Recombinant halomonas capable of inducing protein self-degradation, construction method therefor, and use thereof

By knocking out the SspB protein and inserting the SsrA tag at the C-terminus of the protein to be degraded, the ClpXP protease system is used to achieve self-degradation of proteins in the late stage of bacterial growth, solving the problem of difficult to regulate late stage proteins in the prior art, and improving the protein degradation efficiency and changes in bacterial morphology.

WO2025130719A1PCT designated stage expired Publication Date: 2025-06-26TSINGHUA UNIVERSITY +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/138461
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-19
Filing Date
2024-12-11
Publication Date
2025-06-26

AI Technical Summary

Technical Problem

The prior art is difficult to effectively regulate the expressed proteins later in the growth of bacteria, resulting in the inability to effectively shorten the half-life of the protein.

Method used

The self-degradation of proteins is achieved by knocking out the SspB protein and inserting the SsrA tag at the C-terminus of the protein to be degraded.

Benefits of technology

Delayed and rapid degradation of specific proteins in the middle and late stages of bacterial growth is achieved, shortening the half-life of proteins, and improving the morphological changes of the strain and PHA production capacity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024138461_26062025_PF_FP_ABST
    Figure CN2024138461_26062025_PF_FP_ABST
Patent Text Reader

Abstract

Provided are a recombinant Halomonas capable of inducing protein self-degradation, a construction method therefor, and a use thereof. The recombinant Halomonas does not express SspB protein or the expressed SspB protein does not have a function or has a reduced function, and in the recombinant Halomonas an SsrA tag is inserted into the C-terminus of a protein to be degraded. The recombinant Halomonas can degrade a target protein in the middle and late stages of growth or in a product synthesis stage, and said method is used to achieve the regulation of protein degradation.
Need to check novelty before this filing date? Find Prior Art

Description

Recombinant Halomonas bacteria that induce protein self-degradation and its construction method and application Technical Field

[0001] The present invention relates to the field of microbial engineering, and in particular to a recombinant Halomonas bacterium capable of inducing protein self-degradation, a construction method and an application thereof. Background Art

[0002] Halomonas, a microorganism that can tolerate high salt and high pH environments, is a valuable research material and production resource. Currently, next-generation industrial biotechnology based on halophilic bacteria is relatively mature, with strong market competitiveness and unique advantages due to its advantages in energy conservation, reduced freshwater consumption, and cost reduction.

[0003] Many essential genes in bacteria cannot be directly knocked out because they play an important role in the early stages of bacterial growth. Some existing methods for inhibiting gene expression in the later stages, such as CRISPRi (Clustered regularly interspaced shortpalindromic repeats interference, gene suppression / silencing), are to connect the dCas9 (dead CRISPR-associated protein 9) protein to a transcriptional repressor, such as KRAB (Kruppel associated box). Under the guidance of gRNA (guide RNA), the fusion protein dCas9-KRAB will bind to the target DNA targeted by the gRNA, inhibiting the transcription of DNA into RNA and suppressing the expression of the target gene. Another example is siRNA (Small interfering RNA) technology. siRNA is a short double-stranded RNA that, after entering the cytoplasm, will form base complementary pairs with the target mRNA in the cell and cut the target mRNA, preventing the target mRNA from being normally translated into protein. However, these methods regulate gene expression at the DNA (deoxyribonucleic acid) or RNA (ribonucleic acid) level and cannot regulate proteins that have already been expressed. If regulation is attempted at a later stage, interference from proteins already expressed earlier is unavoidable.

[0004] Therefore, a method for regulating the protein level in the middle and late stages of bacterial growth is needed, so that the target protein is degraded in the middle and late stages of bacterial growth, thereby shortening the half-life of the target protein.

[0005] Many bacteria possess ATP (Adenosine 5'-triphosphate)-dependent protease degradation systems, including the Clp protease family, Lon protease, FtsH protease, and HslUV protease. Among these, ClpXP protease in the Clp family is the most widely studied and applied. Its primary function is to remove or degrade improperly synthesized, damaged, or useless intracellular proteins, maintaining the homeostasis of intracellular proteins under normal metabolism and stress.

[0006] The ClpXP protease works as follows: When protein synthesis on the ribosome stalls, tmRNA (transfer-messenger RNA) is recruited to the ribosome. tmRNA, which simultaneously functions as both mRNA (messenger RNA) and tRNA (transfer RNA), adds a degradation tag, called ssrA, to the C-terminus of the stalled protein. Subsequently, with the assistance of the adaptor protein SspB, the ssrA-tagged target protein is recognized by the ClpXP complex and rapidly degraded. Summary of the Invention

[0007] The present invention provides a method for inducing protein self-degradation in Halomonas to shorten the half-life of the protein. This method can regulate the protein level in bacteria at different stages of bacterial growth, especially in the middle and late stages of bacterial growth, and can achieve regulation of essential genes of bacteria compared to the method of directly knocking out genes. In addition, this method is directly regulated at the protein level. Protein is the bearer of life activities. Genes produce proteins through transcription and translation to exercise corresponding functions. Therefore, this method is more direct than the regulation performed at the DNA or RNA level by CRISPRi and siRNA.

[0008] Specifically, the present application first knocks out the SspB protein and verifies that the growth and production of metabolites of the strain are not affected after the SspB protein is knocked out. The purpose of knocking out the SspB protein is to reduce the recognition accuracy of the clpXP proteasome to the ssrA sequence. In the presence of SspB, even if the ssrA sequence mutates, it will cause rapid degradation of the protein. After knocking out SspB, the change in the ssrA sequence has a greater impact on the degradation effect. The SsrA tag modified by the present application is further added to the C-terminus of the protein to be degraded, and the modified strain is cultured. The results show that the degradation of the expected degraded protein begins to degrade in the middle and later stages of strain growth. Therefore, this method is particularly suitable for the degradation of proteins that are necessary in the early stages of strain growth but not required in the later stages, such as proteins that maintain cell morphology and / or are related to mitosis - MreB protein, FtsZ protein, or protein - GltA protein related to metabolic flux regulation.

[0009] Since MreB protein, FtsZ protein or GltA protein are essential in the early stage of strain growth, it is necessary to regulate their normal expression in the early stage, but degrade them in the middle and late stages. During the experiment on the degradation of MreB protein, FtsZ protein and GltA protein, the inventors unexpectedly found that after knocking out the SspB protein and adding the SsrA tag to the C-terminus of the MreB protein, FtsZ protein or GltA protein, the MreB protein, FtsZ protein or GltA protein began to degrade after culturing the transformed bacteria for 12-24 hours, and the dry weight of the bacteria and the product yield were increased. In addition, the late degradation of the MreB protein or FtsZ protein caused the morphology of the strain to change from rod-shaped to spherical, which made the isolation of the strain easier.

[0010] The first aspect of the present invention provides a recombinant Halomonas bacterium that induces protein self-degradation.

[0011] The recombinant Halomonas does not express SspB protein or the expressed SspB protein has no function or has reduced function.

