Compositions and methods for treating neurodegenerative disorders

A combination of a phosphodiesterase 5 inhibitor and an NMDA receptor antagonist addresses the limitations of current neurodegenerative disorder treatments by targeting multiple pathways, achieving significant reductions in neuroinflammation and amyloid beta aggregation, and promoting neuroregenerative processes.

WO2025134069A1PCT designated stage expired Publication Date: 2025-06-26ARIBIO CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/IB2024/063064
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-22
Filing Date
2024-12-20
Publication Date
2025-06-26

AI Technical Summary

Technical Problem

Current treatments for neurodegenerative disorders primarily focus on managing symptoms and slowing disease progression, with limited efficacy in addressing the underlying causes of cognitive decline.

Method used

A pharmaceutical composition comprising a phosphodiesterase 5 inhibitor, such as mirodenafil, combined with an N-methyl-D-aspartate receptor antagonist, such as memantine, to target multiple pathways involved in neurodegenerative disorders.

Benefits of technology

The combination therapy demonstrates synergistic effects in reducing neuroinflammation, inhibiting amyloid beta aggregation, promoting neurogenesis, and enhancing synaptic plasticity, potentially offering disease-modifying effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IB2024063064_26062025_PF_FP_ABST
    Figure IB2024063064_26062025_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure provides a pharmaceutical composition comprising at least one phosphodiesterase 5 inhibitor and at least one N-methyl-D-aspartate-receptor (NMDA-receptor) antagonist, or pharmaceutically acceptable salts, solvates, or hydrates thereof. The composition is useful for treating neurodegenerative disorders. Methods of treating neurodegenerative disorders and reducing neuroinflammation by administering an effective amount of the pharmaceutical composition to a subject in need thereof are also provided. The phosphodiesterase 5 inhibitor may be mirodenafil and the NMDA-receptor antagonist may be memantine. The composition and methods result in synergistic reduction of inflammatory markers and amyloid beta levels.
Need to check novelty before this filing date? Find Prior Art

Description

COMPOSITIONS AND METHODS FOR TREATING NEURODEGENERATIVEDISORDERSCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority from Korean Provisional Application Serial No. KR 10-2023-0190305 filed on December 22, 2023, which is incorporated herein by reference in its entirety.INCORPORATION-B Y-REFERENCE OF SEQUENCE LISTING

[0002] The Sequence Listing, which is a part of the present disclosure, includes a computer readable sequence listing comprising nucleotide and / or amino acid sequences of the present invention. The subject matter of the Sequence Listing is incorporated herein by reference in its entirety.FIELD

[0003] The present disclosure relates to compositions and methods for treating neurodegenerative disorders, and more particularly to pharmaceutical compositions comprising a phosphodiesterase 5 inhibitor and an N-methyl-D-aspartate receptor antagonist for preventing or treating neurodegenerative disorders.INTRODUCTION

[0004] Neurodegenerative disorders are a group of disorders characterized by the progressive loss of structure or function of neurons, including death of neurons. These diseases, which include conditions such as Alzheimer's disease, Parkinson's disease, Huntington's disease, and multiple sclerosis, pose significant challenges to the aging population and healthcare systems worldwide.

[0005] The pathophysiology of neurodegenerative disorders is complex and multifaceted. Common features include the accumulation of abnormal proteins, mitochondrial dysfunction, oxidative stress, and neuroinflammation. These processes contribute to the gradual deterioration of neural tissues, leading to cognitive decline, motor impairments, and other debilitating symptoms.

[0006] Current therapeutic approaches for neurodegenerative disorders are largely focused on managing symptoms and slowing disease progression. However, these treatmentsoften have limited efficacy and may be associated with significant side effects. The development of disease-modifying therapies that can halt or reverse the underlying neurodegenerative processes remains a critical unmet need in the field.

[0007] Recent research has highlighted the potential of targeting multiple pathways simultaneously to address the complex nature of neurodegenerative disorders. This approach may offer advantages over single-target therapies by addressing multiple aspects of disease pathology concurrently.

[0008] Despite advances in our understanding of neurodegenerative disorders, significant challenges remain in developing effective treatments. These include the need for improved drug delivery to the central nervous system, the identification of reliable biomarkers for early diagnosis and treatment monitoring, and the development of therapies that can effectively modulate multiple disease pathways.

[0009] As the global population ages, the prevalence of neurodegenerative disorders is expected to rise dramatically in the coming decades. This underscores the urgent need for innovative therapeutic strategies that can effectively prevent, halt, or reverse the progression of these devastating disorders.SUMMARY

[0010] This summary is provided to introduce a selection of concepts in a simplified form that are further described below in the detailed description. This summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended to be used as an aid in determining the scope of the claimed subject matter.

[0011] According to an aspect of the present disclosure, a pharmaceutical composition is provided. The pharmaceutical composition includes at least one phosphodiesterase 5 inhibitor and at least one N-methyl-D-aspartate-receptor (NMDA- receptor) antagonist, or pharmaceutically acceptable salts, solvates, hydrates of said phosphodiesterase 5 inhibitor and said NMDA-receptor antagonist.

[0012] According to other aspects of the present disclosure, the pharmaceutical composition may include one or more of the following features. The phosphodiesterase 5 inhibitor may comprise mirodenafil, sildenafil, vardenafil, tadalafil, udenafil, dasantafil, avanafil, and mixtures thereof. The NMDA-receptor antagonist may comprise memantine, amantadine, ketamine, traxoprodil, lanicemine, rislenemdaz, pethidine, levorphanol, methadone, dextropropoxyphene, tramadol, ketobemidone, dextromethorphan (DXM), phencyclidine (PCP), and methoxetamine (MXE), and mixtures thereof. Thephosphodiesterase 5 inhibitor may be mirodenafil.

[0013] According to another aspect of the present disclosure, a method for preventing and / or treating dementia is provided. The method includes administering an effective amount of the pharmaceutical composition comprising at least one phosphodiesterase 5 inhibitor and at least one N-methyl-D-aspartate-receptor (NMDA- receptor) antagonist.

[0014] According to other aspects of the present disclosure, methods are provided for: preventing or treating neuroinflammation; preventing or inhibiting formation and / or accumulation of beta-amyloid; preventing or treating a neurodegenerative disorder; inhibiting Ap Oligomer / Fibril formation by reducing of Ap aggregation; inhibition of P- Amyloidogenic processing by reducing BACE-1; reducing extracellular Ap monomers, oligomers & Ap Fibril / Plaque by increasing cerebral blood flow; suppressing neuronal cell death, promoting neurogenesis, synaptogenesis and / or angiogenesis by activating NO / cGMP / PKG / CREB Pathway; restoring synaptic plasticity by activating Wint Signaling and / or inhibiting DKK-1; inhibiting production of APP and / or reducing Ap accumulation by suppressing positive feedback loop for Ap production; and inhibiting formation of Ap Fibril / plaque by removal of intracellular toxic and soluble Ap oligomers by activating autophagy. Each of these methods includes administering an effective amount of the pharmaceutical composition comprising at least one phosphodiesterase 5 inhibitor and at least one N-methyl-D-aspartate-receptor (NMDA-receptor) antagonist.

[0015] According to other aspects of the present disclosure, the neurodegenerative disorder may be dementia, Parkinson's disease (PD), Parkinson’s disease dementia, Dementia with Lewy body (DLB), Alzheimer's disease (AD), Huntington's disease (HD), Multiple sclerosis (MS), Vascular Dementia (VaD), Amyotrophic Lateral Sclerosis (ALS), Down’s syndrome dementia, frontotemporal dementia, or mixed etiologies thereof.

[0016] According to another aspect of the present disclosure, a pharmaceutical composition is provided. The pharmaceutical composition includes mirodenafil and memantine, and pharmaceutically acceptable salts, solvates, hydrates thereof.

[0017] According to other aspects of the present disclosure, methods are provided for: preventing and / or treating dementia; preventing or treating neuroinflammation; preventing or inhibiting formation and / or accumulation of beta-amyloid; preventing or treating a neurodegenerative disorder; inhibiting Ap Oligomer / Fibril formation by reducing Ap aggregation; inhibiting P-Amyloidogenic processing by reducing BACE-1; reducing extracellular Ap monomers, oligomers & Ap Fibril / Plaque by increasing the cerebral bloodflow; suppressing neuronal cell death, promoting neurogenesis, synaptogenesis and / or angiogenesis by activating NO / cGMP / PKG / CREB Pathway; restoring synaptic plasticity by activating Wint Signaling and / or inhibiting DKK-1; and inhibiting production of APP and / or reducing Ap accumulation by suppressing positive feedback loop for Ap production. Each of these methods includes administering an effective amount of the pharmaceutical composition comprising mirodenafil and memantine.

[0018] According to other aspects of the present disclosure, the neurodegenerative disorder may be dementia, Parkinson's disease (PD), Parkinson’s disease dementia, Dementia with Lewy body (DLB), Alzheimer's disease (AD), Huntington's disease (HD), Multiple sclerosis (MS), Vascular Dementia (VaD), Amyotrophic Lateral Sclerosis (ALS), Down’s syndrome dementia, frontotemporal dementia, or mixed etiologies thereof.

[0019] The foregoing general description of the illustrative embodiments and the following detailed description thereof are merely exemplary aspects of the teachings of this disclosure and are not restrictive.DRAWINGS

[0020] Those of skill in the art will understand that the drawings, described below, are for illustrative purposes only. The drawings are not intended to limit the scope of the present teachings in any way.

[0021] FIG. 1 depicts a bar graph showing effects of mirodenafil and memantine on ILip decrease percentage, according to aspects of the present disclosure.

[0022] FIG. 2 shows a bar graph depicting TNFa reduction percentages for mirodenafil and memantine combinations, according to aspects of the present disclosure.

[0023] FIG. 3 illustrates a bar graph showing Ap42 reduction rates for mirodenafil and memantine combinations, according to aspects of the present disclosure.DETAILED DESCRIPTION

[0024] Abbreviations and Definitions

[0025] To facilitate understanding of the invention, a number of terms and abbreviations as used herein are defined below as follows:

[0026] All patents, applications, published applications and other publications cited herein are incorporated by reference in their entirety. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention belongs. The chemical structures and formulaeset forth herein are constructed according to the standard rules of chemical valency known in the chemical arts. Should a discrepancy exist between a depicted structure and a name given for that structure, the depicted structure is to be accorded more weight. Where the stereochemistry of a structure or a portion of a structure is not indicated in a depicted structure or a portion of the depicted structure, the depicted structure is to be interpreted as encompassing all of its possible stereoisomers.

[0027] Any methods, devices and materials similar or equivalent to those described herein can be used in the practice of this invention. The following definitions are provided to facilitate understanding of certain terms used frequently herein and are not meant to limit the scope of the present disclosure. In the event that there is a plurality of definitions for a term herein, those in this section prevail unless stated otherwise. Headings used herein are for organizational purposes only and in no way limit the invention described herein.

[0028] The term “administering” refers to the act of delivering a combination or composition described herein into a subject by such routes as oral, mucosal, topical, suppository, intravenous, parenteral, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal or subcutaneous administration. Parenteral administration includes intravenous, intramuscular, intra-arteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial administration. Administration generally occurs after the onset of the disease, disorder, or condition, or its symptoms but, in certain instances, can occur before the onset of the disease, disorder, or condition, or its symptoms (e.g., administration for patients prone to such a disease, disorder, or condition).

[0029] The terms “coadministering” or “coadministration” or “combination” refers to administration of two or more agents (e.g., a combination described herein including, optionally, another active agent such as an anti-neurodegenerative agent described herein). The timing of coadministration depends in part of the combination and individual compositions administered and can include administration at the same time, just prior to, or just after the administration of one or more additional therapies, for example therapies such as an anti-neurodegenerative agent including, for example, immunotherapy. Coadministration is meant to include simultaneous or sequential administration of each compound of the combination. Thus, the preparations can also be combined, when desired, with other active substances (e.g., to reduce metabolic degradation). The compounds described herein can be used in combination with one another, with other active agents known to be useful in treating neurodegeneration.

