Thermoresponsive multi-emulsion and nucleic acid amplification method using same

Abstract

The present disclosure relates to a thermoresponsive W / O / W (water-oil-water)-type emulsion composition comprising: an inner phase including water-in-oil type droplets containing a PCR primer and a probe; and an outer phase, which is an aqueous phase, a nucleic acid amplification device comprising the same, and a nucleic acid amplification method. According to the present disclosure, primers and / or probes required for nucleic acid detection or diagnosis are delivered through the thermoresponsive multi-emulsion composition, allowing for their stable storage until the PCR reaction begins, at which point they are released. Accordingly, non-specific reactions that may occur before PCR can be prevented, each composition can be prepared in a target-specific manner, and multiplex diagnosis can be implemented by simply performing PCR after nucleic acids extracted from a specimen are added to a reaction reagent containing the composition.

Description

Thermally reactive multiple emulsion and nucleic acid amplification method using the same

[0001] Cross-reference to related applications

[0002] This application claims priority to Republic of Korea Patent Application No. 10-2023-0179387, filed December 12, 2023, the entire contents of which are incorporated herein by reference.

[0003] Technology field

[0004] Disclosed herein are a nucleic acid amplification device and method using an emulsion.

[0005] Description of nationally supported research and development

[0006] This study was conducted through the following national project.

[0007] -Ministry Name: Ministry of Science and ICT, Project Management (Specialist) Organization Name: National Research Council of Science and Technology, Research Project Name: National Research Council of Science and Technology Research Operational Expenses Support (R&D) (Main Project Expenses), Research Project Name: Development of Electric High-Risk Disaster Medical and Industrial Accident Response Technology, Project Number: CRC-20-02-KIST, Project Unique Number: 1711151313

[0008] In multiplex diagnostics, there is a growing need for technologies capable of simultaneously analyzing multiple target nucleic acids in a single channel using polymerase chain reaction (PCR) to increase diagnostic reliability and precision. However, current technologies only allow multiplexing of up to 10 genes in a single reaction, using different fluorescence wavelengths or varying nucleic acid melting temperatures. Even this technology, when performing multiple target PCRs in a single reaction, requires a high level of computation for primer design to reduce nonspecific signals, limiting its utility. Consequently, for emerging infectious diseases or variants, these reagents are often released as standalone reagents rather than added to existing multiplex diagnostic kits. However, this approach requires multiple reactions from a single sample, making diagnostic testing more expensive and time-consuming. For example, in the case of diagnostic technologies using microwells in which each well is pre-loaded with reaction reagents, including primers and probes, the unit cost of manufacturing the microwell array is high, and the process of pre-loading the reagents into each well is also complicated. Moreover, since the well configuration must be completely changed in the event of a new infectious disease variant or mutation, it takes a long time to respond. In the case of diagnostic technologies using microchambers in which different primers react in each chamber, there is a disadvantage in that the operating cost is high because a microfluidic chip with complex valve control is required.

[0009] Therefore, there is a need to develop a diagnostic technology capable of multiplexing without the need for complex primer design, including multiple reactors within a single channel in a simpler form.

[0010] The problem to be solved in the present disclosure is to provide a composition for nucleic acid diagnosis with improved storage stability and accuracy of PCR primers and probes, and a nucleic acid amplification device including the same.

[0011] The problem to be solved in the present disclosure is to provide a composition for nucleic acid amplification capable of multiplex diagnosis in a simpler form, and a nucleic acid amplification device including the same.

[0012] In order to solve the above problems, one embodiment of the present disclosure comprises an inner layer including a water-in-oil type droplet; and

[0013] Including the award-winning trauma

[0014] It is an emulsion composition of the W1 / O / W2 (water1-oil-water2) type,

[0015] The above water-in-oil (W1 / O) droplet contains at least one of a PCR (polymerase chain reaction) primer and probe in the inner phase, the water phase (W1),

[0016] The above emulsion composition is heat-reactive,

[0017] A multiple emulsion composition is provided.

[0018] In addition, one embodiment of the present disclosure comprises the above multi-emulsion emulsion composition; and

[0019] A reaction chamber in which the above multi-emulsion emulsion composition is arranged;

[0020] A nucleic acid amplification device including a

[0021] In addition, one embodiment of the present disclosure is a nucleic acid amplification method, comprising the steps of: injecting the multi-emulsion emulsion composition into a reaction chamber; and

[0022] A step of amplifying the target nucleic acid by polymerase chain reaction (PCR) of the target nucleic acid;

[0023] A nucleic acid amplification method including:

[0024] In the case of conventional solution PCR, when detecting multiple types of target nucleic acids, multiple PCRs must be performed through primer and probe handling for each, which has the disadvantage of being time-consuming and complicated. However, according to the present disclosure, each composition can be manufactured target-specifically, and multiple types of target nucleic acids can be detected by adding nucleic acids extracted from a specimen to a reaction reagent containing the composition and performing only one PCR, thereby resolving primer and probe handling issues and enabling simultaneous multiplex diagnosis. In addition, according to the present disclosure, primers and / or probes required for nucleic acid detection or diagnosis are delivered through a thermoresponsive multiplex emulsion composition, so that the primers and / or probes can be stably stored until the PCR reaction and released when the PCR reaction begins, thereby preventing nonspecific reactions that may occur before the PCR reaction. Therefore, the present disclosure can quickly respond and diagnose when a new variant virus or new mutation occurs by simply adding target nucleic acids.

[0025] FIG. 1 is a schematic diagram illustrating the structure of an emulsion composition of a multi-emulsion formulation comprising a water-in-oil droplet (W1 / O) containing a water 1 droplet (W1) within an oil globule (O) in a water 2 continuous phase (W2) according to one embodiment of the present disclosure.

[0026] FIG. 2a is an image of a multi-emulsion formulation of a composition according to one embodiment of the present disclosure, confirmed by a transmission electron microscope (TEM).

[0027] FIG. 2b is an image of a multi-emulsion formulation of a composition according to one embodiment of the present disclosure, confirmed by a transmission electron microscope (TEM).

[0028] FIG. 3 is a schematic diagram illustrating the effect of a composition according to one embodiment of the present disclosure on suppressing the generation of non-specific amplification products in PCR.

[0029] FIG. 4 is a schematic diagram showing the structure of a composition in which the trauma is a hydrogel and a method for simultaneously detecting a target nucleic acid (target gene) by arranging a plurality of hydrogels (A, B, C, D) in one PCR chamber using the same as an embodiment of the present disclosure.

[0030] FIG. 5 is an image of a multi-emulsion formulation containing water-in-oil droplets inside a hydrogel state as an example of the present disclosure, confirmed by a scanning electron microscope (SEM).

[0031] FIG. 6 is a diagram comparing the fluorescence levels of each hydrogel particle to confirm the particle uniformity of a multi-emulsion emulsion composition in the form of a hydrogel formulation as an example of the present disclosure.

[0032] FIG. 7 is a diagram showing the results of confirming the formulation stability according to the content of a lipophilic surfactant included in a composition according to one embodiment of the present disclosure.

[0033] FIG. 8 is a diagram showing the results of analyzing the particle size of water-in-oil droplets according to the content of a lipophilic surfactant included in a composition according to one embodiment of the present disclosure.

[0034] FIG. 9 is a diagram showing the results of confirming the emulsion particle size distribution and the uniformity of emulsion particles according to the surfactant concentration of a multi-emulsion emulsion composition (W1 / O / W2) according to one embodiment of the present disclosure.

[0035] FIG. 10 is a diagram confirming the formulation stability according to the types of oil and surfactant included in the oil phase in a multi-emulsion emulsion composition (W1 / O / W2) according to one embodiment of the present disclosure.

[0036] FIG. 11a is a diagram showing the melting point (Tm) of a water-in-oil emulsion (W1 / O) according to the type of lipophilic surfactant as an example of the present disclosure.

[0037] FIG. 11b is a diagram showing the melting point (Tm) of a water-in-oil emulsion (W1 / O) according to the type of lipophilic surfactant as an example of the present disclosure.

[0038] FIG. 11c is a diagram showing the melting point (Tm) of a water-in-oil emulsion (W1 / O) according to the type of lipophilic surfactant as an example of the present disclosure.

[0039] FIG. 11d is a diagram showing the melting point (Tm) of a water-in-oil emulsion (W1 / O) according to the type of lipophilic surfactant as an example of the present disclosure.

[0040] FIG. 11e is a diagram showing the melting point (Tm) of a water-in-oil emulsion (W1 / O) according to the type of lipophilic surfactant as an example of the present disclosure.

[0041] FIG. 11f is a diagram showing the melting point (Tm) of a water-in-oil emulsion (W1 / O) according to the type of lipophilic surfactant as an example of the present disclosure.

