Recombinant botulinum toxin and preparation method therefor

By adding two labels to the beginning and end of the target nucleic acid fragment of Botox toxin and performing two-step purification, the problems of complex preparation process and cumbersome purification steps in the prior art are solved, and the rapid, efficient preparation and high-purity product of Botox toxin are achieved.

WO2025123329A1PCT designated stage expired Publication Date: 2025-06-19LANZHOU HENGLI BIOLOGICAL PROD CO LTD
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2023/139132
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2023-12-15
Publication Date
2025-06-19

AI Technical Summary

Technical Problem

In the prior art, the preparation process of botulinum toxin is complex, requiring a strict anaerobic environment and specialized equipment, and the expressed proteins require multiple steps to purification, which increases the risk and cost of contamination.

Method used

By adding two tags to the beginning and end of the target nucleic acid fragment and performing two-step purification, the purity and yield of the target protein are significantly improved, the purification process is simplified, and the experimental and production costs are reduced.

Benefits of technology

It realizes rapid and efficient preparation of botulinum toxin, reduces the risk of unexpected contamination, improves the purity and activity of proteins, and is suitable for laboratory and industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2023139132_19062025_PF_FP_ABST
    Figure CN2023139132_19062025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention provides a recombinant botulinum toxin and a preparation method therefor. A nucleic acid encoding the recombinant botulinum toxin comprises a first nucleic acid fragment, a second nucleic acid fragment, a first modification tag and a second modification tag, wherein the first nucleic acid fragment encodes a heavy chain of botulinum toxin, the second nucleic acid fragment encodes a light chain of botulinum toxin, the first modification tag encodes a His tag, and the second modification tag encodes a GST tag or an MBP tag.
Need to check novelty before this filing date? Find Prior Art

Description

Recombinant botulinum toxin and preparation method thereof Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a recombinant botulinum toxin and a preparation method thereof. Background Art

[0002] Botulinum neurotoxin, also known as botulinum toxin, is a neurotoxin secreted by Clostridium botulinum. Based on antigenicity, it can be divided into seven serotypes, A and B. Botulinum toxin is highly neurotoxic and can cause nerve paralysis even in extremely small doses. When a person ingests food containing botulinum toxin, the incubation period is 6 hours to 12 days, with clinical symptoms typically appearing within 3 to 4 days, and the patient ultimately dying from respiratory failure. Botulinum toxin is highly toxic, equivalent to 10,000 times the toxicity of potassium cyanide. Therefore, the production of botulinum toxin has strict requirements, making it difficult to obtain in a standard laboratory.

[0003] In situ extraction of botulinum toxin using Clostridium botulinum is a relatively traditional method with a relatively mature theoretical framework. However, since fermentation of Clostridium botulinum requires a very strict anaerobic environment and is very sensitive to temperature, specialized fermentation equipment is required for large-scale production. Furthermore, since the expressed botulinum toxin lacks an affinity chromatography tag, multiple purification steps are required to obtain a relatively pure protein. Furthermore, due to the high toxicity of botulinum toxin, the longer the preparation process, the greater the probability of accidental contamination.

[0004] Therefore, there is an urgent need to develop a method for preparing botulinum toxin that is simple, has a short preparation process, and can be obtained in the laboratory.

[0005] Summary of the Invention

[0006] The present invention aims to solve at least one of the technical problems existing in the prior art to at least a certain extent.

[0007] The inventors found during the experiment that if a single tag purification is adopted, the final material may contain incomplete target protein (found in WB experimental verification that there is incomplete target protein, which may be hydrolyzed by some proteases), and it is difficult to separate incomplete and complete target protein, so that the protein finally obtained is more mixed; After a large number of experiments, the inventors found that when two tags are added to the head and tail of the target nucleic acid fragment, it is only necessary to carry out two-step purification, so that a purer and complete target protein can be obtained, and the yield of the target protein is also improved. Therefore, by adopting the inventive method, the purity of the target protein can be significantly improved, and the whole process can be made more rapid and efficient, and there is no need to carry out complicated purification process, saving the time and resource cost of the laboratory and production link. Compared with traditional protein purification methods, this method greatly shortens the purification time, significantly reduces the risk of accidental contamination, and while saving costs, the target protein obtained also has considerable purity and yield, which brings important advantages for further experimental research, application development and industrial production.

[0008] Specifically, the present invention provides the following technical solutions:

[0009] In its first aspect, the present invention provides an isolated nucleic acid. According to an embodiment of the present invention, the nucleic acid comprises: a first nucleic acid segment, a second nucleic acid segment, a first modification tag, and a second modification tag, wherein the first nucleic acid segment, the second nucleic acid segment, the first modification tag, and the second modification tag are linked; wherein the first nucleic acid segment encodes the heavy chain of botulinum toxin; the second nucleic acid segment encodes the light chain of botulinum toxin; the first modification tag encodes a His tag; and the second modification tag encodes a GST tag or an MBP tag.

[0010] It should be noted that the "first modification tag" or "second modification tag" described herein refers to a nucleotide sequence encoding a His tag, a GST tag, or an MBP tag. The "first modification tag" or "second modification tag" is not limited to the nucleotide sequences listed herein and also includes other nucleotide sequences that can be used to encode the amino acids corresponding to a His tag, a GST tag, or an MBP tag.

[0011] After a large number of experiments, the inventors found that when the first modification tag encodes a His tag and the second modification tag encodes a GST tag or an MBP tag, the subsequently obtained recombinant protein botulinum toxin has higher activity and purity, and has a higher yield, thereby saving costs.

[0012] According to an embodiment of the present invention, the isolated nucleic acid may further include at least one of the following additional technical features:

[0013] According to an embodiment of the present invention, the nucleic acid further includes a first restriction enzyme cleavage site, a second restriction enzyme cleavage site and a third restriction enzyme cleavage site.

[0014] According to an embodiment of the present invention, the first enzyme cutting site, the second enzyme cutting site and the third enzyme cutting site are the same.

[0015] According to an embodiment of the present invention, the first, second, and third restriction sites encode a 3C restriction site, a TEV restriction site, a Thrombin restriction site, an FXa restriction site, or an Enterokinase restriction site. When the above restriction sites are used, the modified tag sequence can be completely removed after cleavage by the corresponding protease, and no amino acid residues that are not present in the original sequence remain.

[0016] It should be noted that the "first restriction site," "second restriction site," and "third restriction site" described herein refer to nucleotide sequences encoding a 3C restriction site, a TEV restriction site, a Thrombin restriction site, an FXa restriction site, or an Enterokinase restriction site. The "first restriction site," "second restriction site," and "third restriction site" are not limited to the nucleotide sequences listed herein but also include other nucleotide sequences that can be used to encode amino acids corresponding to the 3C restriction site, TEV restriction site, Thrombin restriction site, FXa restriction site, or Enterokinase restriction site.

[0017] According to an embodiment of the present invention, the first modification tag encodes a His tag, the second modification tag encodes a GST tag, and the first, second, and third restriction sites encode a 3C restriction site or a Thrombin restriction site. The inventors, through extensive screening experiments, have found that employing this combination can result in a subsequently prepared recombinant botulinum toxin protein with higher activity and purity.

[0018] According to an embodiment of the present invention, the first modification tag encodes a His tag, the second modification tag encodes an MBP tag, and the first, second, and third restriction sites encode a 3C restriction site or a Thrombin restriction site. The inventors, through extensive screening experiments, have found that employing this combination can result in a subsequently prepared recombinant botulinum toxin protein with higher activity and purity.

[0019] According to an embodiment of the present invention, the 5' end of the first modification tag is connected to the 3' end of the first restriction enzyme cleavage site, the 5' end of the first restriction enzyme cleavage site is connected to the 3' end of the first nucleic acid fragment, the 5' end of the first nucleic acid fragment is connected to the 3' end of the second restriction enzyme cleavage site, the 5' end of the second restriction enzyme cleavage site is connected to the 3' end of the second nucleic acid fragment, the 5' end of the second nucleic acid fragment is connected to the 3' end of the third restriction enzyme cleavage site, and the 5' end of the third restriction enzyme cleavage site is connected to the 3' end of the second modification tag.

[0020] According to an embodiment of the present invention, the first nucleic acid fragment has a nucleotide sequence shown in SEQ ID NO: 1.

[0021] According to an embodiment of the present invention, the second nucleic acid fragment has the nucleotide sequence shown in SEQ ID NO: 2.

[0022] According to an embodiment of the present invention, the His tag has the amino acid sequence shown in SEQ ID NO: 73.

[0023] According to an embodiment of the present invention, the sequence encoding the His tag (first modification tag) has the nucleotide sequence shown in SEQ ID NO:3.

[0024] According to an embodiment of the present invention, the GST tag has the amino acid sequence shown in SEQ ID NO: 74.

[0025] According to an embodiment of the present invention, the sequence encoding the GST tag (the second modified tag) has the nucleotide sequence shown in SEQ ID NO:4.

[0026] According to an embodiment of the present invention, the MBP tag has the amino acid sequence shown in SEQ ID NO:75.

[0027] According to an embodiment of the present invention, the sequence encoding the MBP tag (the second modified tag) has the nucleotide sequence shown in SEQ ID NO:5.

[0028] According to an embodiment of the present invention, the 3C restriction site has an amino acid sequence shown in SEQ ID NO: 76.

[0029] According to an embodiment of the present invention, the sequence encoding the 3C restriction site (the first restriction site, the second restriction site and the third restriction site) has the nucleotide sequence shown in SEQ ID NO:6.

[0030] According to an embodiment of the present invention, the TEV cleavage site has an amino acid sequence shown in SEQ ID NO: 77.