[0030] The terms “therapies” and “therapy” refer to any protocol(s), method(s),and / or agent(s) that can be used in the prevention, treatment, management, and / or amelioration of a disease, disorder, or condition or one or more symptoms thereof. In certain instances the term refers to active agents such as an anti-neurodegenerative agent described herein. The terms “therapy” and “therapy” can also refer to anti-viral therapy, anti-bacterial therapy, anti-fungal therapy, anti-neurodegenerative therapy, biological therapy, supportive therapy, and / or other therapies useful in treatment, management, prevention, or amelioration of a disease, disorder, or condition or one or more symptoms thereof known to one skilled in the art, for example, a medical professional such as a physician.

[0031] The term “patient” or “subject” refers to a mammal, such as a human, bovine, rat, mouse, dog, monkey, ape, goat, sheep, cow, or deer. Generally a patient as described herein is human. The subject according to the present disclosure may be a human subject suffering from Alzheimer's disease (e.g., AD, Alzheimer's type dementia) or a human subject possibly suffering from Alzheimer's disease. In these cases, whether a human subject is suffering from or likely to suffer from Alzheimer's disease may be determined by the methods disclosed in the Examples provided herein, and by methods commonly practiced by those skilled in the art. Human subjects suffering from or potentially suffering from Alzheimer's disease include, for example, those for whom a cognitive function test such as the Clinical Dementia Rating Scale Sum of Boxes (CDR-SB), the Alzheimer's Disease Assessment Scale-Cognitive Subscale (ADAS-Cog), or the Mini-Mental State Examination (MMSE) suggests a decline in cognitive function or the possibility thereof. The subject may be a human subject with brain deposits or cerebrospinal fluid concentrations of proteins known to accumulate in Alzheimer's disease patients, such as amyloid-P and tau proteins, a human subject with decreased metabolic function of the brain or atrophy of brain tissue.

[0032] The terms “treating” or “treatment” refer to any indicia of success or amelioration of the progression, severity, and / or duration of a disease, pathology or condition, including any objective or subjective parameter such as abatement; remission; diminishing of symptoms or making the injury, pathology or condition more tolerable to the patient; slowing in the rate of degeneration or decline; making the final point of degeneration less debilitating; or improving a patient’s physical or mental well-being.

[0033] The terms “AR1001” and “mirodenafil” refer to the chemical compound, 5- ethyl-2-[5-[4-(2 -hydroxy ethyl)piperazin-l-yl]sulfonyl-2-propoxyphenyl]-7-propyl-3 / / - pyrrolo[3,2-d]pyrimidin-4-one, which has the following chemical formula:Mirodenafil is a member of the class of pyrrolopyrimidines that is 3,5-dihydro-4H- pyrrolo[3,2-d]pyrimidin-4-one having a 5-{[4-(2-hydroxyethyl)piperazin-l-yl]sulfonyl}-2- propoxyphenyl group at positon 2, ethyl group at position 5, and a propyl group at position 7. It is a phosphodiesterase type 5 inhibitor which is used for the treatment of erectile dysfunction. It has a role as an EC 3.1.4.35 (3',5'-cyclic-GMP phosphodiesterase) inhibitor and a vasodilator agent. It is a sulfonamide, a pyrrolopyrimidine, a N-alkylpiperazine, a primary alcohol and an aromatic ether. Mirodenafil has been used in trials studying the treatment and supportive care of Kidney Diseases, Urologic Diseases, Renal Insufficiency, Erectile Dysfunction, and Male Erectile Dysfunction. More information about mirodenafil can be found in U.S. Pat. No. 9,750,743, and at Kang, B.W., Kim, F., Cho, JY. et al. Phosphodiesterase 5 inhibitor mirodenafil ameliorates Alzheimer-like pathology and symptoms by multimodal actions. Alz Res Therapy 14, 92 (2022). https: / / doi.org / 10.1186 / sl3195-022-01034-3. Mirodenafil is commercially available from vendors including Cooke Chemical Co., Ltd. (#M4050735), AstaTech, Inc. (#C16519), and RR Scientific (#R772058), among others.

[0034] The term “anti-neurodegenerative agent” is used in accordance with its plain ordinary meaning and refers to a composition having neuronal protective properties or the ability to inhibit degeneration of neuronal cells. The term can include neuroprotective agents known to those of skill in the art. In embodiments, an anti-neurodegenerative agent is an agent identified herein having utility in methods of treating neurodegeneration. In embodiments, an anti-neurodegenerative agent is an agent approved by the US FDA or similar regulatory agency of a country other than the US, for treating neurodegeneration. This term includes, but is not limited to, the combinations described herein, and in the context of the present disclosure other anti-neurodegenerative agents.

[0035] The term “neurodegenerative disorder” or “neurodegeneration” refers to a condition primarily characterized by neuron ( / .< ., neuronal cell) loss. The most common neurodegenerative disorders include Alzheimer’s disease and Parkinson’s disease. Although there are several medicines currently approved for managing neurodegenerative disorders, alarge majority of them only help with associated symptoms. A listing of over 500 Neurological Disorders is provided by the US National Institute of Neurological Disorders and Stroke (NINDS) currently available at: https: / / www.ninds.nih.gov / health- information / disorders. See also, Wolfe, M. The Molecular and Cellular Basis of Neurodegenerative Diseases: Underlying Mechanisms. Academic Press, April 18, 2018; Lewis, P. The Molecular and Clinical Pathology of Neurodegenerative Disease. Academic Press, December 14, 2018. For the purposes of the present disclosure, the term “neurodegenerative disorders” includes those disorders, and specifically the synucleinopathies and amyloidoses and amyloidosis-associated condition described herein.

[0036] The term “alpha-synuclein” refers to a protein or polypeptide (aS or aS protein), as used herein, includes a single, monomeric protein or polypeptide, as well as such aS proteins and polypeptides in the form of oligomers, e.g., in the form of dimers, trimers, tetramers, or in the form of lipid-associated complexes, or lipid-free forms, or in the form of aggregates, and any of these forms can be soluble or insoluble. The terms also include the aS proteins found in complexes with other molecules.

[0037] The term “synucleinopathy” is used herein to name a group of neurodegenerative disorders characterized by the presence of increased levels, e.g., steadystate levels, of any one or more of soluble non-fibrillary variants, soluble oligomeric isoforms, insoluble non-fibrillary variants, complexes, and insoluble fibrillary aggregates of aS protein within cellular compartments of selective populations of neurons and glia. Thus, the aS steady-state level is understood to encompass all soluble as well as insoluble and intermediate (metastable) forms of the SNCA gene product. See, UniProt P37840; Gene ID: 6622; NCBI Reference Sequence: NG 011851.1. These disorders include any one of the following grouped as “invariable” (or “primary”) synucleinopathies: Parkinson's disease (PD) e.g., sporadic Parkinson disease / parkinsonism and familial Parkinson disease / parkinsonism; Parkinson’s disease dementia; sporadic or heritable dementia with Lewy bodies (DLB) (aka diffuse Lewy body disease); pure autonomic failure (PAF) with aS deposition; multiple system atrophy (MSA) (of cerebellar, parkinsonian, or mixed type); hereditary neurodegeneration with brain iron accumulation (aka, Hallervordern Spatz disease or pantothenate kinase 2-linked neurodegeneration); and incidental Lewy body disease of advanced age. Furthermore, “variable” (or “secondary”) synucleinopathies have been identified, where dysregulation of the alpha-synuclein metabolism is recognized to be a secondary event (given the abundance of the protein in the nervous system), which nevertheless contributes significantly to the course, penetrance, age-of-onset, severity andexpressivity of the primary illness. Disorders with variable synucleinopathy include, but are not limited to, Alzheimer's disease of the Lewy body variant; Down's syndrome; Down’s syndrome dementia; progressive supranuclear palsy; essential tremor with Lewy bodies; familial parkinsonism with or without dementia resulting from a mutant gene and loci where no gene mutation has yet been identified; Creutzfeldt Jakob disease and related prion diseases such as bovine spongiform encephalopathy (mad cow disease); secondary Parkinson disease / parkinsonism resulting from neurotoxin exposure / drug-induced parkinsonism with a- synuclein deposition; sporadic or heritable spinocerebellar ataxia; amyotrophic lateral sclerosis (ALS); idiopathic rapid eye movement sleep behavior disorder; and other conditions associated with central and / or peripheral a-synuclein accumulation in mammals accompanying a primary disease process. See, Schlossmacher MG a-synuclein and synucleinopathies. The Dementias 2 Blue Books of Practical Neurology; Editors: Growdon J H & Rossor M N. Butterworth Heinemann, Inc., Oxford. 2007; Chapter 8: pp 184-213. Clinically, all of these related disorders are characterized by a chronic and progressive decline in motor, cognitive, behavioral, and / or autonomic functions, depending on the distribution of the alpha-synuclein abnormalities.

[0038] The terms “amyloidosis” and “amyloidoses” refer to a group of diseases that involve the accumulation of amyloid proteins in the body. Amyloid proteins can be deposited in one part of the body, called localized amyloidosis, or in multiple parts, called systemic amyloidosis. Many forms of amyloidosis exist, and the disease can be classified into four groups: primary amyloidosis, secondary amyloidosis, hereditary amyloidosis, and amyloidosis associated with normal aging. Primary amyloidosis (light chain amyloidosis) occurs with abnormalities of plasma cells, and some people with primary amyloidosis also have multiple myeloma (cancer of the plasma cells). Typical sites of amyloid buildup in primary amyloidosis are the heart, lungs, skin, tongue, thyroid gland, intestines, liver, kidneys, and blood vessels. Secondary amyloidosis may develop in response to various diseases that cause persistent infection or inflammation, such as tuberculosis, rheumatoid arthritis, and familial Mediterranean fever. Typical sites of amyloid buildup in secondary amyloidosis are the spleen, liver, kidneys, adrenal glands, and lymph nodes. Hereditary amyloidosis has been noted in some families, particularly those from Portugal, Sweden, and Japan. The amyloid-producing defect occurs because of mutations in specific proteins in the blood. Typical sites for amyloid buildup in hereditary amyloidosis are the nerves, heart, blood vessels, and kidneys. Alzheimer's disease is a type of localized amyloidosis where amyloidbeta proteins build up in the brain. This is the most common type of amyloidosis in humansand the most common form of dementia. The “amyloid hypothesis” is the prevailing theory that Alzheimer's disease is caused by the accumulation of beta-amyloid proteins in the brain. Some studies have shown that amyloid triggers a binding of two proteins in the brain's neurons, which can lead to the rapid accumulation of tau proteins. Tau proteins are a primary driver of neurodegeneration in Alzheimer's disease. Amyloidosis can be caused by chronic inflammation or genetic mutation. There are many different types of amyloid proteins involved in amyloidosis, and each type of amyloid deposit can characterize a different disease.

[0039] The term “amyloidosis-associated condition” refers to a disease that is associated with amyloid deposition and can include but not be limited to Alzheimer's Disease, mild cognitive impairment due to Alzheimer's disease, mild Alzheimer's disease dementia, prodromal stage of Alzheimer’s disease, early-onset Alzheimer’s disease, mild Alzheimer’s disease, moderate Alzheimer’s disease, early Alzheimer’s disease, preclinical Alzheimer’s disease, frontotemporal dementia, idiopathetic myeloma, amyloid polyneuropathy, amyloid cardiomyopathy, systemic senile amyloidosis, amyloid polyneuropathy, hereditary cerebral hemorrhage with amyloidosis, Down's syndrome, Scrapie, medullary carcinoma of the thyroid, isolated atrial amyloid, P2-microglobulin amyloid in dialysis patients, inclusion body myositis, p2-amyloid deposits in muscle wasting disease, and Islets of Langerhans diabetes Type II insulinoma, Type 2 diabetes mellitus, hereditary cerebral hemorrhage amyloidosis (Dutch), amyloid A (reactive), secondary amyloidosis, familial Mediterranean fever, familial amyloid nephropathy with urticaria and deafness (Muckle-wells Syndrome), amyloid lambda L-chain or amyloid kappa L-chain (idiopathic, myeloma or macroglobulinemia-associated) A beta 2M (chronic hemodialysis), ATTR (familial amyloid polyneuropathy (Portuguese, Japanese, Swedish)), familial amyloid cardiomyopathy (Danish), isolated cardiac amyloid, systemic senile amyloidoses, AIAPP or amylin insulinoma, atrial naturetic factor (isolated atrial amyloid), procalcitonin (medullary carcinoma of the thyroid), gelsolin (familial amyloidosis (Finnish)), cystatin C (hereditary cerebral hemorrhage with amyloidosis (Icelandic)), AApo-A-1 (familial amyloidotic polyneuropathy-Iowa), AApo-A-II (accelerated senescence in mice), head injuries (traumatic brain injury), dementia, fibrinogen-associated amyloid; and Asor or Pr P-27 (scrapie, Creutzfeld Jacob disease, Gertsmann-Straussler- Scheinker syndrome, bovine spongiform encephalitis) or in cases of persons who are homozygous for the apolipoprotein E4 allele, and the condition associated with homozygosity for the apolipoprotein E4 allele or Huntington's disease.