[0042] FIG. 11g is a diagram showing the melting point (Tm) of a water-in-oil emulsion (W1 / O) according to the type of lipophilic surfactant as an example of the present disclosure.

[0043] FIG. 12a is a diagram showing the melting point (Tm) of an oil-in-water emulsion (O / W2) according to the type of lipophilic surfactant as an example of the present disclosure.

[0044] FIG. 12b is a diagram showing the melting point (Tm) of an oil-in-water emulsion (O / W2) according to the type of lipophilic surfactant as an example of the present disclosure.

[0045] FIG. 12c is a diagram showing the melting point (Tm) of an oil-in-water emulsion (O / W2) according to the type of lipophilic surfactant as an example of the present disclosure.

[0046] FIG. 12d is a diagram showing the melting point (Tm) of an oil-in-water emulsion (O / W2) according to the type of lipophilic surfactant as an example of the present disclosure.

[0047] FIG. 12e is a diagram showing the melting point (Tm) of an oil-in-water emulsion (O / W2) according to the type of lipophilic surfactant as an example of the present disclosure.

[0048] FIG. 12f is a diagram showing the melting point (Tm) of an oil-in-water emulsion (O / W2) according to the type of lipophilic surfactant as an example of the present disclosure.

[0049] FIG. 13a is a diagram showing the melting point (Tm) of an oil-in-water emulsion (O / W2) according to the type of hydrophilic surfactant as an example of the present disclosure.

[0050] FIG. 13b is a diagram showing the melting point (Tm) of an oil-in-water emulsion (O / W2) according to the type of hydrophilic surfactant as an example of the present disclosure.

[0051] FIG. 13c is a diagram showing the melting point (Tm) of an oil-in-water emulsion (O / W2) according to the type of hydrophilic surfactant as an example of the present disclosure.

[0052] FIG. 13d is a diagram showing the melting point (Tm) of an oil-in-water emulsion (O / W2) according to the type of hydrophilic surfactant as an example of the present disclosure.

[0053] FIG. 13e is a diagram showing the melting point (Tm) of an oil-in-water emulsion (O / W2) according to the type of hydrophilic surfactant as an example of the present disclosure.

[0054] FIG. 13f is a diagram illustrating the melting point (Tm) of an oil-in-water emulsion (O / W2) according to the type of hydrophilic surfactant as an example of the present disclosure.

[0055] FIG. 13g is a diagram showing the melting point (Tm) of an oil-in-water emulsion (O / W2) according to the type of hydrophilic surfactant as an example of the present disclosure.

[0056] FIG. 13h is a diagram showing the melting point (Tm) of an oil-in-water emulsion (O / W2) according to the type of hydrophilic surfactant as an example of the present disclosure.

[0057] FIG. 13i is a diagram showing the melting point (Tm) of an oil-in-water emulsion (O / W2) according to the type of hydrophilic surfactant as an example of the present disclosure.

[0058] FIG. 13j is a diagram showing the melting point (Tm) of an oil-in-water emulsion (O / W2) according to the type of hydrophilic surfactant as an example of the present disclosure.

[0059] FIG. 13k is a diagram showing the melting point (Tm) of an oil-in-water emulsion (O / W2) according to the type of hydrophilic surfactant as an example of the present disclosure.

[0060] FIG. 13l is a diagram showing the melting point (Tm) of an oil-in-water emulsion (O / W2) according to the type of hydrophilic surfactant as an example of the present disclosure.

[0061] FIG. 14a is a diagram showing the thermal reactivity of a multiple emulsion composition according to the type of lipophilic surfactant when Tween20 (0.25 w / w%) is used as a hydrophilic surfactant as an example of the present disclosure.

[0062] FIG. 14b is a diagram showing the thermal reactivity of a multiple emulsion composition according to the type of lipophilic surfactant when Tween20 (0.25 w / w%) is used as a hydrophilic surfactant as an example of the present disclosure.

[0063] FIG. 14c is a diagram showing the thermal reactivity of a multiple emulsion composition according to the type of lipophilic surfactant when Tween20 (0.25 w / w%) is used as a hydrophilic surfactant as an example of the present disclosure.

[0064] FIG. 14d is a diagram showing the thermal reactivity of a multiple emulsion composition according to the type of lipophilic surfactant when Tween20 (0.25 w / w%) is used as a hydrophilic surfactant as an example of the present disclosure.

[0065] FIG. 14e is a diagram showing the thermal reactivity of a multiple emulsion composition according to the type of lipophilic surfactant when Tween20 (0.25 w / w%) is used as a hydrophilic surfactant as an example of the present disclosure.

[0066] FIG. 14f is a diagram showing the thermal reactivity of a multiple emulsion composition according to the type of lipophilic surfactant when Tween20 (0.25 w / w%) is used as a hydrophilic surfactant as an example of the present disclosure.

[0067] FIG. 15a is a diagram showing the thermal reactivity of a multiple emulsion composition according to the type of lipophilic surfactant when Tween85 (0.09 w / w%) is used as a hydrophilic surfactant as an example of the present disclosure.

[0068] FIG. 15b is a diagram showing the thermal reactivity of a multiple emulsion composition according to the type of lipophilic surfactant when Tween85 (0.09 w / w%) is used as a hydrophilic surfactant as an example of the present disclosure.

[0069] FIG. 15c is a diagram showing the thermal reactivity of a multiple emulsion composition according to the type of lipophilic surfactant when Tween85 (0.09 w / w%) is used as a hydrophilic surfactant as an example of the present disclosure.

[0070] FIG. 16a is a diagram showing the thermal reactivity of a multiple emulsion composition according to the type of lipophilic surfactant when TritonX-100 (0.1275 w / w%) is used as a hydrophilic surfactant as an example of the present disclosure.

[0071] FIG. 16b is a diagram showing the thermal reactivity of a multiple emulsion composition according to the type of lipophilic surfactant when TritonX-100 (0.1275 w / w%) is used as a hydrophilic surfactant as an example of the present disclosure.

[0072] FIG. 16c is a diagram showing the thermal reactivity of a multiple emulsion composition according to the type of lipophilic surfactant when TritonX-100 (0.1275 w / w%) is used as a hydrophilic surfactant as an example of the present disclosure.

[0073] FIG. 17 is a diagram showing the thermal reactivity of a multiple emulsion composition according to the type of lipophilic surfactant when Tween80 (0.25 w / w%) is used as a hydrophilic surfactant as an example of the present disclosure.

[0074] FIG. 18 is a diagram showing the results (right) of confirming the effect of reducing non-specific reactions when a liquid multi-emulsion emulsion composition of one embodiment of the present disclosure is supplied to a liquid phase and liquid RT-qPCR is performed, comparing it with the control group (left).

[0075] Figure 19 is a diagram showing the results of confirming the RT-qPCR efficiency of Comparative Example 1 according to the prior art.

[0076] Figure 20 is a diagram showing the results of confirming the RT-qPCR efficiency of Example 3 according to one embodiment of the present disclosure.

[0077] Figure 21 is a diagram showing the results of confirming the RT-qPCR efficiency of Example 4 according to one embodiment of the present disclosure.

[0078] FIG. 22 is a diagram showing the results of confirming the qPCR efficiency of Example 2, which is a multi-emulsion composition in the form of a hydrogel formulation, as an example of the present disclosure.

[0079] FIG. 23 is a diagram showing the results of confirming the qPCR efficiency of Example 2, which is a multi-emulsion composition in the form of a hydrogel formulation, as an example of the present disclosure.

[0080] FIG. 24 is a diagram showing the results of confirming the RT-qPCR efficiency of Example 2, which is a multi-emulsion composition in the form of a hydrogel formulation, as an example of the present disclosure.

[0081] Figure 25 is a diagram showing the RT-qPCR results of the control group NTC (No Template Control) in Test Example 9.

[0082] FIG. 26 is a diagram showing the results of performing multiple diagnosis according to one embodiment of the present disclosure.

[0083] Figure 27 is a diagram showing the results of performing multiple diagnosis according to one embodiment of the present disclosure.

[0084] Hereinafter, preferred embodiments of the present disclosure will be described in detail with reference to the attached drawings.

[0085] The embodiments of the present disclosure disclosed in the text are merely illustrative and exemplary, and the embodiments of the present disclosure may be implemented in various forms and should not be construed as limited to the embodiments described herein. The present disclosure may undergo various modifications and take various forms, and the embodiments are not intended to limit the present disclosure to a specific disclosure form, but should be understood to include all modifications, equivalents, and alternatives falling within the spirit and technical scope of the present disclosure.

[0086] Singular expressions include plural expressions unless the context clearly dictates otherwise. In this application, terms such as "comprise" or "have" are intended to indicate the presence of a feature, number, step, operation, component, part, or combination thereof described in the specification, but do not exclude the possibility of the presence or addition of one or more other features, numbers, steps, operations, components, parts, or combinations thereof.