[0012] The amino acid sequence of the SspB protein comprises SEQ ID NO: 2 or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% or more homology with SEQ ID NO: 2, and has the same or similar function as SEQ ID NO: 2.

[0013] The coding gene sequence of the SspB protein comprises SEQ ID NO: 3 or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% or more homology with SEQ ID NO: 3, and has the same or similar function as SEQ ID NO: 3.

[0014] The lack of SspB protein expression or the lack of or reduced function of the expressed SspB protein can be achieved through gene editing, such as knocking out or knocking down all or part of the SspB protein-encoding gene. CRISPR / Cas9 gene editing technology is preferably used. For example, sgRNA targeting the SspB protein-encoding gene is introduced into Halomonas together with Cas9 to achieve targeted cleavage.

[0015] In one embodiment of the present invention, the sspB gene in Halomonas is knocked out or knocked down using sgRNA targeting the sspB gene.

[0016] Preferably, the target site sequence of the sgRNA includes SEQ ID NO: 7 or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% or more homology with SEQ ID NO: 7, and has the same or similar function thereto.

[0017] In one embodiment of the present invention, a plasmid comprising an sgRNA expression module and / or upstream and downstream homology arms is introduced into Halomonas.

[0018] Preferably, the upstream homology arm includes the nucleotide sequence of positions 153-652 of SEQ ID NO: 1, or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or more homology with the nucleotide sequence of positions 153-652 of SEQ ID NO: 1, and has the same or similar function thereto.

[0019] Preferably, the downstream homology arm includes the nucleotide sequence of positions 653-1152 of SEQ ID NO: 1, or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or more homology with the nucleotide sequence of positions 653-1152 of SEQ ID NO: 1, and has the same or similar function thereto.

[0020] Preferably, the sgRNA expression module includes the target site sequence of the sgRNA, preferably SEQ ID NO: 7.

[0021] Preferably, the sgRNA expression module comprises the nucleotide sequence 1-152 of SEQ ID NO: 1, or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or more homology with the nucleotide sequence 1-152 of SEQ ID NO: 1, and has the same or similar function thereto.

[0022] In a specific embodiment of the present invention, the plasmid comprising the sgRNA expression module and / or upstream and downstream homology arms comprises SEQ ID NO: 1 or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or more homology to SEQ ID NO: 1, and has the same or similar function thereto.

[0023] An SsrA tag is inserted into the C-terminus of the protein to be degraded in the recombinant Halomonas.

[0024] The SsrA tag can be wild-type or mutated, and its sequence includes AANDENYAQGXXXX (SEQ ID NO: 4), wherein X can be independently selected from natural or non-natural amino acids. Preferably, the amino acid sequence of the SsrA tag includes one or more of SEQ ID NOs: 9-29, or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% or greater identity with one or more of SEQ ID NOs: 9-29, and has the same or similar function as the SsrA tag.

[0025] The SsrA tag is inserted before the stop codon of the protein coding sequence to be degraded, preferably immediately adjacent to the stop codon. This means that the insertion of the SsrA tag does not affect gene transcription and expression, and does not regulate the protein at the gene level.

[0026] Preferably, the insertion of the SsrA tag can be achieved by gene editing, such as using CRISPR / Cas9 gene editing technology. Preferably, an sgRNA targeting the gene encoding the protein to be degraded is introduced into Halomonas together with Cas9 to achieve targeted cleavage, and the SsrA tag is added at the cleavage site.

[0027] In one embodiment of the present invention, a plasmid comprising an sgRNA expression module and / or upstream and downstream homology arms is introduced into Halomonas.

[0028] Preferably, the sgRNA used to insert the SsrA tag targets the C-terminal region of the protein to be degraded, preferably the stop codon of the coding sequence of the protein to be degraded.

[0029] Preferably, the upstream homology arm is located about 100-10000mer (e.g., 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000mer, etc.), preferably a 400-600mer nucleotide sequence, upstream of the stop codon of the gene encoding the protein to be degraded.

[0030] Preferably, the downstream homology arm is located at the stop codon of the gene encoding the protein to be degraded or a nucleotide sequence about 100-10000mer (e.g., 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000mer, etc.) downstream thereof, preferably 400-600mer.

[0031] The protein to be degraded is selected from proteins that are improperly synthesized intracellularly, damaged proteins, or proteins that are essential for microbial growth but whose synthesis products are useless. Preferably, the protein to be degraded is a protein that maintains cell morphology, a protein related to cell mitosis, or a protein that regulates microbial metabolic flux.

[0032] More preferably, it is one, two or three of the MreB protein, FtsZ protein or GltA protein.

[0033] The protein to be degraded is MreB protein, and the target site sequence of the sgRNA inserted into the SsrA tag includes SEQ ID NO: 8 or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% or more homology to SEQ ID NO: 8, and has the same or similar function thereto.

[0034] Preferably, the sequence of the sgRNA expression module includes the nucleotide sequence 1-152 of SEQ ID NO: 6, or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or more homology with the nucleotide sequence 1-152 of SEQ ID NO: 6, and has the same or similar function thereto.

[0035] Preferably, the nucleotide sequence of the upstream homology arm includes the nucleotide sequence of positions 153-652 of SEQ ID NO: 6, or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or more homology with the nucleotide sequence of positions 153-652 of SEQ ID NO: 6, and has the same or similar function thereto.

[0036] Preferably, the nucleotide sequence of the downstream homology arm includes the nucleotide sequence of positions 695-1194 of SEQ ID NO: 6, or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or more homology with the nucleotide sequence of positions 695-1194 of SEQ ID NO: 6, and has the same or similar function thereto.

[0037] In a specific embodiment of the present invention, a plasmid comprising an sgRNA expression module and / or upstream and downstream homology arms targeting mreB includes SEQ ID NO: 6, or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or more homology to SEQ ID NO: 6, and has the same or similar function thereto.

[0038] The protein to be degraded is FtsZ protein, and the target site sequence of the sgRNA inserted into the SsrA tag includes SEQ ID NO: 30 or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% or more homology to SEQ ID NO: 30, and has the same or similar function thereto.

[0039] Preferably, the sequence of the sgRNA expression module includes the nucleotide sequence 1-152 of SEQ ID NO: 31, or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or more homology with the nucleotide sequence 1-152 of SEQ ID NO: 31, and has the same or similar function thereto.

[0040] Preferably, the nucleotide sequence of the upstream homology arm includes the nucleotide sequence of positions 153-652 of SEQ ID NO: 31, or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or more homology with the nucleotide sequence of positions 153-652 of SEQ ID NO: 31, and has the same or similar function thereto.

[0041] Preferably, the nucleotide sequence of the downstream homology arm includes the nucleotide sequence of positions 695-1194 of SEQ ID NO: 31, or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or more homology with the nucleotide sequence of positions 695-1194 of SEQ ID NO: 31, and has the same or similar function thereto.

[0042] In a specific embodiment of the present invention, a plasmid comprising an sgRNA expression module and / or upstream and downstream homology arms targeting ftsZ comprises SEQ ID NO: 31, or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or more homology to SEQ ID NO: 31, and has the same or similar function thereto.