[0040] The term “early-onset Alzheimer’s disease” or “EOAD” refers to AD caseswhere symptoms appear before age 65. EOAD includes, but is not limited to: Genetic (Familial) Alzheimer's Disease and its phenotypic variants including Logopenic Variant Primary Progressive Aphasia, Posterior Cortical Atrophy, Behavioral / Dysexecutive Alzheimer's Disease, and Acalculia Variant.

[0041] As used herein, the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.

[0042] As used herein, the term “pharmaceutically acceptable carrier” refers to a diluent, adjuvant, excipient, or vehicle with which a compound is administered. Such carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like, polyethylene glycols, glycerine, propylene glycol, or other synthetic solvents. Water is a preferred carrier when a compound is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol, and the like. A compound, if desired, can also combine minor amount of wetting or emulsifying agents, or pH buffering agents such as acetates, citrates, or phosphates. Antibacterial agents such as a benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; and agents for the adjustment of tonicity such as sodium chloride or dextrose may also be a carrier. Methods for producing compounds in combination with carriers are known to those of skill in the art.

[0043] As used herein, the term “pharmaceutically acceptable salt” includes those salts of a pharmaceutically acceptable compound formed with free amino groups such as those derived from hydrochloric, phosphoric, acetic, oxalic, and tartaric acids, and those formed with free carboxyl groups such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, and procaine. If the compound is basic, salts may be prepared from pharmaceutically acceptable non-toxic acids including inorganic and organic acids. Such acids include acetic, benzene-sulfonic (besylate), benzoic, camphorsulfonic, citric, ethenesulfonic, fumaric, gluconic, glutamic, hydrobromic, hydrochloric, isethionic, lactic, maleic, malic, mandelic, methanesulfonic, mucic, nitric, pamoic, pantothenic, phosphoric, succinic, sulfuric, tartaric,p-toluenesulfonic, and the like. Particularly preferred are besylate, hydrobromic, hydrochloric, phosphoric, and sulfuric acids. If the compound is acidic, salts may be prepared from pharmaceutically acceptable organic and inorganic bases. Suitable organic bases include, but are not limited to, lysine, N,N’ -dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylene diamine, meglumine (N-methyl-glucamine) and procaine. Suitable inorganic bases include, but are not limited to, alkaline and earth-alkaline metals such as aluminum, calcium, lithium, magnesium, potassium, sodium, and zinc. Methods for synthesizing such salts are known to those of skill in the art.

[0044] The term “effective amount” refers to the amount of a therapy (e.g., a combination provided herein or another active agent such as an anti-neurodegenerative agent described herein) which is sufficient to accomplish a stated purpose or otherwise achieve the effect for which it is administered. An effective amount can be sufficient to reduce and / or ameliorate the progression, development, recurrence, severity and / or duration of a given disease, disorder or condition and / or a symptom related thereto. An effective amount can be a “therapeutically effective amount” which refers to an amount sufficient to provide a therapeutic benefit such as, for example, the reduction or amelioration of the advancement or progression of a given disease, disorder or condition, reduction or amelioration of the recurrence, development or onset of a given disease, disorder or condition, and / or to improve or enhance the prophylactic or therapeutic effect(s) of another therapy. A therapeutically effective amount of a composition described herein can enhance the therapeutic efficacy of another therapeutic agent.

[0045] The term “therapeutically effective amount” refers to the amount of a therapy which is sufficient to accomplish a stated purpose or otherwise achieve the effect for which it is administered. An effective amount can be sufficient to reduce and / or ameliorate the progression, development, recurrence, severity and / or duration of a given disease, disorder or condition and / or a symptom related thereto. An effective amount can be a “therapeutically effective amount” which refers to an amount sufficient to provide a therapeutic benefit such as, for example, the reduction or amelioration of the advancement or progression of a given disease, disorder or condition, reduction or amelioration of the recurrence, development or onset of a given disease, disorder or condition, and / or to improve or enhance the prophylactic or therapeutic effect(s) of another therapy. A therapeutically effective amount of a composition described herein can enhance the therapeutic efficacy of another therapeutic agent.

[0046] The term “regimen” refers to a protocol for dosing and timing theadministration of one or more therapies (e.g., combinations described herein including, optionally, another active agent such as an anti-neurodegenerative agent described herein) for treating a disease, disorder, or condition described herein. A regimen can include periods of active administration and periods of rest as known in the art. Active administration periods include administration of combinations and compositions described herein and the duration of time of efficacy of such combinations and compositions. Rest periods of regimens described herein include a period of time in which no compound is actively administered, and in certain instances, includes time periods where the efficacy of such compounds can be minimal. Combination of active administration and rest in regimens described herein can increase the efficacy and / or duration of administration of the combinations and compositions described herein.

[0047] The term “enhance” refers to an increase or improvement in the function or activity of a protein or cell after administration or contacting with a combination described herein compared to the protein or cell prior to such administration or contact.

[0048] Compositions and Methods for Treating Neurodegenerative Disorders

[0049] The following description sets forth exemplary aspects of the present disclosure. It should be recognized, however, that such description is not intended as a limitation on the scope of the present disclosure. Rather, the description also encompasses combinations and modifications to those exemplary aspects described herein.

[0050] The present disclosure relates to pharmaceutical compositions and methods for the prevention or treatment of neurodegenerative disorders. More specifically, the present disclosure provides combination therapies utilizing (1) a phosphodiesterase 5 inhibitor (PDE- 5 inhibitor) in conjunction with (2) an N-methyl-D-aspartate receptor antagonist (NMDA receptor antagonist) in molar ratios more fully described below.

[0051] Neurodegenerative disorders encompass a range of cognitive disorders characterized by impairment of memory, thinking, and social abilities. As the global population ages, the prevalence of neurodegenerative disorders continues to increase, posing significant challenges for healthcare systems and societies worldwide. Current treatments for neurodegenerative disorders primarily focus on managing symptoms and slowing disease progression, with limited success in addressing the underlying causes of cognitive decline.

[0052] In some cases, the phosphodiesterase 5 inhibitor and NMDA receptor antagonist may be combined in specific weight ratios. These ratios may range from 1 :0.1 to 1 : 10. In other cases, the ratios may be 50: 1, 10: 1, 5: 1, 2: 1, 1 : 1, 1 :2, 1 :5, or 1 : 10 and ranges inb etween.

[0053] The combination may inhibit the growth and differentiation of nerve cells and degeneration of learning and memory. In some cases, the combination may induce a decrease in intracellular amyloid beta (AP). This decrease in intracellular Ap may increase the protection of nerve cells and enhance synaptic plasticity.

[0054] The combination of a phosphodiesterase 5 inhibitor and an NMDA receptor antagonist may provide synergistic effects in treating neurodegenerative disorders. These synergistic effects may include reduction of neuroinflammation, inhibition of Ap aggregation, and promotion of neurogenesis and synaptic plasticity.

[0055] In some cases, the combination may be effective in treating various neurodegenerative disorders including the synucleinopathies and amyloidoses and amyloidosis-associated condition described herein. These disorders include dementia, Parkinson's disease, Alzheimer's disease, Huntington's disease, and multiple sclerosis. The combination may act through multiple pathways to address the complex pathology of these diseases.

[0056] The pharmaceutical compositions described herein may provide a novel approach to treating neurodegenerative disorders by combining agents that target multiple pathways involved in the disease process. Without being bound by a particular theory, phosphodiesterase 5 inhibitors may modulate signaling pathways related to neuronal function and survival. Without being bound by a particular theory, NMDA receptor antagonists may reduce excessive activation of NMDA receptors which may contribute to neurodegeneration through exci totoxi city in certain neurodegenerative disorders.

[0057] The pharmaceutical compositions described herein may be formulated for various routes of administration and may contain specific ratios of active ingredients to optimize therapeutic effects. The combinations may be used to treat or prevent various forms of neurodegenerative disorders, including but not limited to Alzheimer's disease, vascular dementia, and Lewy body dementia.

[0058] By targeting multiple aspects of neurodegenerative disorders pathology simultaneously, these combination therapies may offer potential advantages in efficacy and disease modification compared to existing single-agent treatments. The disclosed compositions and methods may provide new options for addressing the growing global burden of neurodegenerative disorders and improving outcomes for affected individuals.

[0059] Compounds of a phosphodiesterase 5 inhibitor and an NMDA receptor antagonist in the molar ratios described in this disclosure include pharmaceutically acceptablesalts, pharmaceutically acceptable stereoisomers, derivatives, prodrugs, enantiomers, diastereomers, hydrates, co-crystals, and polymorphs thereof.

[0060] PDE-5 inhibitors

[0061] The phosphodiesterase 5 inhibitor may be selected from mirodenafil, sildenafil, vardenafil, tadalafil, udenafil, dasantafil, avanafil, and pharmaceutically acceptable salts, solvates, derivatives, and hydrates thereof.

[0062] NMDA receptor antagonists

[0063] The NMDA receptor antagonist may be selected from memantine, amantadine, ketamine, traxoprodil, lanicemine, rislenemdaz, pethidine, levorphanol, methadone, dextropropoxyphene, tramadol, ketobemidone, dextromethorphan (DXM), phencyclidine (PCP), methoxetamine (MXE), and pharmaceutically acceptable salts, solvates, derivatives, and hydrates thereof.

[0064] In certain instances, the combination includes a phosphodiesterase 5 inhibitor present at an amount of greater than about: 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 85 mg, 90 mg, 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 250 mg, or 300 mg. The combination can include a phosphodiesterase 5 inhibitor present at an amount greater than about: 25 mg, 50 mg, 100 mg, 200 mg, 250 mg, or 300 mg.

[0065] The combination can include a phosphodiesterase 5 inhibitor present at an amount greater than about: 1 mg to about 10 mg, 1 mg to about 25 mg, 1 mg to about 50 mg, 5 mg to about 10 mg, 5 mg to about 25 mg, 5 mg to about 50 mg, 10 mg to about 25 mg, 10 mg to about 50 mg, 50 mg to about 100 mg, 100 mg to about 200 mg, or 200 mg to about 300 mg.

[0066] The combination can include a phosphodiesterase 5 inhibitor in an amount of at least about: 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 85 mg, 90 mg, 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 250 mg, or 300 mg. The combination can include a phosphodiesterase 5 inhibitor present at an amount of at least about: 25 mg, 50 mg, 100 mg, 200 mg, 250 mg, or 300 mg. The combination can include a phosphodiesterase 5 inhibitor present at an amount of at least about: 1 mg to about 10 mg, 1 mg to about 25 mg, 1 mg to about 50 mg, 5 mg to about 10 mg, 5 mg to about 25 mg, 5 mg to about 50 mg, 10 mg to about 25 mg, 10 mg to about 50mg, 50 mg to about 100 mg, 100 mg to about 200 mg, or 200 mg to about 300 mg.

[0067] The combination can include a phosphodiesterase 5 inhibitor present in an amount of about: 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 85 mg, 90 mg, 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 250 mg, or 300 mg. The combination can include a phosphodiesterase 5 inhibitor present at an amount of about: 25 mg, 50 mg, 100 mg, 200 mg, 250 mg, or 300 mg. The combination can include a phosphodiesterase 5 inhibitor present at an amount of about: 1 mg to about 10 mg, 1 mg to about 25 mg, 1 mg to about 50 mg, 5 mg to about 10 mg, 5 mg to about 25 mg, 5 mg to about 50 mg, 10 mg to about 25 mg, 10 mg to about 50 mg, 50 mg to about 100 mg, 100 mg to about 200 mg, or 200 mg to about 300 mg.

