Method for detecting RNA-protein interaction

Abstract

Provided are a method for constructing an RNA array, a kit for preparing an RNA array, a method and device for detecting RNA-protein interaction, and a kit. The method comprises: on the basis of a first nucleic acid fixed on a first chip, transcribing the first nucleic acid to obtain a target RNA chain; and on the basis of a second nucleic acid fixed on a second chip, capturing the target RNA chain by using the second nucleic acid, so as to obtain the RNA array.

Description

RNA-protein interaction detection methods Technical Field

[0001] The present disclosure relates to the field of bioinformatics, and in particular to a method for constructing an RNA array, a kit for preparing an RNA array, and a method, device, and kit for detecting RNA-protein interactions. Background Art

[0002] The interaction between RNA and proteins plays a key role in many important biological processes. In addition to its application in the exploration of the mechanisms of life activities and biological evolution, the interaction between RNA and proteins has been widely used in many fields such as molecular detection, disease diagnosis and treatment. RNA generally exists in a single-stranded form, with rich intramolecular interactions and the resulting complex three-dimensional structure. This structure is the basis for the binding of RNA to RNA binding proteins (RBPs). Due to the complexity of RNA-protein interactions, the current methods for exploring the interaction between RNA and proteins by analyzing RNA sequences are very limited.

[0003] Several methods for studying RNA-protein interactions based on high-throughput sequencing chips have been reported: a. The Greenleaf and Lis groups used the Illumina second-generation sequencing platform. By attaching streptavidin and the transcription terminator protein Tus to the ends of DNA transcription templates as roadblocks, RNAP was blocked at the ends of the DNA template during transcription, allowing RNA to be tethered to the DNA template via RNAP. This approach resulted in the construction of high-throughput RNA arrays and enabled binding to target proteins. However, in this approach, the RNA was immobilized by the DNA template, which interfered with subsequent RNA-protein interactions, and the presence of the roadblock protein increased the compositional complexity of the RNA array on the chip surface. b. To eliminate the DNA template, the Smith group employed in situ nucleic acid synthesis. Specifically, polyethylene glycol chains were seeded onto the chip surface, and DNA chains were chemically synthesized at the free ends of the polyethylene glycol chains. The synthesized DNA served as a template for transcription of the RNA array, which was then digested with a DNA digestion enzyme to produce a pure RNA array. However, the chemical synthesis method used in this approach limits the RNA length to 33 bases, which is insufficient for complete transcription of most functional RNAs. To overcome the RNA length limitation, Callaghan's team constructed an RNA array using RNA transcription and capture. The transcribed DNA template and the aptamer-based RNA capture sequence were immobilized on separate surfaces, and the transcribed RNA was captured by the array below through vertical alignment. Although this RNA transcription capture method can construct RNAs up to 600 bases in length, the need for vertical alignment results in a larger area per site in the array, resulting in lower RNA array density and lower throughput.

[0004] Therefore, it is urgent to propose a higher throughput, higher sensitivity, lower cost, and highly automated method for studying RNA-protein interactions.

[0005] Summary of the Invention

[0006] The present disclosure aims to solve one of the technical problems in the related art at least to a certain extent.

[0007] To this end, embodiments of the present disclosure provide a method for constructing an RNA array, a kit for preparing an RNA array, and a method, apparatus, and kit for detecting RNA-protein interactions. This method is based on a first nucleic acid fixed to a chip, which is transcribed to obtain a target RNA strand. A second nucleic acid fixed to the chip is used to capture the target RNA strand, resulting in a long, pure RNA array with high throughput. This improves the throughput, accuracy, and sensitivity of the method for detecting RNA-protein interactions.

[0008] An embodiment of the first aspect of the present disclosure provides a method for constructing an RNA array, comprising: obtaining a target RNA chain by transcribing a first nucleic acid fixed on a first chip; and capturing the target RNA chain using a second nucleic acid fixed on a second chip to obtain the RNA array, wherein the first nucleic acid is a DNA molecule, and the second nucleic acid is a DNA molecule, and optionally, the second nucleic acid contains a nucleotide analog.

[0009] In some embodiments, the first chip and the second chip are the same chip or different chips.

[0010] In some embodiments, the first chip and the second chip are the same chip.

[0011] In some embodiments, the first nucleic acid comprises a first sequence for sequencing and a second sequence for transcription.

[0012] In some embodiments, the first sequence comprises a linker sequence and an identifier sequence; and the second sequence comprises a promoter sequence and a DNA sequence encoding the target RNA chain.

[0013] In some embodiments, the method further includes preparing the first nucleic acid fixed to the first chip, specifically including: synthesizing the first nucleic acid comprising the first sequence and the second sequence; and fixing the first nucleic acid on the first chip.

[0014] In some embodiments, the second nucleic acid comprises a third sequence for capturing the target RNA strand, wherein the third sequence is at least partially complementary to the target RNA strand.

[0015] In some embodiments, the complementary length between the third sequence and the target RNA chain is at least 20 bp.

[0016] In some embodiments, the complementary length between the third sequence and the target RNA chain is 35 bp.

[0017] In some embodiments, the third sequence has modifications such as dibenzocyclooctyne (DBCO), cyclooctyne, alkyne, or azide for immobilization.

[0018] In some embodiments, the first nucleic acid is selected from one or more of the following: DNA nanoballs generated by rolling circle amplification, DNA clusters generated by bridge amplification, synthetic DNA chains generated by strand displacement synthesis, and synthetic DNA chains generated by inkjet printing or chemical synthesis.

[0019] In some embodiments, the method further comprises preparing the second nucleic acid fixed on the second chip, specifically comprising: synthesizing the second nucleic acid and optionally amplifying the second nucleic acid; and fixing the second nucleic acid on the second chip.

[0020] In some embodiments, the first nucleic acid is linked to the first chip through non-covalent binding; the second nucleic acid is linked to the second chip through covalent binding.

[0021] In some embodiments, the method further comprises: sequencing the first nucleic acids to determine a first signal based on each of the first nucleic acids, wherein the first signal comprises a sequence and a position of each of the first nucleic acids on the first chip.

[0022] In some embodiments, the method further comprises digesting the first nucleic acid to purify the RNA array.

[0023] In some embodiments, the enzyme used to digest the first nucleic acid is a nuclease, preferably DNase I, DNase II, nuclease S1 and / or nuclease S7, more preferably nuclease S1.

[0024] In some embodiments, the first chip and the second chip are different chips, and the second chip generates the RNA array by diffusion transfer.

[0025] An embodiment of the second aspect of the present disclosure provides a method for detecting RNA-protein interaction, comprising: contacting a target protein with an RNA array to obtain RNA-protein interaction data, wherein the RNA array is obtained according to the method for constructing an RNA array according to any embodiment of the first aspect of the present disclosure.