[0031] According to an embodiment of the present invention, the sequence encoding the TEV cleavage sites (the first cleavage site, the second cleavage site and the third cleavage site) has the nucleotide sequence shown in SEQ ID NO:7.

[0032] According to an embodiment of the present invention, the Thrombin cleavage site has an amino acid sequence shown in SEQ ID NO: 78.

[0033] According to an embodiment of the present invention, the sequence encoding the Thrombin cleavage site (the first cleavage site, the second cleavage site and the third cleavage site) has the nucleotide sequence shown in SEQ ID NO:8.

[0034] According to an embodiment of the present invention, the Fxa cleavage site has an amino acid sequence shown in SEQ ID NO: 79.

[0035] According to an embodiment of the present invention, the sequence encoding the Fxa cleavage site (the first cleavage site, the second cleavage site and the third cleavage site) has the nucleotide sequence shown in SEQ ID NO:9.

[0036] According to an embodiment of the present invention, the enterokinase cleavage site has an amino acid sequence shown in SEQ ID NO: 80.

[0037] According to an embodiment of the present invention, the sequence encoding the enterokinase cleavage site (the first cleavage site, the second cleavage site and the third cleavage site) has the nucleotide sequence shown in SEQ ID NO:10.

[0038] In a second aspect, the present invention provides a vector. According to an embodiment of the present invention, the vector carries the nucleic acid described in the first aspect. The expression vector may include optional control sequences operably linked to the nucleic acid molecule. The control sequences are one or more control sequences that can direct the expression of the nucleic acid molecule in a host.

[0039] According to an embodiment of the present invention, the vector is selected from plasmid.

[0040] As used herein, "operably linked" means that the exogenous gene is linked to the vector so that the control elements within the vector, such as transcriptional and translational control sequences, can perform their intended functions of regulating the transcription and translation of the exogenous gene. When linking the nucleic acid molecule to the vector, the nucleic acid molecule and the control elements on the vector can be linked directly or indirectly, as long as these control elements are capable of controlling the translation and expression of the nucleic acid molecule. These control elements can be derived directly from the vector itself or exogenously, i.e., not from the vector itself.

[0041] In a third aspect, the present invention provides a recombinant cell. According to an embodiment of the present invention, the recombinant cell comprises the nucleic acid described in the first aspect or the vector described in the second aspect.

[0042] According to an embodiment of the present invention, the cell is selected from a prokaryotic cell or a eukaryotic cell.

[0043] According to an embodiment of the present invention, the cell is selected from Escherichia coli, yeast, cyanobacteria or mammalian cell lines, insect cells, plant cells or amphibian cells.

[0044] According to an embodiment of the present invention, the cell is selected from Escherichia coli.

[0045] In the fourth aspect of the present invention, the present invention proposes a method for obtaining a recombinant protein botulinum toxin. According to an embodiment of the present invention, the method comprises: culturing the recombinant cell described in the third aspect under conditions suitable for protein expression; purifying the culture treatment product; and enzymatically cleaving the purified treatment product to obtain the recombinant protein botulinum toxin. The method described in the present invention is simple and easy to implement, with simple and clear steps and a fast preparation process. It does not require complex equipment or strict experimental conditions and is suitable for routine operations in general laboratories, which makes the method more feasible and flexible in practical applications. In addition, the recombinant protein botulinum toxin obtained by this method also has high purity and activity, laying the foundation for the subsequent development of the uses and applications of recombinant protein botulinum toxin.

[0046] According to an embodiment of the present invention, the method for obtaining recombinant botulinum toxin may further include at least one of the following additional technical features:

[0047] According to an embodiment of the present invention, the purification treatment is carried out in the following manner: the culture treatment product is subjected to a first purification treatment, and the first purification treatment is carried out in a second modification tag purification column; the culture treatment product that has undergone the first purification treatment is subjected to a second purification treatment, and the second purification treatment is carried out in the first modification tag purification column.

[0048] It should be noted that the "second modification tag purification column" has the function of separating the second modification tag from the total protein while retaining the biological activity and chemical integrity of the target protein; the "first modification tag purification column" has the function of separating the first modification tag from the total protein while retaining the biological activity and chemical integrity of the target protein.

[0049] According to an embodiment of the present invention, the purification process is performed as follows: the culture product undergoes a first purification process, the first purification process being performed in a GST-tag purification column; the culture product undergoes a second purification process, the second purification process being performed in a His-tag purification column, and the enzyme cleavage site is a 3C enzyme cleavage site. This method can achieve high purity and activity of the recombinant botulinum toxin protein, laying the foundation for the subsequent development of uses and applications of the recombinant botulinum toxin protein.

[0050] According to an embodiment of the present invention, the purification process is performed as follows: the culture product undergoes a first purification process, performed in a GST-tagged purification column; the culture product undergoes a second purification process, performed in a His-tagged purification column, with the enzymatic cleavage site being the Thrombin cleavage site. This method can achieve high purity and activity of the recombinant botulinum toxin protein, laying the foundation for the subsequent development of uses and applications of the recombinant botulinum toxin protein.

[0051] According to an embodiment of the present invention, the purification process is performed as follows: the culture product undergoes a first purification process, the first purification process being performed in an MBP-tag purification column; the culture product undergoing the first purification process undergoes a second purification process, the second purification process being performed in a His-tag purification column, and the enzyme cleavage site is a 3C enzyme cleavage site. This method can achieve high purity and activity of the recombinant botulinum toxin protein, laying the foundation for the subsequent development of uses and applications of the recombinant botulinum toxin protein.

[0052] According to an embodiment of the present invention, the purification process is performed as follows: the culture product undergoes a first purification process, performed in an MBP-tagged purification column; the culture product undergoes a second purification process, performed in a His-tagged purification column, with the enzymatic cleavage site being the Thrombin cleavage site. This method can achieve a high purity and activity of the recombinant botulinum toxin protein, laying the foundation for the subsequent development of uses and applications of the recombinant botulinum toxin protein.

[0053] According to an embodiment of the present invention, the purification process can also be performed as follows: the culture product is subjected to a third purification process, wherein the third purification process is performed on a His-tag purification column; and the culture product after the third purification process is subjected to a fourth purification process, wherein the fourth purification process is performed on a strong anion exchange chromatography column. High-quality recombinant botulinum toxin can also be obtained using this purification method.

[0054] The inventors have discovered through experiments that when the third purification step is performed on a His-tag purification column, the fourth purification step involves passing the culture product from the third purification step through a strong anion exchange chromatography column (HiTrap Q HP, Q Sepharose High Performance) to isolate the target protein. The modified tags GST or MBP in this step increase the expression level of the target protein.

[0055] In its fifth aspect, the present invention provides a recombinant botulinum toxin. According to embodiments of the present invention, the recombinant botulinum toxin is prepared by the method described in the fourth aspect. The recombinant botulinum toxin prepared by the method of the present invention has high purity and activity, laying the foundation for subsequent medical applications, scientific research, and drug development.

[0056] In a sixth aspect, the present invention provides a composition. According to an embodiment of the present invention, the composition comprises the nucleic acid described in the first aspect, the vector described in the second aspect, the recombinant cell described in the third aspect, or the recombinant botulinum toxin described in the fifth aspect.

[0057] In the seventh aspect of the present invention, the present invention proposes the use of the nucleic acid described in the first aspect, the vector described in the second aspect, the recombinant cell described in the third aspect, the recombinant protein botulinum toxin described in the fifth aspect, or the composition described in the sixth aspect in the preparation of a drug for preventing or treating a disease.

[0058] According to an embodiment of the present invention, the disease includes a neuromuscular disease, and the symptoms of the disease include: spasmodic dysphonia, spasmodic torticollis, laryngeal dystonia, oromandibular dysphonia, tongue dystonia, cervical dystonia, focal dystonia, blepharospasm, strabismus, hemifacial spasm, eyelid disorder, cerebral palsy, focal spasm, spastic colitis, neurogenic overactive bladder, idiopathic overactive bladder, pelvic floor achalasia, limb spasm, motor tics, essential hand tremor, head tremor, detrusor-sphincter dyssynergia, bruxism, anal fissure, achalasia, dysphagia, hyperhidrosis, sialorrhea, excessive gastrointestinal secretion, secretory disorders, pain caused by muscle spasm, chronic migraine or skin disorders. One or more of the following.

[0059] In the eighth aspect of the present invention, the present invention proposes the use of the nucleic acid described in the first aspect, the vector described in the second aspect, the recombinant cell described in the third aspect, the recombinant protein botulinum toxin described in the fifth aspect, or the composition described in the sixth aspect in the preparation of a reagent, wherein the reagent is used to interfere with the release of neurotransmitters in isolated nerve cells or to improve related symptoms of the body by interfering with the release of neurotransmitters in the body.

[0060] According to an embodiment of the present invention, the agent is used for cosmetic purposes.

[0061] In a ninth aspect, the present invention provides a drug. According to an embodiment of the present invention, the drug comprises: the nucleic acid described in the first aspect, the vector described in the second aspect, the recombinant cell described in the third aspect, the recombinant botulinum toxin described in the fifth aspect, or the composition described in the sixth aspect.

[0062] According to an embodiment of the present invention, the drug further includes a pharmaceutically acceptable carrier or excipient.

[0063] As used herein, a "pharmaceutically acceptable" ingredient is a substance that is suitable for use in humans and / or mammals without excessive adverse side effects (such as toxicity, irritation, and allergic reactions), i.e., a substance with a reasonable benefit / risk ratio. The term "pharmaceutically acceptable carrier" refers to a carrier for administering a therapeutic agent, including various excipients and diluents.