[0068] A phosphodiesterase 5 inhibitor can be present in the combinations described herein relative to the weight of the patient (e.g., mg / kg). In some instances, the phosphodiesterase 5 inhibitor is present in an amount equivalent to about: 0.0001 mg / kg to about 200 mg / kg, 0.001 mg / kg to about 200 mg / kg, 0.01 mg / kg to about 200 mg / kg, 0.01 mg / kg to about 150 mg / kg, 0.01 mg / kg to about 100 mg / kg, 0.01 mg / kg to about 50 mg / kg, 0.01 mg / kg to about 25 mg / kg, 0.01 mg / kg to about 10 mg / kg, or 0.01 mg / kg to about 5 mg / kg, 0.05 mg / kg to about 200 mg / kg, 0.05 mg / kg to about 150 mg / kg, 0.05 mg / kg to about 100 mg / kg, 0.05 mg / kg to about 50 mg / kg, 0.05 mg / kg to about 25 mg / kg, 0.05 mg / kg to about 10 mg / kg, or 0.05 mg / kg to about 5 mg / kg, 0.5 mg / kg to about 200 mg / kg, 0.5 mg / kg to about 150 mg / kg, 0.5 mg / kg to about 100 mg / kg, 0.5 mg / kg to about 50 mg / kg, 0.5 mg / kg to about 25 mg / kg, 0.5 mg / kg to about 10 mg / kg, or 0.5 mg / kg to about 5 mg / kg. In other instances the phosphodiesterase 5 inhibitor is present in an amount equivalent to about: 1 mg / kg to about 200 mg / kg, 1 mg / kg to about 150 mg / kg, 1 mg / kg to about 100 mg / kg, 1 mg / kg to about 50 mg / kg, 1 mg / kg to about 25 mg / kg, 1 mg / kg to about 10 mg / kg, or 1 mg / kg to about 5 mg / kg.

[0069] In certain instances, the combination includes an NMDA receptor antagonist present at an amount of greater than about: 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 85 mg, 90 mg, 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 250 mg, or 300 mg. The combination can include an NMDA receptor antagonist present at an amount greater than about: 25 mg, 50 mg, 100 mg, 200 mg, 250 mg, or 300 mg.

[0070] The combination can include an NMDA receptor antagonist present at an amount greater than about: 1 mg to about 10 mg, 1 mg to about 25 mg, 1 mg to about 50 mg, 5 mg to about 10 mg, 5 mg to about 25 mg, 5 mg to about 50 mg, 10 mg to about 25 mg, 10mg to about 50 mg, 50 mg to about 100 mg, 100 mg to about 200 mg, or 200 mg to about 300 mg.

[0071] The combination can include an NMDA receptor antagonist in an amount of at least about: 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 85 mg, 90 mg, 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 250 mg, or 300 mg. The combination can include an NMDA receptor antagonist present at an amount of at least about: 25 mg, 50 mg, 100 mg, 200 mg, 250 mg, or 300 mg. The combination can include an NMDA receptor antagonist present at an amount of at least about: 1 mg to about 10 mg, 1 mg to about 25 mg, 1 mg to about 50 mg, 5 mg to about 10 mg, 5 mg to about 25 mg, 5 mg to about 50 mg, 10 mg to about 25 mg, 10 mg to about 50 mg, 50 mg to about 100 mg, 100 mg to about 200 mg, or 200 mg to about 300 mg.

[0072] The combination can include an NMDA receptor antagonist present in an amount of about: 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 85 mg, 90 mg, 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 250 mg, or 300 mg. The combination can include an NMDA receptor antagonist present at an amount of about: 25 mg, 50 mg, 100 mg, 200 mg, 250 mg, or 300 mg. The combination can include an NMDA receptor antagonist present at an amount of about: 1 mg to about 10 mg, 1 mg to about 25 mg, 1 mg to about 50 mg, 5 mg to about 10 mg, 5 mg to about 25 mg, 5 mg to about 50 mg, 10 mg to about 25 mg, 10 mg to about 50 mg, 50 mg to about 100 mg, 100 mg to about 200 mg, or 200 mg to about 300 mg.

[0073] An NMDA receptor antagonist can be present in the combinations described herein relative to the weight of the patient (e.g., mg / kg). In some instances, an NMDA receptor antagonist is present in an amount equivalent to about: 0.0001 mg / kg to about 200 mg / kg, 0.001 mg / kg to about 200 mg / kg, 0.01 mg / kg to about 200 mg / kg, 0.01 mg / kg to about 150 mg / kg, 0.01 mg / kg to about 100 mg / kg, 0.01 mg / kg to about 50 mg / kg, 0.01 mg / kg to about 25 mg / kg, 0.01 mg / kg to about 10 mg / kg, or 0.01 mg / kg to about 5 mg / kg, 0.05 mg / kg to about 200 mg / kg, 0.05 mg / kg to about 150 mg / kg, 0.05 mg / kg to about 100 mg / kg, 0.05 mg / kg to about 50 mg / kg, 0.05 mg / kg to about 25 mg / kg, 0.05 mg / kg to about 10 mg / kg, or 0.05 mg / kg to about 5 mg / kg, 0.5 mg / kg to about 200 mg / kg, 0.5 mg / kg to about 150 mg / kg, 0.5 mg / kg to about 100 mg / kg, 0.5 mg / kg to about 50 mg / kg, 0.5 mg / kg to about 25 mg / kg, 0.5 mg / kg to about 10 mg / kg, or 0.5 mg / kg to about 5 mg / kg. In other instances the NMDA receptor antagonist is present in an amount equivalent to about: 1 mg / kg to about 200 mg / kg, 1 mg / kg to about 150 mg / kg, 1 mg / kg to about 100 mg / kg, 1 mg / kg to about 50 mg / kg, 1 mg / kg to about 25 mg / kg, 1 mg / kg to about 10 mg / kg, or 1 mg / kg to about 5 mg / kg.

[0074] In certain instances the therapeutically effective amount of combination hereof is determined as an amount provided in a package insert provided with the combination. The term package insert refers to instructions customarily included in commercial packages of medicaments approved by the FDA or a similar regulatory agency of a country other than the US, which contains information about, for example, the usage, dosage, administration, contraindications, and / or warnings concerning the use of such medicaments.

[0075] The phosphodiesterase 5 inhibitor and NMDA receptor antagonist can be administered in the molar ratios described in this disclosure can be provided in amounts that are synergistic with another member of the group. The term synergistic refers to a combination described herein (e.g., a phosphodiesterase 5 inhibitor and an NMDA receptor antagonist - including, optionally, coadministration with another active agent such as an anti- neurodegenerative agent described herein) or a combination of regimens such as those described herein that is more effective than the additive effects of each individual therapy or regimen.

[0076] A synergistic effect of a combination described herein can permit the use of lower dosages of one or more of the components of the combination (e.g., a phosphodiesterase 5 inhibitor and an NMDA receptor antagonist in the molar ratios described in this disclosure). A synergistic effect can permit less frequent administration of at least one of the administered therapies (e.g., a phosphodiesterase 5 inhibitor and an NMDA receptor antagonist in the molar ratios described in this disclosure) to a subject with a disease, disorder, or condition described herein. Such lower dosages and reduced frequency of administration can reduce the toxicity associated with the administration of at least one of the therapies (e.g., a phosphodiesterase 5 inhibitor and an NMDA receptor antagonist in the molar ratios described in this disclosure) to a subject without reducing the efficacy of the treatment. A synergistic effect as described herein avoid or reduce adverse or unwanted side effects associated with the use of any therapy.

[0077] Pharmaceutical Compositions

[0078] Combinations described herein can be provided as a pharmaceutical composition suitable for administration via any route to a patient described herein including but not limited to: oral, mucosal (e.g., nasal, inhalation, pulmonary, sublingual, vaginal, buccal, or rectal), parenteral (e.g., subcutaneous, intravenous, bolus injection, intramuscular, or intra-arterial), topical (e.g., eye drops or other ophthalmic preparations), transdermal ortranscutaneous administration to a patient.

[0079] Exemplary of dosage forms include: tablets; caplets; capsules (e.g., gelatin capsules); cachets; lozenges; suppositories; powders; gels; liquid dosage forms suitable for parenteral administration to a patient; and sterile solids (e.g., crystalline or amorphous solids) that can be reconstituted to provide liquid dosage forms suitable for parenteral administration to a patient.

[0080] Pharmaceutical compositions and dosage forms described herein typically include one or more excipients. Suitable excipients are well known to those skilled in the art of pharmacy. Whether a particular excipient is suitable for incorporation into a pharmaceutical composition or dosage form depends on a variety of factors such as, for example, the intended route of administration to the patient. Pharmaceutical compositions described herein can include other agents such as stabilizers, lubricants, buffers, and disintegrants that can reduce the rate by which an active ingredient can decompose in a particular formulation.

[0081] Pharmaceutical compositions described herein can in certain instances include additional active agents other than those in the combinations described herein (e.g., an anti-neurodegenerative agent such as those described herein) in an amount provided herein.

[0082] In one embodiment, one of a phosphodiesterase 5 inhibitor or an NMDA receptor antagonist is provided in an oral dosage form such as a tablet or capsule. In another embodiment, one of a phosphodiesterase 5 inhibitor or an NMDA receptor antagonist is supplied as a powder (e.g., lyophilized powder) that can be resuspended in a liquid suitable for parenteral administration.

[0083] The combinations described herein can be provided in forms convenient to or facilitate their administration to a patient. For example, the combination can be formulated as a tablet, capsule, or as a powder (e.g., lyophilized powder) that can be resuspended in a liquid suitable for parenteral administration.

[0084] Combinations described herein can be provided as controlled release pharmaceutical products, which have a goal of improving drug therapy over that achieved by their non-controlled counterparts. Controlled release formulations can extend activity of the drug, reduce dosage frequency, and increase subject compliance. In addition, controlled release formulations can be used to affect the time of onset of action or other characteristics, such as blood levels of the drug, and can thus affect the occurrence of side (e.g., adverse) effects.

[0085] Methods

[0086] The combinations, pharmaceutical compositions, and kits described herein are useful for treating diseases, disorders, or alleviating, ameliorating, or eliminating the symptoms of diseases and disorders such as, for example, neurodegenerative disorders. It is to be understood that the methods described herein pertain to administration of combinations and pharmaceutical compositions described herein, and such combinations and pharmaceutical compositions can be provided in the form of a kit as described herein. Provided herein are methods of treating neurodegenerative disorders by administering a therapeutically effective amount of a combination described herein to a patient in need thereof. Also provided herein are methods of managing neurodegenerative disorders by administering therapeutically effective amount of a combination described herein to a patient in need thereof.

[0087] In an aspect the methods of treating neurodegenerative disorders provide for methods for reducing amyloid or Ap burden in an individual by administering a therapeutically effective amount of a combination described herein. In some embodiments, neurodegeneration related to the neurodegenerative disorder is reduced by at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%.

[0088] The methods of treating neurodegenerative disorders described herein also provide for methods for increasing or otherwise prolonging time to neurodegenerative disorder progression. Time to disease progression can be prolonged in a patient by administering a therapeutically effective amount of a combination described herein. In some embodiments, the increase is a comparison between the time to neurodegenerative disorder progression without treatment and with treatment with a combination described herein. In some embodiments, the methods described herein prolong the time to disease progression by at least 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 3 years, 4 years, 5 years, 10 years, 15 years, 20 years, 25 years, or more, including values in between.

[0089] The methods of treating neurodegenerative disorders described herein also provide for methods for increasing or otherwise prolonging survival of patients diagnosed with neurodegenerative disorders as described herein. Patient survival can be prolonged by administering a therapeutically effective amount of a combination described herein. In some embodiments, the increase is a comparison between the survival without treatment and withtreatment with a combination as described herein. In some embodiments, the methods described herein prolong survival by at least 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 3 years, 4 years, 5 years, 10 years, 15 years, 20 years, 25 years, or more, including values in between.