[0026] In some embodiments, the target protein carries a fluorescent label, and contacting the target protein with the RNA array to obtain RNA-protein interaction data comprises: contacting the target protein with the RNA array; after contact, detecting the RNA array to collect a second signal, wherein the second signal is a fluorescent signal of the target protein bound to the RNA array; and obtaining the RNA-protein interaction data based on the second signal.

[0027] In some embodiments, the affinity of each RNA in the RNA array to the target protein is determined based on the RNA-protein interaction data.

[0028] An embodiment of the third aspect of the present disclosure provides a kit for preparing an RNA array, comprising: a first nucleic acid, which is fixed on a first chip; a second nucleic acid, which is fixed on a second chip; and an optional sequencing system, a transcription system, and a digestion system, wherein the first nucleic acid is a DNA molecule, and the second nucleic acid is a DNA molecule, optionally, the second nucleic acid contains a nucleotide analog, and the first chip and the second chip are the same chip or different chips.

[0029] In some embodiments, the first chip and the second chip are the same chip.

[0030] In some embodiments, the first nucleic acid comprises a first sequence for sequencing and a second sequence for transcription.

[0031] In some embodiments, the first sequence comprises a linker sequence and an identifier sequence; and the second sequence comprises a promoter sequence and a DNA sequence encoding a target RNA chain.

[0032] In some embodiments, the second nucleic acid comprises a third sequence for capturing the target RNA strand, wherein the third sequence is at least partially complementary to the target RNA strand.

[0033] In some embodiments, the complementary length between the third sequence and the target RNA chain is greater than 20 bp, preferably 35 bp.

[0034] In some embodiments, the first nucleic acid is selected from one or more of the following: DNA nanoballs generated by rolling circle amplification, DNA clusters generated by bridge amplification, synthetic DNA chains generated by strand displacement synthesis, and synthetic DNA chains generated by inkjet printing or chemical synthesis; the second nucleic acid is a naturally occurring nucleic acid sequence or an artificially constructed nucleic acid sequence.

[0035] In some embodiments, the first nucleic acid is covalently linked to the first chip; and the second nucleic acid is covalently linked to the second chip.

[0036] An embodiment of the fourth aspect of the present disclosure provides a kit for detecting RNA-protein interactions, the kit comprising an RNA array, and the RNA array is obtained according to the method for constructing an RNA array according to any embodiment of the first aspect of the present disclosure.

[0037] In some embodiments, the RNA array comprises a plurality of different RNAs, and is used to detect the interaction between the target protein and the plurality of different RNAs to determine affinity.

[0038] An embodiment of the fifth aspect of the present disclosure provides an RNA-protein interaction detection device, comprising: an RNA array construction module, for constructing the RNA array based on a first nucleic acid, a second nucleic acid, a first chip, and a second chip, wherein the RNA array construction module is specifically used to: obtain a target RNA chain by transcribing the first nucleic acid based on the first nucleic acid fixed on the first chip; capture the target RNA chain using the second nucleic acid based on the second nucleic acid fixed on the second chip to obtain the RNA array; a target protein acquisition module, for acquiring the target protein; and an RNA-protein interaction detection module, for obtaining the RNA-protein interaction data by contacting the RNA array with the target protein, wherein the first nucleic acid is a DNA molecule, and the second nucleic acid is a DNA molecule, optionally, the second nucleic acid contains nucleotide analogs, and the first chip and the second chip are the same or different chips.

[0039] In some embodiments, the first chip and the second chip are the same chip.

[0040] The advantages and technical effects brought about by the independent claims of the embodiments of the present disclosure are as follows:

[0041] (1) The method provided by the present disclosure can be used to construct RNA arrays on a single chip with high throughput, effectively reducing the cost of RNA-protein interaction detection and achieving high-throughput detection of RNA-protein interactions.

[0042] (2) The length of RNA in the RNA array constructed by the method provided by the present disclosure can be longer, which can meet the requirements of transcribing complete functional RNA, and the degree of crosstalk is lower, thereby improving the efficiency of RNA-protein interaction detection.

[0043] (3) The method provided by the present disclosure obtains a pure RNA array by digesting the transcribed DNA template, thereby reducing the interference of the template DNA on the subsequent interaction between RNA and proteins and other macromolecules; at the same time, through the free transcription capture method, the steric hindrance caused by RNA polymerase in the terminal roadblock RNA array construction method is avoided, thereby improving the accuracy of RNA-protein interaction detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] In order to more clearly illustrate the technical solutions in the present disclosure or related technologies, the following briefly introduces the drawings required for use in the embodiments or related technical descriptions. Obviously, the drawings described below are only embodiments of the present disclosure. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0045] FIG1 is a schematic flow chart of a method for constructing an RNA array according to an embodiment of the present disclosure.

[0046] FIG2 is a schematic diagram of the steps of a method for constructing an RNA array according to an embodiment of the present disclosure.

[0047] FIG3 is a schematic structural diagram of a first nucleic acid according to an embodiment of the present disclosure.

[0048] FIG4 is a schematic diagram showing the principle of RNA transcription capture according to an embodiment of the present disclosure.

[0049] FIG5 is a schematic diagram of the fluorescence visualization results of RNA transcription capture according to an embodiment of the present disclosure.

[0050] FIG6 is a schematic diagram of the mean fluorescence intensity results of RNA transcription capture according to an embodiment of the present disclosure.

[0051] FIG7 is a schematic diagram showing the principle of RNA crosstalk verification according to an embodiment of the present disclosure.

[0052] FIG8 is a schematic diagram of fluorescence visualization results of RNA crosstalk verification according to an embodiment of the present disclosure.

[0053] FIG9 is a schematic diagram showing the principle of RNA-protein interaction detection according to an embodiment of the present disclosure.

[0054] FIG10 is a schematic diagram of fluorescence visualization results of RNA transcription capture according to another embodiment of the present disclosure.

[0055] FIG11 is a schematic diagram of fluorescence visualization results of RNA-protein interaction detection according to an embodiment of the present disclosure.

[0056] FIG12 is a diagram showing the effect of a morpholino base RNA capture primer according to an embodiment of the present disclosure. DETAILED DESCRIPTION

[0057] The embodiments of the present disclosure are described in detail below, and examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and intended to be used to explain the present disclosure, but should not be understood as limiting the present disclosure.

[0058] RNA-protein interactions refer to RNA-binding proteins, which are proteins that can coordinate with one or more related RNAs to achieve biological functions. After binding to RNA, they play a role in regulating various biological processes. For example, (1) during transcription, the transcribed RNA can regulate its own transcription by coordinating with RNA polymerase (RNAP) II; (2) long noncoding RNAs (lncRNAs) can directly affect the expression of other genes by interacting with proteins, such as XIST lncRNA, which can guide regulatory proteins to chromatin to silence chromosomes; (3) RNA can also affect RNA localization, splicing, and other post-transcriptional regulation through interactions with proteins to regulate gene expression.