[0087] One embodiment of the present disclosure provides a W1 / O / W2 (water1-oil-water2) type emulsion composition comprising an inner phase comprising water-in-oil type droplets and an outer phase comprising an aqueous phase. In this case, the water-in-oil (W1 / O) type droplets include at least one of a PCR (polymerase chain reaction) primer and a probe in the inner phase, the aqueous phase (W1), and the emulsion composition may be thermoreactive.

[0088] In the present disclosure, 'thermoreactivity' means a characteristic in which, as the temperature increases, the instability of the surfactant increases, resulting in separation of the oil phases, whereby the innermost phase (W1) of the composition is released outside the oil phase (O), and the water phase (W1) and the outer phase (W2) are united, so that the PCR primers and / or probes contained in the water phase (W1) are released outside the water-in-oil (W1 / O) droplets. The critical temperature at which such thermal reactivity appears, i.e., the release temperature of the contained PCR primers and / or probes, can be controlled depending on the type, concentration, and / or oil type of the surfactant contained in the composition. For example, the critical temperature can be higher than 55°C, higher than 56°C, higher than 57°C, higher than 58°C, higher than 59°C, or higher than 60°C.

[0089] The attached drawing 1 illustrates an exemplary form of the present disclosure. Referring to drawing 1, a composition (Emulsion) according to the present disclosure may be an emulsion composition of a multiple emulsion formulation comprising a water-in-oil droplet (W1 / O) including a water phase (Water 1 droplet, W1) in an oil phase (oil globule, O) in an external phase (Water 2 continuous phase, W2). In one embodiment, the water-in-oil droplet (W1 / O) included in the composition may be one or multiple as exemplarily illustrated in drawing 1. Specifically, the number of the droplets is 10. 11 Less than 10 pcs / μl 10 Less than 10 pcs / μl 9 Less than 10 pcs / μl 8 Less than 10 pcs / μl 7 Less than 10 pcs / μl 6 Less than 10 pcs / μl 5 Less than 10 pcs / μl 4 Less than 10 pcs / μl 3 Less than 10 pcs / μl 2 Less than or equal to 10 / μl 11The number of water droplets (W1) contained in one water-in-oil type droplet (W1 / O) may be 1, or 2 or more as exemplarily illustrated in FIG. 1. Specifically, the number of water droplets (W1) may be 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, or 10 or more, and may be 50 or less, 40 or less, 30 or less, 20 or less, or 10 or less. If the number of water phases (W1) included in the above composition is too small, the amount of reagents participating in the reaction may be too small, so that the reaction may not occur well, and if the amount of oil phase is relatively too large, it may cause a decrease in the fluorescence signal according to the reaction. If the number of water phases (W1) is too large, the reaction buffer composition may be changed during the process of the water phase (W1) being released out of the oil phase (O), thereby reducing the reaction efficiency, and if the amount of oil phase is relatively too small, the formulation stability may be reduced.

[0090] FIG. 2a and FIG. 2b are images of a multi-emulsion formulation of a composition according to one embodiment of the present disclosure, confirmed by a transmission electron microscope (TEM), in which the innermost phase (W1) and the outermost phase (W2) are separated by an oil film of the oil phase (O) and are stably dispersed with each other.

[0091] In addition, as exemplarily illustrated in FIG. 1, in one embodiment, the outer layer (W2) of the composition may include components necessary for a PCR reaction other than the PCR primer and / or probe included in the inner layer (W1). For example, as illustrated in FIG. 1, the composition may include a PCR primer, an RT primer used for reverse transcription reaction to convert RNA into DNA, a probe, etc. Alternatively, the outer layer (W2) may include a PCR reagent mixture containing components necessary for the PCR reaction described above.

[0092] FIG. 3 is a diagram illustrating the action of a composition according to an embodiment of the present disclosure in PCR. Specifically, according to the present disclosure, the water-in-oil droplets (W1 / O) (emulsion in FIG. 3) of the composition have thermoreactivity, so that in the reverse transcription (RT) step performed at about 55°C or lower, the water phase of the water-in-oil droplets can be contained within an oil film to maintain the droplet shape, and in the qPCR step performed at a temperature of about 95°C, as the instability of the droplets increases, phase separation of the oil phase (O) and the water phase (W1) occurs, and the water phase (W1) and the external water phase (W2) unite, so that the PCR primers contained in the droplets can be released from the W1 / O droplets. That is, since the composition according to one embodiment of the present disclosure safely stores the PCR primer inside the droplet and releases the PCR primer at the stage where the PCR primer is needed, not only does a non-specific reaction by the PCR primer not occur in the reverse transcription stage, but also the generation of non-specific amplification products in the PCR stage can be suppressed, thereby improving the RNA detection limit (LoD) and enabling quantitative analysis of even a small amount of RNA. In addition, as one embodiment, when a probe is included in the water-in-oil type droplet (W1 / O), the probe can be stored in the reverse transcription stage and damage to the probe can be prevented, thereby maintaining its function in the subsequent PCR process, thereby solving the problem that, when a probe is included in a conventional thermosensitive solid phase particle, the reporter and quencher are damaged by the radical chain reaction and thus the cross-linking reaction cannot be applied. When a probe is included, as one embodiment, there is an advantage in that damage caused by the radical chain reaction that occurs when curing with a hydrogel formulation can be prevented, thereby maintaining the function in the subsequent PCR process.

[0093] As an example, the PCR primer and RT primer may each be, but are not limited to, one or more nucleic acids selected from DNA, RNA, LNA, and PNA. In this case, the PCR primer and RT primer may each be 10 to 100 bases, more specifically 20 to 50 bases, but the sequence type and sequence length of each primer may be modified without limitation depending on the target nucleic acid.

[0094] In one embodiment, the probe may be a selective fluorescent probe. The fluorescent probe binds to the target nucleic acid and provides a fluorescent signal, thereby enabling real-time detection of the target nucleic acid. In one embodiment, since the fluorescent intensity also increases as the target nucleic acid is amplified by a PCR reaction, the amplified target nucleic acid can be quantified by detecting the fluorescent intensity. The fluorescent probe may be used without limitation in type as long as it binds complementarily to the target nucleic acid and exhibits fluorescent properties. For example, the selective fluorescent probe may include a TaqMan probe, etc. As an example, the TaqMan probe is a nucleic acid modified with a fluorescent substance (such as FAM) at the 5' end and a quencher substance (such as BHQ) at the 3' end. It specifically hybridizes and binds to template DNA in the annealing step, but fluorescence generation is suppressed by the quencher on the probe, and during the extension reaction, the Taq DNA polymerase has a 5'→ exonuclease activity to decompose the TaqMan probe hybridized and bound to the template, releasing the fluorescent dye from the probe, thereby releasing the suppression by the quencher and causing fluorescence to be emitted. As an example, the probe may include a FRET pair (fluorescence resonance energy transfer pair) in which the quencher is not a universal quencher, but rather shifts the emission wavelength to prevent fluorescence detection, and an example thereof may be a FAM-TAMRA pair. In an example, the water phase (W1) of the water-in-oil type droplet (W1 / O) may include a substance having an upper critical solution temperature (UCST) of 20 to 90°C, and various substances may be selected depending on room temperature stability and PCR reactivity.Specifically, the water phase (W1) may include at least one selected from the group consisting of agarose, gelatin, collagen, LMPA (low melting point agarose), and PEG-aCD (a mixture of polyethylene glycol and alpha-cyclodextrin). More specifically, the water phase (W1) may include, but is not limited to, agarose having a critical melting temperature of 80 to 90°C, gelatin having a critical melting temperature of 40 to 50°C, collagen having a critical melting temperature of 30 to 40°C, LMPA having a critical melting temperature of 60 to 80°C, and PEG-aCD having a critical melting temperature of 20 to 90°C.

[0095] In one embodiment, the type of oil included in the oil phase (O) of the water-in-oil type droplets (W1 / O) is not limited, but specifically, at least one selected from the group consisting of hydrofluoroether (HFE) oil, mineral oil, silicone oil, and isopropyl palmitate oil may be included. For example, the silicone oil may be at least one selected from the group consisting of dimethicone, cyclomethicone, polydimethylsiloxane, methylphenylpolysiloxane, methylcyclopolysiloxane, octamethylcyclotetrasiloxane, decamethylcyclopentasiloxane, dodecamethylcyclohexasiloxane, tetradecamethylhexasiloxane, and octamethyltrisiloxane.