[0090] The methods of treating neurodegenerative disorders described herein also provide for methods for increasing progression-free survival of patients diagnosed with neurodegenerative disorders as described herein. Patient progression-free survival can be prolonged by administering a therapeutically effective amount of a combination described herein. In some embodiments, the increase is a comparison between the progression-free survival without treatment and with treatment with a combination as described herein. In some embodiments, the methods described herein increase progression-free survival by at least 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 3 years, 4 years, 5 years, 10 years, 15 years, 20 years, 25 years, or more, including values in between.

[0091] Target Neurodegenerative Disorders

[0092] Synucleinopathies are a group of neurodegenerative disorders characterized by the abnormal accumulation and aggregation of alpha-synuclein protein in various parts of the nervous system. In some cases, these disorders may share common pathological mechanisms, but they often present with distinct clinical features. The following outlines several known synucleinopathies:

[0093] Parkinson's Disease (PD): PD may be characterized by the loss of dopaminergic neurons in the substantia nigra pars compacta and the presence of Lewy bodies containing aggregated alpha-synuclein. In some cases, patients may experience motor symptoms such as tremor, rigidity, bradykinesia, and postural instability. Non-motor symptoms may include cognitive impairment, depression, sleep disorders, and autonomic dysfunction.

[0094] Parkinson's Disease Dementia (PDD): PDD may develop in some patients with long-standing PD. It may be characterized by cognitive decline, including impairments in attention, executive function, and visuospatial abilities. In some cases, PDD may be associated with a more widespread distribution of Lewy bodies in cortical and limbic regions.

[0095] Dementia with Lewy Bodies (DLB): DLB may share features with both PD and Alzheimer's disease. It may be characterized by fluctuating cognition, visualhallucinations, and parkinsonism. In some cases, patients may experience rapid eye movement (REM) sleep behavior disorder. The distribution of Lewy bodies in DLB may be more widespread than in PD, often affecting cortical areas.

[0096] Multiple System Atrophy (MSA): MSA may be characterized by a combination of parkinsonian, cerebellar, and autonomic symptoms. In some cases, it may be divided into two subtypes: MSA-P (predominant parkinsonism) and MSA-C (predominant cerebellar ataxia). Alpha-synuclein aggregates in MSA may primarily affect oligodendrocytes, forming glial cytoplasmic inclusions.

[0097] Pure Autonomic Failure (PAF): PAF may be characterized by progressive autonomic dysfunction without significant central nervous system involvement. In some cases, patients may experience orthostatic hypotension, gastrointestinal disturbances, and urogenital dysfunction. Alpha-synuclein aggregates may be found in peripheral autonomic neurons.

[0098] Lewy Body Variant of Alzheimer's Disease (LBV): LBV may represent a condition where patients exhibit pathological features of both Alzheimer's disease and DLB. In some cases, patients may show cognitive decline typical of Alzheimer's disease along with some features of DLB, such as visual hallucinations or fluctuating cognition.

[0099] In some aspects, these synucleinopathies may share common pathological mechanisms related to alpha-synuclein aggregation and neuronal dysfunction. However, the specific distribution of alpha-synuclein pathology and the affected cell types may vary among these disorders, contributing to their distinct clinical presentations.

[0100] The development of therapeutic strategies targeting alpha-synuclein aggregation, such as the combination of Lamotrigine and Rivastigmine described in this disclosure, may have potential applications across various synucleinopathies. In some cases, such approaches may address the underlying pathological processes common to these disorders, potentially offering new avenues for prevention, alleviation, or treatment of these debilitating neurodegenerative conditions.

[0101] Alzheimer's disease (AD) is a progressive neurodegenerative disorder that may be characterized by cognitive decline, memory loss, and behavioral changes. In some cases, AD may be the most common cause of dementia in older adults. The disease may be associated with the accumulation of Ap plaques and neurofibrillary tangles composed of hyperphosphorylated tau protein in the brain.

[0102] In some aspects, the pathological hallmarks of AD may include:

[0103] 1. Ap plaques: These extracellular deposits may consist of aggregated beta-amyloid peptides, which may be derived from the amyloid precursor protein (APP).

[0104] 2. Neurofibrillary tangles: These intracellular aggregates may be composed of hyperphosphorylated tau protein, which may disrupt normal neuronal function.

[0105] 3. Neuronal loss: Progressive degeneration of neurons, particularly in regions such as the hippocampus and cortex, may occur.

[0106] 4. Synaptic dysfunction: Impairment of synaptic transmission and plasticity may contribute to cognitive decline.

[0107] In some cases, AD may progress through several stages, from mild cognitive impairment to severe dementia. The disease may affect various cognitive domains, including memory, language, executive function, and visuospatial abilities.

[0108] Other neurodegenerative disorders related to AD may include:

[0109] Vascular dementia: This form of dementia may be caused by reduced blood flow to the brain, often due to stroke or other vascular issues.

[0110] Frontotemporal dementia (FTD): FTD may be characterized by changes in behavior, personality, and language abilities, often with an earlier onset than AD.

[0111] Lewy body dementia (LBD): This condition may share features with both AD and Parkinson's Disease, and may be characterized by cognitive fluctuations, visual hallucinations, and parkinsonism.

[0112] Mixed dementia: In some cases, individuals may exhibit pathological features of multiple types of dementia, such as AD and vascular dementia.

[0113] Posterior cortical atrophy (PCA): This rare form of dementia may primarily affect visual processing and spatial awareness.

[0114] Primary progressive aphasia (PPA): PPA may be characterized by progressive language impairment, which may be a variant of FTD or AD.

[0115] Corticobasal degeneration (CBD): This rare neurological disorder may affect movement and cognition, often presenting with asymmetric motor symptoms and cognitive impairment.

[0116] Progressive supranuclear palsy (PSP): PSP may be characterized by problems with balance, eye movements, and cognitive function.

[0117] Amyloidoses are also target neurodegenerative disorders of the present disclosure. In some aspects, these neurodegenerative disorders may share common pathological mechanisms, such as protein aggregation, mitochondrial dysfunction, and neuroinflammation, including mechanisms involved in synucleinopathies. However, the specific proteins involved, the regions of the brain affected, and the clinical presentationsmay vary among these disorders.

[0118] The development of therapeutic strategies targeting multiple pathological processes, such as the combination of a phosphodiesterase 5 inhibitor and an NMDA receptor antagonist in the molar ratios described in this disclosure, may have potential applications across various neurodegenerative disorders. In some cases, such approaches may address the underlying pathological processes common to these disorders, potentially offering new avenues for prevention, alleviation, or treatment of these debilitating conditions.

[0119] The combinations described herein can include administration of each therapy (e.g., a phosphodiesterase 5 inhibitor and an NMDA receptor antagonist in the molar ratios described in this disclosure, optionally including another anti-neurodegenerative agent), where the administration is performed simultaneously or sequentially (in either order). In one embodiment, a phosphodiesterase 5 inhibitor and an NMDA receptor antagonist in the molar ratios provided herein are administered simultaneously (e.g., within at least 1 to 5 min of each other). In another embodiment, the phosphodiesterase 5 inhibitor and NMDA receptor antagonist in the molar ratios provided herein are administered sequentially (e.g., within at least 10 min, 15 min, 30 min, 1 h, 2 h, 5 h, 10 h, 12 h, 1 day, 2 days, 5 days, 7 days, 14 days, or 21 days of each other).

[0120] The combinations of the present disclosure can be administered, for example, once a day (QD), twice daily (BID), once a week (QW), twice weekly (BIW), three times a week (TIW), or monthly (QM) regularly on a continuous basis or intermittent basis such as BIW for 3 months then resume a month later. For example, the combinations of the present disclosure can be administered BID. The combinations of the present disclosure can be administered TIW. In certain instances, the combinations of the present disclosure can be administered 2 to 3 times a week. In another embodiment, the combinations of the present disclosure is administered QD. The combinations of the present disclosure can be administered QD for about: 1 day to about 7 days, 1 day to about 14 days, 1 day to about 21 days, 1 day to about 28 days, or daily until disease progression changes or unacceptable toxicity occurs. The administration of combinations of the present disclosure can, in part, depend upon the tolerance of the patient where greater tolerance can allow greater or more frequent administration. Alternatively, where a patient shows poor tolerance to a phosphodiesterase 5 inhibitor or an NMDA receptor antagonist, a lesser amount of one individual compounds or a less frequent dosing of the combination can be performed. Combinations of the present disclosure can be administered in any regimen as described herein.

[0121] For example, combinations of the present disclosure can be administered at an amount of about: 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 85 mg, 90 mg, 100 mg, 125 mg, 150 mg, 175 mg, or 200 mg, QD. For example, combinations of the present disclosure can be administered at an amount of about: 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 85 mg, 90 mg, 100 mg, 125 mg, 150 mg, 175 mg, or 200 mg, BIW. For example, combinations of the present disclosure can be administered at an amount of about: 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 85 mg, 90 mg, 100 mg, 125 mg, 150 mg, 175 mg, or 200 mg, TIW. For example, combinations of the present disclosure can be administered at an amount of about: 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 85 mg, 90 mg, 100 mg, 125 mg, 150 mg, 175 mg, or 200 mg, QW. For example, combinations of the present disclosure can be administered at an amount of about: 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 85 mg, 90 mg, 100 mg, 125 mg, 150 mg, 175 mg, or 200 mg, Q2W. For example, combinations of the present disclosure can be administered at an amount of about 5 mg or about 10 mg, QD. For example, combinations of the present disclosure can be administered at an amount of about 5 mg or about 10 mg, BIW. For example, combinations of the present disclosure can be administered at an amount of about 5 mg or about 10 mg, TIW. For example, combinations of the present disclosure can be administered at an amount of about 5 mg or about 10 mg, QW. For example, combinations of the present disclosure can be administered at an amount of about 5 mg or about 10 mg, Q2W. Administration of combinations of the present disclosure can be continuous. Administration of combinations of the present disclosure can be intermittent.

[0122] For example, combinations of the present disclosure can be administered at an amount of about: 1 mg to about 10 mg, 1 mg to about 25 mg, 1 mg to about 50 mg, 5 mg to about 10 mg, 5 mg to about 25 mg, 5 mg to about 50 mg, 10 mg to about 25 mg, 10 mg to about 50 mg, 50 mg to about 100 mg, or 100 mg to about 200 mg, QD. For example, combinations of the present disclosure can be administered at an amount of about: 1 mg to about 10 mg, 1 mg to about 25 mg, 1 mg to about 50 mg, 5 mg to about 10 mg, 5 mg to about 25 mg, 5 mg to about 50 mg, 10 mg to about 25 mg, 10 mg to about 50 mg, 50 mg to about 100 mg, or 100 mg to about 200 mg, BIW. For example, combinations of the present disclosure can be administered at an amount of about: 1 mg to about 10 mg, 1 mg to about 25mg, 1 mg to about 50 mg, 5 mg to about 10 mg, 5 mg to about 25 mg, 5 mg to about 50 mg, 10 mg to about 25 mg, 10 mg to about 50 mg, 50 mg to about 100 mg, or 100 mg to about 200 mg, TIW. For example, combinations of the present disclosure can be administered at an amount of about: 1 mg to about 10 mg, 1 mg to about 25 mg, 1 mg to about 50 mg, 5 mg to about 10 mg, 5 mg to about 25 mg, 5 mg to about 50 mg, 10 mg to about 25 mg, 10 mg to about 50 mg, 50 mg to about 100 mg, or 100 mg to about 200 mg, QW. For example, combinations of the present disclosure can be administered at an amount of about: 1 mg to about 10 mg, 1 mg to about 25 mg, 1 mg to about 50 mg, 5 mg to about 10 mg, 5 mg to about 25 mg, 5 mg to about 50 mg, 10 mg to about 25 mg, 10 mg to about 50 mg, 50 mg to about 100 mg, or 100 mg to about 200 mg, Q2W. Administration of combinations of the present disclosure can be continuous. Administration of combinations of the present disclosure can be intermittent.