[0059] RNA-protein interactions are widely used in a variety of fields, including molecular detection, disease diagnosis, and treatment. Therefore, RNA-protein interaction detection methods can be applied to the screening and modification of RNA aptamers; they can also be used to develop RNA-based anticancer drugs based on the influence of gene transcription regulation on tumor immunity; and they can also be used in scientific research to observe the evolutionary trajectory of RNA-protein interactions.

[0060] The ability of RNA to bind to RBPs stems from the complex structures of RNA and proteins. In its natural state, RNA typically exists as a single strand. Single-stranded RNA exhibits a rich array of intramolecular interactions, including mismatched base bulges, stem-loops, pseudoknots, G-quadruplexes, divalent cation interactions, and non-canonical base pairing. Proteins, on the other hand, are also biological macromolecules with highly complex spatial structures. Consequently, due to the complexity of RNA-protein interactions, current methods for analyzing RNA sequences to understand these interactions are very limited.

[0061] Related research methods include gel shift, chromatin immunoprecipitation, surface plasmon resonance, and biofilm interferometry. These methods can initially identify RNA-protein interactions, but they suffer from significant limitations such as low throughput, low sensitivity, high labor intensity, high cost, and low automation. Although capillary electrophoresis has advanced the study of RNA-protein interactions to medium-throughput, it still faces challenges in scale-up and quantitative analysis.

[0062] In recent years, with the development of second-generation sequencing technology, the technology of generating hundreds of millions of DNA arrays on chips has become mature, the relationship between nucleic acid sequence, structure and function has been revealed, and new biological mechanisms have gradually been discovered. High-throughput sequencing platforms have become a powerful tool for in-depth analysis of RNA-protein interaction research methods. However, in related technologies, chip-based RNA-protein interaction research methods rely on DNA templates, the resulting RNA is short in length, and the required reaction space is large. As a result, there are problems such as interference from DNA signals, inability to measure longer RNA fragments in the original biological background, and low throughput.

[0063] To this end, embodiments of the present disclosure provide a method for constructing an RNA array, a kit for preparing an RNA array, and a method, apparatus, and kit for detecting RNA-protein interactions. This method is based on a first nucleic acid fixed to a chip, which is transcribed to obtain a target RNA strand; a second nucleic acid fixed to the chip is used to capture the target RNA strand, thereby obtaining a long, pure RNA array with high throughput. This improves the throughput, accuracy, and sensitivity of the method for detecting RNA-protein interactions.

[0064] An embodiment of the first aspect of the present disclosure provides a method for constructing an RNA array, comprising: based on a first nucleic acid fixed on a first chip, transcribing the first nucleic acid to obtain a target RNA chain; based on a second nucleic acid fixed on a second chip, capturing the target RNA chain using the second nucleic acid to obtain the RNA array. The first nucleic acid is a DNA molecule, and the second nucleic acid is a DNA molecule, optionally, the second nucleic acid comprises a nucleotide analog. The first nucleic acid is a single-stranded or double-stranded DNA molecule that is partially complemented to a double-stranded DNA molecule, preferably a partially complemented single-stranded DNA molecule; the second nucleic acid may be a single-stranded DNA molecule or may comprise an oligonucleotide that is complementary to a nucleotide molecule in the target RNA chain. It can be understood that since the first nucleic acid is a DNA template to be transcribed, it is in an open single-stranded DNA state.

[0065] In the examples of this application, "first chip" and "second chip" refer to solid-phase supports that can carry biological sequences and accommodate reactions such as sequence amplification. In some embodiments, the "first chip" and "second chip" can be simple glass slides or in situ capture chips, or they can be high-throughput sequencing chips, such as those suitable for DNB sequencing on the MGI platform (e.g., the BGISEQ-500 high-throughput sequencing chip) or high-throughput sequencing chips suitable for the Illumina platform. This application is not intended to limit the chip substrate.

[0066] In some embodiments, the first chip and the second chip are the same chip or different chips.

[0067] It should be noted that, in some embodiments, after sequencing the first nucleic acid on the first chip, the second chip may be introduced to generate the RNA array in a diffusion transfer manner.

[0068] In some embodiments, the first chip and the second chip are the same chip. It is understood that, based on the fact that the first chip and the second chip are the same chip, RNA transcription, target RNA capture, and subsequent DNA template digestion in the RNA array construction method proposed in the embodiments of the present application can all be performed on the same chip, thereby simplifying experimental operations, saving experimental costs, and improving experimental efficiency. In addition, this method does not require the target RNA to be transferred again, and therefore does not require a large reaction space, thereby greatly improving the construction throughput of the RNA array.

[0069] In some embodiments, the method further includes preparing the first nucleic acid fixed to the first chip, specifically including: synthesizing a first nucleic acid comprising the first sequence and the second sequence and fixing the first nucleic acid on the first chip. In an embodiment of the present application, a first nucleic acid template comprising the first sequence and the second sequence can be pre-synthesized, and amplification is performed based on the first nucleic acid template to obtain the first nucleic acid, and the first nucleic acid is fixedly connected to the first chip. It is understandable that the amplification of the first nucleic acid based on the first nucleic acid template can be performed on the first chip or outside the chip. The obtained first nucleic acid can be fixed on the chip by covalent bonding. The first nucleic acid will serve as a transcription template to obtain the target RNA chain.

[0070] In some embodiments, the first nucleic acid is selected from one or more of the following: DNA nanoballs (DNBs) generated by rolling circle amplification, DNA clusters generated by bridge amplification, synthetic DNA chains generated by strand displacement synthesis, and synthetic DNA chains generated by inkjet printing or chemical synthesis. It is understood that using the first nucleic acid immobilized on the chip as a transcription template can conveniently obtain a large number of target RNA chains.

[0071] In some embodiments, the first nucleic acid comprises a first sequence for sequencing and a second sequence for transcription.

[0072] In some embodiments, the first sequence comprises an adapter sequence and an identifier sequence, wherein the identifier sequence can be a unique molecular identifier (UMI). It is understood that based on the adapter sequence in the first sequence used for sequencing, the first nucleic acid can be sequenced in advance, thereby establishing a relationship between the sequence of the first nucleic acid and its position on the chip based on the specific identifier sequence in the first sequence. Subsequently, based on in situ capture of the target RNA, this relationship can be further used to indicate the position of each target RNA in the RNA array, thereby obtaining an RNA array with position and sequence resolution.

[0073] In some embodiments, the second sequence comprises a promoter sequence and a DNA sequence encoding the target RNA strand. It is understood that RNA polymerase can bind to the promoter sequence in the second sequence to transcribe the DNA coding sequence in the second sequence, thereby obtaining the target RNA strand.

