Lactic acid bacterium capable of highly expressing human type-iii collagen, and use thereof

Abstract

Disclosed in the present invention are a lactic acid bacterium capable of highly expressing human type-III collagen, and a preparation method therefor and the use thereof. By means of induction under a conventional culture medium and conventional culture conditions, the lactic acid bacterium obtained in the present invention can produce a large amount of human type-III collagen. Since the lactic acid bacterium is free of endotoxin and also contains many active ingredients beneficial to the human body, the present invention has important value regarding the promotion and application of collagen and the lactic acid bacterium.

Description

Lactic acid bacteria highly expressing human type III collagen and application thereof Technical Field

[0001] The invention belongs to the technical field of bioengineering, and particularly relates to a lactic acid bacterium highly expressing human type III collagen and an application thereof. Background Art

[0002] Collagen is an important protein component of the human body. Artificially prepared collagen has good biocompatibility, biodegradability and absorbability. It can promote the formation of new cells, wound healing and scar repair. It is widely used in the medical, beauty, cosmetics and health care industries and has huge market potential. Current collagen production methods mainly use animal tissue extraction, animal cell culture expression, and yeast or Escherichia coli heterologous expression. The process of extracting collagen from animal tissue includes three main steps: tissue dissolution, enzyme treatment, and purification. The expression of animal cells, yeast or Escherichia coli mainly includes five steps: cell or bacterial expansion culture, induced expression, cell or bacterial concentration and collection, lysis and extraction, and purification.

[0003] Collagen extracted from animal tissue may carry various viruses, so direct use of animal extracts on humans poses serious health risks. Animal cell culture is extremely expensive and time-consuming, making industrial production difficult. Escherichia coli is not an edible bacterium, and the endotoxins it contains pose health risks, making the purification process complex and costly. While edible bacteria such as Saccharomyces cerevisiae are safe, their nutritional profile differs from that of lactic acid bacteria, lacking the various hydrolytic enzymes unique to lactic acid bacteria.

[0004] Summary of the Invention

[0005] In view of the shortcomings of the existing technology, the present invention provides a lactic acid bacterium capable of highly expressing human type III collagen fragments, so as to obtain an extract rich in human type III collagen fragments and lactic acid bacteria nutrients.

[0006] One aspect of the present invention provides an isolated nucleic acid molecule having the nucleotide sequence shown in SEQ ID NO: 2, or a sequence having greater than 80%, greater than 85%, greater than 90%, greater than 92%, greater than 95%, greater than 96%, greater than 97%, greater than 98%, greater than 99%, or greater than 99.5% homology to the nucleotide sequence shown in SEQ ID NO: 2.

[0007] In some embodiments, the nucleic acid molecule encodes human type III collagen, and the human type III collagen has the amino acid sequence shown in SEQ ID NO: 1 or the amino acid sequence shown in SEQ ID NO: 1 with one or more amino acids added, deleted, replaced or modified.

[0008] Another aspect of the present invention provides a recombinant expression vector containing the nucleic acid molecule of the present invention.

[0009] Another aspect of the present invention provides a host cell, wherein the host cell contains the nucleic acid molecule or the recombinant expression vector of the present invention.

[0010] In some embodiments, the host cell is a lactic acid bacterium.

[0011] In some embodiments, the host cell is Lactococcus lactis NZ3900 strain.

[0012] In some embodiments, the host cell can express type III collagen, and the type III collagen has the amino acid sequence shown in SEQ ID NO: 1 or the amino acid sequence shown in SEQ ID NO: 1 with one or more amino acids added, deleted, replaced or modified.

[0013] Another aspect of the present invention provides a primer pair for PCR amplification of the nucleic acid molecule of the present invention, the primer pair comprising:

[0014] Forward primer: CTAGCCATGGGCGAAAATCTTTATTTTCAAGGAGGA (SEQ ID NO: 3),

[0015] Reverse primer: CAAGAAGCTTAACTTCGCCCTTGGCACC (SEQ ID NO: 4).

