ LTCAUCUALTGACACCACACUA 3’).

[0144] The present disclosure provides an isolated oligonucleotide comprising a sense and an antisense strand, wherein sense strand comprises a sequence that is substantially identical to a region comprising the sequence between nucleotide positions 156 to 177, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1 .

[0145] The present disclosure provides an isolated oligonucleotide comprising a sense and an antisense strand, wherein sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising the sequence between nucleotide positions 156 to 177, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1.

[0146] The present disclosure provides an isolated oligonucleotide comprising a sense and an antisense strand, wherein the sense strand comprises a nucleotide sequence that is identical to a region comprising the sequence between nucleotide positions 156 to 177, from the 5’ end of a human LPA mRNA sequence according to SEQ ID NO: 1 .

[0147] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence that is identical to a region comprising the sequence between nucleotide positions 156 to 177, from the 5’ end of a LPA mRNA sequence according to SEQ ID NO: 1, and the double stranded region comprises: i) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 22 (5’ UGUGCCUCGAUAACUCUGUCCA 3’), and a sense strandI llof nucleic acid sequence according to SEQ ID NO: 41 (5’ GACAGAGUUAUCGAGGCACA

[0148] The present disclosure also provides an isoiated oligonucleotide comprising a sense strand and an antisense strand, wherein the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand form a double stranded region, wherein the double stranded region comprises: i) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 2 (5’ UUCGAUAACUCUGUCCAUCACC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 1102 (5’ UGAUGGACAGAGUUAUCGAA(X)n 3’); ii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 3 (5’ UCAUUUGGGUAGUUUUCUGUGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 1103 (5’ ACAGAAAACUACCCAAAUGA(X)n 3’); iii) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 4 (5’ UUGGUGUCAUAGAUGACCAAGC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 1104 (5’ UUGGUCAUCUAUGACACCAA(X)n 3’); iv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 5 (5’ UAAGCCAGCAUUUGGGUAGUAU 30, and a sense strand of nucleic acid sequence according to SEQ ID NO: 1 105 (5’ ACUACCCAAAUGCUGGCUUA(X)n 3’); v) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 6 (5’ UAGACUGACAUGUCCUUCCUGU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 1106 (5’ AGGAAGGACAUGUCAGUCUA(X)n 3’); vi) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 7 (5’ UAGUUGCAAGGACACUUGAUUC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 1107 (5’ AUCAAGUGUCCUUGCAACUA(X)n 3’); vii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 8 (5’ UCGAUAACUCUGUCCAUCACCA 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 1 108 (5’ GUGAUGGACAGAGUUAUCGA(X)n 3’); viii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 9 (5’ UUAACUCUGUCCAUCACCAUGG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 1109 (5’ AUGGUGAUGGACAGAGUUAA(X)n 3’); ix) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 10 (5’ UUGAGCAUUGUGUCAGGUUGCA 3’), and a sense strandof nucleic acid sequence according to SEQ ID NO: 1110 (5’CAACCUGACACAAUGCUCAA(X)n 3’); x) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 1 1 (5’ UGAUAACUCUGUCCAUCACCAU 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 1111 (5’GGUGAUGGACAGAGUUAUCA(X)n 3’); xi) an anti -sense strand of nucleic acid sequence according to SEQ ID NO: 12 (5’ UAUAACUCUGUCCAUUACCGUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 1112 (5’CGGUAAUGGACAGAGUUAUA(X)n 3’); xii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 13 (5’ UUCAUAGAUGACCAAGCUUGGC 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 1113 (5’CAAGCUUGGUCAUCUAUGAA(X)n 3’); xiii) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 14 (5’ UAU / AACUCUGUCCAUCACCAUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 1114 (5’UGGUGAUGGACAGAGUUAUA(X)n 3’); xiv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 15 (5’ UUGUCAUAGAUGACCAAGCUUG 3’), and a sense strand of nucleic acid sequence according to SEQ ID NO: 1115 (5’AGCUUGGUCAUCUAUGACAA(X)n 3’), xv) an anti-sense strand of nucleic acid sequence according to SEQ ID NO: 16 (5’ UAAUGUGCCUCGAUAACUCUGG 3’), an...

Claims

CLAIMSWhat is claimed is:

1. An isolated oligonucleotide comprising a sense strand selected from SEQ ID NOs: 2-22 and 42-295 and its corresponding antisense strand selected from SEQ ID NOs: 23-41 and 296- 551, as set forth in Table 2.

2. The isolated oligonucleotide of claim 1 , wherein the sense strand comprises a modified sequence of a sequence selected from SEQ ID NOs: 2-22 and 42-295 and its corresponding antisense strand selected from SEQ ID NOs: 23-41 and 296-551, as set forth in Table 2, or wherein the sense strand comprises a modified sequence of a sequence as set forth in SEQ ID NOs: 552-845, 1372-1378, 1383-1384, 1386-1387, and 1395-1396 and its corresponding antisense strand comprises a sequence selected from SEQ ID NOs: 573-1101 , 1379-1380, 1385, and 1388, as set forth in Table 6.

3. The isolated oligonucleotide of claim 1, wherein the sense strand comprises a sequence selected from SEQ ID NOs: 2-22 and its corresponding antisense strand comprises a sequence selected from 23-41 and 550-551, as set forth in Table 1.

4. The isolated oligonucleotide of claim 2, wherein the sense strand comprises a sequence selected from SEQ ID NOs: 2, 6, 16, 18, 552, 556, 568, 566 1377-1378, 1383-1384, 1386-1387, and 1395-1396 and its corresponding antisense strand selected from SEQ ID NOs: 575, 585, 587, 1100, 1379-1380, 1385, and 1388, as set forth in Table 3.

5. The isolated oligonucleotide of claim 2, wherein the sense strand comprises a sequence selected from SEQ ID NOs: 2, 6, 18, 552, 556, and 568, and its corresponding antisense strand selected from SEQ ID NOs: 575, 587, 1100, 1379-1380, and 1385, as set forth in Table 4.

6. The isolated oligonucleotide of claim 2, wherein the sense strand comprises a sequence selected from SEQ ID NOs: 18, 568 and 1383-1384, and its corresponding antisense strand selected from SEQ ID NOs: 587 and 1380, as set forth in Table 5.A vector encoding the isolated oligonucleotide of any one of claims 1-6.

8. A delivery system comprising the isolated oligonucleotide of any one of claims 1-6 or the vector of claim 7.

9. A pharmaceutical composition comprising at least one isolated oligonucleotide of any one of claims 1-6, the vector of claim 7, or the deliver}' system of claim 8, and a pharmaceutically acceptable carrier, diluent or excipient.

10. A kit comprising at least one isolated oligonucleotide of any one of claims 1-6, the vector of claim 7, the delivery system of claim 8, or the pharmaceutical composition of claim 9.

11. A method of inhibiting or downregulating the expression or level of human Lpta) in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of at least one i solated oligonucleotide of any one of claims 1-6, the vector of claim 7, the delivery' system of claim 8, or the pharmaceutical composition of claim 9.

12. A method of treating or preventing a disease or disorder associated with aberrant or increased expression or activity of human Lp(a) or a disease or disorder where human Lp(a) plays a role in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of at least one isolated oligonucleotide of any one of claims 1-6, the vector of claim 7, the delivery system of claim 8, or the pharmaceutical composition of claim 9.

Images