[0074] In some specific embodiments, a first nucleic acid (or first nucleic acid template), i.e., a DNA template, can be constructed by overlapping PCR to include the following sequences: a looping adapter sequence, a barcode identifier sequence, a promoter for RNA polymerase, a DNA sequence encoding a target RNA chain, or a mutant library thereof. The first nucleic acid template is amplified into DNBs (i.e., the first nucleic acid) by cyclization and is loaded onto the surface of the first chip by the DNB loading program of the loader to form an array. Therefore, the sequence information of each first nucleic acid and its position in the array of the first chip can be determined by subsequently sequencing the first chip, as shown in (A) in Figure 1.

[0075] In some specific embodiments, the nucleotide sequence of the first nucleic acid encoding the second sequence of the target RNA chain is shown in SEQ ID NO: 1-4.

[0076] In some embodiments, the method further comprises preparing the second nucleic acid fixed on the second chip, specifically comprising: synthesizing the second nucleic acid and optionally amplifying the second nucleic acid; and fixing the second nucleic acid on the second chip.

[0077] In some embodiments, the second nucleic acid comprises a third sequence for capturing the target RNA strand, wherein the third sequence is at least partially complementary to the target RNA strand. It is understood that the second nucleic acid is attached to the second chip via modification of the third sequence, and after transcription, the target RNA can be captured in situ based on the third sequence that is at least partially complementary to the target RNA strand, thereby constructing an RNA array in a simple and rapid one-step process.

[0078] In some embodiments, the first nucleic acid is covalently linked to the first chip; and the second nucleic acid is covalently linked to the second chip.

[0079] It should be noted that, as shown in FIG1 (B), the second nucleic acid, i.e., a DNA primer (probe) for capturing the target RNA chain, can be fixed to the second chip through a two-step covalent reaction. In some embodiments, the first chip and the second chip are the same chip, so the second nucleic acid can be directly fixed on the first chip. Specifically, first, an amide bond is formed between azide-N-hydroxysuccinimide ester and a primary amine modified at the active site on the chip surface, thereby modifying the azide functional group on the chip. Then, the azide on the chip covalently links each second nucleic acid modified with DBCO at the 5' end to the chip surface through a click chemistry reaction. It can be understood that, based on the fact that the first chip and the second chip are the same chip, that is, the first nucleic acid and the second nucleic acid are simultaneously fixed on the same chip, the target RNA chain obtained after transcription can be directly captured by the second nucleic acid, and an RNA array with position and sequence information can be directly established by this in situ capture without the need for additional operations such as top and bottom alignment, thereby greatly simplifying the experimental process and effectively improving the preparation throughput.

[0080] It is understood that because the third sequence of the second nucleic acid is at least partially complementary to the 3' end of the target RNA chain, the target RNA chain can be captured through complementary base pairing. It is understood that the efficiency of RNA capture and resistance to DNA nuclease degradation can be improved by improving conditions such as the length of complementarity with RNA, the concentration of the second nucleic acid, and nucleic acid backbone modifications.

[0081] In some embodiments, the nucleotide sequence of the second nucleic acid is as shown in SEQ ID NO:5.

[0082] iSp18-DBCO-TGTGAGCCAAGGAGTTGTTGTCTTCCTAAGACCGC (SEQ ID NO: 5).

[0083] In some embodiments, the complementary length between the third sequence and the target RNA chain is at least 20 bp.

[0084] In some embodiments, the complementary length of the third sequence to the target RNA chain is 35 bp, and the third sequence has a modification such as dibenzocyclooctyne (DBCO), cyclooctyne, alkyne, or azide for fixation. Those skilled in the art will appreciate that the modification is used to connect the third sequence to the chip, which can be accomplished by a chemical reaction based on the modification or other non-covalent fixation method. This application is not intended to be limiting.

[0085] In some embodiments, the obtaining of the target RNA chain by transcribing the first nucleic acid includes: introducing the corresponding transcription system into the first chip according to the first nucleic acid; and transcribing based on the first nucleic acid as a template to obtain the free target RNA chain. It can be understood that the method for constructing an RNA array provided in the embodiment of the present application can produce target RNA chains of different lengths according to specific needs, and is particularly conducive to producing target RNA chains of longer lengths that are difficult to achieve in traditional technologies. Although the present application is not intended to limit the length of the RNA produced, in some embodiments, the target RNA chain produced by the method of the embodiment of the present application can reach a length of more than 300bp. If a long fragment transcription kit is used, the length of the RNA can be further increased.

[0086] In some embodiments, capturing the free target RNA chain by the second nucleic acid comprises: capturing the free target RNA chain to the second chip by the third sequence of the second nucleic acid.

[0087] It should be noted that the chip of the disclosed embodiment is compatible with a variety of in vitro transcription systems. Therefore, during specific transcription, the transcription system can be adjusted as needed. For example, the transcription system can be selected based on the promoter sequence in the first nucleic acid. As shown in (C) in Figure 1, before RNA transcription is performed, the region to be transcribed on the first nucleic acid should be padded to a double strand according to the needs of RNAP. For example, for T7RNAP, transcription can be performed by simply padded the promoter sequence to a double strand, while for the whole enzyme, all transcription sequences need to be padded to a double strand. T4 or phi29 DNA polymerase systems can be selected to padded the double strands. As shown in Figure 1 (D), the RNA in vitro transcription reaction system is passed into the chip to transcribe and generate a target RNA chain. As shown in Figure 1 (E), as described above, the target RNA chain is captured by the second nucleic acid on the chip through base complementarity.

[0088] In some embodiments, the promoter can be a prokaryotic and eukaryotic promoter such as a T7 promoter, a T7lac promoter, or an sp6 promoter. In some embodiments, the promoter is a T7 promoter, which initiates transcription by a T7 promoter hybrid primer as shown in SEQ ID NO:6 (GATAATACGACTCACTATAGGG). It is understood that the promoter sequence in the RNA array construction method proposed in the embodiment of the present application is not intended to be limited to this as long as it is ensured that it can be bound by RNA polymerase to initiate transcription of the target RNA.

[0089] In some embodiments, the method further comprises: sequencing the first nucleic acid to determine a first signal based on each of the first nucleic acids, wherein the first signal comprises the sequence and position of each of the first nucleic acids on the first chip. It is understood that after the first nucleic acid is fixed to the first chip, the first nucleic acid can be sequenced to determine the specific sequence of the first nucleic acid and its position on the first chip. The sequence and position can be directly converted into the position and specific sequence of each target RNA in the constructed RNA array by in situ capture based on the target RNA chain transcribed therefrom, and the affinity of the protein to be tested to each RNA can be evaluated based on the position and specific sequence of each RNA at a later stage.

[0090] In some embodiments, the method further comprises digesting the first nucleic acid to purify the RNA array. It is understood that by digesting the original DNA template in the RNA array, DNA interference can be effectively reduced, making the detection of RNA-protein interaction signals more accurate.

[0091] In some embodiments, the enzyme used to digest the first nucleic acid is a nuclease, preferably DNase I, DNase II, nuclease S1 and / or nuclease S7, more preferably nuclease S1.