[0016] Another aspect of the present invention provides use of the nucleic acid molecule, the recombinant expression vector, the host cell, and the primer pair of the present invention in producing human type III collagen.

[0017] Another aspect of the present invention provides a method for preparing human type III collagen, the method comprising the following steps:

[0018] 1) introducing the nucleic acid molecule of the present invention into a plasmid to obtain a recombinant plasmid;

[0019] 2) transforming the recombinant plasmid into host cells, culturing and inducing expression, and purifying to obtain human type III collagen.

[0020] In some embodiments, in step 1), the nucleic acid molecule further comprises a nucleotide sequence encoding a tag.

[0021] In some embodiments, the nucleic acid molecule comprises a nucleotide sequence encoding at least one His tag, for example, comprises six His tags.

[0022] In some embodiments, the host cell is a lactic acid bacterium.

[0023] In some embodiments, the host cell is Lactococcus lactis NZ3900 strain.

[0024] In some embodiments, the plasmid is pNZ8149 plasmid.

[0025] In some embodiments, the induction is performed using nisin. Preferably, the concentration of nisin is 5-20 μg / L, preferably 8-12 μg / L, and more preferably 10 μg / L.

[0026] In some embodiments, the induction temperature is 20-35°C, preferably 25-32°C, and more preferably 28-30°C.

[0027] In some embodiments, the induction time is 5-20 hours, preferably 5-15 hours, and more preferably 8-12 hours.

[0028] In some embodiments, the culture is performed using a conventional culture medium used in the art for culturing lactic acid bacteria, such as M17 culture medium.

[0029] In some embodiments, the culture temperature is 30-40°C, preferably 35-40°C, more preferably 37°C.

[0030] In some embodiments, the culture time is 5-30 hours, preferably 10-20 hours, and more preferably 12-16 hours.

[0031] Another aspect of the present invention provides the use of type III collagen obtained by the preparation method of the present invention in the preparation of medicines, cosmetics or health products for promoting new cell formation, wound healing and scar repair.

[0032] The lactic acid bacteria provided by the present invention can be induced to produce a large amount of human type III collagen under conventional culture medium and conditions. Since the lactic acid bacteria do not contain endotoxins and contain many active ingredients beneficial to the human body, they are of great value for the promotion and application of collagen and lactic acid bacteria. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] FIG1 shows the protein gel electrophoresis detection results obtained in step 5 of Example 1 of the present invention.

[0034] FIG2 shows the immunoblotting results obtained in step 6 of Example 1 of the present invention. DETAILED DESCRIPTION

[0035] The following examples illustrate the present invention, but the present invention is not limited to these examples. Modifications to the specific embodiments of the present invention or equivalent replacements of some technical features without departing from the spirit of the present invention should be included in the scope of the technical solution claimed in the present invention.

[0036] As used herein with respect to amino acids, the term "substitution" refers to the replacement of at least one amino acid residue in an amino acid sequence with another, different, "replacement" amino acid residue. As used herein with respect to amino acids, the term "insertion" refers to the incorporation of at least one additional amino acid into an amino acid sequence. Although indels typically consist of the insertion of one or two amino acid residues, larger "peptide indels" can also be prepared, for example, insertions of about three to five, or even up to about ten, fifteen, or twenty amino acid residues. As disclosed above, the inserted residues can be naturally occurring or non-naturally occurring. As used herein with respect to amino acids, the term "deletion" refers to the removal of at least one amino acid residue from an amino acid sequence.

[0037] The enamel matrix proteins of the present invention may comprise conservative amino acid substitutions at one or more amino acid residues, for example, at essential or non-essential amino acid residues. A "conservative amino acid substitution" is a substitution of an amino acid residue with an amino acid residue having a similar side chain. Families of amino acid residues with similar side chains have been defined in the art and include basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Therefore, in the present invention, an essential or non-essential amino acid residue in an enamel matrix protein is preferably substituted with another amino acid residue from the same side chain family.