[0123] For example, combinations of the present disclosure can be administered at an amount of about: 0.0001 mg / kg to about 200 mg / kg, 0.001 mg / kg to about 200 mg / kg, 0.01 mg / kg to about 200 mg / kg, 0.01 mg / kg to about 150 mg / kg, 0.01 mg / kg to about 100 mg / kg, 0.01 mg / kg to about 50 mg / kg, 0.01 mg / kg to about 25 mg / kg, 0.01 mg / kg to about 10 mg / kg, or 0.01 mg / kg to about 5 mg / kg, 0.05 mg / kg to about 200 mg / kg, 0.05 mg / kg to about 150 mg / kg, 0.05 mg / kg to about 100 mg / kg, 0.05 mg / kg to about 50 mg / kg, 0.05 mg / kg to about 25 mg / kg, 0.05 mg / kg to about 10 mg / kg, or 0.05 mg / kg to about 5 mg / kg, 0.5 mg / kg to about 200 mg / kg, 0.5 mg / kg to about 150 mg / kg, 0.5 mg / kg to about 100 mg / kg, 0.5 mg / kg to about 50 mg / kg, 0.5 mg / kg to about 25 mg / kg, 0.5 mg / kg to about 10 mg / kg, or 0.5 mg / kg to about 5 mg / kg, QD. For example, combinations of the present disclosure can be administered at an amount of about: 0.0001 mg / kg to about 200 mg / kg, 0.001 mg / kg to about 200 mg / kg, 0.5 mg / kg to about 200 mg / kg, 0.5 mg / kg to about 150 mg / kg, 0.5 mg / kg to about 100 mg / kg, 0.5 mg / kg to about 50 mg / kg, 0.5 mg / kg to about 25 mg / kg, 0.5 mg / kg to about 10 mg / kg, or 0.5 mg / kg to about 5 mg / kg, BIW. For example, combinations of the present disclosure can be administered at an amount of about: 0.0001 mg / kg to about 200 mg / kg, 0.001 mg / kg to about 200 mg / kg, 0.5 mg / kg to about 200 mg / kg, 0.5 mg / kg to about 150 mg / kg, 0.5 mg / kg to about 100 mg / kg, 0.5 mg / kg to about 50 mg / kg, 0.5 mg / kg to about 25 mg / kg, 0.5 mg / kg to about 10 mg / kg, or 0.5 mg / kg to about 5 mg / kg, TIW. For example, combinations of the present disclosure can be administered at an amount of about: 0.0001 mg / kg to about 200 mg / kg, 0.001 mg / kg to about 200 mg / kg, 0.5 mg / kg to about 200 mg / kg, 0.5 mg / kg to about 150 mg / kg, 0.5 mg / kg to about 100 mg / kg, 0.5 mg / kg to about 50 mg / kg, 0.5 mg / kg to about 25 mg / kg, 0.5 mg / kg to about 10 mg / kg, or 0.5 mg / kg to about 5 mg / kg,QW. For example, combinations of the present disclosure can be administered at an amount of about: 0.0001 mg / kg to about 200 mg / kg, 0.001 mg / kg to about 200 mg / kg, 0.5 mg / kg to about 200 mg / kg, 0.5 mg / kg to about 150 mg / kg, 0.5 mg / kg to about 100 mg / kg, 0.5 mg / kg to about 50 mg / kg, 0.5 mg / kg to about 25 mg / kg, 0.5 mg / kg to about 10 mg / kg, or 0.5 mg / kg to about 5 mg / kg, Q2W. In one example, combinations of the present disclosure can be administered at an amount of about 15 mg / kg to about 75 mg / kg, QD. In another example, combinations of the present disclosure can be administered at an amount of about 20 mg / kg to about 50 mg / kg. In still another example, combinations of the present disclosure can be administered at an amount of about 0.001 mg / kg, 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.5 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 40 mg / kg, 50 mg / kg, 60 mg / kg, 70 mg / kg, 80 mg / kg, 90 mg / kg, 100 mg / kg, 125 mg / kg, 150 mg / kg, 175 mg / kg, or 200 mg / kg. Administration of combinations of the present disclosure can be continuous. Administration of combinations of the present disclosure can be intermittent.

[0124] For example, combinations of the present disclosure can be administered at an amount of about: 1 mg / kg to about 200 mg / kg, 1 mg / kg to about 150 mg / kg, 1 mg / kg to about 100 mg / kg, 1 mg / kg to about 50 mg / kg, 1 mg / kg to about 25 mg / kg, 1 mg / kg to about 10 mg / kg, or 1 mg / kg to about 5 mg / kg, QD. For example, combinations of the present disclosure can be administered at an amount of about: 1 mg / kg to about 200 mg / kg, 1 mg / kg to about 150 mg / kg, 1 mg / kg to about 100 mg / kg, 1 mg / kg to about 50 mg / kg, 1 mg / kg to about 25 mg / kg, 1 mg / kg to about 10 mg / kg, or 1 mg / kg to about 5 mg / kg, BIW. For example, combinations of the present disclosure can be administered at an amount of about: 1 mg / kg to about 200 mg / kg, 1 mg / kg to about 150 mg / kg, 1 mg / kg to about 100 mg / kg, 1 mg / kg to about 50 mg / kg, 1 mg / kg to about 25 mg / kg, 1 mg / kg to about 10 mg / kg, or 1 mg / kg to about 5 mg / kg, TIW. For example, combinations of the present disclosure can be administered at an amount of about: 1 mg / kg to about 200 mg / kg, 1 mg / kg to about 150 mg / kg, 1 mg / kg to about 100 mg / kg, 1 mg / kg to about 50 mg / kg, 1 mg / kg to about 25 mg / kg, 1 mg / kg to about 10 mg / kg, or 1 mg / kg to about 5 mg / kg, QW. For example, combinations of the present disclosure can be administered at an amount of about: 1 mg / kg to about 200 mg / kg, 1 mg / kg to about 150 mg / kg, 1 mg / kg to about 100 mg / kg, 1 mg / kg to about 50 mg / kg, 1 mg / kg to about 25 mg / kg, 1 mg / kg to about 10 mg / kg, or 1 mg / kg to about 5 mg / kg, Q2W. In one example, combinations of the present disclosure can be administered at an amount of about 15 mg / kg to about 75 mg / kg, QD. In another example, combinations of the present disclosure can be administered at an amount of about 20 mg / kg to about 50 mg / kg. Instill another example, combinations of the present disclosure can be administered at an amount of about 0.001 mg / kg, 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.5 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 40 mg / kg, 50 mg / kg, 60 mg / kg, 70 mg / kg, 80 mg / kg, 90 mg / kg, 100 mg / kg, 125 mg / kg, 150 mg / kg, 175 mg / kg, or 200 mg / kg. Administration of combinations of the present disclosure can be continuous. Administration of combinations of the present disclosure can be intermittent.

[0125] As used herein, the term daily is intended to mean that a therapeutic compound of a combination described herein, such as a phosphodiesterase 5 inhibitor and an NMDA receptor antagonist, is administered once or more than once each day for a period of time. The term continuous is intended to mean that a therapeutic compound of a combination described herein, such as a phosphodiesterase 5 inhibitor and an NMDA receptor antagonist, is administered daily for an uninterrupted period of at least 10 days to 52 weeks, to multiple years. The term intermittent or intermittently as used herein is intended to mean stopping and starting at either regular or irregular intervals. For example, intermittent administration of a therapeutic compound of a combination described herein, such as a phosphodiesterase 5 inhibitor and an NMDA receptor antagonist, includes administration for one to six days per week (e.g., 2 to 3 times per week or QD), administration in cycles (e.g., daily administration for two to eight consecutive weeks, then a rest period with no administration at least one day), or, for example, administration on alternate days.

[0126] The combinations described herein can be administered in a regimen. The regimen can be structured to provide therapeutically effective amounts of a phosphodiesterase 5 inhibitor and an NMDA receptor antagonist in the molar ratios provided herein, optionally including another anti-neurodegenerative agent, over a predetermined period of time (e.g., an administration time). The regimen can be structured to limit or prevent side-effects or undesired complications of each of the components of the combination described herein. The regimen can be structured in a manner that results in increased effect for both therapies of the combination (e.g., synergy). Regimens useful for treating neurodegenerative disorders can include any number of days, months or years of administration which can be repeated as necessary. Administration periods can be broken by a rest period that includes no administration of at least one therapy. For example, a regimen can include administration periods that include 2, 3, 5, 7, 10, 15, 21, 28, or more days. These periods can be repeated. For example, a regimen can include a set number of days as previously described where the regimen is repeated 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, ormore times.

[0127] Regimens can include a rest period of at least 1, 2, 3, 5, 7, 10, or more days, where at least one therapy is no longer administered to a patient. The rest period can be determined by, for example, monitoring the reaction of the patient to the drug or by measuring the efficacy of the treatment. A rest period can be applicable to a single therapy, such that only one therapy of a combination described herein is discontinued in the rest period but the other therapy(ies) are still administered. Rest periods can be applied to all of the therapies administered to the subject such that the subject receives no therapy for a set period of time during the rest period.

[0128] Regimens described herein for the treatment of neurodegenerative disorders using the combinations described herein can be continued until disease progression is changed or unacceptable toxicity occurs.

[0129] Regimens for administration of combinations described herein include, for example administration one of a phosphodiesterase 5 inhibitor or an NMDA receptor antagonist can be administered BIW, and administration of another member of the group TIW. For example, one of a phosphodiesterase 5 inhibitor or an NMDA receptor antagonist can be administered QD for about 21 days, and another member of the group can be administered Q2W or Q4W. For example, one of a phosphodiesterase 5 inhibitor or an NMDA receptor antagonist can be administered BIW or TIW, and another member of the group can be administered Q2W. In another exemplary regimen, one of a phosphodiesterase 5 inhibitor or an NMDA receptor antagonist can be administered BIW or TIW, and another member of the group can be administered BIW for 2 or 3 weeks. In still another exemplary regimen, one of a phosphodiesterase 5 inhibitor or an NMDA receptor antagonist can be administered BIW or TIW, and another member of the group can be administered Q4W. In still another exemplary regimen, one of a phosphodiesterase 5 inhibitor or an NMDA receptor antagonist can be administered BIW, and another member of the group can be administered Q2W, Q3W, or Q4W. In certain instances, such regimens include administration of another anti -neurodegenerative agent administered Q2W, Q3W, or Q4W. In yet another exemplary regimen, one of a phosphodiesterase 5 inhibitor or an NMDA receptor antagonist can be administered TIW, and another member of the group can be administered Q2W, Q3W, or Q4W.

[0130] It should also be appreciated that the combinations described herein for treating neurodegenerative disorders can be coadministered with other active agents other than those present in the combinations described herein (e.g., anti -neurodegenerative agents).Regimens for administration of a combination described herein, including the exemplary regimens set forth above, can be modified as necessary to include administration of such active agents. Administration of such active agents, e.g., anti-neurodegenerative agents, can be performed QD, QW, QM, BID, BIW, TIW, Q2W, Q3W, or Q4W, or in accordance with prescribing information for such anti-neurodegenerative agents as set forth, for example, in a package insert.

[0131] The pharmaceutical composition comprising a phosphodiesterase 5 inhibitor and an NMDA-receptor antagonist may provide synergistic effects on inhibition of proinflammatory factors to reduce neuroinflammation. FIG. 1 illustrates the effects of mirodenafil and memantine, alone and in combination, on interleukin 1 beta (IL ip) levels.

[0132] As shown in FIG. 1, treatment with increasing concentrations of mirodenafil or memantine alone resulted in a concentration-dependent reduction in ILip levels. When mirodenafil and memantine were combined, a greater reduction in ILip levels was observed compared to either compound alone at the same concentrations.

[0133] For example, treatment with 2 pM mirodenafil alone resulted in a small reduction in ILip, while 2 pM memantine alone showed a slightly larger effect. However, the combination of 2 pM mirodenafil and 2 pM memantine produced a reduction in ILip levels that was greater than the sum of their individual effects, suggesting a synergistic interaction.

[0134] This synergistic effect became more pronounced at higher concentrations.The combination of 20 pM mirodenafil and 20 pM memantine resulted in the greatest reduction in ILip levels, which was substantially larger than the effects of either compound alone at 20 pM.