[0092] It should be noted that, as shown in FIG1(F), after the RNA capture step, the DNB can be digested by a nuclease digestion system to obtain a pure RNA array. Commonly used nucleases include DNase I, DNase II, nuclease S1, nuclease S7, etc. It is understood that in practice, an endonuclease that tends to digest nucleotides of single-stranded DNA should be selected, and its efficiency in digesting single-stranded nucleic acids should be much greater than that of double-stranded DNA-RNA hybrid molecules. Ultimately, the transcribed DNA template is digested, while the RNA hybridized to the DNA capture primer is retained.

[0093] An embodiment of the second aspect of the present disclosure provides a method for detecting RNA-protein interactions, comprising: contacting a target protein with an RNA array to obtain RNA-protein interaction data, wherein the RNA array is obtained according to the method for constructing an RNA array described in any embodiment of the first aspect of the present disclosure. It will be understood that by contacting the target protein with the RNA array to obtain a hybridization signal, the affinity of the target single marker for each RNA sequence in the RNA array can be determined based on the size of the detected hybridization signal.

[0094] In some embodiments, the target protein may carry a fluorescent label, and contacting the target protein with the RNA array to obtain RNA-protein interaction data comprises: contacting the target protein with the RNA array; after contact, detecting the RNA array to collect a second signal, wherein the second signal is a fluorescent signal of the target protein bound to the RNA array; and obtaining the RNA-protein interaction data based on the second signal.

[0095] In some embodiments, the affinity of each RNA in the RNA array to the target protein is determined based on the RNA-protein interaction data. It should be noted that the constructed RNA array can be used to detect the interaction between RNA and protein. After the target protein is expressed and purified, the target protein is labeled with a fluorescent dye. When the fluorescently labeled protein is brought into contact with the RNA array, the target protein with a high affinity for the RNA sequence can remain on the chip surface by binding, thus displaying a fluorescent signal at this site. After protein binding, a second signal acquisition is performed by taking pictures, and the affinity of different RNA sequences to the target protein can be obtained by matching the first signal of the previous sequencing through algorithm processing.

[0096] It is understood that, by in situ capture, the specific position and specific information of each RNA sequence in the RNA array can be known based on the above-mentioned first signal in the embodiment of the present application; and by detecting the second signal, the specific hybridization signal between the target protein and each RNA sequence in the RNA array can be known and the specific affinity can be determined. Therefore, according to the strength of the hybridization signal displayed by the second signal, the RNA sequence with a higher affinity to the protein of interest (target protein) can be traced back and known through the first signal. This achieves high-throughput, high-accuracy screening of target proteins or affinity sequences.

[0097] In some embodiments, the target protein can be MS2, GFP, AGO, HuR, AUF1 RNA binding protein, including but not limited to these.

[0098] An embodiment of the third aspect of the present disclosure provides a kit for preparing an RNA array, comprising: a first nucleic acid, which is fixed on a first chip; a second nucleic acid, which is fixed on a second chip; and an optional sequencing system, a transcription system, and a digestion system, wherein the first nucleic acid is a DNA molecule, and the second nucleic acid is a DNA molecule, optionally, the second nucleic acid contains a nucleotide analog, and the first chip and the second chip are the same chip or different chips.

[0099] An embodiment of the fourth aspect of the present disclosure provides a kit for detecting RNA-protein interactions, the kit comprising an RNA array, and the RNA array is obtained according to the method for constructing an RNA array according to any embodiment of the first aspect of the present disclosure.

[0100] In some embodiments, the RNA array comprises a plurality of different RNAs, and is used to detect the interaction between the target protein and the plurality of different RNAs to determine affinity.

[0101] In some embodiments, the density of the second chip is the same as the density of the first chip.

[0102] An embodiment of the fifth aspect of the present disclosure provides an RNA-protein interaction detection device, comprising: an RNA array construction module, for constructing the RNA array based on a first nucleic acid, a second nucleic acid, a first chip, and a second chip, wherein the RNA array construction module is specifically used to: obtain a target RNA chain by transcribing the first nucleic acid based on the first nucleic acid fixed on the first chip; capture the target RNA chain using the second nucleic acid based on the second nucleic acid fixed on the second chip to obtain the RNA array; a target protein acquisition module, for acquiring the target protein; and an RNA-protein interaction detection module, for obtaining the RNA-protein interaction data by contacting the RNA array with the target protein, wherein the first nucleic acid is a DNA molecule, and the second nucleic acid is a DNA molecule, optionally, the second nucleic acid contains nucleotide analogs, and the first chip and the second chip are the same or different chips.

[0103] It should be noted that the explanation of the embodiment of the method for constructing an RNA array in the embodiments of the present application is also applicable to the proposed method for detecting RNA-protein interactions, a kit for preparing an RNA array, a kit for detecting RNA-protein interactions, and an RNA-protein interaction detection device, which also achieve the same beneficial effects and are not further described in this application.

[0104] The following examples will explain in detail the methods for constructing RNA arrays, kits for preparing RNA arrays, and methods and devices for detecting RNA-protein interactions, as well as kits, proposed in this disclosure. It should be noted that the experimental methods in the following examples, unless otherwise specified, are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0105] Unless otherwise specified, the quantitative tests in the following examples were performed three times, and the results were averaged.

[0106] Unless otherwise specified, the sequences required for the examples disclosed herein were synthesized by HuaDa Liuhe.

[0107] Example 1

[0108] The structure of the DNA template used as the first nucleic acid in the disclosed embodiment is shown in Figure 3. Referring to Figure 3, the DNA template includes a 5'-end circularization linker sequence, a T7 promoter sequence, a GFP adapter sequence, and a 3'-end circularization linker sequence that also serves as a second nucleic acid hybridization sequence. It is understandable that the GFP adapter sequence is used to simulate the nucleic acid encoding the target RNA chain and is included in the second sequence of the first nucleic acid in this embodiment. The 3'-end circularization linker sequence acts as both a circularization linker sequence and a nucleic acid of the target RNA chain, and therefore can also be included in the second sequence of the first nucleic acid. As shown in Figure 4, since the GFP adapter sequence can be transcribed to generate RNA that specifically binds to a fluorescent molecule, it is possible to visually verify whether the RNA capture probe on the chip can capture the transcribed RNA by using a fluorescent GFP RNA detection primer. The specific steps are as follows:

[0109] (1) Synthesizing a DNA template with a GFP aptamer sequence (SEQ ID NO: 1) and fabricating it into nanospheres;

[0110] (2) The nanospheres were loaded onto a BGI500 high-throughput sequencing chip (BGI, 930-000007-00) and sequenced to obtain the sequence and position information of the DNA;

[0111] (3) After sequencing is complete, formamide is added and maintained at 55°C for 10 min to elute the sequencing strand;