[0043] The protein to be degraded is GltA protein, and the target site sequence of the sgRNA inserted into the SsrA tag includes SEQ ID NO: 32 or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% or more homology to SEQ ID NO: 32, and has the same or similar function thereto.

[0044] Preferably, the sequence of the sgRNA expression module includes the nucleotide sequence 1-152 of SEQ ID NO: 5, or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or more homology with the nucleotide sequence 1-152 of SEQ ID NO: 5, and has the same or similar function thereto.

[0045] Preferably, the nucleotide sequence of the upstream homology arm includes the nucleotide sequence of positions 153-657 of SEQ ID NO: 5, or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or more homology with the nucleotide sequence of positions 153-657 of SEQ ID NO: 5, and has the same or similar function thereto.

[0046] Preferably, the nucleotide sequence of the downstream homology arm includes the nucleotide sequence of positions 700-1199 of SEQ ID NO: 5, or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or more homology with the nucleotide sequence of positions 700-1199 of SEQ ID NO: 5, and has the same or similar function thereto.

[0047] In a specific embodiment of the present invention, a plasmid comprising an sgRNA expression module and / or upstream and downstream homology arms targeting gltA comprises SEQ ID NO: 5, or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or more homology to SEQ ID NO: 5, and has the same or similar function thereto.

[0048] Preferably, the introduced plasmid (eg, knocking out or knocking down sspB, or inserting an SsrA tag) can be transformed by conjugation of E. coli.

[0049] The recombinant Halomonas also knocked out phaP1 and introduced phaP2-GFP.

[0050] Preferably, the recombinant Halomonas includes Halomonas bluephagenesis or its derivatives (such as TD01ΔphaP1-phaP2-GFP, etc.), Halomonas campaniensis or its derivatives, or Halomonas aydingkolgenesis or its derivatives.

[0051] The recombinant Halomonas still maintains the function of producing PHA and can produce more PHA.

[0052] When protein to be degraded is MreB protein, FtsZ protein or GltA protein, in the initial stage (such as logarithmic phase or before it, such as first 10-15h) of cultivating recombinant Halomonas, MreB protein, FtsZ protein or GltA protein normally play a role, and the amount of protein does not have significant difference yet. When continuing to cultivate recombinant Halomonas to mid-to-late stage (such as stationary phase or decay phase, such as 12-24h), MreB protein, FtsZ protein or GltA protein start to degrade, and the degraded of MreB protein, FtsZ protein makes bacterial morphology become spherical. Show that the recombinant Halomonas constructed by the application can realize the degraded of protein to be degraded in the mid-to-late stage of cultivating.

[0053] The recombinant Halomonas bacteria degrade proteins by adding an SsrA tag to the C-terminus of the protein to be degraded, enabling the ClpXP protease in the bacteria to recognize and degrade the protein. Deleting the adaptor protein SspB delayed protein degradation and achieved an optimal degradation rate without affecting bacterial growth and metabolism.

[0054] The second aspect of the present invention provides a method for constructing the above-mentioned recombinant Halomonas, which comprises knocking out or knocking down the sspB gene, and inserting an SsrA tag into the C-terminus of the protein to be degraded.

[0055] Preferably, the construction method comprises introducing a plasmid for knocking out or knocking down the sspB gene and a plasmid for inserting the SsrA tag into Halomonas.

[0056] The plasmid for knocking out or knocking down the sspB gene includes an sgRNA expression module and / or upstream and downstream homology arms targeting the sspB gene. Preferably, the nucleotide sequence of the plasmid for knocking out or knocking down the sspB gene includes SEQ ID NO: 1.

[0057] The plasmid into which the SsrA tag is inserted comprises an sgRNA expression module and / or upstream and downstream homology arms targeting the stop codon of the gene encoding the protein to be degraded. Preferably, the nucleotide sequence of the plasmid into which the SsrA tag is inserted comprises SEQ ID NO: 6, 31 or 5.

[0058] In a third aspect, the present invention provides a method for producing PHA or a method for changing the morphology of Halomonas or regulating the metabolic flow of Halomonas, wherein the method comprises culturing the recombinant Halomonas.

[0059] The culture can be carried out under conventional culture medium and culture conditions in the prior art or fermentation.

[0060] The culture medium can be solid, liquid or semi-solid.

[0061] The culture medium includes carbon sources, nitrogen sources, inorganic salts and other substances that are beneficial to the growth and metabolism of microorganisms.

[0062] The culture medium can be LB or MM.

[0063] The culture temperature is any value between 30-40°C, for example, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C or 40°C.

[0064] The culture may be an open culture.

[0065] The culture includes seed culture, shake flask culture and / or fermenter culture.

[0066] The culture can be batch fermentation, fed-batch fermentation or continuous fermentation.

[0067] The fourth aspect of the present invention provides a method for inducing self-degradation of proteins in Halomonas, the method comprising causing Halomonas to not express SspB protein or the expressed SspB protein to have no function or reduced function, and inserting an SsrA tag at the C-terminus of the protein to be degraded in Halomonas.

[0068] Preferably, it comprises culturing the recombinant Halomonas described above.

[0069] In a fifth aspect, the present invention provides a method for separating bacteria or extracting PHA, wherein the method comprises centrifuging the fermentation broth obtained by the above-mentioned culture.

[0070] The sixth aspect of the present invention provides a method for transforming the morphology of Halomonas from rod-shaped to spherical, the method comprising causing Halomonas to not express SspB protein or the expressed SspB protein to have no function or reduced function, and inserting an SsrA tag at the C-terminus of the protein to be degraded in Halomonas.

[0071] Preferably, the protein to be degraded is MreB protein and / or FtsZ protein.

[0072] Preferably, the transformation from rod-shaped to spherical is in the middle and late stages of the culture of Halomonas.

[0073] The "PHA" of the present invention is a homopolymer or copolymer of monomers constituting PHA, wherein the monomers constituting PHA include, but are not limited to, one, two, or more of 2-hydroxypropionic acid, 3-hydroxybutyric acid, 4-hydroxybutyric acid, 3-hydroxyvaleric acid, 3-hydroxypropionic acid, 5-hydroxyvaleric acid, 3-hydroxyhexanoic acid, 3-hydroxyheptanoic acid, 6-hydroxyhexanoic acid, 3-hydroxyoctanoic acid, 3-hydroxynonanoic acid, 3-hydroxydecanoic acid, 3-hydroxyundecanoic acid, or 3-hydroxydodecanoic acid. More preferably, the PHA includes, but is not limited to, one, two, or more of P3HP, PHB, P(HB-LA), PHV, P34HB, PHBV, PHBHHx, PHBHHp, PHO, PHN, PHD, P3HB4HB3HV, or P3HB4HB5HV.

[0074] The "natural amino acids" mentioned in the present invention include alanine, serine, asparagine, glutamic acid, threonine, phenylalanine, histidine, aspartic acid, methionine, leucine, isoleucine, cysteine, arginine, valine, proline, tryptophan, lysine, glycine, tyrosine, glutamine, etc.