[0064] The drug of the present invention contains a safe and effective amount of the active ingredient of the present invention and a pharmaceutically acceptable carrier. Such carriers include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. Generally, the pharmaceutical preparation should be compatible with the mode of administration, wherein the mode of administration can be oral administration, nasal administration, intradermal administration, subcutaneous administration, intramuscular administration, intravenous administration, or intraperitoneal administration. The dosage form of the drug of the present invention is an injection, an oral preparation (tablet, capsule, oral solution), a transdermal agent, or a sustained-release agent. For example, it can be prepared by conventional methods using physiological saline or an aqueous solution containing glucose and other adjuvants. The drug is preferably manufactured under sterile conditions.

[0065] In its tenth aspect, the present invention provides a method for preventing or treating a neuromuscular disease. According to an embodiment of the present invention, the method comprises administering to a subject an effective amount of the nucleic acid described in the first aspect, the vector described in the second aspect, the recombinant cell described in the third aspect, the recombinant botulinum toxin described in the fifth aspect, the composition described in the sixth aspect, or the drug described in the eighth aspect.

[0066] As used herein, the term "effective amount" or "effective dose" refers to an amount that can produce a function or activity on humans and / or animals and can be accepted by humans and / or animals.

[0067] The effective amount of the present invention may vary depending on the mode of administration and the severity of the disease to be treated. The preferred effective amount can be determined by one of ordinary skill in the art based on various factors (e.g., through clinical trials). Such factors include, but are not limited to, the pharmacokinetic parameters of the active ingredient, such as bioavailability, metabolism, and half-life; the severity of the disease to be treated, the patient's weight, the patient's immune status, the route of administration, and the like. For example, depending on the exigencies of the treatment, several divided doses may be administered daily, or the dose may be proportionally reduced.

[0068] In the eleventh aspect of the present invention, the present invention proposes the use of the nucleic acid described in the first aspect, the vector described in the second aspect, the recombinant cell described in the third aspect, the recombinant protein botulinum toxin described in the fifth aspect, the composition described in the sixth aspect, or the drug described in the eighth aspect in preventing or treating neuromuscular diseases.

[0069] The botulinum toxin preparation method provided by the present invention can prepare botulinum toxin quickly and efficiently, has a short host culture cycle, is not prone to phage contamination, and has a simple and easy toxin protein purification process, which is easy to scale up production, greatly reducing the cost of botulinum toxin preparation. The prepared botulinum toxin has the expected biological activity, which is equivalent to that of natural botulinum toxin, and has good application prospects.

[0070] Additional aspects and advantages of the present invention will be set forth in part in the description which follows and, in part, will be obvious from the description which follows, or may be learned by practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0071] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the following description of the embodiments with reference to the accompanying drawings, in which:

[0072] FIG1 is a gel electrophoresis diagram of pQe30 after double enzyme digestion according to an embodiment of the present invention;

[0073] FIG2 is a gel electrophoresis diagram of the start codon in plasmid 1 after mutation according to an embodiment of the present invention;

[0074] FIG3 is a diagram showing the sequencing results of plasmid 2 according to an embodiment of the present invention;

[0075] FIG4 is a gel electrophoresis diagram of plasmid 2 after 6×His removal according to an embodiment of the present invention;

[0076] FIG5 is a diagram showing the sequencing results of plasmid 3 according to an embodiment of the present invention;

[0077] FIG6 is a gel electrophoresis diagram of target fragments of light chain and heavy chain according to an embodiment of the present invention;

[0078] FIG7 is a gel electrophoresis diagram of plasmid 3 after double enzyme digestion according to an embodiment of the present invention;

[0079] 8 is an electrophoresis diagram of a GST tag with a 3C restriction site and a single enzyme linearization of plasmid 4 according to an embodiment of the present invention;

[0080] 9 is an electrophoretic diagram of PCR amplification of the MBP tag sequence and PCR amplification of the remaining sequence portions except the GST tag sequence in plasmid 5 according to an embodiment of the present invention;

[0081] FIG10 is a gel electrophoresis diagram of a single His-tag (plasmid 4) purified according to an embodiment of the present invention (wherein, M refers to protein MARK, FT1 refers to a sample after the culture treatment product has passed through a His-tag column; FT2 refers to a sample after F1 has passed through a His-tag column again; 0 mM refers to a sample after the His-tag column has been washed with a buffer; 25 mM refers to a sample after the His-tag column has been washed with a buffer containing 25 mM imidazole; and Elute refers to a sample after the target protein has been eluted from the His-tag column using a buffer containing 200 mM imidazole).

[0082] FIG11 is a gel electrophoresis diagram of GST after the first purification according to an embodiment of the present invention (wherein, FT refers to the sample after the culture treatment product passes through the GST tag column; the first W refers to the sample after the GST tag column is washed with a small amount of buffer; the second W refers to the sample after the GST tag column is washed with a large amount of buffer; 1 / 3 / 5 / 8 / 10 / 13 / 15 / 17 refer to tubes 1, 3 / 5 / 8 / 10 / 13 / 15 / 17 collected when the target protein is eluted from the GST tag column with 20 mM reduced glutathione; beads refers to GST-tagged beads to check whether there is any target protein that has not been eluted on the GST tag);

[0083] FIG12 is a gel electrophoresis diagram of a sample after a second His purification after a first GST purification according to an embodiment of the present invention (wherein, FT refers to a sample after the target protein eluted from the GST tag column in the first step is passed through a His tag column; 0 mM refers to a sample after the His tag column is washed with a buffer; 25 mM refers to a sample after the His tag column is washed with a buffer containing 25 mM imidazole; and E refers to a sample after the target protein is eluted from the His tag column using a buffer containing 200 mM imidazole);

[0084] Figure 13 is an SDS-PAGE electrophoresis of the target protein after two-step purification by 3C enzyme digestion according to an embodiment of the present invention, after passing through molecular sieves (wherein, 9 / 10 / 11 / 12 / 13 refers to the 9th, 10th, 11th, 12th, and 13th tubes collected after passing through molecular sieves);

[0085] FIG14 is an electrophoretic diagram of the first step of His purification with an MBP tag according to an embodiment of the present invention (wherein, NC refers to the uninduced culture product, negative control; FT refers to the sample of the culture treatment product passed through the His-tagged column; 0 / 25 refers to the sample in which the His-tagged column was washed with a buffer containing 0 / 25 mM imidazole; E refers to the sample in which the target protein was eluted from the His-tagged column using a buffer containing 200 mM imidazole);

[0086] FIG15 is an SDS-PAGE electrophoresis after the second step of ion exchange according to an embodiment of the present invention (wherein, M refers to protein MARK; before loading refers to the sample before passing through the ion exchange column; FT refers to the sample after passing through the ion exchange column, and 1 to 24 refer to the 1st to 24th tubes of samples collected through the ion exchange column);

[0087] FIG16 is an SDS-PAGE electrophoresis of the samples after the second step ion exchange of 3C enzyme digestion according to an embodiment of the present invention (wherein, M refers to protein MARK; 1 to 13 refer to samples in tubes 1 to 13 collected by molecular sieves);

[0088] FIG17 is a biological activity experiment of a recombinant protein botulinum toxin cleaving a SNAP25 substrate with different second modification tags GST / MBP and different enzyme cleavage sites obtained according to different methods of the embodiments of the present invention (wherein 036 refers to the SNAP25 substrate; M refers to the protein MARK);

[0089] FIG18 is an anatomical diagram of the intestinal tract of mice in the 3.335 ng / kg dose group according to an embodiment of the present invention;

[0090] FIG19 is an anatomical diagram of the intestinal tract of mice in the 2.000 ng / Kg dose group according to an embodiment of the present invention;

[0091] FIG20 is an anatomical diagram of the intestinal tract of mice in the 1.200 ng / kg dose group according to an embodiment of the present invention;

[0092] FIG21 is an anatomical diagram of the intestinal tract of mice in the 0.720 ng / kg dose group according to an embodiment of the present invention;

[0093] FIG22 is an anatomical diagram of the intestinal tract of mice in the 0.432 ng / kg dose group according to an embodiment of the present invention;

[0094] FIG23 is an anatomical diagram of the intestinal tract of mice in the 0.259 ng / kg dose group according to an embodiment of the present invention;

[0095] FIG24 is an anatomical diagram of the intestinal tract of mice in the 0.156 ng / kg dose group according to an embodiment of the present invention;

[0096] Figure 25 is a plasmid map of plasmid 4 according to an embodiment of the present invention;

[0097] Figure 26 is a plasmid map of plasmid 5 according to an embodiment of the present invention;

[0098] Figure 27 is a plasmid map of plasmid 6 according to an embodiment of the present invention;

[0099] FIG28 is a plasmid spectrum of a plasmid containing a GST tag + a His tag + a Thrombin restriction site constructed according to an embodiment of the present invention;

[0100] FIG29 is a plasmid spectrum of a plasmid containing an MBP tag+His tag+Thrombin restriction site constructed according to an embodiment of the present invention. DETAILED DESCRIPTION

[0101] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be understood as limiting the present invention.

[0102] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood to indicate or imply relative importance or implicitly specify the number of the technical features indicated. Therefore, features defined as "first" or "second" may explicitly or implicitly include one or more of such features. Furthermore, in the description of the present invention, unless otherwise specified, "plurality" means two or more.

[0103] In this document, the terms “contain”, “include” or “include” are open expressions, that is, they include the contents specified in the present invention but do not exclude other contents.

[0104] As used herein, the terms "optionally," "optional," or "optionally" generally mean that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0105] The following embodiments of the present invention are described in detail. The embodiments described below are exemplary and are only used to explain the present invention, and are not to be construed as limiting the present invention. Where specific techniques or conditions are not specified in the embodiments, the techniques or conditions described in the literature in this field or the product specifications are used. Where the manufacturer of the reagents or instruments is not specified, all are conventional products that can be obtained commercially.