[0112] (4) Using phosphate buffered saline, NHS-azide (Thermo Scientific TM NHS-PEG4-azide, catalog number: 26130) was diluted to 10,000 times, and the diluted NHS-azide solution was passed into the chip in (3) through a loading instrument (BGI fully automatic sample loading system, BGIDL-50);

[0113] (5) After reacting at room temperature for 30 min, the chip was washed with PBS solution to remove unbound NHS-azide;

[0114] (6) Using 5xssc (Sanggong, B548110), the DBCO-RNA capture primer (second nucleic acid, SEQ ID NO: 5) was diluted to a concentration of 10 nM-100 nM, and the diluted second nucleic acid was introduced into the chip in (5) and reacted at room temperature overnight to fix the second nucleic acid to the chip through a click chemistry reaction;

[0115] (7) washing the chip with PBS solution to remove the second nucleic acid that is not bound to the chip;

[0116] (8) Add T7 promoter hybridization primer (SEQ ID NO: 6) and react at 55°C for 2 min, then at 30°C for 2 min. After the primer hybridizes with the promoter on the DNA template, wash the chip with PBS solution;

[0117] (9) Prepare T7 in vitro transcription reagent (Invitrogen TM MEGAscript TM The transcription reaction system of T7 transcription kit (Cat. No. AM1334) was introduced into the chip and transcribed at 37°C for 2 h;

[0118] (10) After the transcribed target RNA, i.e., the GFP aptamer, is captured on the chip, an appropriate volume of S1 enzyme (Thermo Scientific) is prepared according to the user manual. TM S1 nuclease (Cat. No. EN0321) digestion system was passed into the chip and reacted at 30°C for 30 min.

[0119] (11) Add the GFP RNA detection primer with AF532 fluorescence (AF532-AGCTTCTGTGGTGGCCCTCTTTTAA, SEQ ID NO: 7) to the chip and react at 55°C for 2 min and at 30°C for 2 min to allow the primer to hybridize with the RNA;

[0120] (12) Wash the chip with PBS solution to remove excess fluorescent primers and take photos to observe the RNA transcription capture.

[0121] The results of RNA transcription capture are shown in Figures 5 and 6. Channel 1 on the chip, referred to as L1, is the experimental group, where transcription capture is performed normally; L2 serves as the DNB control group, where PBS is passed instead of transcription reagent.

[0122] Figure 5 shows the visualization of the chip image, with a clear fluorescent spot in the L1 channel, indicating that GFP RNA was transcribed and captured in situ on the chip. No fluorescent signal was observed in the L2 channel. Figure 6 shows the average fluorescence intensity in the L1 and L2 channels. These results demonstrate that RNA can be immobilized on the chip surface through transcription and in situ capture, demonstrating the feasibility of the RNA array construction method provided by the present disclosure.

[0123] Example 2

[0124] As shown in Figure 7, the disclosed embodiment uses two different nucleic acid sequences encoding different RNAs to prepare DNA templates, and also uses fluorescent probe hybridization to explore the degree of RNA crosstalk. The specific steps are as follows:

[0125] (1) synthesizing DNA templates having nucleic acid sequence S1 (SEQ ID NO: 2) and nucleic acid sequence S2 (SEQ ID NO: 3), respectively, and fabricating them into nanospheres;

[0126] (2) Repeat steps (2) to (5) in Example 1;

[0127] (3) Using 5xssc (Sangon, B548110), the DBCO-RNA capture primer (second nucleic acid, SEQ ID NO: 5) was diluted to a concentration of 10 nM-100 nM, and the diluted second nucleic acid was introduced into the chip and reacted at room temperature overnight to fix the second nucleic acid to the chip through click chemistry reaction;

[0128] (4) Repeat steps (7) to (10) in Example 1;

[0129] (5) Fluorescent RNA detection primers AF532-P1 primer (AF532-CAATTGCGCCACGACGTTTCGTGCT, SEQ ID NO: 8) and AF647-P2 primer (AF647-AGCTTCTGTGGTGGCCCTCTTTTAA, SEQ ID NO: 9) carrying AF532 fluorescence and AF647 fluorescence, respectively, were added to the chip and reacted at 55°C for 2 min and at 30°C for 2 min to allow the primers to hybridize with RNA P1 and P2 transcribed from S1 and S2;

[0130] (6) Wash the chip with PBS solution to remove excess fluorescent primers and take photos to observe RNA crosstalk.

[0131] The crosstalk results of two RNAs P1 and P2 are shown in Figure 8. If the two RNAs crosstalk at the same site, two fluorescences will be displayed. Figure 8 (A) shows the fluorescence of AF532-P1. Figure 8 (B) shows the fluorescence of AF647. After the positions of Figure 8 (A) and (B) are aligned, it can be seen that the fluorescence points of P1 and P2 exist separately. 6The results of calculating the overlap of P1 and P2 fluorescent bright spots in the data volume show that the crosstalk RNA sites account for only about 5%. This result shows that the two RNAs can be correctly transcribed and captured respectively, and the degree of crosstalk is low. This also suggests that the RNA array construction method proposed in the present disclosure can be used to construct multiple RNA arrays on the same chip and used for batch detection of interactions with proteins of interest to screen out RNA sequences with higher affinity for the protein, thereby achieving high-throughput and high-accuracy RNA-protein interaction detection.

[0132] Example 3

[0133] The present embodiment uses RNA binding protein MS2 and its RNA binding sequence to verify the feasibility of the method for detecting RNA-protein interaction provided by the present disclosure. As shown in Figure 9, this embodiment constructs a specific binding RNA array of MS2 on a chip, and introduces MS2 protein carrying a fluorescent marker AF647 to detect whether the constructed RNA array is used to detect interactions with proteins. It should be noted that only when the RNA on the chip is completely transcribed and correctly folded can it bind to its corresponding RBPs.

[0134] It is known that the RNA-binding protein MS2 (i.e., the bacteriophage capsid protein MS2) is composed of 129 amino acids and can specifically bind to an RNA sequence with a 19-base stem-loop structure. MS2 and its MS2 RNA binding sequence are a classic model for studying RNA-protein interactions. Therefore, those skilled in the art will recognize that the verification results of this example are universal. The specific steps are as follows:

[0135] (1) Preparation of MS2 protein;

[0136] (2) AF647 dye (Invitrogen TM Alexa Fluor TM 647NHS ester, Catalog No. A37573) was added to the protein solution at an amount 3 times that of MS2 protein and incubated in the dark at room temperature for 1 h;

[0137] (3) adding 50 mM Tris solution to the solution obtained in step (2), mixing, incubating for 10 min, and then terminating the reaction;

[0138] (4) Using purification columns (Thermo Scientific TM Zeba TM Dye and biotin removal spin columns (0.5 mL, Catalog No. A44296) were used to remove the remaining fluorescent dye and obtain the MS2 protein carrying the fluorescent label AF647 (AF647-MS2).