[0075] The "non-natural amino acids" of the present invention are compounds containing an amino group and a carboxyl group that are not naturally found in proteins. Preferably, the non-natural amino acids are any non-natural amino acids known in the art. Further preferably, the non-natural amino acids include, but are not limited to, N-ethylaspartyl, hydroxylysine, 3-hydroxyproline, 2-aminobutyric acid, β-alanine, β-aminopropionic acid, 2-aminoadipic acid, 3-aminoadipic acid, 4-aminobutyric acid, 6-aminohexanoic acid, 2-aminoheptanoic acid, allo-isoleucine, isodesmosine, 4-hydroxyproline, allo-hydroxylysine, 2-aminoisobutyric acid, N-methylglycine, N-methylisoleucine, 3-aminoisobutyric acid, 6-N-methyllysine, 2,4-diaminobutyric acid, N-methylvaline, ornithine, norleucine, norvaline, desmosine, 2,2'-diaminopimelane, 2,3-diaminopropionic acid, N-ethylglycine, or 2-aminopimelane, and the like. Of course, the "non-natural amino acids" mentioned in this application may also be derivatives of natural amino acids after modification.

[0076] The terms "comprising" or "including" as used in the present invention are open-ended. When used to describe a protein or nucleic acid sequence, the protein or nucleic acid may be composed of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, but still have the same or similar activity as the original sequence.

[0077] The Chinese or English full names corresponding to the English abbreviations of this application are shown in Table 1.

[0078] Table 1 BRIEF DESCRIPTION OF THE DRAWINGS

[0079] The embodiments of the present invention are described in detail below with reference to the accompanying drawings, in which:

[0080] Figure 1: Degradation rate of GFP by different mutation tags at different time points.

[0081] Figure 2: Fluorescence microscope images of the recombinant bacteria TD01ΔsspBΔphaP1-phaP2-GFP and TD01ΔsspBΔphaP1-phaP2-GFP-mreB-ssrA under different fields of view, among which the first column is TD01ΔsspBΔphaP1-phaP2-GFP, and the second column is TD01ΔsspBΔphaP1-phaP2-GFP-mreB-ssrA.

[0082] Figure 3: Optical microscope images of recombinant bacteria TD01ΔsspBΔphaP1-phaP2-GFP and TD01ΔsspBΔphaP1-phaP2-GFP-mreB-ssrA under different fields of view, among which the first column is TD01ΔsspBΔphaP1-phaP2-GFP and the second column is TD01ΔsspBΔphaP1-phaP2-GFP-mreB-ssrA.

[0083] Figure 4: Diameter size statistics of PHA particles in recombinant bacteria TD01ΔsspBΔphaP1-phaP2-GFP (control) and TD01ΔsspBΔphaP1-phaP2-GFP-mreB-ssrA (mreB-ssrA21).

[0084] Figure 5: Sedimentation of recombinant bacteria TD01ΔsspBΔphaP1-phaP2-GFP and TD01ΔsspBΔphaP1-phaP2-GFP-mreB-ssrA after centrifugation at 1000 rpm for 15 minutes. The three groups on the left are TD01ΔsspBΔphaP1-phaP2-GFP, and the three groups on the right are TD01ΔsspBΔphaP1-phaP2-GFP-mreB-ssrA.

[0085] Figure 6: Comparison of cell dry weight and PHA content of recombinant bacteria TD01ΔsspBΔphaP1-phaP2-GFP (control) and TD01ΔsspBΔphaP1-phaP2-GFP-mreB-ssrA (mreB-ssrA21).

[0086] Figure 7: Optical microscope images of wild-type LS21 and LS21ΔsspB-ftsZ-ssrA under different fields of view, where the first column is wild-type LS21 and the second column is LS21ΔsspB-ftsZ-ssrA.

[0087] Figure 8: Sedimentation of wild-type LS21 and recombinant LS21ΔsspB-ftsZ-ssrA after centrifugation at 1000 rpm for 15 minutes. The three groups on the left are wild-type LS21, and the three groups on the right are recombinant LS21ΔsspB-ftsZ-ssrA.

[0088] Figure 9: Dry cell weight and PHA content of the recombinant bacteria LS21ΔsspB-ftsZ-ssrA21 (FtsZ-ssrA21) and LS21 (control) after 48 h of fermentation. DETAILED DESCRIPTION

[0089] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts shall fall within the scope of protection of the present invention.

[0090] The strains used in the examples are derived from:

[0091] Halomonas bluephagenesis TD01: described in patent application publication number CN102120973A and the literature "Tan D, Xue Y, Aibaidula G, et al. Unsterile and continuous production of polyhydroxybutyrate by Halomonas TD01[J]. Bioresource Technology, 2011, 102: 8130-8136"; the public can obtain this bacterium from Tsinghua University.

[0092] Halomonas bluephagenesis TD01ΔphaP1-phaP2-GFP: described in LIU X, LID J. et.al, Rapid Quantification of Polyhydroxyalkanoates Accumulated in Living Cells Based on Green Fluorescence Protein-Labeled Phasins: The qPHA Method[J]. Biomacromolecules, 2022. The public can obtain this bacterium from Tsinghua University.

[0093] Halomonas campaniensis LS21: published in “Jiang X, Yao Z, Chen G Q. Controlling cell volume for efficient PHB production by Halomonas[J]. Metabolic Engineering, 2017, 44:30-37” and is available from Tsinghua University.

[0094] Halomonas aydingkolgenesis M1: described in patent application publication number CN111593006A; the public can obtain this bacterium from Tsinghua University.

[0095] Gene editing methods used in the examples:

[0096] For example, CRISPR / Cas9 gene editing technology is used to knock out sspB or insert an SsrA tag. Please refer to the literature Qin et.al. CRISPR / Cas9 editing genome of extremophile Halomonas spp. Metabolic Engineering. 47 (2018) 219-229.

[0097] The culture medium used in the examples is:

[0098] LB60 medium formula:

[0099] 60g / L sodium chloride, 5g / L yeast extract, 10g / L tryptone, 0.1-50g / L carbon source combination.

[0100] MM medium formula:

[0101] Urea 0.5 g / L; MgSO4 0.2 g / L; KH2PO4 1.5 g / L; and <0.1 g / L of Fe(III)-NH4-Citrate, CaCl2·2H2O, ZnSO4·7H2O, MnCl2·4H2O, H3BO3, CoCl2·6H2O, CuSO4·5H2O, NiCl2·6H2O, and NaMoO4·2H2O. Glucose 10-50 g / L as a carbon source and 10-100 g / L sodium chloride are added to provide the osmotic pressure required for halophilic bacteria growth. The pH is adjusted to 8.0-9.0.

[0102] Detection methods used in the examples:

[0103] Gas chromatography method for detecting polyhydroxyalkanoate (PHA) content:

[0104] The oven temperature was set at 80°C, the injector temperature at 200°C, the detector temperature at 220°C, and the column head pressure at 0.25 MPa. The temperature program was as follows: dwell at 80°C for 1.5 minutes, then increase the temperature to 140°C at a rate of 30°C / min, then increase the temperature to 220°C at a rate of 40°C / min and hold at this temperature for 0.5 minutes. The sample injection volume was 1 μL using an Agilent microinjector.