[0106] Example 1: Transformation of pQe30 expression plasmid

[0107] 1. Transformation 1

[0108] The pQe30 plasmid was double-digested with EcoR and HindIII restriction endonucleases from Thermo Fisher Scientific to linearize it. The digestion products were collected by gel electrophoresis, and the target band was excised from the gel (see Figure 1) and recovered using the TIANGEN gel recovery kit. After recovery, homologous recombination was performed with a DNA sequence synthesized by General Bio (Anhui) Co., Ltd. containing a 3C restriction site, 10×His, and pQe30 homology arms using the ClonExpress II One-Step Cloning Kit. The procedure was the same as in the manufacturer's instructions.

[0109] Take 10 μl of the homologous recombination reaction product and add DH5a competent medium (purchased from Beijing Quanshijin Biotechnology Co., Ltd.). Heat shock at 42°C for 60 seconds. Add 800 μl of fresh LB medium and incubate at 37°C for 1 hour. Then, spread on a solid LB plate (containing 50 μg / mL ampicillin) and incubate at 37°C overnight. Pick a single colony and expand it. Then, use the TIANGEN Plasmid Extraction Kit to extract the transformed plasmid 1.

[0110] 2. Transformation 2

[0111] On the basis of transformation 1, in order to disable the 6×His at the N-terminus of plasmid 1, the inventors mutated the start codon ATG in front of plasmid 1 to CTG. The mutation primers are:

[0112] Mut-F:5'-GAGGAGAAATTAACTCTGAGAGGATCGCATC-3'(SEQ ID NO:11)

[0113] Mut-R:5'-GATGCGATCCTCTCAGAGTTAATTTCTCCTC-3'(SEQ ID NO:12)

[0114] Using the PrimeSTAR Mix system, a 20 μl reaction (transformed plasmid 1 template: 1 μl, approximately 28 ng; mutant primer: Mut-F, 1 μl; mutant primer: Mut-R, 1 μl; sterile water: 7 μl; 2× PrimeSTAR Mix: 10 μl) was performed. The reaction procedure was: denaturation at 98°C for 10 s; annealing at 58°C for 10 s; extension at 72°C for 4 min; and 32 cycles. Reaction fragments were collected by gel electrophoresis (target bands are shown in Figure 2). PCR reaction bands were excised and recovered using the TIANGEN gel recovery kit. The recovered bands were transferred to DH5a (purchased from Beijing Quanshijin Biotechnology Co., Ltd.), heat-shocked at 42°C for 60 s, and incubated in 800 μl of fresh LB medium at 37°C for 1 h. The plates were then plated on LB plates containing 50 μg / mL ampicillin and incubated overnight at 37°C. A single clone was picked for expansion, and then the plasmid was extracted using the TIANGEN plasmid extraction kit to obtain the modified plasmid 2.

[0115] Plasmid 2 was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing and identification. The sequencing results were compared using SnapGeng software. The results are shown in FIG3 , which shows that the start codon ATG was successfully mutated to CTG.

[0116] 3. Transformation 3

[0117] In order to bring the coding region and the ribosome binding site (RBS) closer, the inventors deleted 18 bases of the 6×His sequence at the N-terminus of plasmid 2. The deletion primers were:

[0118] Del-His-F:5'-AAAGAGGAGAAATTAACTCTGAGAGGATCGGGATCCGCATGCGAGCTCC-3'(SEQ ID NO:13)

[0119] Del-His-R:5'-GGAGCTCGCATGCGGATCCCGATCCTCTCAGAGTTAATTTCTCCTCTTT-3'(SEQ ID NO:14)

[0120] Using the PrimeSTAR Mix system, a 20 μl reaction (plasmid 2 template: 1 μl, approximately 30 ng; primer Del-His-F: 1 μl; primer Del-His-R: 1 μl; sterile water: 7 μl; 2× PrimeSTAR Mix: 10 μl) was performed. The reaction procedure was as follows: denaturation at 98°C for 10 s; annealing at 58°C for 10 s; and extension at 72°C for 4 min; for 32 cycles. Reaction fragments were collected by gel electrophoresis (the fragment after 6× His removal is shown in Figure 4). PCR bands were excised and recovered using the TIANGEN gel recovery kit. The recovered bands were transferred to DH5a (purchased from Beijing Quanshijin Biotechnology Co., Ltd.), heat-shocked at 42°C for 60 s, and then incubated in 800 μl of fresh LB medium at 37°C for 1 h. The plates were then plated on LB plates containing 50 μg / mL ampicillin and incubated overnight at 37°C. A single clone was picked for expansion, and then the plasmid was extracted using the TIANGEN plasmid extraction kit to obtain the modified plasmid 3.

[0121] Plasmid 3 was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing and identification. The sequencing results were compared using SnapGeng software. The results are shown in FIG5 , which shows that the 18 bases of 6×His were successfully deleted.

[0122] Example 2: Construction of target plasmid

[0123] Based on the botulinum protein sequence (UniProtKB / Swiss-Prot:PODPI0.1) expressed by Clostridium botulinum published by NCBI (National Center for Bioinformation, website: https: / / www.ncbi.nlm.nih.gov / ), the design was carried out and General Bio (Anhui) Co., Ltd. was commissioned to optimize the synthetic botulinum toxin encoding gene.

[0124] Using PCR amplification, three modified pQe30 homology arms (i.e., plasmid 3) were introduced upstream and downstream of the light chain and heavy chain of the botulinum toxin encoding gene, and a 3C restriction site was introduced between the light chain and heavy chain. The required primers are:

[0125] pQe-BTXL-F:5'-ATTAACTCTGAGAGGATCGGGATCCATGCCATTTGTTAATAAGCA-3'(SEQ ID NO:15)

[0126] pQe-BTXL-R:5'-CCTTGAAACAAGACTTCTAAAGACCCACTAGTGATGATAACCTCT-3'(SEQ ID NO:16)

[0127] pQe-BTXH-F:5'-TTAGAAGTCTTGTTTCAAGGTCCGGGCTCTTTAAACGACCTTTGTATT-3'(SEQ ID NO:17)

[0128] pQe-BTXH-R:5'-CTGGAACAGAACTTCCAGGGTACCAAGGGGCCGCTCTCCCCACC-3'(SEQ ID NO:18)

[0129] Light and heavy chains were amplified using the PrimeSTAR Mix system, with each reaction performed in 50 μl (heavy chain / light chain template DNA (provided by General Motors): 1 μl, approximately 20-50 ng; primers pQe-BTXL-F / pQe-BTXH-F: 1 μl; primers pQe-BTXL-R / pQe-BTXH-R: 1 μl; sterile water: 22 μl; 2× PrimeSTAR Mix: 25 μl). The reaction procedure was: denaturation at 98°C for 10 s; annealing at 58°C for 10 s; extension at 72°C (90 s for light chain, 180 s for heavy chain); and 32 cycles. Reaction fragments were collected by gel electrophoresis (the target light and heavy chain fragments are shown in Figure 6). PCR reaction bands were excised from the gel and recovered using the TIANGEN gel recovery kit to obtain the PCR-amplified light and heavy chains.

[0130] The pQe30 plasmid (plasmid 3) after three modifications was double-digested with BamHI and KpnI restriction endonucleases from Thermo Fisher Scientific to linearize it. The digestion products were collected by gel electrophoresis, and the target band was excised from the gel (target band is shown in Figure 7) and recovered using the TIANGEN gel recovery kit to obtain the double-digested linearized vector.

[0131] After double digestion with BamHI and KpnI, the linearized vector and the PCR-amplified light and heavy chains were subjected to gel recovery and homologous recombination. The kit used was the ClonExpress II One Step Cloning Kit. The operation steps were the same as those in the instructions. Take 10μl of the reaction product, add DH5a competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd.), heat shock at 42℃ for 60s, add 800μl of fresh LB medium and incubate at 37℃ for 1h, then spread on a resistant LB solid plate (containing 50μg / mL ampicillin) and culture at 37℃ overnight. Pick a single clone for amplification and culture, and then use the TIANGEN plasmid mini kit for plasmid extraction to obtain plasmid 4, the plasmid map of which is shown in Figure 25.

[0132] Example 3: Introduction of tags

[0133] 1. Introduction of GST label:

[0134] After the target sequence (PCR-amplified light chain and heavy chain) and the modified vector (linearized vector after double enzyme digestion) in Example 2 were successfully connected, the inventors used the BamHI restriction endonuclease from Thermo Fisher Scientific to single-digest the ligated plasmid 4 to linearize it, and used the TIANGEN gel recovery kit to recover the vector to obtain the linearized vector after BamHI single enzyme digestion. The band of the vector is shown in the right figure in Figure 8.

[0135] At the same time, primers containing the homology arms of this linearized plasmid were designed to amplify the GST tag sequence with a 3C restriction site at the end (the template plasmid is pGEX-6P-1), so that the GST tag has a 3C restriction site. The primers are:

[0136] GST-F:5'-GAGAAATTAACTCTGAGAGGATCGGGATCCATGTCCCCTATACTAGGTTATTG-3'(SEQ ID NO:19)

[0137] GST-R:5'-CTGCTTATTAACAAATGGCATGGGCCCCTGGAACAGAACTTCC-3'(SEQ ID NO:20)

[0138] A 50 μl reaction was performed using the PrimeSTAR Mix system (template DNA (pGEX-6P-1): 1 μl, approximately 20-50 ng; primer GST-F: 1 μl; primer GST-R: 1 μl; sterile water: 22 μl; 2× PrimeSTAR Mix: 25 μl). The reaction procedure was as follows: 98°C, 10 s denaturation; 58°C, 10 s annealing; 72°C, 60 s extension; and 34 cycles. Reaction fragments were collected by gel electrophoresis (the target reaction fragment band is shown in the left image of Figure 8). The PCR reaction bands were excised from the gel and recovered using the TIANGEN gel recovery kit. The linearized vector digested with BamHI and the PCR-amplified GST tag sequence with a 3C restriction site were then gel-recovered and homologously recombined using the ClonExpress II One-Step Cloning Kit. The procedure was the same as the manufacturer's instructions. Take 10 μl of the homologous recombination reaction product and add DH5a competent medium (purchased from Beijing Quanshijin Biotechnology Co., Ltd.). Heat shock at 42°C for 60 seconds. Add 800 μl of fresh LB medium and incubate at 37°C for 1 hour. Then, spread on a solid LB plate (containing 50 μg / mL ampicillin) and culture at 37°C overnight. Pick a single colony for expansion and then use the TIANGEN Plasmid Extraction Kit for plasmid extraction to obtain plasmid 5. The plasmid map of plasmid 5 is shown in Figure 26.