[0139] (5) synthesizing a DNA template with an MS2 RNA binding sequence (SEQ ID NO: 4) and fabricating it into nanospheres;

[0140] (6) Repeat steps (2) to (5) in Example 1;

[0141] (7) Using 5xssc, the DBCO-RNA capture primer (second nucleic acid, SEQ ID NO: 5) was diluted to an appropriate concentration, and the diluted second nucleic acid was introduced into the chip and reacted at room temperature overnight to fix the second nucleic acid to the chip through a click chemistry reaction;

[0142] (8) Repeat steps (7) to (10) in Example 1;

[0143] (9) Add the MS2 RNA detection primer with AF532 fluorescence (AF532-GGATCCAGGAACGTCTTCCATACAACCTCCTTACTACAT, SEQ ID NO: 10) to the chip and react at 55°C for 2 min and at 30°C for 2 min to allow the primer to hybridize with the RNA;

[0144] (12) Wash the chip with PBS solution to remove excess fluorescent primers and take photos to observe RNA transcription capture;

[0145] (13) Add 1% casein (Thermo Scientific TM Blocker in PBS TM Casein, Catalog No. 37582) and reacted at room temperature for 1 h to allow casein to bind to the nonspecific adsorption sites on the chip surface;

[0146] (14) AF647-MS2 was diluted with TMK buffer (100 mM Tris-HCl, pH 8.0, 80 mM KCl, 10 mM MgCl2), and 1% casein, 0.05 U / μl RNase inhibitor (20 U / μL SUPERase·In TM RNase inhibitor, Catalog No.: AM2694);

[0147] (15) The AF647-MS2 solution obtained in (14) was introduced into the chip in a volume of 200 μl on a loader and incubated at room temperature for 1 h to allow the protein to bind to the RNA array;

[0148] (16) The chip was washed with TMK buffer containing 0.1% Tween-20, and the binding of RNA and protein was analyzed by taking photos.

[0149] The RNA transcription capture results are shown in FIG10 . The fluorescent bright spots are evenly displayed in the AF532 fluorescence channel, demonstrating that the target RNA was captured by transcription and the RNA array was successfully constructed.

[0150] The results of RNA-protein interaction detection are shown in Figure 11. As shown in Figure 11, in the AF647 fluorescence channel, the fluorescent bright spot is clearly distinguished from the background, proving that the RNA captured on the chip is structurally intact, forms the correct spatial structure in the TMK buffer environment, specifically binds to its target RBPs (MS2), and exhibits significant RNA-protein interactions. This indicates that the RNA array constructed by the RNA array construction method of the embodiment of the present application has a correct RNA structure and can effectively capture the target protein, thereby achieving high-resolution RNA-protein interaction detection.

[0151] Example 4

[0152] In the above embodiment, although the S1 enzyme tends to digest the DNA template rather than the target RNA, some RNA is still digested. Therefore, based on the RNA array construction method, the embodiment of the present application further optimizes the second nucleic acid used as the RNA capture primer to obtain a more complete RNA array with higher throughput. In this embodiment, natural base and morpholino base primers are used as RNA capture primers, respectively, and the DNA template of the S2 sequence is used as the target RNA chain transcribed by the first nucleic acid to obtain an RNA array; and the DNA template is digested by S1 enzyme and Turbo DNase respectively, and then the retention of the target RNA is detected with complementary paired fluorescent DNA primers. The specific steps are as follows:

[0153] (1) A DNA template having the nucleic acid sequence S2 (SEQ ID NO: 3) was synthesized and made into nanospheres. 12 ng of the DNA template was taken and steps (2) to (5) in Example 1 were repeated.

[0154] (2) Dilute the natural base DBCO-RNA capture primer (second nucleic acid, SEQ ID NO: 5) to 10 nM using 5xssc (Sanggong, B548110), and dilute the morpholino base RNA capture primer modified with Cyclooctyne at the 5' end (gene-tools, 5'-Cyclooctyne v3morpholino oligo (optimized second nucleic acid: TGTGAGCCAAGGAGTTGTTGTCTTC, SEQ ID NO: 11)) to 10 nM using water. The two diluted RNA capture primers were introduced into the chip and reacted at room temperature overnight.

[0155] (3) Repeat steps (7)-(9) in Example 1 to perform RNA transcription and capture;

[0156] (4) Using S1 enzyme (Thermo Scientific TM S1 nuclease (catalog number: EN0321) and Turbo DNase enzyme (thermo fisher, catalog number: AM2238) were respectively introduced into the chip and reacted at 30°C for 30 min to digest the DNA template;

[0157] (5) After digestion, the detection primer AF532-P2 (AF532-AGCTTCTGTGGTGGCCCTCTTTTAA, SEQ ID NO: 12) with AF532 fluorescence was introduced into each chip for RNA hybridization detection.

[0158] The optimized second nucleic acid in the present embodiment, i.e., the backbone structure of the morpholino base RNA capture primer is shown in Figure 12 (A). The morpholino base RNA capture primer can resist digestion with multiple nucleases and can stably bind to the target RNA single strand in the form of base pairing. The optimization result is shown in Figure 12 (B). When using DNase to digest DNB, the target RNA amount retained by the morpholino base RNA capture primer is significantly higher than the target RNA amount that the natural base DBCO-RNA capture primer can retain when using S1 enzyme to digest DNB. This result shows that when constructing a high-throughput RNA array in a transcription capture mode, the morpholino base RNA capture primer has a better RNA retention effect than the natural primer, and therefore, can be used as an optimized RNA capture primer. In summary, it has been demonstrated that the method provided by the present disclosure embodiment can construct an RNA array in high throughput on a chip, and its crosstalk level is low, and it can be effectively used for high throughput, high accuracy detection of RNA and protein interactions.

[0159] In the description of the present disclosure, it should be understood that the terms "up", "down", "front", "back", "left", "right", "inside", "outside", etc., indicating directions or positional relationships, are based on the directions or positional relationships shown in the accompanying drawings, and are only for the convenience of describing the present disclosure and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific direction, be constructed and operated in a specific direction, and therefore cannot be understood as a limitation on the present disclosure.

[0160] Furthermore, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features being referred to. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one such feature. Throughout the present disclosure, "plurality" means at least two, such as two, three, etc., unless otherwise specifically defined.

[0161] In the present disclosure, unless otherwise expressly specified or limited, when a first feature is "above" or "below" a second feature, it may mean that the first and second features are in direct contact, or the first and second features are in indirect contact through an intermediate medium. Furthermore, when a first feature is "above," "above," or "above" a second feature, it may mean that the first feature is directly above or diagonally above the second feature, or simply means that the first feature is at a higher level than the second feature. When a first feature is "below," "below," or "below" a second feature, it may mean that the first feature is directly below or diagonally below the second feature, or simply means that the first feature is at a lower level than the second feature.

[0162] In the present disclosure, the terms "one embodiment", "some embodiments", "examples", "specific examples", or "some examples" mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present disclosure. In this specification, the schematic expressions of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.