[0105] Gas phase sample preparation: 40-60 mg of dry cells of the sample to be tested (centrifuge the bacterial suspension at 10,000 rpm for 10 minutes at room temperature. Wash the resulting cell pellet once with water and then freeze-dry to obtain the dry cells. Homopolymers are produced in the cells). Add 2 mL of chloroform and 2 mL of esterification solution (3% (v / v) concentrated sulfuric acid in pure methanol and 1 g / L benzoic acid as an internal standard) to an esterification tube. Seal the tube and heat at 100°C for 4 hours. After cooling, add 1 mL of distilled water, shake thoroughly, and allow to stand. After the chloroform and aqueous phases have completely separated, remove 1 μL of the lower chloroform phase and inject it into a gas chromatograph (Hewlett Packard 6890) for chromatographic analysis. Operate the gas chromatograph according to the HP Hewlett Packard 6890 gas chromatograph manual.

[0106] Preparation of standard samples: Take 10-20 mg of standard sample into an esterification tube, add 2 mL of chloroform and 2 mL of esterification solution, seal the tube, and then esterify at 100°C.

[0107] Result analysis: Using the standard sample as a control, if the esterified sample of the cells to be tested (test sample) has a clear peak at the standard sample, the mass of each monomer can be calculated based on the peak area, and then the molar ratio can be calculated based on the mass fraction of each monomer; the proportion of polymers in the dry weight of the cells can be calculated based on the amount of sample added (wt%).

[0108] The dry cell weight (DCW, g / L) is the ratio of the mass of the dry cells to the volume of the fermentation product.

[0109] The PHA content (wt%) is the mass ratio of PHA to the dry bacterial cells.

[0110] Example 1: Effect of knocking out sspB on the growth of Halomonas

[0111] The verification results of this example show that knocking out sspB has no effect on bacterial growth.

[0112] The recombinant strain Halomonas bluephagenesis TD01ΔsspB was constructed using the CRISPR / Cas9 genome editing method. Specifically, a plasmid containing the sgRNA (atagagagctcgggcgagat (SEQ ID NO: 7)) and the recombination template was constructed by inserting DNA fragments, including upstream and downstream homology arms and the sgRNA expression module, into the original expression plasmid pSEVA341 (containing kanamycin and spectinomycin resistance genes) using the Gibson method. The inserted plasmid sequence is SEQ ID NO: 1, and consists of the sgRNA expression module (nucleotides 1-152), upstream homology arms (nucleotides 153-652), and downstream homology arms (nucleotides 653-1152). The pSEVA341 plasmid expressing the sgRNA and recombination template and the Cas9 expression plasmid were then transformed into Halomonas bluephagenesis TD01 (abbreviated as TD01) via conjugation with Escherichia coli S17-1. Primers were designed by colony PCR to screen mutants with sspB gene knockout, and confirmed by gene sequencing. Colony PCR is a routine operation. Then, by continuously and multiple passages of the strain after successful genome editing in liquid culture medium, and streaking and culturing on spectinomycin-resistant, chloramphenicol-resistant and non-resistant plates, the strain with lost CRISPR plasmid was identified to facilitate the next round of genome editing. Finally, after colony PCR and gene sequencing confirmation, it was confirmed that the endogenous sspB gene in the Halomonas bluephagenesis TD01 genome (amino acid sequence as shown in SEQ ID NO: 2, nucleotide sequence as shown in SEQ ID NO: 3) had been knocked out. The constructed recombinant bacteria was named TD01ΔsspB.

[0113] The impact of gene knockout on the bacteria was further assessed through PHA production experiments. The knockout strain was first streaked onto LB60 plates to obtain a single clone. A seed culture was then obtained by secondary LB60 transfer culture. This seed culture was inoculated into MM medium at a 5% inoculum and cultured at 37°C, 200 rpm for 48 hours. The cells were then freeze-dried and their PHA content was measured by gas chromatography. This demonstrated that knocking out sspB had no effect on bacterial growth or PHA production (see Table 2).

[0114] Table 2

[0115] Example 2: Verification of protein degradation by adding a mutant SsrA tag

[0116] 1. Mutate the wild-type SsrA tag to construct a library

[0117] The wild-type SsrA tag from Halomonas bluephagenesis was mutated to obtain a sequence as shown in AANDENYAQGXXXX (SEQ ID NO: 4), wherein XXXX is independently selected from natural or non-natural amino acids. The obtained specific sequence is shown in Table 3.

[0118] Table 3

[0119] 2. Degradation of green fluorescent protein (GFP) in bacteria by adding SsrA tag

[0120] The pSEVA321-GFP-ssrA series of plasmids were constructed. These plasmids comprise the pSEVA backbone, the gene encoding green fluorescent protein, and an SsrA tag sequence fused to its C-terminus (each mutant SsrA tag from Table 3 was added separately). These plasmids were then introduced into TD01ΔsspB prepared in Example 1. GFP fluorescence intensity was measured at different time points to assess GFP degradation. The results showed that different sequences exhibited different degradation rates. The degradation effects of selected representative sequences are shown in Figure 1.

[0121] 3. Compare the effects of the presence or absence of SspB on degradation.

[0122] The pSEVA321-GFP-ssrA21 plasmid was introduced into the TD01 strain and TD01△sspB, respectively. Comparing the fluorescence at 12 hours and 24 hours, it can be observed that sspB can cause rapid degradation of the tagged protein, which is not conducive to achieving the purpose of late degradation (see Table 4).

[0123] Table 4

[0124] Example 3: Morphological engineering of bacteria by degrading MreB protein

[0125] Using Halomonas bluephagenesis TD01ΔphaP1-phaP2-GFP (abbreviated as TD01ΔphaP1-phaP2-GFP) as the starting strain, the SsrA21 tag was used to induce MreB protein degradation after 12 hours. Specifically, the sspB gene in the TD01ΔphaP1-phaP2-GFP genome was knocked out (according to the method in Example 1), and a recombinant strain named TD01ΔsspBΔphaP1-phaP2-GFP was constructed. Based on this recombinant strain, a strain that automatically degrades MreB protein at a later stage was constructed. Specifically, the SsrA21 coding sequence (GCGgcaaatgacgaaaactacgctcaaggcGCGCAGAGCGCG (SEQ ID NO: 33)) was inserted immediately before the stop codon of the endogenous mreB gene. The constructed strain was named TD01ΔsspBΔphaP1-phaP2-GFP-mreB-ssrA.

[0126] The recombinant strains TD01ΔsspBΔphaP1-phaP2-GFP and TD01ΔsspBΔphaP1-phaP2-GFP-mreB-ssrA were tested in fermentation. Microscopic observation of the bacteria after 24 hours of fermentation revealed a change from rod-shaped to spherical and an increase in size. After 48 hours of fermentation, the samples were centrifuged at low speed and analyzed by gas chromatography. The spherical bacteria were more easily precipitated and showed an increase in PHA (polyhydroxyalkanoates) content.