[0038] "Percent sequence identity" or "percent identity" between two polynucleotide or polypeptide sequences refers to the number of identical matched positions shared by the sequences over the comparison window, taking into account additions or deletions (i.e., gaps) that must be introduced for optimal alignment of the two sequences. A matched position is any position where the same nucleotide or amino acid is present in both the target sequence and the reference sequence. Since a gap is not a nucleotide or amino acid, gaps present in the target sequence are not counted. Similarly, since target sequence nucleotides or amino acids are counted and nucleotides or amino acids from the reference sequence are not counted, gaps present in the reference sequence are not counted.

[0039] Percentage sequence identity can be calculated by the following process: determine that the number of positions where identical amino acid residues or nucleic acid bases occur in both sequences, to obtain the number of matched positions, the number of matched positions divided by the total number of positions in the comparison window, and multiply the result by 100, to obtain percent sequence identity. The determination of percent sequence identity between the comparison of a sequence and two sequences can be accomplished using software that is easy to use online and download. Suitable software programs can be obtained from various sources for the comparison of protein and nucleotide sequences. A suitable program for determining percent sequence identity is bl2seq, which is a part for the BLAST suite of programs that can be obtained from the BLAST website (blast.ncbi.nlm.nih.gov) of the National Center for Biotechnology Information of the U.S. Government. Bl2seq uses BLASTN or BLASTP algorithms to compare between two sequences. BLASTN is used for comparing nucleic acid sequences, and BLASTP is used for comparing amino acid sequences. Other suitable programs are, for example, Needle, Stretcher, Water or Matcher, part of the EMBOSS suite of bioinformatics programs and also available from the European Bioinformatics Institute (EBI) at www.ebi.ac.uk / Tools / psa.

[0040] The present invention provides a method for preparing lactic acid bacteria that highly express human type III collagen. First, the full sequence of human type III collagen (protein retrieval number: P02461) is downloaded from the NCBI database, and a partial sequence is selected. A tag sequence for easy detection is added to the end for expression construction. A DNA sequence for collagen expression is designed according to the codon preference of lactic acid bacteria, and a biotechnology company is commissioned to synthesize it. The synthesized sequence is inserted into the multiple cloning site of a lactic acid bacteria expression vector through restriction enzyme digestion and ligation reaction to construct a recombinant vector. The recombinant vector is introduced into a lactic acid bacteria expression strain, and after obtaining a recombinant strain, liquid culture and induction expression are performed. The bacteria are collected, lysed, and then protein gel electrophoresis and immunoblotting (western blot) are performed to confirm the high expression of the target protein.

[0041] In this example, no specific techniques or conditions are specified, and the operations were performed according to conventional techniques and instrument specifications in the art. All reagents or instruments used without specifying the manufacturer are conventional products that can be purchased commercially.

[0042] Example 1 Preparation Method of Lactic Acid Bacteria Highly Expressing Human Type III Collagen

[0043] Step 1: Obtain the complete sequence of human type III collagen from the NCBI database (protein accession number: P02461). Select a portion of the sequence for expression constructs. A His tag was added to the end of the sequence for detection. The specific sequence is as follows:

[0044] Step 2: Design a DNA sequence for collagen expression (SEQ ID NO: 2) based on the codon preference of lactic acid bacteria. The specific sequence is as follows:

[0045] Step 3: Primer design, as shown in Table 1 below, the primer sequence contains two restriction enzyme sites: NcoI (CCATGG) and HindIII (AAGCTT).

[0046] Table 1

[0047] Step 4: Using the DNA sequence fragment synthesized in step 2 as a template, PCR amplification was performed with the primers ColF and ColR designed in step 3 to obtain a high-concentration DNA fragment. The DNA fragment and the pNZ8149 plasmid (purchased from Changsha Abiwei Biotechnology Co., Ltd.) were then double-digested with restriction endonucleases NcoI and HindIII, respectively. The DNA fragment and the plasmid were ligated with T4 ligase to obtain a recombinant plasmid pNZ8149-ColⅢ. The recombinant plasmid was then transferred into lactic acid bacteria Lactococcus lactis NZ3900 (purchased from Changsha Abiwei Biotechnology Co., Ltd.) by electroporation to obtain the type III collagen expression strain NZ3900-ColⅢ.