[0096] In one embodiment, the average diameter of the water-in-oil droplets (W1 / O) may be from 100 nm to 10 μm. Specifically, the average diameter may be 100 nm or more, 150 nm or more, 200 nm or more, 250 nm or more, 300 nm or more, 450 nm or more, 500 nm or more, and may be 10 μm or less, 1 μm or less, 950 nm or less, 900 nm or less, 850 nm or less, 800 nm or less, 750 nm or less, 700 nm or less, 650 nm or less, 600 nm or less, 550 nm or less, 500 nm or less, 450 nm or less, 400 nm or less, 350 nm or less, 300 nm or less, 250 nm or less, or 200 nm or less. Here, the average diameter may be calculated as the average of the maximum diameter values ​​of each droplet particle among water-in-oil droplets comprising 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more of the water-in-oil droplets contained in the composition. If the average diameter of the water-in-oil droplets (W1 / O) is too small, trapping of the droplets in the formulation may not be performed well when manufacturing a hydrogel formulation, and if it is too large, it may cause instability of the hydrogel structure.

[0097] In one embodiment, the oil phase (O) of the water-in-oil type droplet (W1 / O) may include a lipophilic surfactant, and the water phase (W2) of the outer surface may include a hydrophilic surfactant, and the release temperature and release efficiency of the PCR primers and / or probes included in the water-in-oil type droplet may be controlled depending on the type and concentration of these surfactants.

[0098] Specifically, the lipophilic surfactant may include a fluoro-based surfactant, and more specifically, may include a fluoro-based anionic surfactant or a fluoro-based nonionic surfactant. Examples of the fluoro-based anionic surfactant include, but are not limited to, poly(hexafluoropropylene oxide), perfluorodecanoic acid (PFDA), perfluorododecanoic acid (PFDoA), and the like. The polyhexafluoropropylene oxide may be, more specifically, Krytox 157FS-L, Krytox 157FS-M, and Krytox 157FS-H. Examples of the fluoro-based nonionic surfactant include, but are not limited to, Ran surfactant, Picosurf, and Fluosurf. In one embodiment, the water-in-oil type droplets may include hydrofluoroether oil in the oil phase and a fluoro-based surfactant as the lipophilic surfactant.

[0099] Alternatively, in one embodiment, the lipophilic surfactant may include a silicone-based nonionic surfactant. The silicone-based nonionic surfactant is not limited, but may include, for example, Abil EM90. In one embodiment, the water-in-oil droplet may include at least one of mineral oil, silicone oil, and isopropyl palmitate oil in the oil phase, and the lipophilic surfactant may include a silicone-based nonionic surfactant.

[0100] Specifically, the hydrophilic surfactant may be a surfactant having an HLB (Hydrophile-Lipophile Balance) of 8 to 20. More specifically, the hydrophilic surfactant may be a polyoxyethylene sorbitan-based surfactant, and may be, for example, at least one of Tween 20, Tween 80, Tween 85, Triton X 100, Brij S10, PEG 400 monolaurate, and Pluronic F127.

[0101] As an example, the aqueous phase (W2) of the trauma may be water or a water-based salt solution containing the hydrophilic surfactant. Specifically, the aqueous phase (W2) may include phosphate-buffered saline (PBS).

[0102] In another embodiment, the outer surface (W2) may be a hydrogel. More specifically, the hydrogel may have a porous structure including pores, and the water-in-oil droplets may be positioned within the pores of the hydrogel. In one embodiment, the porosity of the porous structure may be 10% to 80% by volume, more specifically 20% to 70% by volume, based on the total volume of the hydrogel particles. If it is out of the above range, the porosity may be reduced or the structural stability of the hydrogel particles may be unstable, which may be detrimental to the PCR reaction. Fig. 4 is a diagram schematically showing the structure of a composition in which the outer surface is a hydrogel, and Fig. 5 is a diagram showing an image confirmed by a scanning electron microscope (SEM) of a composition in which the outer surface is a hydrogel according to one embodiment. In one embodiment, when the outer surface is in the form of a hydrogel as described above, the water-in-oil droplets (W1 / O) may be physically fixed inside the gel.

[0103] As an example, when the trauma (W2) is a hydrogel as described above, the average diameter of the W1 / O / W2 particles may be 10 μm to 10 mm. Specifically, the average diameter may be 10 μm or more, 100 μm or more, 200 μm or more, 300 μm or more, 400 μm or more, 500 μm or more, 600 μm or more, 700 μm or more, 800 μm or more, 900 μm or more, 1000 μm or more, 2000 μm or more, 3000 μm or more, 4000 μm or more, 5000 μm or more, 6000 μm or more, 7000 μm or more, 8000 μm or more, or 9000 μm or more, and 10000 μm or less, 9000 μm or less, 8000 μm or less, 7000 μm or less, 6000 μm or less, 5000 μm or less, 4000 μm or less, 3000 μm or less, It may be 2000 μm or less, 1000 μm or less, 900 μm or less, 800 μm or less, 700 μm or less, 600 μm or less, 500 μm or less, 400 μm or less, 300 μm or less, 200 μm or less, or 100 μm or less. Here, the average diameter may be calculated as the average value of the maximum diameter value of each particle targeting 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more of the total W1 / O / W2 particles.

[0104] As an example, the material of the hydrogel may be any polymer (pre-polymer) capable of solidification, and may specifically include one or more hydrophilic polymers selected from the group consisting of polyethylene glycol-diacrylate (PEG-DA), polyacrylamide (PAAm), agarose, gelatin, and collagen.

[0105] As an example, the above-described external structure may further include at least one of an encoder that provides target nucleic acid primer information and a fluorescent marker that provides quantitative information on the amplified nucleic acid. The encoder refers to a material that distinguishes what the PCR primer is in each porous structure by color or shape, and for example, a dye that fluoresces in various colors, a quantum dot, or a metal, plastic, glass, silicon, etc. with a specific shape can be used. Alternatively, when the external structure is a hydrogel, the PCR primer in each hydrogel particle can be distinguished by changing the size or shape of the hydrogel particle itself or by marking a specific mark on the surface of the hydrogel particle without using an encoder. Alternatively, the PCR primer in each hydrogel particle can be distinguished by specifying the position of each hydrogel particle within the array.

[0106] In the case of conventional solution PCR, when detecting multiple types of target nucleic acids, the target must be detected through multiple PCRs using primer and probe handling for each, which has the disadvantage of being time-consuming and complicated. However, according to the present disclosure, multiple types of target nucleic acids can be detected through a single PCR, thereby resolving the primer and probe handling issue and enabling simultaneous multiplex diagnosis.

[0107] One embodiment of the present disclosure may provide a nucleic acid amplification device comprising the above-described multi-emulsion emulsion composition; and a reaction chamber in which the multi-emulsion emulsion composition is arranged. In one embodiment, the nucleic acid amplification device may comprise a plurality of multi-emulsion emulsion compositions, each of which contains primers for different target nucleic acids.

[0108] In one embodiment, the device may further include a reaction chamber, wherein the reaction chamber may include an array or tube in which the composition is arranged. The material of the array according to one embodiment is not limited to any type of material, such as glass, plastic, polymer, or silicon, as long as it can accommodate the temperature conditions of the nucleic acid amplification reaction.

[0109] In addition, one embodiment of the present disclosure may provide a nucleic acid amplification method including a step of injecting one or more of the above multi-emulsion emulsion compositions into a reaction chamber; and a step of amplifying the target nucleic acid by polymerase chain reaction (PCR).

[0110] As an example, the step of amplifying the target nucleic acid may include releasing the inner phase (W1) into the outer phase (W2) by destabilizing the surfactant constituting the interface of the multi-emulsion (W1 / O / W2) emulsion composition during the denaturation step during PCR, thereby releasing the PCR primer contained therein out of the droplet.

[0111] As one embodiment, the one or more multi-emulsion emulsion compositions may each contain PCR primers for different target nucleic acids.

[0112] In one embodiment, the method may further comprise a step of injecting a solution containing one or more target nucleic acids into the chamber prior to the PCR step. In one embodiment, the solution containing the target nucleic acids may further comprise a primer containing a locked nucleic acid (LNA), such as a 3'-locked nucleic acid primer, Taq polymerase, or the like.

[0113] As an example, the reaction chamber may include an array or tube in which the composition is arranged.

[0114] In one embodiment, the method may further comprise a step of analyzing nucleic acids polymerized within the multi-emulsion emulsion composition. In another embodiment, the method may further comprise a step of quantitatively analyzing in real time the nucleic acids polymerized within the one or more compositions polymerized simultaneously with the polymerase chain reaction step, thereby enabling the simultaneous amplification of different types of target nucleic acids and their quantitative analysis in real time.