[0127] The specific implementation process is as follows:

[0128] (1) Construction of recombinant strain TD01ΔsspBΔphaP1-phaP2-GFP-mreB-ssrA

[0129] The genome was edited using the CRISPR genome editing method. Specifically, a plasmid containing an sgRNA (tgtcgagcgactgatcgtag (SEQ ID NO: 8)) and a recombination template was constructed by inserting DNA fragments, including upstream and downstream homology arms, an sgRNA expression module, and an SsrA21 tag, into the original expression plasmid pSEVA341 (containing kanamycin and spectinomycin resistance genes) using the Gibson method. The sequence of the inserted plasmid is SEQ ID NO: 6, arranged in the order of the sgRNA expression module (nucleotides 1-152), upstream homology arms (nucleotides 153-652), SsrA21 tag encoding sequence (nucleotides 653-694), and downstream homology arms (nucleotides 695-1194).

[0130] The pSEVA341 plasmid expressing sgRNA and recombination template and the pQ08 plasmid expressing Cas9 were transformed into the recombinant bacteria TD01ΔsspBΔphaP1-phaP2-GFP by conjugation of Escherichia coli S17-1.

[0131] Primers were designed by colony PCR to screen for mutants with SsrA21 tag insertion, and the results were confirmed by gene sequencing. Colony PCR is a routine procedure.

[0132] Finally, colony PCR and gene sequencing confirmed that the SsrA21 tag coding sequence at nucleotides 653–694 of SEQ ID NO: 6 was inserted before the stop codon of the mreB gene in the genome of the recombinant strain TD01ΔsspBΔphaP1-phaP2-GFP. The constructed recombinant strain was named TD01ΔsspBΔphaP1-phaP2-GFP-mreB-ssrA.

[0133] (2) Shake flask fermentation was used to verify the morphological changes and PHA particle size changes of the recombinant bacteria TD01ΔsspBΔphaP1-phaP2-GFP and TD01ΔsspBΔphaP1-phaP2-GFP-mreB-ssrA.

[0134] The specific steps for detecting the morphology and PHA particle size of the recombinant strain during shake flask fermentation are as follows:

[0135] The recombinant strain was inoculated into 20 mL of LB60 medium, cultured for 12-16 h, and then transferred to a new 20 mL of LB60 medium at a volume ratio of 1%, and cultured for another 8-12 h.

[0136] A 2.5 mL seed culture was inoculated into a 500 mL Erlenmeyer flask containing 50 mL of PHA fermentation medium for a shake flask experiment. Each experiment was performed in triplicate, with the shaker maintained at 37°C and 200 rpm. After 24 hours of incubation, a 3 μL sample was prepared as a temporary slide and observed using an FV1200 Confocal / FLIM / FCS microscope. As shown in Figures 2 and 3, the recombinant TD01ΔsspBΔphaP1-phaP2-GFP strain exhibited a rod-shaped morphology. Furthermore, the recombinant TD01ΔsspBΔphaP1-phaP2-GFP-mreB-ssrA strain, with the SsrA21 tag added to the end of the mreB gene, exhibited a spherical morphology and a slightly increased cell diameter. Discrete PHA particles are visible in the statistical graph, indicating that some bacteria were crushed during the slide preparation process, releasing PHA particles from the cells.

[0137] Specifically, each sphere in Figure 2 represents a PHA particle. The size of the PHA particles was statistically analyzed using imageJ software. It was found that the size of the PHA particles in the recombinant bacteria TD01ΔsspBΔphaP1-phaP2-GFP-mreB-ssrA was larger than that in TD01ΔsspBΔphaP1-phaP2-GFP, and there was a significant difference between the two, as shown in Figure 4.

[0138] (3) Shake flask fermentation was used to verify the sedimentation degree of the recombinant bacteria TD01ΔsspBΔphaP1-phaP2-GFP and TD01ΔsspBΔphaP1-phaP2-GFP-mreB-ssrA during centrifugation.

[0139] The specific steps for testing the sedimentation degree during centrifugation after shake flask fermentation of the recombinant strain are as follows:

[0140] The recombinant strain was inoculated into 20 mL of LB60 medium, cultured for 12-16 h, and then transferred to a new 20 mL of LB60 medium at a volume ratio of 1%, and cultured for another 8-12 h.

[0141] A shake flask experiment was performed by inoculating 2.5 mL of seed culture into a 500 mL Erlenmeyer flask containing 50 mL of PHA fermentation medium (MM medium). Three replicates were set up for each experiment, and the shaker temperature was 37°C and the rotation speed was 200 rpm. After 48 hours of incubation, 35 mL of sample was poured into a 50 mL centrifuge tube and centrifuged at 1000 rpm for 15 minutes. As shown in Figure 5, after centrifugation at 1000 rpm for 15 minutes, the recombinant strain TD01ΔsspBΔphaP1-phaP2-GFP-mreB-ssrA was easier to centrifuge than TD01ΔsspBΔphaP1-phaP2-GFP, and the supernatant and precipitate could be clearly distinguished.

[0142] (4) Shake flask fermentation was used to verify the DCW (Dry cell weight) and PHA content of the recombinant bacteria TD01ΔsspBΔphaP1-phaP2-GFP and TD01ΔsspBΔphaP1-phaP2-GFP-mreB-ssrA.

[0143] The specific steps for testing the PHA production capacity of the recombinant strain after shake flask fermentation are as follows:

[0144] The recombinant strain was inoculated into 20 mL of LB60 medium, cultured for 12-16 h, and then transferred to a new 20 mL of LB60 medium at a volume ratio of 1%, and cultured for another 8-12 h.

[0145] 2.5 mL of seed bacterial liquid was inoculated into a 500 mL conical flask containing 50 mL of PHA fermentation medium (MM medium) for a shake flask experiment. The shaker temperature was 37°C and the rotation speed was 200 rpm. After 48 hours of culture, the PHA content was detected. The experiment was set up in triplicate and the results were averaged. The results are shown in Figure 6. After 48 hours of fermentation, the cell dry weight of the recombinant bacteria TD01ΔsspBΔphaP1-phaP2-GFP-mreB-ssrA was not much different from that of TD01ΔsspBΔphaP1-phaP2-GFP, but the PHA content increased from 64.36% to 69.34%, and the difference was significant.

[0146] Example 4: Morphological engineering of bacteria by degradation of FtsZ protein

[0147] Halomonas campaniensis LS21 (abbreviated as LS21) was used as the starting strain, and the SsrA21 tag was used to induce FtsZ protein degradation after 12 hours. Specifically, the sspB gene on the LS21 genome was knocked out (according to the method of Example 1), and a recombinant strain was constructed and named LS21ΔsspB. Based on the recombinant strain, a strain that automatically degrades FtsZ protein in the later stage was constructed. Specifically, the coding sequence of SsrA21 (GCGgcaaatgacgaaaactacgctcaaggcGCGCAGAGCGCG (SEQ ID NO: 33)) was inserted before the stop codon of the endogenous ftsZ gene (immediately adjacent to the stop codon), and the constructed strain was named LS21ΔsspB-ftsZ-ssrA21.