[0139] 2. Introduction of MBP label:

[0140] By PCR, using the constructed target plasmid with a GST tag (plasmid 5) as a template, we only need to PCR amplify the MBP tag sequence to replace the GST tag sequence, and at the same time PCR amplify the remaining sequence after removing the GST tag sequence in plasmid 5. The primers used are:

[0141] MBP-F:5'-CTCTGAGAGGATCGGGATCCATGAAAATCGAAGAAGGTAAAC-3'(SEQ ID NO:21)

[0142] MBP-R:5'-CCCGAGGTTGTTGTTATTGTTATTGTTG-3'(SEQ ID NO:22)

[0143] pQe-BTX-F2:5'-ACAATAACAACAACCTCGGGCTGGAAGTTCTGTTCCAGGGGCCCATGCCATTTGTTAATAAGCAGT-3'(SEQ ID NO:23)

[0144] pQe-BTX-R2:5'-ACCTTCTTCGATTTTCATGGATCCCGATCCTCTCAG-3'(SEQ ID NO:24)

[0145] Using the PrimeSTAR Mix system, a 50 μl reaction was performed. The 50 μl reaction system for removing the GST sequence from plasmid 5 consisted of: 1 μl (approximately 20-50 ng) of template DNA (plasmid 5); 1 μl each of primers pQe-BTX-F2 and pQe-BTX-R2; 22 μl of sterile water; and 25 μl of 2× PrimeSTAR Mix. The 50 μl reaction system for amplifying the MBP tag consisted of: 1 μl (approximately 20-50 ng) of template DNA (plasmid pGEX-6P-1); 1 μl each of primers MBP-F and MBP-R; 22 μl of sterile water; and 25 μl of 2× PrimeSTAR Mix. The reaction procedure was as follows: denaturation at 98°C for 10 s; annealing at 58°C for 10 s; and extension at 72°C (MBP tag for 90 s, pQe30-BTX for 450 s); for a total of 34 cycles. Reaction fragments were collected by gel electrophoresis (the target reaction fragment band is shown in Figure 9). The PCR reaction bands were excised and recovered using the TIANGEN Gel Extraction Kit. The two recovered fragments were then homologously recombined using the ClonExpress II One-Step Cloning Kit. The procedure was the same as the manufacturer's instructions. 10 μl of the homologous recombination reaction product was added to a DH5a competent medium (purchased from Beijing Quanshijin Biotechnology Co., Ltd.), heat-shocked at 42°C for 60 s, and then incubated in 800 μl of fresh LB medium at 37°C for 1 h. The culture was then plated on a solid LB plate containing 50 μg / mL ampicillin and incubated overnight at 37°C. A single clone was picked for expansion, and then the plasmid was extracted using the TIANGEN plasmid extraction kit to obtain plasmid 6. The plasmid map of plasmid 6 is shown in Figure 27.

[0146] Example 4: Construction of plasmids containing different restriction sites

[0147] 1. The method for constructing other restriction sites carrying His tags and GST / MBP tags refers to the method mentioned above, as follows

[0148] (1) First, construct a target protein expression plasmid (such as plasmid 4) without a GST or MBP tag. Primers are used to introduce a TEV / Fxa / EK / Thrombin restriction site between the light chain and the heavy chain, and corresponding TEV / Fxa / EK / Thrombin restriction sites at the 3' end of the heavy chain and the 5' end of the light chain. The two adjacent sequences contain homology arms. In this way, target proteins with different restriction sites can be obtained through homologous recombination.

[0149] (2) Following the aforementioned method for constructing plasmid 5 or plasmid 6, introduce the GST tag or MBP tag into the plasmids containing the target protein with different restriction sites.

[0150] 2. The primers involved in constructing plasmids containing different tags and restriction sites in step 1 are as follows:

[0151] (1) Construct a target protein expression plasmid without GST or MBP tag (such as plasmid 4)

[0152] 1.1. Primers required for constructing a TEV restriction site:

[0153] TEV-F:ATTAACTCTGAGAGGATCGGGATCCATGCCATTTGTTAATAAGCAG(SEQ ID NO:25)

[0154] TEV-R:GCTCTGGAAGTATAGATTTTCAGACCCACTAGTGATGATCTCTAA(SEQ ID NO:26)

[0155] TEV2-F:GAAAATCTATACTTCCAGAGCGGCTTCTTCTTTAAACGACCTTTGTATTAA(SEQ ID NO:27)

[0156] TEV2-R:TGATGGCTCTGGAAGTATAGATTTTCAAGGGGCCGCTCTCCCCACC(SEQ ID NO:28)

[0157] pQe30-TEV-F:TGAAAATCTATACTTCCAGAGCCATCACCATCACCATCACCATC (SEQ ID NO: 29)

[0158] pQe30-TEV-R:CTGCTTATTAACAAATGGCATGGATCCCGATCCTCTCAGAGTTAAT(SEQ ID NO:30)

[0159] 1.2. Primers required for constructing Thrombin restriction site:

[0160] Throm-F:TTAACTCTGAGAGGATCGGGATCCATGCCATTTGTTAATAAGCAGTTT(SEQ ID NO:31)

[0161] Throm-R:GCTACCGCGTGGCACCAGTGAACTAGACCCACTAGTGATGATAACCTCTAACA(SEQ ID NO:32)

[0162] Throm2-F:GTTCACTGGTGCCACGCGGTAGCTCCTCTTTAAACGACCTTTGTATTAAAG(SEQ ID NO:33)

[0163] Throm2-R:ATGGCTACCGCGTGGCACCAGAAGGGGCCGCTCTCCCCACCCGT(SEQ ID NO:34)

[0164] pQe30-Throm-F:CCTTCTGGTGCCACGCGGTAGCCATCACCATCACCATCACCATCACC (SEQ ID NO:35)

[0165] pQe30-Throm-R:AAACTGCTTATTAACAAATGGCATGGATCCCGATCCTTCCAGAGTTAA (SEQ ID NO:36)

[0166] 1.3. Primers required for constructing the Fxa restriction site:

[0167] Fxa-F:TTAACTCTGAGAGGATCGGGATCCATGCCATTTGTTAATAAGCAGTTT(SEQ ID NO:37)

[0168] Fxa-R:CCTACCTTCGATTGAACTAGACCCACTAGTGATGATAACCTCTAACACA(SEQ ID NO:38)

[0169] Fxa2-F:TAGTTCAATCGAAGGTAGGGGTAGCTCCTCTTTAAACGACCTTTGTATTAA(SEQ ID NO:39)

[0170] Fxa2-R:ATGCCTACCTTCGATAAGGGGCCGCTCTCCCCACCCGT(SEQ ID NO:40)

[0171] pQe30-Fxa-F:CCCCTTATCGAAGGTAGGCATCACCATCACCATCACCATCA (SEQ ID NO:41)

[0172] pQe30-Fxa-R:AAACTGCTTATTAACAAATGGCATGGATCCCGATCCTCTCAGAGTTAA (SEQ ID NO:42)

[0173] 1.4. Primers required for the construction of EK restriction sites:

[0174] EK-F:TTAACTCTGAGAGGATCGGGATCCATGCCATTTGTTAATAAGCAGTTT(SEQ ID NO:43)

[0175] EK-R:CCTTATCGTCGTCATCACTAGACCCACTAGTGATGATAACCTCTAACA(SEQ ID NO:44)

[0176] EK2-F:TAGTGATGACGACGATAAGGGTAGCTCCTCTTTAAACGACCTTTGTATTAA(SEQ ID NO:45)

[0177] EK2-R:ATGCTTATCGTCGTCATCAAGGGGCCGCTCTCCCCACCC (SEQ ID NO:46)

[0178] pQe30-EK-F:GGCCCCTTGATGACGACGATAAGCATCACCATCACCATCACCATCACC (SEQ ID NO:47)

[0179] pQe30-EK-R:AAACTGCTTATTAACAAATGGCATGGATCCCGATCCTCTCAGAGTTAA (SEQ ID NO:48)

[0180] (2) Introducing the GST tag (e.g. plasmid 5):

[0181] 2.1. Primers required for constructing Thrombin restriction site:

[0182] GST-Thrombin-F:TTAACTCTGAGAGGATCGGGATCCATGTCCCCTATACTAGGTTATTGG(SEQ ID NO:51)

[0183] GST-Thrombin-R:CTGCTTATTAACAAATGGCATGCTACCGCGTGGCACCAGTTTTGGAGGATGGTCGCCACCAC(SEQ ID NO:52)

[0184] The plasmid spectrum of the constructed plasmid is shown in Figure 28.

[0185] 2.2. Primers required for constructing a TEV restriction site:

[0186] GST-TEV-F:TTAACTCTGAGAGGATCGGGATCCATGTCCCCTATACTAGGTTAT(SEQ ID NO:49)

[0187] GST-TEV-R:ACTGCTTATTAACAAATGGCATGCTCTGGAAGTATAGATTTTCTTTTGGAGGATGGTCGCCAC (SEQ ID NO: 50)

[0188] The plasmid map of the constructed plasmid is similar to that in Figure 28, except that the Thrombin restriction site is replaced by a TEV restriction site.