[0115] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

[0116] [Example 1] Preparation of a liquid multi-emulsion emulsion composition

[0117] First, to prepare the water-in-oil type droplet phase, 4 μl of 1 mM PCR primer (Forward primer) was added to a 1.7 ml tube, then 16 μl of 2.5% LMPA (low melting point agarose) (Manufacturer: Promega, Product name: Agarose, LMP, Preparative Grade for Small Fragments (10 to 1,000 bp)) (at least 400 μl in volume) heat-treated at 100°C for 10 minutes was added, mixed, and centrifuged until the speed reached approximately 400 rpm. Next, a fluoro-based nonionic surfactant (product name: 008-FluoroSurfactant, manufacturer: RAN Biotechnologies) was melted as a lipophilic surfactant into hydrofluoroether oil (product name: HFE7500, manufacturer: Kemis Co., Ltd.) as an oil phase to a concentration of 0.4% (w / w), and then 200 μl of the solution heat-treated at a temperature of 100°C was added to the tube, and then emulsified through ultrasonic treatment to prepare a water-in-oil emulsion composition (W1 / O).

[0118] At this time, the sequence of the PCR primer is as follows.

[0119] -PCR primer (Forward primer): 5'-GTTCTTACCTTTCTTTTCCAATGTTAC-3' (SEQ ID NO: 1)

[0120] The above-mentioned water-in-oil emulsion composition (W1 / O) was placed on ice and stabilized for 10 minutes, and then centrifuged at 13,000 rpm for 40 seconds to separate the water-in-oil emulsion composition (W1 / O) in the upper layer and the hydrofluoroether oil in the lower layer, thereby completely removing the hydrofluoroether oil in the lower layer.

[0121] As a trauma, 1 mL of a solution (PBST 0.25% (w / w)) containing Tween20 (product name: Tween®20, manufacturer: Sigma-Aldrich) dissolved as a hydrophilic surfactant in PBS was added to the tube, and the W1 / O / W2 emulsion composition was well dispersed using a pipette, and then the dispersed W1 / O / W2 emulsion composition was sonicated to stabilize the particle size of the W1 / O / W2 emulsion composition.

[0122] [Example 2] Preparation of a multi-emulsion emulsion composition in the form of a hydrogel formulation

[0123] As one embodiment of the present disclosure, a water-in-oil type emulsion composition (W1 / O / W2) 35% (v / v) prepared in the same manner as Example 1 except that both the PCR primer (Forward primer) and the probe were added to the composition, 20% (v / v) of poly(ethylene glycol) diacrylate (PEG-DA, Sigma-Aldrich, MW700) as a hydrogel monomer added to the external surface, 40% (v / v) of poly(ethylene glycol) (PEG, Sigma-Aldrich, MW600) as a pore-inducing polymer, 5% (v / v) of 20% diphenyl(2,4,6-trimethylbenzoyl)phosphine oxide (product name: Water-soluble TPO based nanoparticle photoinitiator, manufacturer: Sigma-Aldrich), and 5% (v / v) of Acrydite reverse primer were mixed to obtain a total A 100 μL prepolymer hydrogel solution was prepared. Unlike the PCR primer (forward primer) and probe included in the water-in-oil type emulsion composition, the reverse primer is included in the form of an acrydite reverse primer in which an acrydite functional group is attached as a linker to the reverse primer, and is directly fixed to the hydrogel through the linker.

[0124] The sequences of each primer and probe used in the above manufacturing are as follows.

[0125] -PCR primer (Forward primer): 5'-GTTCTTACCTTTCTTTTCCAATGTTAC-3' (SEQ ID NO: 1)

[0126] -RT primer (Reverse primer): 5'- CCATCATTAAATGGTAGGACAGGG-3' (SEQ ID NO: 2)

[0127] -Probe: 5'-FAM / TGGTTCCATGCTATCTCTGGGACC / BHQ1-3' (SEQ ID NO: 3; Product name: DNA oligo, Manufacturer: IDT)

[0128] The solution prepared above was prepared in the form of droplets using a plasma-treated PDMS mold, and cured by exposing it to UV (2.5 mW) for 30 seconds.

[0129] Fig. 6 shows a comparison of the fluorescence levels of hydrogel particles of the multiple emulsion emulsion composition, in order to confirm the particle uniformity of the prepared hydrogel formulation. The fluorescence values ​​of eight particles among the particles illustrated in Fig. 6 were measured, and the average brightness was 7365, the standard deviation was 596, and the inter-particle variation was uniformly less than 10%.

[0130] [Example 1]

[0131] As an example of the present disclosure, the following experiment was performed to confirm the formulation stability according to the size of water-in-oil droplets (W1 / O) and the content of lipophilic surfactant.

[0132] First, a water-in-oil emulsion composition (W1 / O) was prepared by emulsifying in the same manner as in Example 1, except that Picosurf® (product name: Pico-Surf®, manufacturer: Sphere Fluidics) was used as a lipophilic surfactant. At this time, the content of the lipophilic surfactant was adjusted to 0.05, 0.1, 0.2, 0.3, 0.4, and 0.5 wt%, respectively, based on the total weight of the water-in-oil emulsion composition (W1 / O), and the formulation stability according to the content of the lipophilic surfactant was visually confirmed immediately after preparation. In addition, the size of the water-in-oil droplets (W1 / O) according to each content was confirmed using a particle size analyzer (Dynamic light scattering system, DLS; product name: Zetasizer Nano ZSP, manufacturer: Malvern Instruments).

[0133] As a result, when the content of lipophilic surfactant was 0.2% (w / w) or less, a creaming phenomenon occurred and the two-phase formulation of water-in-oil was not maintained, and when it was 0.3% (w / w) or more, it was confirmed that a stable formulation of water-in-oil droplets (W1 / O) was maintained (see Fig. 7). In addition, at this time, the average diameter of the water-in-oil droplets (W1 / O) was 252 ± 8 nm (see Fig. 8).

[0134] Next, the following experiment was conducted to confirm the formulation stability according to the particle size of the multiple emulsion composition (W1 / O / W2) and the content of hydrophilic surfactant.

[0135] First, a multiple emulsion emulsion composition (W1 / O / W2) was prepared in the same manner as in Example 1, but the content of the hydrophilic surfactant was adjusted to 0.05, 0.1, 0.2, 0.3, 0.4, and 0.5 wt%, respectively, based on the total weight of the multiple emulsion emulsion composition. Then, the size of W1 / O / W2 particles according to the content of the hydrophilic surfactant was confirmed using a particle size analyzer (Dynamic light scattering system, DLS; manufacturer: Malvern Instruments, product name: Zetasizer Nano ZSP).

[0136] As a result, as shown in Fig. 9, the particle size of the multi-emulsion emulsion composition (W1 / O / W2) was found to be approximately 200 to 400 nm, and it was confirmed that the content of the hydrophilic surfactant must be 0.05% (w / w) or more to maintain a stable emulsion formulation.

[0137] [Example 2]

[0138] As an example of the present disclosure, the formulation stability was compared according to the type of oil and the type of surfactant included in the water-in-oil type droplet.

[0139] Specifically, a multiple emulsion emulsion composition (W1 / O / W2) was prepared in the same manner as in Example 1, but the types of oils and surfactants included in the oil phase were different. A total of four types of oils, two types of lipophilic surfactants, and two types of hydrophilic surfactants were used, and whether they were mixed was visually confirmed, and this is shown in Fig. 10 and Table 1 below. At this time, the oil was hydrofluoroether (HFE) oil (3M, HFE-7500), mineral oil (Sigma-aldrich, mineral oil), silicone oil (Sigma-aldrich, silicone oil AR20), isopropyl palmitate (IPP) oil (Sigma-aldrich, Isopropyl palmitate), the lipophilic surfactant was 0.4% (w / w) of fluorosurfactant (RAN Biotechnologies, 008-FluoroSurfactant-2wtH-50g), 3% (w / w) of cetyl PEG / PPG-10 / 1 dimethicone (Abil EM90; KCC, SeraSol SC 83-A), and the hydrophilic surfactant was 0.1275% (w / w) of Triton-X (Sigma-aldrich, Triton X-100), Tween20 (Sigma-aldrich, Tween 20). It was 0.25% (w / w).

[0140] Lipophilic surfactantHydrophilic surfactantFluoro surfactant 0.4%Abil EM90 3%Triton-X 0.1275%Tween20 0.25%HFE Oil mixingSeparationSeparationSeparationMineral oil separationMixingSeparationSeparationSilicone oil separationMixingSeparationSeparationIPP oil separationMixingSeparationSeparation

[0141] As a result, it was confirmed that all four types of oils were not mixed with the hydrophilic surfactants Triton-X and tween20, HFE oil mixed well with the fluorosurfactant, and mineral oil, silicone oil, and IPP oil mixed well with the silicone nonionic surfactant Abil EM90.

[0142] [Example 3]

[0143] The following experiment was conducted to determine the melting point (Tm) of each type of lipophilic surfactant included in one embodiment of the present disclosure, i.e., the temperature at which a morphological change occurs in a water-in-oil emulsion (W1 / O) as the lipophilic surfactant maintaining the W1 / O interface becomes unstable depending on temperature correspondence.