[0048] Step 5: Strain NZ3900-ColⅢ was cultured in M17 medium at 37°C with shaking (100 rpm) for 14 hours. Expression was induced with 10 μg / L nisin (30°C for 10 hours). The cells were harvested, lysed by boiling, and then analyzed by protein gel electrophoresis. The results, as shown in Figure 1, showed high expression of the target protein near the 12 kDa position. The composition of M17 medium is as follows: 5 g / L soytone, 2.5 g / L peptone, 2.5 g / L casein peptone / enzymatic casein hydrolyzate, 2.5 g / L yeast extract, 5 g / L beef extract, 5 g / L lactose, 0.5 g / L sodium ascorbate, 19 g / L sodium β-glycerophosphate, and 0.25 g / L magnesium sulfate.

[0049] Step 6: Western blot detection was performed on the target protein after protein gel electrophoresis. The results are shown in FIG2 , indicating that a significant target band can be detected using the histidine tag antibody.

[0050] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not limitations on the implementation methods of the present invention. For ordinary technicians in the relevant field, other different forms of changes or modifications can be made based on the above description. It is impossible to list all the implementation methods here. All obvious changes or modifications derived from the technical solution of the present invention are still within the scope of protection of the present invention.

Claims

1. A isolated nucleic acid molecule having the nucleotide sequence shown in SEQ ID NO:2, or a sequence having more than 80% homology with the nucleotide sequence shown in SEQ ID NO:

2.

2. The nucleic acid molecule according to claim 1, wherein, the nucleic acid molecule encodes human type III collagen, and the human type III collagen has the amino acid sequence shown in SEQ ID NO:1 or an amino acid sequence obtained by adding, deleting, substituting or modifying one or more amino acids in the amino acid sequence shown in SEQ ID NO:

1.

3. A recombinant expression vector containing the nucleic acid molecule according to claim 1 or 2.

4. A host cell, wherein, the host cell contains the nucleic acid molecule according to claim 1 or 2 or the recombinant expression vector according to claim 3.

5. The host cell according to claim 4, wherein, the host cell is a lactic acid bacterium, preferably Lactococcus lactis NZ3900 strain, preferably, the host cell can express type III collagen, and the type III collagen has the amino acid sequence shown in SEQ ID NO:1 or an amino acid sequence obtained by adding, deleting, substituting or modifying one or more amino acids in the amino acid sequence shown in SEQ ID NO:

1.

6. A primer pair for PCR amplification of the nucleic acid molecule according to claim 1 or 2, the primer pair comprises: Forward primer: CTAGCCATGGGCGAAAATCTTTATTTTCAAGGAGGA (SEQ ID NO:3), Reverse primer: CAAGAAGCTTAACTTCGCCCTTGGCACC (SEQ ID NO:4).

7. Use of the nucleic acid molecule according to claim 1 or 2, the recombinant expression vector according to claim 3, the host cell according to claim 4 or 5, and the primer pair according to claim 6 in the production of human type III collagen.

8. A method for preparing human type III collagen, wherein, the method comprises the following steps: 1) Introducing the nucleic acid molecule according to claim 1 into a plasmid to obtain a recombinant plasmid; 2) Transforming the recombinant plasmid into a host cell, culturing and inducing expression, and purifying to obtain human type III collagen.

9. The method according to claim 7, wherein, the nucleic acid molecule further comprises a nucleotide sequence encoding a tag, preferably a nucleotide sequence encoding at least one His tag; and / or the host cell is a lactic acid bacterium, preferably Lactococcus lactis NZ3900 strain; and / or the plasmid is pNZ8149 plasmid; and / or the induction is carried out using nisin.

10. Use of the type III collagen obtained by the preparation method according to claim 8 in the preparation of drugs, cosmetics or health products for promoting new cell formation, wound healing and scar repair.

Images