[0189] 2.3. Primers required for the construction of FXa restriction site:

[0190] GST-Fxa-F:TTAACTCTGAGAGGATCGGGATCCATGTCCCCTATACTAGGTTATT(SEQ ID NO:53)

[0191] GST-Fxa-R:TGCTTTATTAACAAATGGCATCCTACCTTCGATTTTTGGAGGATGGTCGCCACC(SEQ ID NO:54)

[0192] The plasmid map of the constructed plasmid is similar to that in Figure 28, except that the Thrombin restriction site is replaced by the Fxa restriction site.

[0193] 2.4. Primers required for the construction of EK restriction sites:

[0194] GST-EK-F:TTAACTCTGAGAGGATCGGGATCCATGTCCCCTATACTAGGTTATT(SEQ ID NO:55)

[0195] GST-EK-R:CTGCTTATTAACAAATGGCATCTTATCGTCGTCATCTTTTGGAGGATGGTCGCCACC(SEQ ID NO:56)

[0196] The plasmid map of the constructed plasmid is similar to that in Figure 28, except that the Thrombin restriction site is replaced by the EK restriction site.

[0197] (3) Introducing the MBP tag (e.g., plasmid 6):

[0198] 3.1. Primers required for constructing Thrombin restriction site:

[0199] MBP-Thrombin-F:TTAACTCTGAGAGGATCGGGATCCATGAAAATCGAAGAAGGTAAACTGGT (SEQ ID NO: 61)

[0200] MBP-Thrombin-R:CTGACGACCGCTGGCGGCGTTGATCACCGCAGTACGCACGGCATACCAGAAAGCGGACAT(SEQ ID NO:62)

[0201] pQe30-Thrombin-F:ATGTCCCGCTTTCTGGTATGCCGTGCGTACTGCGGTGATCAACGCCGCCAGCGGTCGTCAG (SEQ ID NO: 63)

[0202] pQe30-Thrombin-R:ACCAGTTTACCTTCTTCGATTTTCATGGATCCCGATCCTCTCAGAGTTAA (SEQ ID NO:64)

[0203] The plasmid map of the constructed plasmid is shown in FIG29 .

[0204] 3.2. Primers required for constructing a TEV restriction site:

[0205] MPB-TEV-F:TTAACTCTGAGAGGATCGGGATCCATGAAAATCGAAGAAGGTAAACTGG(SEQ ID NO:57)

[0206] MPB-TEV-R:AACTGCTTATTAACAAATGGCATGCTCTGGAAGTATAGATTTTCCCCGAGGTTGTT GTTATTGT(SEQ ID NO:58)

[0207] pQe30-TEV-F:ACAATAACAACAACCTCGGGGAAAATCTATACTTCCAGAGCATGCCATTTGTTAATAAGCAGTT (SEQ ID NO:59)

[0208] pQe30-TEV-R:CCAGTTTTACCTTCTTCGATTTTCATGGATCCCGATCCTCTCAGAGTTAA (SEQ ID NO: 60)

[0209] The plasmid map of the constructed plasmid is similar to that in Figure 29, except that the Thrombin restriction site is replaced by a TEV restriction site.

[0210] 3.3. Primers required for constructing the Fxa restriction site:

[0211] MBP-Fxa-F:TTAACTCTGAGAGGATCGGGATCCATGAAAATCGAAGAAGGTAAACTGG(SEQ ID NO:65)

[0212] MBP-Fxa-R:CTGCTTATTAACAAATGGCATCCTACCTTCGATCCCGAGGTTGTTGTTATTGT(SEQ ID NO:66)

[0213] pQe30-Fxa-F:ACAATAACAACAACCTCGGGATCGAAGGTAGGATGCCATTTGTTAATAAGCAG (SEQ ID NO: 67)

[0214] pQe30-Fxa-R:CCAGTTTTACCTTCTTCGATTTTCATGGATCCCGATCCTCTCAGAGTTAA (SEQ ID NO: 68)

[0215] The plasmid map of the constructed plasmid is similar to that in Figure 29, except that the Thrombin restriction site is replaced by the Fxa restriction site.

[0216] 3.4. Primers required for the construction of EK restriction sites:

[0217] MBP-EK-F:TTAACTCTGAGAGGATCGGGATCCATGAAAATCGAAGAAGGTAAACTG(SEQ ID NO:69)

[0218] MBP-EK-R:AACAAATGGCATCTTATCGTCGTCATCCCCGAGGTTGTTGTTATTGTTATTGT(SEQ ID NO:70)

[0219] pQe30-EK-F:ACAATAACAATAACAACAACCTCGGGGATGACGACGATAAGATGCCATTTGTT (SEQ ID NO:71)

[0220] pQe30-EK-R:CAGTTTACCTTCTTCGATTTTCATGGATCCCGATCCTTCCAGAGTTAA (SEQ ID NO:72)

[0221] The plasmid map of the constructed plasmid is similar to that in Figure 29, except that the Thrombin restriction site is replaced by the EK restriction site.

[0222] Example 5: Obtaining botulinum toxin protein

[0223] 1. Plasmid 6 containing different tags and restriction sites was constructed according to the methods described in Examples 1-4 above. 1 μl of plasmid 6 was added to competent Escherichia coli BL21(DE3) (purchased from Beijing Quanshijin Biotechnology Co., Ltd.), heat-shocked at 42°C for 60 seconds, and incubated at 37°C for 1 hour with 800 μl of fresh LB medium. The cells were then spread on solid LB plates (containing 50 μg / mL ampicillin) and cultured overnight at 37°C. A single colony was selected from the plate where a colony grew, and cultured in 10 mL of LB medium (containing 50 μg / mL ampicillin) at 37°C overnight. The next day, the colony was inoculated into 1 L of LB medium. When the OD reached 0.6, IPTG was added to a final concentration of 0.2 mM. The cells were then cultured at 20 to 37°C. After the incubation period, the cells were harvested by centrifugation. The harvested cells were resuspended in buffer and disrupted using an ultrasonic disruptor. The supernatant collected after sonication and centrifugation was the culture product.

[0224] 2. After the culture product is purified, a relatively pure target protein can be obtained. Purification can be performed in two ways:

[0225] The first method is to purify the culture treatment product using a GST or MBP tag purification column, and then continue to purify the purified culture treatment product in a His tag purification column. After the purification is completed, a relatively pure botulinum toxin protein can be obtained.

[0226] The second method is to purify the culture product using a His-tag purification column, and then pass the purified culture product through a strong anion exchange chromatography column (HiTrap Q HP, full name Q Sepharose High Performance), which can also obtain relatively pure botulinum toxin protein.

[0227] 3. The purified target protein is subjected to corresponding enzyme digestion and then purified by molecular sieve chromatography to obtain botulinum toxin protein with higher purity.

[0228] Example 6: Botulinum toxin proteins obtained using different tags and enzyme cleavage sites

[0229] The inventors used different tag combinations (His tag + GST ​​tag or His tag + MBP tag) to obtain the target protein. However, when only one His tag was used, the target protein obtained was not ideal. The experimental results are shown in Figure 10. It can be seen that the protein obtained after purification is very mixed. In order to make the purified protein (Figure 11) purer, the inventors subjected the purified protein to molecular sieve. As a result, the target protein could not be purified more. The reason for this phenomenon may be that the complete protein and the incomplete protein are mixed together and cannot be separated.

[0230] When the inventors used His tags and GST tags, the above five enzyme cleavage sites (3C, TEV, Thrombin, Fxa and EK enzyme cleavage sites) can all be used as ways to obtain the target protein, so the inventors have five ways to obtain the target protein. The inventors obtained the target protein through two-step affinity chromatography purification. In this experimental process, the inventors used the first purification method in Example 5, that is, the purification order of GST tag first and then His tag. The electrophoresis result diagram after the first step of GST tag purification is shown in Figure 11, and the electrophoresis result diagram after the second step of His tag purification is shown in Figure 12. It can be found that the purity of the target protein after two-step tag purification is higher than that after one-step tag purification. The purified target protein is then subjected to enzyme cleavage and molecular sieve chromatography purification to obtain a botulinum toxin protein with a higher final purity (electrophoresis diagram as shown in Figure 13).

[0231] When the inventor replaced the GST tag with an MBP tag, there are 5 ways to obtain the target protein. In this experimental process, the inventor used the second purification method in Example 5, that is, first purifying through the His tag. The electrophoresis result after purification is shown in Figure 14. It can be seen from the figure that the His tag purification can roughly and well obtain the target protein (compared with Figure 10 of the single-tag His). Then it was subjected to a strong anion exchange chromatography column (HiTrap Q HP, full name Q Sepharose High Performance) to obtain a relatively pure target protein. The electrophoresis diagram of the target protein is shown in Figure 15. It can be seen that the target protein was separated relatively purely. After the target protein was enzymatically digested, it was purified by molecular sieve chromatography to obtain a botulinum toxin protein with higher purity (the electrophoresis diagram is shown in Figure 16).