[0144] First, a water-in-oil emulsion (W1 / O) was prepared, and the Tm of the water-in-oil emulsion (W1 / O) was determined. At this time, the water phase was fixed as PBS and the oil phase was fixed as HFE, and the surfactants in Table 2 below were used as lipophilic surfactants, and their physical properties are shown in the table.

[0145] Poly(hexafluoropropylene oxide)PFDA(Perfluorodecanoic acid)PFDoA(Perfluorododecanoic acid)RanPicosurfFluosurfKrytox 157FS-LKrytox 157FS-MKrytox 157FS-HionicAnionicNonionicMw250050007000-7500514.08614.11000~20000 Da4147000-13000 DaViscosity99.4-149-703-1055---1.24 (Absolute)-Density1.91-1.881.81.81.81.5-Boiling point ( o C)170-200-170-200218249->100-

[0146] A 1.7 mL tube was filled with 20 μL of PBS containing 200 μM FAM-DNA (5'-GGTCGAGGGTGGCTACGGCTGAACT[FAM]-3'; SEQ ID NO: 4) and 200 μL of HFE oil containing a lipophilic surfactant, and then a water-in-oil emulsion (W1 / O) was prepared through tip sonication (Amplitude 40%, 45 sec). 16 μL of the water-in-oil emulsion (W1 / O) solution was injected into a microfluidic chip, and the chip was placed on a hot plate. The temperature was increased from 30 °C to 120 °C at a rate of 0.2 °C / sec, and fluorescence images of the water-in-oil emulsion (W1 / O) were obtained once every 5 s. After drawing a graph of the fluorescence values ​​of water-in-oil emulsion (W1 / O) according to temperature, the melting point (T) was calculated based on the inflection point. m ) values ​​were analyzed.

[0147] As a result, as shown in Figs. 11a to 11g, it was confirmed that both the water-in-oil emulsion (W1 / O) using the anionic surfactant Krytox and the nonionic surfactant Ran had a Tm value at a high temperature of 90°C or higher. The Tm value of Krytox decreased as the molecular weight increased. Regardless of the amount (volume percentage) used, the water-in-oil emulsion (W1 / O) showed a Tm value of 94±1°C.

[0148] Next, an oil-in-water emulsion (O / W2) was prepared in the same manner as above using 0.25% (w / w) of the hydrophilic surfactant Tween20 included in the outer layer (W2) of the multiple emulsion (W1 / O / W2), and the Tm according to the lipophilic surfactant in the oil-in-water emulsion (O / W2) was confirmed again. In actual PCR, no primers or probes are added to the W2 phase, but in this experiment, 200 μM FAM-DNA (5'-GGTCGAGGGTGGCTACGGCTGAACT[FAM]-3'; SEQ ID NO: 4) was added to the W2 phase together with the hydrophilic surfactant to observe the state change of the emulsion through the fluorescence change.

[0149] At this time, the external wound (W2) was fixed with PBS containing 0.25% (w / w) of Tween20, and the internal oil phase was HFE, and the surfactants in Table 2 were used as lipophilic surfactants.

[0150] As a result, as shown in Figs. 12a to 12f, it was confirmed that both the oil-in-water emulsion (O / W2) and the nonionic surfactant had a Tm value at a high temperature of 90°C or higher when anionic surfactants and nonionic surfactants were used. Among these, the Tm value of Krytox decreased as the molecular weight increased.

[0151] [Example 4]

[0152] In order to determine the melting point (Tm), i.e., the temperature at which a morphological change occurs in an oil-in-water emulsion (O / W2), depending on the type of hydrophilic surfactant included in one embodiment of the present disclosure, the following experiment was performed.

[0153] First, an oil-in-water emulsion (O / W2) was prepared, and the Tm of the oil-in-water emulsion (O / W2) was determined. At this time, the water phase was fixed as PBS and the oil phase was fixed as HFE, and the surfactants in Table 3 below were used as hydrophilic surfactants, and their physical properties are shown in the table.

[0154] Tween 20Tween 80Tween85Triton X 100Span 20Span 80Brij S10PEG 400MonolauratePluronic F127SDS(Sodium dodecyl surfate)IonicNonionicNonionicNonionicNonionicNonionicNonionicNonionicNonionicNonionicMw(g / mol)604.8833.91839625346.4742871140012600288.38CMC0.06 mM0.012 mM0.06 mM0.24 mM(0.04 mM)0.43 mM90 uM(0.1 mM)129.97 μg / mL8.2 mMBoiling point(℃)695695.8100270516.1579.3->260>149204-207HLB17.015.011.013.58.64.3121318-2340.0

[0155] A 1.7 mL tube was filled with 200 μM FAM-DNA (5'-GGTCGAGGGTGGCTACGGCTGAACT[FAM]-3'; SEQ ID NO: 4) and 20 μL of PBS containing hydrophilic surfactants and 200 μL of HFE oil, and then an oil-in-water emulsion (O / W2) was prepared through tip sonication (Amplitude 40%, 45 sec). At this time, the molar concentrations of other hydrophilic surfactants except Tween 20 were adjusted to be the same as that of Tween 20 0.25% (2.2 mM).

[0156] 16 μL of the above oil-in-water emulsion (O / W2) solution was injected into the microfluidic chip, the chip was placed on a heat plate, and the temperature was increased from 30°C to 120°C at a rate of 0.2°C / sec, and a fluorescence image of the oil-in-water emulsion (O / W2) was obtained every 5 seconds. After drawing a graph of the fluorescence value of the oil-in-water emulsion (O / W2) according to temperature, the melting point (T) was calculated based on the inflection point. m ) values ​​were analyzed.

[0157] As a result, as shown in Figs. 13a to 13l, among the hydrophilic surfactants used, tween20 exhibited the highest Tm value, and it was confirmed that the Tm value decreased as the amount of tween20 decreased. Span20 showed poor formulation stability because the emulsion was largely clumped together from room temperature.

[0158] [Example 5]

[0159] Based on the results of Test Examples 3 and 4 included in one embodiment of the present disclosure, the following experiment was performed to compare the DNA release efficiency according to temperature of a multiple emulsion composition (W1 / O / W2) depending on the type of hydrophilic surfactant and lipophilic surfactant.

[0160] Preparation of W1 / O / W2 multiple emulsion composition

[0161] A 1.7 mL tube was filled with 20 μL of PBS containing 200 μM FAM-DNA (5'-GGTCGAGGGTGGCTACGGCTGAACT[FAM]-3'; SEQ ID NO: 4) and 200 μL of HFE oil containing a lipophilic surfactant, and then a water-in-oil emulsion (W1 / O) was prepared through tip sonication (Amplitude 40%, 45 sec).

[0162] After stabilizing the above-prepared water-in-oil emulsion (W1 / O) on ice for 10 minutes, the water-in-oil emulsion (W1 / O) (upper layer) and HFE oil (lower layer) were separated by centrifugation (13,000 rpm, 40 sec), and the HFE oil in the lower layer was removed using a pipette. After injecting 1 mL of PBS containing a hydrophilic surfactant (0.25%), the W1 / O / W2 multiple emulsion composition was dispersed using a pipette.

[0163] The above dispersed W1 / O / W2 multiple emulsion composition solution was tip-sonicated (Amplitude 40%, 8 sec) to prepare a second W1 / O / W2 multiple emulsion emulsion composition, which was then centrifuged again (10,000 rpm, 10 sec) to remove the PBS in the upper layer.

[0164] Standard curve for DNA quantification

[0165] FAM-DNA solutions at various concentrations (2 μM, 1 μM, 0.5 μM, 0.25 μM, 0.1 μM) were prepared, 80 μL of each FAM-DNA solution was loaded onto a 96-well black plate, and the fluorescence was measured using a fluorescence spectrometer. A standard curve was obtained based on the measured fluorescence at each FAM-DNA concentration.

[0166] Determination of DNA concentration in W1 / O / W2 multiple emulsion compositions

[0167] After diluting the W1 / O / W2 multiple emulsion composition prepared above 10-fold, 80 μL was added to a 96-well black plate, and the fluorescence was measured using a fluorescence spectrometer (product name: FLUOstar Omega, manufacturer: BMG LABTECH). The fluorescence value of the W1 / O / W2 multiple emulsion emulsion composition was substituted into the above standard curve to obtain the encapsulated DNA concentration.

[0168] Confirmation of DNA release efficiency according to temperature change of W1 / O / W2 multi-emulsion emulsion composition

[0169] 20 μL of the W1 / O / W2 multiple emulsion composition prepared above was heated in a heating block for 10 minutes. At this time, each experiment was conducted under temperature conditions of 10°C intervals from 30°C to 120°C.