[0148] The recombinant strains LS21ΔsspB-ftsZ-ssrA21 and LS21 were tested in fermentation. Microscopic observation of the samples taken at 24 hours of fermentation revealed that the rod-shaped bacteria had become elongated. After 48 hours of fermentation, the samples were centrifuged at low speed and analyzed by gas chromatography. The elongated bacteria were more easily pelleted and showed an increase in PHA (polyhydroxyalkanoates) content.

[0149] The specific implementation process is as follows:

[0150] (1) Construction of recombinant strain LS21ΔsspB-ftsZ-ssrA21

[0151] The genome was edited using CRISPR genome editing. Specifically, a plasmid containing the sgRNA (acgtcgtcaggcagattaat (SEQ ID NO: 30)) and a recombination template was constructed by inserting DNA fragments, including upstream and downstream homology arms, the sgRNA expression module, and the SsrA21 tag, into the original expression plasmid pSEVA341 (containing kanamycin and spectinomycin resistance genes) using the Gibson method. The sequence of the inserted plasmid is SEQ ID NO: 31, arranged in order: the sgRNA expression module (nucleotides 1-152), the upstream homology arm (nucleotides 153-652), the SsrA21 tag encoding sequence (nucleotides 653-694), and the downstream homology arm (nucleotides 695-1194).

[0152] The pSEVA341 plasmid expressing sgRNA and recombination template and the pQ08 plasmid expressing Cas9 were transformed into the recombinant bacteria LS21ΔsspB by conjugation of Escherichia coli S17-1.

[0153] Primers were designed by colony PCR to screen for mutants with SsrA21 tag insertion, and the results were confirmed by gene sequencing. Colony PCR is a routine procedure.

[0154] Finally, colony PCR and gene sequencing confirmed that the SsrA21 tag coding sequence at nucleotides 653–694 of SEQ ID NO: 31 was inserted before the stop codon of the ftsZ gene in the genome of the recombinant strain LS21ΔsspB. The constructed recombinant strain was named LS21ΔsspB-ftsZ-ssrA21.

[0155] (2) Shake flask fermentation was used to verify the morphological changes and PHA content changes of the recombinant bacteria LS21ΔsspB-ftsZ-ssrA21 and LS21.

[0156] The specific steps for detecting morphological changes of the recombinant strain during shake flask fermentation are as follows:

[0157] The recombinant strain was inoculated into 20 mL of LB60 medium, cultured for 12-16 h, and then transferred to a new 20 mL of LB60 medium at a volume ratio of 1%, and cultured for another 8-12 h.

[0158] A shake flask experiment was performed by inoculating 2.5 mL of seed culture into a 500 mL Erlenmeyer flask containing 50 mL of PHA fermentation medium. Each experiment was performed in triplicate, with the shaker maintained at 37°C and 200 rpm. After 24 hours of incubation, a 3 μL sample was prepared as a temporary slide and observed using an FV1200 Confocal / FLIM / FCS microscope. As shown in Figure 7, the wild-type LS21 strain has a rod-shaped morphology. However, the recombinant strain LS21ΔsspB-ftsZ-ssrA21, which incorporates the SsrA21 tag at the end of the ftsZ gene, exhibits a more elongated morphology, with a significantly longer cell axis. Some discrete PHA particles are visible in the statistical graph, indicating that some bacteria were crushed during the slide preparation process, releasing PHA particles from the cells.

[0159] (3) Shake flask fermentation was used to verify the sedimentation degree of the recombinant bacteria LS21ΔsspB-ftsZ-ssrA21 and LS21 during centrifugation.

[0160] The specific steps for testing the sedimentation degree during centrifugation after shake flask fermentation of the recombinant strain are as follows:

[0161] The recombinant strain was inoculated into 20 mL of LB60 medium, cultured for 12-16 h, and then transferred to a new 20 mL of LB60 medium at a volume ratio of 1%, and cultured for another 8-12 h.

[0162] 2.5 mL of seed bacterial liquid was inoculated into a 500 mL conical flask containing 50 mL of PHA fermentation medium (MM medium) for a shake flask experiment. Three parallel experiments were set up for each group of experiments, the shaker temperature was 37 ° C, and the speed was 200 rpm. After 48 hours of culture, 35 mL of sample was poured into a 50 mL centrifuge tube and centrifuged at 1000 rpm for 15 minutes. The results are shown in Figure 8. After centrifugation at 1000 rpm for 20 minutes, the recombinant bacteria LS21ΔsspB-ftsZ-ssrA21 was easier to centrifuge than LS21, and the supernatant and precipitate could be clearly distinguished.

[0163] (4) Shake flask fermentation was used to verify the DCW (Dry cell weight) and PHA content of the recombinant bacteria LS21ΔsspB-ftsZ-ssrA21 and LS21.

[0164] The specific steps for testing the PHA production capacity of the recombinant strain after shake flask fermentation are as follows:

[0165] The recombinant strain was inoculated into 20 mL of LB60 medium, cultured for 12-16 h, and then transferred to a new 20 mL of LB60 medium at a volume ratio of 1%, and cultured for another 8-12 h.

[0166] 2.5 mL of seed bacterial liquid was inoculated into a 500 mL conical flask containing 50 mL of PHA fermentation medium (MM medium) for a shake flask experiment. The shaker temperature was 37°C and the rotation speed was 200 rpm. After 48 hours of culture, the PHA content was detected. The experiment was set up in triplicate and the results were averaged. The results are shown in Figure 9. After 48 hours of fermentation, the cell dry weight of the recombinant bacteria LS21ΔsspB-ftsZ-ssrA21 and LS21 was not much different, but the PHA content increased from 81.0% to 84.2%, and the difference was significant.

[0167] Example 5: Controlling bacterial metabolic flux by degrading GltA protein

[0168] Halomonas aydingkolgenesis M1 (abbreviated as M1) was used as the starting strain, and the SsrA7 tag was used to induce partial degradation of the GltA protein within 12 hours. Specifically, the sspB gene on the M1 genome was knocked out (according to the method of Example 1), and a recombinant strain was constructed and named M1ΔsspB. Based on the recombinant strain, a strain that automatically degraded part of the GltA protein in the later stage was constructed. Specifically, the coding sequence of SsrA7 (GCGgcaaatgacgaaaactacgctcaaggcGCGGATGCGGTG (SEQ ID NO: 34)) was inserted before the stop codon of the endogenous gltA gene (immediately adjacent to the stop codon), and the constructed strain was named M1ΔsspB-gltA-ssrA7.

[0169] The recombinant strains M1ΔsspB-gltA-ssrA7 and M1 were tested in fermentation. After 48 hours of fermentation, the cells were centrifuged at low speed and analyzed by gas chromatography. The strain that partially degraded the GltA protein in the late stage showed an increase in DCM (dry cell weight) by 1.7 g / L and a rise in PHA (polyhydroxyalkanoates) content from 75.3% to 83.2%.