[0232] Example 7: Substrate testing experiment to verify the biological activity of botulinum toxin protein

[0233] Although the above 10 methods (His tag + GST ​​tag or His tag + MBP tag with five enzyme cleavage sites) can all obtain the target protein, whether the target proteins obtained in the 10 methods have biological activity still needs further verification. In order to further verify whether the target proteins obtained in these 10 methods have biological activity, the following experiment was conducted: the botulinum toxin proteins obtained in different forms were prepared into 1 mg / mL stock solutions, and the SNAP25 reaction substrate was also prepared into 1 mg / mL stock solutions. Take 18 μL of botulinum toxin proteins obtained in different forms and 1 μL of SNAP25 substrate, add 1 μL of PBS to a total volume of 20 μL, and enzymatically cleave the SNAP25 substrate overnight at room temperature. The results are shown in Figure 17. It can be seen that the botulinum toxin obtained by combining the MBP purification tag and the Thrombin cleavage site can cleave the SNAP25 (036) protein more thoroughly (it can be seen that there is basically no band at the original position, that is, the cleavage is more thorough, which further shows that the protein obtained by this combination has higher activity); the botulinum toxin obtained by combining the MBP purification tag and the 3C cleavage site or the GST purification tag and the Thrombin / 3C cleavage site also has a good effect on cleaving the SNAP25 protein (compared to 036, the band at the original position has become significantly lighter, indicating that the protein activity obtained by these two combinations is also better).

[0234] Example 8 In vivo experiment

[0235] In order to further verify whether the botulinum toxin prepared according to the present invention can exert a better effect in vivo, the inventors prepared a botulinum toxin with a purification tag of MBP tag and His tag and a cleavage site of 3C according to the above method. The botulinum toxin prepared by this combination was named (030-3c(WT)3(t1)) and injected into mice to observe acute toxic reactions and calculate the median lethal dose.

[0236] To observe the acute toxicity of 030-3c(WT)3(t1) in mice after a single intraperitoneal injection, mice were injected with 030-3C(WT)3(t1) at doses of 3.335, 2.000, 1.200, 0.720, 0.432, 0.259, 0.156, and 0.093 ng / kg, respectively. The status of the mice was observed within 7 days after administration, and the median lethal dose (50% lethal dose, LD50) was calculated as follows:

[0237] 80 Kunming mice, half male and half female, 5 females and 5 males per group, weighing 18-28 g, were purchased from the Animal Experiment Center of Lanzhou University. Animal qualification certificate number: No. 62000800000298

[0238] 1. Grouping: 80 mice, half male and half female. Weigh 40 male mice and randomly assign them to 8 groups, numbered 1, 2, 3, 4, and 5, based on weight. Forty female mice were randomly assigned to 8 groups, numbered 6, 7, 8, 9, and 10, based on weight. Ensure that each of the 8 groups contains 10 mice, with 50% male and 50% female. Each of the 8 groups serves as a single drug dose group.

[0239] 2. Administration: The 030-3c(WT)3(t1) drug was a colorless liquid with a drug concentration of 0.77 mg / ml. A 0.01 M PBS solution containing 0.2% gelatin was used as the drug diluent. The 0.77 mg / ml drug stock solution was prepared to concentrations of 6.6670, 4.0010, 2.4006, 1.4403, 0.8642, 0.5185, 0.3111, and 0.1866 ng / ml, respectively. At these concentrations, the eight groups of mice were intraperitoneally injected with a volume of 0.5 ul / g. That is, the dosages for the eight groups were 3.335, 2.000, 1.200, 0.720, 0.432, 0.259, 0.156, and 0.093 ng / kg, respectively.

[0240] The experimental results are as follows:

[0241] 1. Animal responses in each dose group after administration

[0242] (1) 3.335 ng / kg dose group:

[0243] Deaths: 10 Survivors: 0

[0244] Post-drug observations: 8 minutes after intraperitoneal injection, male mice began scratching their ears and eyes frequently. This scratching gradually decreased after 25 minutes, and eventually ceased. 15 minutes after injection, female mice began scratching their ears and eyes frequently. This scratching gradually decreased after 40 minutes, and after 60 minutes, both males and females completely stopped scratching and returned to normal. Nine mice were found dead 20 hours later, and another died of systemic convulsions 27 hours later. Post-mortem examination revealed gas bubbles and mild ulceration in the intestines of all mice, with some mice exhibiting mild intestinal bleeding. The dissection is shown in Figure 18.

[0245] (2) 2.000 ng / kg dose group:

[0246] Deaths: 10 Survivors: 0

[0247] Observation after administration: 12 minutes after intraperitoneal injection, male mice began to scratch the back of their ears and eyes frequently. After 30 minutes, the frequency of scratching gradually decreased until it stopped. 20 minutes after injection, female mice began to scratch the back of their ears and eyes frequently. After 40 minutes, the frequency of scratching gradually decreased. After 60 minutes, both male and female mice completely stopped scratching and returned to normal. Six mice were found dead 20 hours later, another mouse died of whole-body convulsions 22 hours later, and three mice died of whole-body convulsions 24 hours later. At the time of death, the mice first slowed down their movements, became dizzy, and had large breathing fluctuations before they began to convulse. After autopsy, gross examination revealed bubbles in the intestines, slight ulceration, no bleeding in the intestinal cavity, and no abnormalities in other organs. The autopsy is shown in Figure 19.

[0248] (3) 1.200 ng / Kg dose group:

[0249] Death toll: 9 Survival toll: 1

[0250] Post-drug observations: 15 minutes after intraperitoneal injection, male mice began scratching their ears and eyes frequently. This scratching gradually decreased after 40 minutes, and eventually ceased. 25 minutes after injection, female mice began scratching their ears and eyes frequently. This scratching gradually decreased after 50 minutes, and after 60 minutes, both males and females completely stopped scratching and returned to normal. Three mice were found dead 20 hours later, three others died of convulsions after 26 hours, two died of convulsions after 29 hours, and one died of convulsions after 32 hours. At death, the mice initially showed slowed movements, dizziness, and rapid breathing, followed by convulsions. Post-mortem examination revealed gas bubbles and mild ulceration in the intestines, but no bleeding was observed. Other organs showed no abnormalities. Surviving animals began scratching their ears and abdomen 32 minutes after observation, but this scratching stopped after 40 minutes. They were observed for 7 days without behavioral abnormalities or significant signs. Body weight changes were recorded. The autopsy is shown in Figure 20.

[0251] (4) 0.720 ng / kg dose group:

[0252] Deaths: 6 Survivors: 4

[0253] Post-drug observations: 20 minutes after intraperitoneal injection, male mice began scratching their ears and eyes frequently. This scratching gradually decreased after 40 minutes, and eventually ceased. 30 minutes after injection, female mice began scratching their ears and eyes frequently. This scratching gradually decreased after 50 minutes, and after 60 minutes, both males and females completely stopped scratching and returned to normal. Two mice were found dead 20 hours later, two others died of systemic convulsions after 24 hours, one died of systemic convulsions after 27 hours, and one died of systemic convulsions after 31 hours. At the time of death, the mice initially showed slowed movements, dizziness, and rapid breathing, followed by systemic convulsions. Post-mortem examination revealed gas bubbles and intestinal distension in all mice, but no ulceration or bleeding was observed. Other organs showed no abnormalities. Surviving animals all exhibited varying degrees of scratching. After the scratching subsided, they were observed for 7 days with no behavioral abnormalities or significant changes. Body weight changes were recorded. The autopsies are shown in Figure 21.

[0254] (5) 0.432 ng / kg dose group:

[0255] Deaths: 4 Survivors: 6

[0256] Observation after administration: 25 minutes after intraperitoneal injection, male mice began to scratch the back of their ears and eyes frequently. After 50 minutes, the frequency of scratching gradually decreased until it stopped. 35 minutes after injection, female mice began to scratch the back of their ears and eyes frequently. After 60 minutes, the frequency of scratching gradually decreased. After 65 minutes, both male and female mice completely stopped scratching and returned to normal. Two mice were found dead 20 hours later, and another two mice died of whole-body convulsions 26 hours later. At the time of death, the mice first slowed down their movements, became dizzy, and had large breathing fluctuations, and then began to convulse. Gross examination after autopsy revealed air bubbles and intestinal distension in all mice. No ulceration was observed, no bleeding in the intestinal cavity, and no abnormalities in other organs. Among the surviving animals, four mice showed varying degrees of scratching reactions. After the scratching stopped, they were observed for 7 consecutive days without abnormal behavior or obvious symptoms. Body weight changes were recorded. The autopsy is shown in Figure 22.

[0257] (6) 0.259 ng / kg dose group:

[0258] Deaths: 2 Survivors: 8

[0259] Observation after administration: 30 minutes after intraperitoneal injection, male mice began to scratch the back of their ears and eyes frequently. After 50 minutes, the number of scratchings gradually decreased until they stopped. 40 minutes after injection, female mice began to scratch the back of their ears and eyes frequently. After 60 minutes, the number of scratchings gradually decreased. After 70 minutes, both male and female mice completely stopped scratching and returned to normal. Two of the mice were found dead 20 hours later. When they died, their movements first slowed down, they became dizzy, their breathing fluctuated greatly, and then they began to convulse all over their bodies. After the autopsy, gross examination showed that there were bubbles and intestinal flatulence in all the mice. No ulceration was observed, no bleeding in the intestinal cavity, and no abnormalities in other organs. Among the surviving animals, 5 mice showed varying degrees of scratching reactions. After the scratching phenomenon disappeared, they were observed for 7 consecutive days without abnormal behavior. The other mice showed no obvious symptoms after administration, and the weight changes were recorded. The autopsy is shown in Figure 23.

[0260] (7) 0.156 ng / kg dose group:

[0261] Deaths: 1 Survivors: 9

[0262] Observation after administration: 30 minutes after intraperitoneal injection, male mice began to scratch the back of their ears and eyes frequently. After 50 minutes, the number of scratchings gradually decreased until they stopped. 40 minutes after injection, female mice began to scratch the back of their ears and eyes frequently. After 60 minutes, the number of scratchings gradually decreased. After 70 minutes, both male and female mice completely stopped scratching and returned to normal. 43 hours after administration, one mouse was found to have slowed movements, dizziness, and large breathing fluctuations. 44 hours later, it began to convulse and die. After autopsy, gross examination showed bubbles and intestinal flatulence in the intestines. No ulceration was observed, no bleeding in the intestinal cavity, and no abnormalities in other organs. Among the surviving animals, 3 mice showed varying degrees of scratching reactions. After the scratching phenomenon disappeared, the behavior was observed for 7 consecutive days without abnormalities. No obvious symptoms were observed in other mice after administration, and weight changes were recorded. The autopsy is shown in Figure 24.