[0170] The heated W1 / O / W2 multiple emulsion composition was centrifuged (10,000 rpm, 30 sec) to separate the supernatant, diluted 10-fold, and 80 μL of the diluted supernatant was loaded onto a 96-well black plate. The fluorescence was measured using a fluorescence spectrometer (product name: FLUOstar Omega, manufacturer: BMG LABTECH), and the released DNA concentration was obtained by substituting each fluorescence value. This was substituted into the mathematical equation below to calculate the DNA release efficiency for each temperature and represented graphically.

[0171] [Mathematical Formula 1]

[0172] DNA release efficiency = (DNA concentration released at each temperature * 100) / (encapsulated DNA concentration)

[0173] As a result, as shown in Figs. 14a to 17, both multi-emulsion emulsion compositions containing a hydrophilic surfactant in the outer layer and a lipophilic surfactant in the inner layer showed a tendency toward thermal reactivity. In the case of hydrophilic surfactants, the highest DNA release efficiency was observed when tween85 was used, and in the case of lipophilic surfactants, the release efficiency was confirmed to be high in the order of krytox > Ran > picosurf > fluosurf. In addition, in the case of lipophilic surfactants, the DNA release efficiency increased in most cases as the surfactant content decreased.

[0174] [Example 6]

[0175] In order to confirm the RT-qPCR non-specific reaction inhibition effect of the multi-emulsion emulsion composition (W1 / O / W2) according to one embodiment of the present disclosure, the following experiment was performed.

[0176] First, as an example, a multi-emulsion emulsion composition (W1 / O / W2) was prepared in the same manner as the method described in Test Example 5 above, but the inner phase (W1) was PBS, the oil phase (O) was HFE oil containing 0.4% of ran as a lipophilic surfactant, and the outer phase (W2) was PBS containing 0.25% of Tween20.

[0177] At this time, the primer used in the composition is a SARS-COV-2 N gene primer set, and the base sequences of the two primers are as follows.

[0178] -Forward primer: 5'-GACCCCAAAATCAGCGAAAT-3' (SEQ ID NO: 5)

[0179] -Reverse primer: 5'-TCTGGTTACTGCCAGTTGAATCTG-3' (SEQ ID NO: 6)

[0180] As a control, a PCR solution in which the two primers are freely present in the solution was prepared, containing both bidirectional primers in a PBS solution containing 0.25% Tween20.

[0181] The experiment is 2*10 2 RT-qPCR was performed using the above examples and the control group in a human total RNA (complex sample) environment containing copies of the SARS-COV-2 target gene, and gel electrophoresis was performed on the PCR-completed solution using a 3% agarose gel.

[0182] As a result, as shown in Fig. 18, compared to the control group (left), the example of the present disclosure (right) showed a reduction in the band of non-specific amplification products in a complex sample environment. This is because, in the example of the present disclosure, the primers are encapsulated in the inner phase of the multi-emulsion composition during RT-qPCR, physically separated from the reaction environment, and released under high temperature conditions of 95°C to participate in the PCR reaction, thereby suppressing non-specific reactions.

[0183] [Example 7]

[0184] To verify the RT-qPCR performance according to one embodiment of the present disclosure, the following experiment was performed. The target gene was SARS-CoV-2 viral RNA (NCCP No.: 43326) gene sample (Template) 2x10 5 , 2x10 4 , 2x10 3 , 2x10 2 , 2x10 1 copies / μl and NTC (No Template Control) were used.

[0185] The primers and probes used in this experiment are as follows.

[0186] -Forward primer: 5'- GGGAGCCTTGAATACACCAAAAG-3' (SEQ ID NO: 7)

[0187] -Reverse primer: 5'- TGTAGCACGATTGCAGCATTG-3' (SEQ ID NO: 8)

[0188] -Probe: 5'-(FAM)-TCACATTGGCACCCGCAATCCTGC-(BHQ1)-3' (SEQ ID NO: 9)

[0189] The PCR equipment used was a CFX opus 96 real-time PCR equipment from Bio-Rad. The composition of each PCR mixture in the examples and comparative examples is as follows (in μl).

[0190] Comparative Example 1 (Prior Technology)

[0191] -H2O: 4.1

[0192] -2x PCR reaction mixture (SuperScript TM III Platinum TM One-Step qRT-PCR Kit, Thermo Fisher): 12.5

[0193] -MgSO4(50 mM) (SuperScript TM III Platinum TM One-Step qRT-PCR Kit, Thermo Fisher): 0.4

[0194] -Human Total RNA (50 ng / μl) (Total RNA Control (Human), Thermo Fisher): 1

[0195] -Forward primer (10 μM): 1.5

[0196] -Reverse primer (10 μM): 2

[0197] -Probe (10 μM): 0.5

[0198] -Enzyme Blend (SuperScript TM III Platinum TM One-Step qRT-PCR Kit, Thermo Fisher): 1

[0199] -Template: 2

[0200] Example 3 (multi-emulsification emulsion composition)

[0201] -H2O: 4.1

[0202] -2x PCR reaction mix (SuperScript TM III Platinum TM One-Step qRT-PCR Kit, Thermo Fisher): 12.5

[0203] -MgSO4(50 mM) (SuperScript TM III Platinum TM One-Step qRT-PCR Kit, Thermo Fisher): 0.4

[0204] -Human Total RNA (50 ng / μl) (Total RNA Control (Human), Thermo Fisher): 1

[0205] -Emulsion-forward primer (10 μM): 1.5

[0206] -Reverse primer (10 μM): 2

[0207] -Probe (10 μM): 0.5

[0208] -Enzyme Blend (SuperScript TM III Platinum TM One-Step qRT-PCR Kit, Thermo Fisher): 1

[0209] -Template: 2

[0210] Example 4 (multi-emulsification emulsion composition)

[0211] -H2O: 4.1

[0212] -2x PCR reaction mixture (SuperScript TM III Platinum TM One-Step qRT-PCR Kit, Thermo Fisher): 12.5

[0213] -MgSO4(50 mM) (SuperScript TM III Platinum TM One-Step qRT-PCR Kit, Thermo Fisher): 0.4

[0214] -Total human RNA (50 ng / μl) (Total RNA Control (Human), Thermo Fisher): 1

[0215] -Emulsion-forward primer (10 μM): 1.5

[0216] -Reverse primer (10 μM): 2

[0217] -Probe (10 μM): 0.5

[0218] -Enzyme Blend (SuperScript TM III Platinum TM One-Step qRT-PCR Kit, Thermo Fisher): 1

[0219] -Template: 2

[0220] The PCR equipment temperature conditions were reverse transcription (RT) (55℃, 10 min)-PCR (pre-denaturation 94℃, 3 min / denaturation 94℃, 15 sec / annealing 58℃, 30 sec), repeated for 45 cycles. The results of amplifying the target nucleic acid through PCR were confirmed with a real-time curve, and after the PCR, whether the amplified product matched the target to be detected was confirmed through gel electrophoresis (mupid 2plus equipment; manufacturer: TaKaRa, product name: mupid 2plus).

[0221] As a result, as shown in Fig. 19, Comparative Example 1 according to the prior art is 2x10 3 copies / μl concentration was detectable, and as shown in FIG. 20 (Example 3) and FIG. 21 (Example 4), the example of the present disclosure was 2x10 2 copies / μl concentration was detectable. That is, when using the emulsion according to the present disclosure, quantitative analysis was possible up to an RNA concentration of 200 copies / μl, and the limit of detection (LoD) for RNA was improved by 1 / 10 times. This is because the forward primer stored in the emulsion according to the present disclosure did not cause nonspecific reactions with other targets during the RT process, and a sufficient amount of the forward primer was used only to amplify the detection target during the PCR process.

[0222] [Example 9]

[0223] As an example of the present disclosure, the following experiments were performed to confirm the performance of the multi-emulsion composition of the hydrogel formulation of Example 2 in qPCR and RT-qPCR.

[0224] qPCR

[0225] The target gene is COVID19 alpha variant synthetic DNA (Template, IDT) 2x107, 2x10 6 , 2x10 5 , 2x10 4copies / μl and NTC (No Template Control) were used, and the PCR equipment used was MycoBiomed's G2-4. The PCR mixture containing 7 μl of H2O, 8 μl of 2x MycoBiomed Master Mix, and 1 μl of template was used. The PCR equipment temperature conditions were pre-denaturation 95°C, 8 sec - denaturation 95°C, 4 sec - annealing 51°C, 30 sec, repeated for 40 cycles. As shown in Figures 22 and 23, the qPCR efficiency of Example 2 was 97.24%.

[0226] The COVID19 alpha variant synthetic DNA used above and the primers and probes used are as follows.