[0135] Table 1 provides a quantitative analysis of the synergistic effects observed with combined mirodenafil and memantine treatments on ILip levels.Table 1Ao: Percentage Decrease of ARI 001 treated alone;Bo; Percentage Decrease of Memantine treated alone;A+B: Percentage Decrease of combined treatment of ARI 001 and MemantineSynergistic Effect Evaluation: >1 Synergistic Effect; =1 Additive Effect; <1 Antagonistic Effect

[0136] The data in Table 1 demonstrates that various combinations of mirodenafil and memantine resulted in percentage decreases in ILip that were greater than the sum of their individual effects. For instance, the combination of 20 pM mirodenafil and 20 pM memantine produced a 45.10% decrease in ILip levels, which was higher than the sum of their individual effects.

[0137] In some cases, the synergistic reduction in ILip levels may contribute to the overall anti-inflammatory effects of the pharmaceutical composition. The inhibition of proinflammatory factors such as ILip may play a role in reducing neuroinflammation associated with neurodegenerative disorders.

[0138] The pharmaceutical composition comprising a phosphodiesterase 5 inhibitor and an NMDA-receptor antagonist may also provide synergistic effects on tumor necrosis factor alpha (TNFa) levels. FIG. 2 illustrates the effects of mirodenafil and memantine, alone and in combination, on TNFa reduction percentages.

[0139] As shown in FIG. 2, treatment with increasing concentrations of mirodenafil or memantine alone resulted in a concentration-dependent reduction in TNFa levels. When mirodenafil and memantine were combined, a greater reduction in TNFa levels was observed compared to either compound alone at the same concentrations.

[0140] For example, treatment with 2 pM mirodenafil alone resulted in a smallreduction in TNFa, while 2 pM memantine alone showed a slightly larger effect. However, the combination of 2 pM mirodenafil and 2 pM memantine produced a reduction in TNFa levels that was greater than the sum of their individual effects, suggesting a synergistic interaction.

[0141] This synergistic effect became more pronounced at higher concentrations.The combination of 20 pM mirodenafil and 20 pM memantine resulted in the greatest reduction in TNFa levels, which was substantially larger than the effects of either compound alone at 20 pM.

[0142] Table 2 provides a quantitative analysis of the synergistic effects observed with combined mirodenafil and memantine treatments on TNFa levels.Table 2Ao: Percentage Decrease of ARI 001 treated alone;Bo; Percentage Decrease of Memantine treated alone;A+B: Percentage Decrease of combined treatment of ARI 001 and MemantineSynergistic Effect Evaluation: >1 Synergistic Effect; =1 Additive Effect; <1 Antagonistic Effect

[0143] The data in Table 2 demonstrates that various combinations of mirodenafil and memantine resulted in percentage decreases in TNFa that were greater than the sum of their individual effects. For instance, the combination of 20 pM mirodenafil and 20 pM memantine produced a 41.34% decrease in TNFa levels, which was higher than the sum of their individual effects.

[0144] In some cases, the synergistic reduction in TNFa levels may contribute to the overall anti-inflammatory effects of the pharmaceutical composition. The inhibition of proinflammatory factors such as TNFa may play a role in reducing neuroinflammationassociated with neurodegenerative disorders.

[0145] The data presented in Table 2 also shows that the synergistic effect was observed across various concentration combinations. For example, the combination of 2 pM mirodenafil and 2 pM memantine resulted in a 16.38% decrease in TNFa levels, which was greater than the sum of their individual effects (1.30% for mirodenafil alone and 11.75% for memantine alone).

[0146] In some cases, the synergistic effect may be more pronounced at certain concentration ratios. For instance, the combination of 10 pM mirodenafil and 10 pM memantine showed a synergistic effect value of 1.2, indicating a strong synergistic interaction.

[0147] The dose-dependent nature of the TNFa reduction may allow for flexibility in dosing strategies. In some cases, lower doses of both compounds in combination may achieve similar or greater effects than higher doses of either compound alone, potentially reducing the risk of side effects associated with higher doses of individual compounds.

[0148] The pharmaceutical composition comprising a phosphodiesterase 5 inhibitor and an NMDA-receptor antagonist may provide synergistic effects on reduction of Ap42 accumulation. FIG. 3 illustrates the effects of mirodenafil and memantine, alone and in combination, on Ap42 reduction rates.

[0149] As shown in FIG. 3, treatment with increasing concentrations of mirodenafil or memantine alone resulted in modest reductions in Ap42 levels. However, when mirodenafil and memantine were combined, a greater reduction in Ap42 levels was observed compared to either compound alone at the same concentrations.

[0150] For example, treatment with 0.1 pM mirodenafil alone or 0.1 pM memantine alone resulted in small reductions in Ap42 levels. However, the combination of 0.1 pM mirodenafil and 0.1 pM memantine produced a reduction in Ap42 levels that was greater than the sum of their individual effects, suggesting a synergistic interaction.

[0151] This synergistic effect became more pronounced at higher concentrations. The combination of 0.5 pM mirodenafil and 0.5 pM memantine resulted in the greatest reduction in Ap42 levels, which was substantially larger than the effects of either compound alone at 0.5 pM.

[0152] Table 3 provides a quantitative analysis of the effects observed with combined mirodenafil and memantine treatments on Ap42 levels.Table 3

[0153] The data in Table 3 demonstrates that various combinations of mirodenafil and memantine resulted in percentage decreases in Ap42 that were greater than the effects of individual treatments. For instance, the combination of 0.5 pM mirodenafil and 0.5 pM memantine produced a 23.17% decrease in Ap42 levels, which was higher than the effects of either compound alone at the same concentration.

[0154] In some cases, the synergistic reduction in Ap42 levels may contribute to the overall neuroprotective effects of the pharmaceutical composition. The inhibition of Ap42 accumulation may play a role in preventing or treating neurodegenerative disorders associated with amyloid pathology, such as Alzheimer's disease.

[0155] The data presented in Table 3 also shows that the synergistic effect was observed across various concentration combinations. For example, the combination of 0.1 pM mirodenafil and 0.5 pM memantine resulted in a 15.97% decrease in Ap42 levels, which was greater than the effects of either compound alone at these concentrations.

[0156] In some cases, the synergistic effect may be more pronounced at certain concentration ratios. For instance, the combination of 0.5 pM mirodenafil and 0.5 pM memantine showed the highest reduction rate of 23.17%, indicating a strong synergistic interaction.

[0157] The dose-dependent nature of the Ap42 reduction may allow for flexibility in dosing strategies. In some cases, lower doses of both compounds in combination may achieve similar or greater effects than higher doses of either compound alone, potentially reducing the risk of side effects associated with higher doses of individual compounds.

[0158] In some cases, the pharmaceutical composition comprising a phosphodiesterase 5 inhibitor and an NMDA-receptor antagonist may exert its therapeutic effects through multiple mechanisms of action. These mechanisms may contribute to the prevention or treatment of neurodegenerative disorders.

[0159] The pharmaceutical composition may inhibit the growth and differentiation of nerve cells that are associated with degenerating learning and memory processes. This inhibition may lead to a decrease in intracellular amyloid beta (AP) levels. The reduction in intracellular Ap may result in increased protection of nerve cells and enhanced synaptic plasticity.

[0160] In some cases, the phosphodiesterase 5 inhibitor component of the composition may modulate cyclic guanosine monophosphate (cGMP) signaling pathways. This modulation may lead to improved cerebral blood flow and reduced inflammation in the central nervous system. The enhanced blood flow may contribute to better clearance of toxic proteins, such as Ap, from the brain.

[0161] The NMDA-receptor antagonist component of the composition may help regulate glutamate signaling in the brain. Excessive glutamate signaling has been associated with exci totoxi city and neuronal death in various neurodegenerative disorders. By modulating NMDA receptor activity, the composition may help protect neurons from excitotoxic damage.

[0162] In some cases, the combination of a phosphodiesterase 5 inhibitor and an NMDA-receptor antagonist may synergistically enhance neuroprotective effects. This synergy may result in more effective prevention or treatment of neurodegenerative disorders compared to either component alone.

[0163] The pharmaceutical composition may have therapeutic applications in various neurodegenerative disorders. In some cases, the composition may be used for the prevention or treatment of Alzheimer's disease. The ability of the composition to reduce Ap accumulation and enhance synaptic plasticity may be particularly beneficial in addressing the pathological hallmarks of Alzheimer's disease.

[0164] In other cases, the composition may be applied to the treatment of Parkinson's disease. The neuroprotective effects of the composition, particularly its ability to modulate inflammation and protect against excitotoxicity, may help slow the progression of dopaminergic neuron loss characteristic of Parkinson's disease.

[0165] The pharmaceutical composition may also have potential applications in other neurodegenerative conditions such as Huntington's disease, amyotrophic lateral sclerosis (ALS), and multiple sclerosis. The broad neuroprotective mechanisms of the composition may provide benefits across various neurodegenerative pathologies.

[0166] In some cases, the composition may be used as a preventive measure in individuals at high risk for neurodegenerative disorders. The ability of the composition toenhance synaptic plasticity and protect against neuronal damage may help maintain cognitive function and delay the onset of neurodegenerative symptoms in susceptible individuals.

[0167] The therapeutic applications of the pharmaceutical composition may extend beyond neurodegenerative disorders. In some cases, the composition may have potential benefits in other neurological conditions characterized by inflammation or synaptic dysfunction, such as traumatic brain injury or stroke.

[0168] A number of implementations have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the disclosure. Accordingly, other implementations are within the scope of the following claims.

[0169] EXAMPLES

[0170] Hereafter, a more detailed description will be made using the below embodiments. However, these embodiments are only for illustrating the present invention, and the scope of the present invention is not limited by these embodiments.

[0171] Experimental Example 1. Culture method of IMG cells

[0172] The IMG cells, a mouse microglia cell line used in the experiments, were cultured, and maintained in DMEM complete medium (HyClone) containing 10% fetal bovine serum (FBS; Australian Orgin, HyClone, Logan, UT, USA) and 1% penicillin / streptomycin (P / S; HyClone) at 37°C with 5% CO 2in a humidified CO 2incubator (311-TIF, Thermo Fisher Scientific Forma, MA, USA). Total 2^ 105cells were seeded in each well of the 6-well plate and they were incubated for 24 hours in the humidified CO 2incubator as mentioned above. Further, 100 pM of glutamate and the drugs, ARI 001 and NMD A receptor antagonist (Memantine), were treated in the concentration of 2, 10, 20 pM individually or in combination.

[0173] Experimental Example 2. RNA Extraction and cDNA Synthesis

[0174] The cells were scraped using a cell scraper, and 2 mL of the culture solution was collected in a 15 mL conical tube. It was centrifuged at 3,000 RPM for 5 minutes and the supernatant (culture solution) was discarded. The pellet was resuspended in 1 mL of Trizol, and it was transferred to 1.5 mL microfuge tube. Further, 0.2 mL of chloroform was added, and it was vortexed for 1 minutes. The microfuge tube was kept in a stand for 2 min at room temperature. After centrifugation at 12,000 x g for 10 minutes at 4 °C, the supernatant(approx. 500 pL) separated in a fresh microfuge tube. Equal volume of isopropanol was added to the supernatant and mixed the solution well. It was put in the microfuge tube stand for 10 minutes at room temperature and thereafter, centrifuged at 12,000 * g for 10 minutes at 4 °C. The supernatant was discarded, and the pellet was washed twice with 75% ethanol. The RNA pellet was dried and dissolved in 10 pL DEPC treated water. After quantification of the RNA, it was converted to cDNA following the PrimeScript™ II 1st strand cDNA Synthesis Kit (Takara) protocol.

[0175] Experimental Example 3. Real Time RT-qPCR of pro-inflammatory cytokines

[0176] The sample cDNAs were amplified with gene specific primers and SYBR green PCR master mix (ThermoFisher) in the model Quant Studio 5 Thermal cycler (Applied biosystems). The amplification conditions were as follows - polymerase activation at 50°C for 2 minutes, predenaturation preceding at 95°C for 10 minutes, total 40 cycles of denaturation at 95°C for 15 seconds, annealing at 60°C for 30 seconds and extension at 72°C for 30 seconds. The specific primer sequences are mentioned in Table 4.Table 4: Primer sequences for Real Time RT-PCRGene name Primer sequenceIL 1 p Forward 5 ’ - AGCTTC AGGC AGGC AGT ATC -3 ’ (SEQ ID NO : 1 )Reverse 5’- AAGGTCCACGGGAAAGACAC -3’ (SEQ ID NO: 2)TNFa Forward 5’- AAATGGCCTCCCTCTCATCAG -3’ (SEQ ID NO: 3) Reverse 5’ - GTCACTCGAATTTTGAGAAGATGATC -3’ (SEQ ID NO: 4) p actin Forward 5 ’ - CGTGCGTGAC ATC AAAGAGAA-3 ’ (SEQ ID NO : 5)Reverse 5’ - TGGATGCCACAGGATTCCAT-3’ (SEQ ID NO: 6)

[0177] Experimental Example 4. Measurement of pro-inflammatory cytokines level.