[0263] (8) 0.093ng / Kg dose group:

[0264] Deaths: 0 Survivors: 10

[0265] Post-drug observations: 35 minutes after intraperitoneal injection, two male mice began to scratch their faces slightly. This scratching gradually decreased and ceased after 45 minutes. A female mouse also began to scratch her eyes slightly 45 minutes after injection. This scratching gradually decreased after 55 minutes, and both male and female mice completely stopped scratching and returned to normal after 60 minutes. No behavioral abnormalities were observed for 7 consecutive days, and body weight changes were recorded. No animals died.

[0266] 2. Calculation of median lethal dose using the Bliss method

[0267] The median lethal dose (LD) was calculated from the above results. As shown in Table 1, the regression equation y(Probit) = 5.9644 + 3.174Log(D) and the median lethal dose (LD) was 1. 50 =0.49676ng / kg, LD 50 (Feiller correction) 95% confidence limit = 0.36659 ~ 0.6715ng / kg, LD5 = 0.15063ng / kg, LD 95 =1.6383ng / kg.

[0268] The above results show that the LD 50 It is 0.49676 ng / kg, and the 95% confidence limit is 0.36659~0.6715 ng / kg, indicating that it has a high activity, which is equivalent to the activity of commercial botulinum toxin.

[0269] Table 1 Calculation of median lethal dose by Bliss method

[0270] In the description of this specification, the reference terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.

[0271] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.

Claims

1. An isolated nucleic acid, characterized in that, Comprising: A first nucleic acid fragment, a second nucleic acid fragment, a first modification tag, and a second modification tag, wherein the first nucleic acid fragment, the second nucleic acid fragment, the first modification tag, and the second modification tag are connected; wherein, The first nucleic acid fragment encodes the heavy chain of botulinum toxin; The second nucleic acid fragment encodes the light chain of botulinum toxin; The first modification tag encodes a His tag; The second modification tag encodes a GST tag or encodes an MBP tag.

2. The nucleic acid according to claim 1, characterized in that, Further comprising a first cleavage site, a second cleavage site, and a third cleavage site; The first cleavage site, the second cleavage site, and the third cleavage site are the same; The first cleavage site, the second cleavage site, and the third cleavage site encode a 3C cleavage site, encode a TEV cleavage site, encode a Thrombin cleavage site, encode an Fxa cleavage site, or encode an Enterokinase cleavage site.

3. The nucleic acid according to claim 1 or 2, characterized in that, The first modification tag encodes a His tag, the second modification tag encodes a GST tag, and the first cleavage site, the second cleavage site, and the third cleavage site encode a 3C cleavage site or encode a Thrombin cleavage site; 4. The nucleic acid according to claim 1 or 2, characterized in that, The first modification tag encodes a His tag, the second modification tag encodes an MBP tag, and the first cleavage site, the second cleavage site, and the third cleavage site encode a 3C cleavage site or encode a Thrombin cleavage site.

5. The nucleic acid according to any one of claims 1 to 4, characterized in that, The 5' end of the first modification tag is connected to the 3' end of the first cleavage site, the 5' end of the first cleavage site is connected to the 3' end of the first nucleic acid fragment, the 5' end of the first nucleic acid fragment is connected to the 3' end of the second cleavage site, the 5' end of the second cleavage site is connected to the 3' end of the second nucleic acid fragment, the 5' end of the second nucleic acid fragment is connected to the 3' end of the third cleavage site, and the 5' end of the third cleavage site is connected to the 3' end of the second modification tag.

6. The nucleic acid according to any one of claims 1 to 5, characterized in that, The first nucleic acid fragment has the nucleotide sequence shown in SEQ ID NO:1; The second nucleic acid fragment has the nucleotide sequence shown in SEQ ID NO:2; The encoding of the His tag has the nucleotide sequence shown in SEQ ID NO:3; The encoding of the GST tag has the nucleotide sequence shown in SEQ ID NO:4; The encoding of the MBP tag has the nucleotide sequence shown in SEQ ID NO:5; The encoding of the 3C cleavage site has the nucleotide sequence shown in SEQ ID NO:6; The encoding of the TEV cleavage site has the nucleotide sequence shown in SEQ ID NO:7; The encoding of the Thrombin cleavage site has the nucleotide sequence shown in SEQ ID NO:8; The encoding of the Fxa cleavage site has the nucleotide sequence shown in SEQ ID NO:9; The encoding of the Enterokinase cleavage site has the nucleotide sequence shown in SEQ ID NO:

10.

7. A vector, characterized in that, The vector carries the nucleic acid according to any one of claims 1 to 6; The vector is selected from plasmids.

8. A recombinant cell, characterized in that, Comprising the nucleic acid according to any one of claims 1 to 6 or the vector according to claim 7; The cells are selected from prokaryotic cells or eukaryotic cells; The cells are selected from Escherichia coli, yeast, cyanobacteria or mammalian cell lines.

9. A method for obtaining recombinant protein botulinum toxin, characterized in that, Comprising: Culturing the recombinant cells according to claim 8 under conditions suitable for protein expression; Purifying the product of the culturing treatment; Performing enzymatic cleavage on the purified product to obtain the recombinant protein botulinum toxin.

10. The method according to claim 9, characterized in that, The purification treatment is carried out in the following manner: Performing a first purification treatment on the product of the culturing treatment, and the first purification treatment is carried out in a second modified tag purification column; Performing a second purification treatment on the product of the culturing treatment after the first purification treatment, and the second purification treatment is carried out in a first modified tag purification column.

11. The method according to claim 9, wherein, The purification treatment is carried out in the following manner: Performing a first purification treatment on the product of the culturing treatment, and the first purification treatment is carried out in a GST tag purification column; Performing a second purification treatment on the product of the culturing treatment after the first purification treatment, and the second purification treatment is carried out in a His tag purification column. The site of the enzymatic cleavage is the 3C enzymatic cleavage site or the Thrombin enzymatic cleavage site.

12. The method according to claim 9, wherein, The purification treatment is carried out in the following manner: Performing a first purification treatment on the product of the culturing treatment, and the first purification treatment is carried out in an MBP tag purification column; Performing a second purification treatment on the product of the culturing treatment after the first purification treatment, and the second purification treatment is carried out in a His tag purification column. The site of the enzymatic cleavage is the 3C enzymatic cleavage site or the Thrombin enzymatic cleavage site.

13. The method according to claim 9, wherein, The purification treatment is carried out in the following manner: Performing a third purification treatment on the product of the culturing treatment, and the third purification treatment is carried out in a His tag purification column; Performing a fourth purification treatment on the product of the culturing treatment after the third purification treatment, and the fourth purification treatment is carried out in a strong anion exchange chromatography column; The site of the enzymatic cleavage is the 3C enzymatic cleavage site or the Thrombin enzymatic cleavage site.

14. A recombinant protein botulinum toxin, wherein, Obtained by the method according to any one of claims 9 to 13.

15. A composition, wherein, Comprising the nucleic acid according to any one of claims 1 to 6, the vector according to claim 7, the recombinant cells according to claim 8 or the recombinant protein botulinum toxin according to claim 14.

16. Use of the nucleic acid according to any one of claims 1 to 6, the vector according to claim 7, the recombinant cell according to claim 8, the recombinant protein botulinum toxin according to claim 14 or the composition according to claim 15 in the preparation of a medicament for preventing or treating a disease.

17. The use according to claim 16, wherein, The diseases include neuromuscular diseases, and the symptoms of the diseases include: spastic dysphonia, spasmodic torticollis, laryngeal dystonia, oromandibular dystonia, lingual dystonia, cervical dystonia, focal dystonia, blepharospasm, strabismus, hemifacial spasm, eyelid disorder, cerebral palsy, focal spasm, spastic colitis, neurogenic detrusor overactivity, idiopathic detrusor overactivity, pelvic floor dyssynergia, limb spasm, motor tics, essential hand tremor, head tremor, detrusor-sphincter dyssynergia, bruxism, anal fissure, akinesia, dysphagia, hyperhidrosis, sialorrhea, excessive gastrointestinal secretion, secretion disorder, pain caused by muscle spasm, chronic migraine or skin diseases, one or several of them.

18. Use of the nucleic acid according to any one of claims 1 to 6, the vector according to claim 7, the recombinant cell according to claim 8, the recombinant protein botulinum toxin according to claim 14 or the composition according to claim 15 in the preparation of a reagent for interfering with neurotransmitter release of isolated nerve cells or improving related symptoms of an organism by interfering with neurotransmitter release of the organism, preferably, the reagent is used for beauty treatment.

19. A method for preventing or treating a neuromuscular disease, wherein, Comprising: Administering to a subject an effective amount of the nucleic acid according to any one of claims 1 to 6, the vector according to claim 7, the recombinant cell according to claim 8, the recombinant protein botulinum toxin according to claim 14, or the composition according to claim 15.

Citation Information

Patent Citations

  • Modified single-chain polypeptide of neurotoxin and application thereof

    CN114957482A

  • Recombinant botulinum toxin and preparation method thereof

    CN115785237A

  • Botulinum toxin protein composition

    CN116440281A

  • Preparation method and application of botulinum toxin A

    CN116813727A

  • Botulinum toxin protein composition, method for preparing same, and use thereof

    TW202339791A