[0227] -COVID19 alpha variant synthetic DNA: 5' TCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCA -3' (SEQ ID NO: 10)

[0228] -Forward primer: 5'- TCAACTCAGGACTTGTTCTTACCT -3' (SEQ ID NO: 11)

[0229] -Reverse primer: 5'- TGGTAGGACAGGGTTATCAAAC -3' (SEQ ID NO: 12)

[0230] -Probe: 5'- TCCATGCTATCTCTGGGACC -3' (SEQ ID NO: 13)

[0231] RT-qPCR

[0232] The same qPCR as above was used as the target gene, COVID19 alpha mutant viral RNA (Template) NCCP.43381_ 86.2 ng / μl, and the same primers and probes. The PCR equipment used was Genechecker UF-350 from Genesystem. The PCR mixture containing 7 μl of H2O, 8 μl of 2x MycoBioMed Master Mix, and 1 μl of template was used. The PCR equipment temperature conditions were reverse transcription (RT) 55℃, 10 min - PCR pre-denaturation 95℃, 30 sec - denaturation 95℃, 4 sec - annealing 51℃, 30 sec, repeated for 40 cycles. Figure 24 shows the results of Example 2, and Figure 25 shows the results of NTC (No Template Control).

[0233] From the above two results, it can be confirmed that the composition according to the present disclosure normally amplifies the target in both qPCR using synthetic DNA and RT-qPCR using viral RNA, and that the amplification efficiency is about 97%, with the target being amplified about 1.97 times per cycle.

[0234] [Example 10]

[0235] Multiple diagnosis was performed using a composition according to one embodiment of the present disclosure as follows.

[0236] To distinguish the mutations of the COVID-19 virus, microparticles targeting the mutant virus were produced and placed all together in one reaction, and the sample was added to carry out the reaction in the same manner as RT-qPCR in Test Example 9 above.

[0237] The mutant virus target primer and probe sequences used in this experiment are as follows.

[0238] Mutant virus distinguishing base sequence (5'→3') Sequence number N Forward primer GGGAGCCTTGAATACACCAAAAG14 Reverse primer TGTAGCACGATTGCAGCATTG15 Probe TCACATTGGCACCCGCAATCCTGC16 Alpha(a, a-) Forward primer TCAACTCAGGACTTGTTCTTACCT17 Reverse primer TGGTAGGACAGGGTTATCAAAC18 Probe TCCATGCTATCTCTGGGACC19 Drop-out probe Probe TTCCATGCTATACATGTCTCTGGGA20 Beta(b) Forward primer AGATTTGCCAATAGGTATTAACATC21 Reverse primer CTGAAGAAGAATCACCAGGAGTC22 Probe CTAGGTTTCAAACTTTACATAGAAGTT23 Gamma(r) Forward primer CATGACGTTCGTGTTGTTTTAG24 Reverse Primer CATTTCGCTGATTTTGGGGTCC25 Probe TTTCATCTAAACGAACAAACAAACTAAAAT26 Delta(d, d-) Forward primer GTTTTATTACCACAAAAACAACAAAAG27 Reverse primer GGCTGAGAGACATATTCAAAAGTG28 Probe TGGATGGAAAGTG / GAGTTTATTCTAGT29 Drop-out probe Probe TGG AAA GTG AGT TCA GAG TTT ATT30 Omicron(o) Forward primer AATCTTTAGGGAATTTGTGTTTAAGA31 Reverse primer TCTAAAGCCGAAAAACCCT32 Probe TTATAGTGCGTGAGCCAGAAGAT33

[0239] As a result, as shown in FIGS. 26 and 27, the fluorescence of the microparticles brightened in line with the inserted target, and it can be confirmed that the multiple diagnosis efficiency was improved when using the present disclosure.

[0240] 서열번호염기서열 (5' -> 3')1GTTCTTACCTTTCTTTTCCAATGTTAC2CCATCATTAAATGGTAGGACAGGG3TGGTTCCATGCTATCTCTGGGACC4GGTCGAGGGTGGCTACGGCTGAACT5GACCCCAAAATCAGCGAAAT6TCTGGTTACTGCCAGTTGAATCTG7GGGAGCCTTGAATACACCAAAAG8TGTAGCACGATTGCAGCATTG9TCACATTGGCACCCGCAATCCTGC10TCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCA11TCAACTCAGGACTTGTTCTTACCT12TGGTAGGACAGGGTTATCAAAC13TCCATGCTATCTCTGGGACC14GGGAGCCTTGAATACACCAAAAG15TGTAGCACGATTGCAGCATTG16TCACATTGGCACCCGCAATCCTGC17TCAACTCAGGACTTGTTCTTACCT18TGGTAGGACAGGGTTATCAAAC19TCCATGCTATCTCTGGGACC20TTCCATGCTATACATGTCTCTGGGA21AGATTTGCCAATAGGTATTAACATC22CTGAAGAAGAATCACCAGGAGTC23CTAGGTTTCAAACTTTACATAGAAGTT24CATGACGTTCGTGTTGTTTTAG25CATTTCGCTGATTTTGGGGTCC26TTTCATCTAAACGAACAAACAAACTAAAAT27GTTTATTACCACAAAAACAACAAAAG28GGCTGAGAGACATATTCAAAAGTG29TGGATGGAAAGTG / GAGTTTATTCTAGT30TGG AAA GTG AGT TCA GAG TTT ATT31AATCTTAGGGAATTTGTGTTTAAGA32TCTAAAGCCGAAAAACCCT33TTATAGTGCGTGAGCCAGAAGAT

Claims

1. An inner layer containing water-in-oil droplets; and Including the award-winning trauma It is an emulsion composition of the W1 / O / W2 (water1-oil-water2) type. The above water-in-oil (W1 / O) droplet contains at least one of a PCR (polymerase chain reaction) primer and probe in the inner phase, the water phase (W1), and The above emulsion composition is heat-reactive, A multiple emulsion composition.

2. In the first paragraph, the oil phase (O) of the water-in-oil (W1 / O) droplet contains a lipophilic surfactant, The above award (W2) contains a hydrophilic surfactant, A multiple emulsion composition.

3. A multi-emulsion emulsion composition according to claim 1, wherein the number of droplets contained in the composition is 2 or more.

4. A multi-emulsion emulsion composition in the first paragraph, wherein the number of water phases (W1) contained in one droplet is two or more.

5. A multi-emulsion emulsion composition according to claim 1, wherein the average diameter of the droplets is 100 nm to 10 μm.

6. In the second paragraph, the water-in-oil (W1 / O) droplet contains hydrofluoroether oil in the oil phase (O), The lipophilic surfactant comprises a fluorosurfactant, A multiple emulsion composition.

7. A multi-emulsion emulsion composition in claim 6, wherein the fluoro-based surfactant is a fluoro-based anionic surfactant or a fluoro-based nonionic surfactant.

8. In the second paragraph, the water-in-oil (W1 / O) droplet contains at least one of mineral oil, silicone oil, and isopropyl palmitate oil in the oil phase, A multi-emulsion emulsion composition comprising a silicone-based nonionic surfactant as the above lipophilic surfactant.

9. A multiple emulsion composition in the second paragraph, wherein the hydrophilic surfactant is a surfactant having a HLB (Hydrophile-Lipophile Balance) of 8 to 20.

10. A multiple emulsion composition in claim 9, wherein the hydrophilic surfactant is a polyoxyethylene sorbitan-based surfactant.

11. A multi-emulsification emulsion composition in the first paragraph, wherein the water phase (W1) of the water-in-oil (W1 / O) droplets comprises at least one selected from the group consisting of agarose, gelatin, collagen, LMPA (low melting point agarose), and PEG-aCD (a mixture of polyethylene glycol and alpha-cyclodextrin).

12. A multi-emulsion emulsion composition in the first paragraph, wherein the trauma (W2) is a hydrogel.

13. In the 12th paragraph, the hydrating gel has a porous structure including pores, A multi-emulsion emulsion composition wherein the water-in-oil (W1 / O) droplets are positioned within the pores of the hydrogel.

14. A multi-emulsion emulsion composition in claim 12, wherein the hydrating gel comprises at least one selected from the group consisting of polyethylene glycol-diacrylate (PEG-DA), polyacrylamide (PAAm), agarose, gelatin, and collagen.

15. A multi-emulsion emulsion composition according to any one of claims 1 to 14; and A reaction chamber in which the above multi-emulsion emulsion composition is arranged; A nucleic acid amplification device comprising:

16. In the 15th paragraph, the nucleic acid amplification device comprises a plurality of multi-emulsion emulsion compositions each containing primers for different target nucleic acids.

17. As a method for amplifying nucleic acids, A step of injecting a multi-emulsion emulsion composition according to any one of claims 1 to 14 into a reaction chamber; and A step of amplifying a target nucleic acid by polymerase chain reaction (PCR); A nucleic acid amplification method comprising:

18. A nucleic acid amplification method further comprising a step of analyzing a nucleic acid polymerized in the multiple emulsion composition of claim 17.

Images