[0170] The specific implementation process is as follows:

[0171] (1) Construction of recombinant strain M1ΔsspB-gltA-ssrA7

[0172] The genome was edited using CRISPR genome editing. Specifically, a plasmid containing the sgRNA (cgactatcctaaaaaataac (SEQ ID NO: 32)) and a recombination template was constructed by inserting DNA fragments, including upstream and downstream homology arms, the sgRNA expression module, and the SsrA7 tag, into the original expression plasmid pSEVA341 (containing kanamycin and spectinomycin resistance genes) using the Gibson method. The sequence of the inserted plasmid is SEQ ID NO: 5, which is arranged in the order of the sgRNA expression module (nucleotides 1-152), upstream homology arms (nucleotides 153-657), SsrA7 tag encoding sequence (nucleotides 658-699), and downstream homology arms (nucleotides 700-1199).

[0173] The pSEVA341 plasmid expressing sgRNA and recombination template and the pQ08 plasmid expressing Cas9 were transformed into the recombinant bacteria M1ΔsspB by conjugation of Escherichia coli S17-1.

[0174] Primers were designed by colony PCR to screen for mutants with SsrA7 tag insertion, and the results were confirmed by gene sequencing. Colony PCR is a routine procedure.

[0175] Finally, colony PCR and gene sequencing confirmed that the SsrA7 tag coding sequence at nucleotides 658–699 of SEQ ID NO: 5 was inserted before the stop codon of the gltA gene in the genome of the recombinant strain M1ΔsspB-gltA-ssrA7. The constructed recombinant strain was named M1ΔsspB-gltA-ssrA7.

[0176] (2) Shake flask fermentation was used to verify the DCW (Dry cell weight) and PHA content of the recombinant bacteria M1ΔsspB-gltA-ssrA7 and M1.

[0177] The specific steps for testing the PHA production capacity of the recombinant strain after shake flask fermentation are as follows:

[0178] The recombinant strain was inoculated into 20 mL of LB60 medium, cultured for 12-16 h, and then transferred to a new 20 mL of LB60 medium at a volume ratio of 1%, and cultured for another 8-12 h.

[0179] 2.5 mL of seed bacterial liquid was inoculated into a 500 mL conical flask containing 50 mL of PHA fermentation medium (MM medium) for a shake flask experiment. The shaker temperature was 37 ° C and the rotation speed was 200 rpm. After 48 hours of culture, the PHA content was detected. The experiment was set up in triplicate and the results were averaged. The results are shown in Table 5. After 48 hours of fermentation, compared with M1, the cell dry weight of the recombinant bacteria M1ΔsspB-gltA-ssrA7 increased from 10.13 to 11.82, and the PHA content increased from 75.3% to 83.2%, both of which were significantly different.

[0180] Table 5

[0181] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.

[0182] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

Claims

1. A recombinant Halomonas that induces protein self-degradation, characterized in that: The recombinant salt mononas do not express SspB protein or the expressed SspB protein has no function or has reduced function, and the C-terminus of the protein to be degraded in the recombinant salt mononas is inserted with an SsrA tag.

2. The recombinant Halomonas according to claim 1, characterized in that Knockout or knockdown of the sspB gene in Halomonas using sgRNA targeting the sspB gene; Preferably, the target site sequence of the sgRNA includes SEQ ID NO: 7 or has 90%, 95% or 99% or more homology with SEQ ID NO:

7.

3. The recombinant Halomonas according to claim 1, characterized in that The SsrA tag is inserted before the stop codon of the protein coding sequence to be degraded, preferably immediately adjacent to the stop codon.

4. The recombinant Halomonas according to claim 1 or 3, characterized in that The SsrA tag is wild type or mutated, and its sequence includes AANDENYAQGXXXX (SEQ ID NO: 4), wherein X is independently selected from natural or non-natural amino acids.

5. The recombinant Halomonas according to claim 4, characterized in that The amino acid sequence of the SsrA tag includes one or more of SEQ ID NOs: 9-29, or has 80%, 85%, 90%, 95% or 99% or more homology with one or more of SEQ ID NOs: 9-29.

6. The recombinant Halomonas according to any one of claims 1 to 5, characterized in that The protein to be degraded is selected from proteins improperly synthesized in cells, damaged proteins, or proteins necessary for microbial growth but whose synthesis products are useless; Preferably, the protein to be degraded is a protein that maintains cell morphology or a protein related to cell mitosis or a protein that regulates microbial metabolic flow; More preferably, it is one, two or three of the MreB protein, the FtsZ protein or the GltA protein.

7. The recombinant Halomonas according to claim 6, characterized in that The protein to be degraded is MreB protein, and the target site sequence of the sgRNA inserted into the SsrA tag includes SEQ ID NO: 8 or has 90%, 95% or 99% or more homology with SEQ ID NO:

8.

8. The recombinant Halomonas according to claim 6, characterized in that The protein to be degraded is FtsZ protein, and the target site sequence of the sgRNA inserted into the SsrA tag includes SEQ ID NO: 30 or has 90%, 95% or 99% or more homology with SEQ ID NO:

30.

9. The recombinant Halomonas according to claim 6, characterized in that The protein to be degraded is GltA protein, and the target site sequence of the sgRNA inserted into the SsrA tag includes SEQ ID NO: 32 or has 90%, 95% or 99% or more homology with SEQ ID NO:

32.

10. The recombinant Halomonas according to any one of claims 1 to 9, characterized in that: The recombinant Halomonas includes Halomonas bluephagenesis or its derivatives, Halomonas campaniensis or its derivatives, or Halomonas aydingkolgenesis or its derivatives.

11. A method for constructing the recombinant Halomonas according to any one of claims 1 to 10, characterized in that: The construction method comprises knocking out or knocking down the sspB gene, and inserting an SsrA tag into the C-terminus of the protein to be degraded.

12. The construction method according to claim 11, characterized in that: The construction method comprises introducing a plasmid for knocking out or knocking down the sspB gene and a plasmid for inserting the SsrA tag into Halomonas; Preferably, the nucleotide sequence of the plasmid for knocking out or knocking down the sspB gene includes SEQ ID NO: 1; Preferably, the nucleotide sequence of the plasmid into which the SsrA tag is inserted includes SEQ ID NO: 6, 31 or 5.

13. A method for producing PHA, characterized in that: The method comprises culturing the recombinant Halomonas described in any one of claims 1-10.

14. A method for changing the morphology of Halomonas, characterized in that: The method comprises culturing the recombinant Halomonas described in any one of claims 1-10.

15. A method for inducing protein self-degradation in Halomonas, characterized in that: The method comprises making the Halomonas not express the SspB protein or the expressed SspB protein not functional or with reduced function, and inserting an SsrA tag at the C-terminus of the protein to be degraded in the Halomonas; Preferably, the method comprises culturing the recombinant Halomonas according to any one of claims 1 to 10.

Citation Information

Patent Citations

  • Tunable control of protein degradation in synthetic and endogenous bacterial systems

    US20160016995A1

  • Dynamic knockdown of central metabolism for redirecting glucose-6-phosphate fluxes

    US20170130210A1