[0163] Although the embodiments of the present disclosure have been shown and described above, it is understood that the above embodiments are illustrative and are not to be construed as limitations on the present disclosure. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present disclosure.

Claims

1. A method for constructing an RNA array, comprising: Based on the first nucleic acid immobilized on the first chip, obtaining a target RNA strand by transcribing the first nucleic acid; Based on the second nucleic acid immobilized on the second chip, capturing the target RNA strand by using the second nucleic acid to obtain the RNA array, Wherein the first nucleic acid is a DNA molecule, and the second nucleic acid is a DNA molecule. Optionally, the second nucleic acid contains nucleotide analogs.

2. The method for constructing an RNA array according to claim 1, wherein The first chip and the second chip are the same or different chips. Preferably, the first chip and the second chip are the same chip.

3. The method for constructing an RNA array according to claim 1, wherein The first nucleic acid contains a first sequence for sequencing and a second sequence for transcription, Optionally, the first sequence contains a linker sequence and an identifier sequence; the second sequence contains a promoter sequence and a DNA sequence encoding the target RNA strand.

4. The method for constructing an RNA array according to claim 3, wherein The method further includes preparing the first nucleic acid immobilized on the first chip, specifically including: Synthesizing a first nucleic acid containing the first sequence and the second sequence; and Immobilizing the first nucleic acid on the first chip.

5. The method for constructing an RNA array according to claim 1, wherein The second nucleic acid contains a third sequence for capturing the target RNA strand, wherein the third sequence is at least partially complementary to the target RNA strand, Optionally, the complementary length of the third sequence to the target RNA strand is greater than 20 bp, preferably 35 bp; the third sequence has a dibenzocyclooctyne, cyclooctyne, alkyne or azide modification for immobilization.

6. The method for constructing an RNA array according to claim 5, wherein, The first nucleic acid is selected from one or more of the following: DNA nanospheres generated by rolling circle amplification, DNA clusters generated by bridge amplification, synthetic DNA strands generated by strand displacement synthesis methods, synthetic DNA strands generated by inkjet printing or chemical synthesis methods.

7. The method for constructing an RNA array according to claim 5, wherein The method further includes preparing the second nucleic acid immobilized on the second chip, specifically including: Synthesizing the second nucleic acid and optionally amplifying the second nucleic acid; and Immobilizing the second nucleic acid on the second chip.

8. The method for constructing an RNA array according to any one of claims 1 to 7, characterized in that, The first nucleic acid is covalently linked to the first chip; the second nucleic acid is covalently linked to the second chip.

9. The method for constructing an RNA array according to any one of claims 1 to 8, characterized in that, The method further includes: Sequencing the first nucleic acid to determine a first signal based on each of the first nucleic acids, wherein the first signal includes the sequence and position of each of the first nucleic acids on the first chip.

10. The method for constructing an RNA array according to claim 1, wherein The method further includes digesting the first nucleic acid to purify the RNA array.

11. The method for constructing an RNA array according to claim 10, wherein The enzyme for digesting the first nucleic acid is a nuclease, preferably DNase I, DNase II, nuclease S1 and / or nuclease S7, more preferably nuclease S1.

12. The method for constructing an RNA array according to claim 1, wherein The first chip and the second chip are different chips, and the second chip generates the RNA array by diffusion transfer printing.

13. A method for detecting RNA-protein interaction, characterized in that, Including: Contacting a target protein with the RNA array to obtain RNA-protein interaction data, wherein the RNA array is obtained by the method for constructing an RNA array according to any one of claims 1 to 12.

14. The detection method of RNA-protein interaction according to claim 13, wherein, The target protein carries a fluorescent label, and the contacting the target protein with the RNA array to obtain RNA-protein interaction data includes: Contact the target protein with the RNA array; After the contact, detect the RNA array to collect a second signal, where the second signal is the fluorescence signal of the target protein bound on the RNA array; and Based on the second signal, obtain the RNA-protein interaction data. Optionally, according to the RNA-protein interaction data, determine the affinity of each RNA in the RNA array for the target protein.

15. A kit for preparing an RNA array, characterized in that, Comprising: A first nucleic acid, which is immobilized on a first chip; A second nucleic acid, which is immobilized on a second chip; And an optional sequencing system, transcription system, and digestion system. Wherein the first nucleic acid is a DNA molecule, and the second nucleic acid is a DNA molecule. Optionally, the second nucleic acid contains nucleotide analogs. The first chip and the second chip are the same or different chips. Preferably, the first chip and the second chip are the same chip.

16. The kit according to claim 15, wherein The first nucleic acid contains a first sequence for sequencing and a second sequence for transcription. Optionally, the first sequence contains an adapter sequence and an identifier sequence; the second sequence contains a promoter sequence and a DNA sequence encoding a target RNA strand.

17. The kit according to claim 15, wherein The second nucleic acid contains a third sequence for capturing the target RNA strand, where the third sequence is at least partially complementary to the target RNA strand. Optionally, the complementary length of the third sequence to the target RNA strand is greater than 20 bp, preferably 35 bp.

18. The kit according to any one of claims 15 to 17, characterized in that, The first nucleic acid is selected from one or more of the following: DNA nanospheres generated by rolling circle amplification, DNA clusters generated by bridge amplification, synthetic DNA strands generated by strand displacement synthesis methods, synthetic DNA strands generated by inkjet printing or chemical synthesis methods; the second nucleic acid is a naturally occurring nucleic acid sequence or an artificially constructed nucleic acid sequence.

19. The kit according to claim 18, characterized in that, The first nucleic acid is covalently linked to the first chip; the second nucleic acid is covalently linked to the second chip.

20. A kit for detecting RNA-protein interaction, characterized in that, The kit includes an RNA array, which is obtained according to the method for constructing an RNA array as described in any one of claims 1 to 12. Optionally, the RNA array contains a plurality of different RNAs for detecting the interaction between a target protein and the plurality of different RNAs to determine the affinity.

21. An RNA-protein interaction detection device, characterized in that, Comprising: An RNA array construction module for constructing the RNA array based on the first nucleic acid, the second nucleic acid, the first chip, and the second chip. Specifically, the RNA array construction module is used to: based on the first nucleic acid immobilized on the first chip, obtain a target RNA strand by transcribing the first nucleic acid; based on the second nucleic acid immobilized on the second chip, capture the target RNA strand using the second nucleic acid to obtain the RNA array. A target protein acquisition module for acquiring the target protein; And An RNA-protein interaction detection module for obtaining the RNA-protein interaction data by contacting the RNA array with the target protein. Wherein the first nucleic acid is a DNA molecule, and the second nucleic acid is a DNA molecule. Optionally, the second nucleic acid comprises nucleotide analogs. The first chip and the second chip are the same or different chips. Preferably, the first chip and the second chip are the same chip.

Images