[0178] FIG. 1 shows the synergistic effect on IL-ip in the present invention of the combined treatment of mirodenafil and memantine. Here, AR1001 refers to the mirodenafil.

[0179] In Table 1, the IL-ip reduction rate for the combined treatment of 2 pM of mirodenafil and 2 pM of memantine was 6.11%; for the combination of 2 pM of mirodenafil and 10 pM of memantine, the reduction rate was 14.70%; for 2 pM of mirodenafil and 20 pM of memantine combination, the reduction rate was 30.48%; for 10 pM of mirodenafil and 2pM of memantine combination, the reduction rate was 16.99%; for 10 pM of mirodenafil and 10 pM of memantine combination, the reduction rate was 27.47%; for 10 pM of mirodenafil and 20 pM of memantine combination, the reduction rate was 40.56%; for 20 pM of mirodenafil and 2 pM of memantine combination, the reduction rate was 28.35%; for 20 pM of mirodenafil and 10 pM of memantine combination, the IL-ip reduction rate was 39.11%; and for the combined treatment of 20 pM of mirodenafil and 20 pM of memantine, the IL-ip reduction rate was 45.10%. The reduction rates of the different combinations were significantly higher than the sum of individual reduction rates observed when treated with mirodenafil or memantine alone, which confirmed the synergistic effect beyond the additive effect.

[0180] FIG. 2 shows the synergistic effect on TNF-a in the present invention of the combined treatment of mirodenafil and memantine. Here, AR1001 refers to the mirodenafil.

[0181] In Table 2, the TNF-a reduction rate for a combined treatment of 2 pM of mirodenafil and 2 pM of memantine was 16.38%; for the combination of 2 pM of mirodenafil and 10 pM of memantine, the reduction rate was 24.26%; for the combination of 2 pM of mirodenafil and 20 pM of memantine, the reduction rate was 28.51%; for 10 pM of mirodenafil and 2 pM of memantine combination, the reduction rate was 21.22%; for 10 pM of mirodenafil and 10 pM of memantine combination, the reduction rate was 29.86%; for 10 pM of mirodenafil and 20 pM of memantine combination, the reduction rate was 32.53%; for 20 pM of mirodenafil and 2 pM of memantine combination, the reduction rate was 34.58%; for 20 pM of mirodenafil and 10 pM of memantine combination, the reduction rate was 39.26%; and for a combined treatment of 20 pM of mirodenafil and 20 pM of memantine, the reduction rate was 41.34%. The reduction rates of the different combinations were significantly higher than the sum of individual reduction rates observed when treated with mirodenafil or memantine alone, which confirmed the synergistic effect beyond the additive effect.

[0182] Experimental Example 5. Cell culture

[0183] The SH-SY5Y human neuroblastoma cell line used in the experiment was purchased from American Type Culture Collection (ATCC; Manassas, VA, USA), and it was cultured in a CO 2incubator (311-TIF, Thermo Fisher Scientific Forma, MA, USA) under the conditions of 37°C and 5% CO2 using a DMEM / F12 Complete Medium (HyClone) containing 10% fetal bovine serum (FBS; Australian Orgin, HyClone, Logan, UT, USA) and 1% penicillin / streptomycin (P / S; HyClone).

[0184] Experimental Example 6. Neuron-like differentiation of SH-SY5Y cells using all-trans-retinoic acid (RA)

[0185] 2x 104cells / well were dispensed into a 96-well plate to evaluate cytotoxicity, and 2x 105cells were dispensed into a T-25 flask to check neuronal cell death, neuronal inflammatory response, protein expression changes related to neurotransmitters and synaptic plasticity, and activity of acetylcholinesterase (AChE) activity. For cell fixation and stabilization, a DMEM / F12 Complete Medium (HyClone) containing 10% FBS (HyClone) and 1% P / S (HyClone) was used to culture for 24 hours in a CO 2incubator (Thermo Fisher Scientific Forma) under the conditions of 37°C and 5% CO 2. 24 hours after cell dispensing, the cell culture medium was removed for neuron-like differentiation and replaced with a DMEM / F12 differentiation medium containing 1% FBS (HyClone), 1% P / S (HyClone), and 10 pM all-trans-retinoic acid (RA; Sigma-Aldrich, St. Louis, MO, USA). On the third day of differentiation, the medium was replaced with a new DMEM / F12 differentiation medium. On the sixth day of differentiation, the medium for the untreated control group was replaced with a new DMEM / F12 differentiation medium, and the sample treated group was replaced by adding a new DMEM / F12 differentiation medium under various conditions.

[0186] Experimental Example 7. Formation and treatment of Amyloid P(AP)1- 42

[0187] To form Api-42 oligomers, human Api-42 (Abeam, Cambridge, MA, USA) was added to a DMEM / F12 Complete Medium (HyClone) containing 1% FBS (HyClone) and 1% P / S (HyClone) to make 10 pM and left for three hours in a CO 2incubator (Thermo Fisher Scientific Forma) under the conditions of 37°C and 5% CO 2to form Api-42 oligomers.

[0188] To check the BDNF change, the existing cell culture medium was removed from the RA-differentiated SH-SY5Y neuron-like cell, and replaced with a DMEM / F12 Complete Medium (HyClone) containing Api-42 oligomers (1 pM), and cultured for 72 hours in a CO 2incubator (Thermo Fisher Scientific Forma) under the conditions of 37°C and 5% CO 2to induce Api-42 oligomer-induced cell damage.

[0189] After 72 hours, the culture medium was removed, and then the DMEM / F12 Complete Medium (HyClone) containing Api-42 oligomers (1 pM or 10 pM) was treated alone or in combination with mirodenafil and memantine and cultured for 24 hours in a CO 2incubator (Thermo Fisher Scientific Forma) under the conditions of 37°C and 5% CO 2, andthen the experiment was carried out.

[0190] Experimental Example 8. Measurement of amyloid P (A )42 by Human ELISA (enzyme-linked immunosorbent assay) kit

[0191] To measure the amount (pg / mL) of Ap42, 50 pL of cell culture media were placed into a 96 well plate. Further, 50 pL of Hu Ap42 detection antibody solution was added in each well, and it was incubated for 3 hours at room temperature on orbital shaker. The solution was discarded, it was washed with 1 x wash buffer, 100 pL of anti-rabbit IgG HRP antibody was added to it, and it was incubated for 30 min at room temperature. The solution was discarded entirely again, it was washed with l x wash buffer, 100 pL of stabilized chromogen was added to it, and it was incubated for 30 min at room temperature in a dark room. Finally, 100 pL of stop solution was added to it and absorbance was measured at 450 nm within 2 hours.

[0192] Examples 5 to 8

[0193] In FIG. 3, embodiment 1 is a combined treatment of 0.1 pM of mirodenafil and 0.1 pM of memantine, embodiment 2 is a combined treatment of 0.5 pM of mirodenafil and 0.1 pM of memantine, and embodiment 3 is a combined treatment of 0.5 pM of mirodenafil and 0.5 pM of memantine. For reference, ARI 001 in Table 3 refers to mirodenafil.

[0194] Comparative Examples 1 to 4

[0195] In FIG. 3, comparative examples 1 and 2 are treatments with 0.1 pM and 0.5 pM of mirodenafil alone, and comparative examples 3 and 4 are treatments with 0.1 pM and 0.5 pM of memantine alone.

[0196] The results indicate that the Ap reduction rate of 15.97% in embodiment 1 for a combined treatment of 0.1 pM of mirodenafil and 0.5 pM of memantine; the Ap reduction rate of 13.15% in embodiment 2 for a combined treatment of 0.5 pM of mirodenafil and 0.1 pM of memantine; and the Ap reduction rate of 23.18% in embodiment 3 for a combined treatment of 0.5 pM of mirodenafil and 0.5 pM of memantine were significantly higher than the sum of the reduction rates A and B for treatment of mirodenafil or memantine alone, which confirmed that an effect beyond the additive effect can be recognized.

[0197] In other words, referring to the Ap reduction rates of comparative examples 1 and 2 for treatments with 0.1 pM and 0.5 pM of mirodenafil alone as Al and A2,respectively, and referring to the Ap reduction rates of comparative examples 3 and 4 for treatments with 0.1 pM and 0.5 pM of memantine alone as Bl and B2, respectively, it can be seen that the Ap reduction rate of 15.97% in embodiment 1 is significantly higher than ‘A1+B2 = -0.18%’, the Ap reduction rate of 15.97% in embodiment 2 is significantly higher than ‘A2+B1 = -1.63%’, and the Ap reduction rate of 15.97% in embodiment 3 is significantly higher than ‘A2+B2 = -1.72%’.

[0198] The present invention described above is merely illustrative and a person skilled in the art to which the present invention appertains will understand that various modifications and other equivalent embodiments are possible therefrom. Therefore, it will be understood that the present invention is not limited to the form mentioned in the detailed description above. Therefore, the true scope of the technical protection of the present invention should be determined by the technical idea of the appended scope of claims. In addition, it is to be understood that the present invention covers all modifications, equivalents, and substitutions within the spirit and scope of the present invention defined by the appended scope of claims.

[0199] Other Embodiments

[0200] The detailed description set-forth above is provided to aid those skilled in the art in practicing the present invention. However, the invention described and claimed herein is not to be limited in scope by the specific embodiments herein disclosed because these embodiments are intended as illustration of several aspects of the invention. Any equivalent embodiments are intended to be within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description which do not depart from the spirit or scope of the present inventive discovery. Such modifications are also intended to fall within the scope of the appended claims.

[0201] References Cited

[0202] All publications, patents, patent applications and other references cited in this application are incorporated herein by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application or other reference was specifically and individually indicated to be incorporated by reference in its entirety for all purposes. Citation of a reference herein shall not be construed as an admission that such is prior art to the present invention.

Claims

CLAIMSWhat is claimed is:

1. A pharmaceutical formulation for preventing or treating a neurodegenerative disorder, comprising: a therapeutically effective amount of mirodenafil; a therapeutically effective amount of an N-methyl-D-aspartate-receptor (NMDA- receptor) antagonist; and a pharmaceutically acceptable carrier, wherein the formulation is configured for oral administration.

2. The pharmaceutical formulation of claim 1, wherein the NMDA-receptor antagonist is selected from the group consisting of memantine, amantadine, ketamine, traxoprodil, lanicemine, rislenemdaz, pethidine, levorphanol, methadone, dextropropoxyphene, tramadol, ketobemidone, dextromethorphan (DXM), phencyclidine (PCP), methoxetamine (MXE), and pharmaceutically acceptable salts, solvates, hydrates, derivatives, and mixtures thereof.

3. The pharmaceutical formulation of claim 2, wherein the NMDA-receptor antagonist is memantine or pharmaceutically acceptable salts, solvates, derivatives, or hydrates thereof.

4. The pharmaceutical formulation of claim 3, wherein the molar ratio of mirodenafil to memantine is from 1 :0.1 to 1 : 10.

5. A pharmaceutical composition comprising: mirodenafil; and at least one NMDA-receptor antagonist, or pharmaceutically acceptable salts, solvates, derivatives, or hydrates of both the mirodenafil or NMD A-receptor antagonist.

6. The pharmaceutical composition of claim 5, wherein the NMDA-receptor antagonist is selected from the group consisting of memantine, amantadine, ketamine, traxoprodil, lanicemine, rislenemdaz, pethidine, levorphanol, methadone, dextropropoxyphene, tramadol, ketobemidone, dextromethorphan (DXM), phencyclidine (PCP), methoxetamine (MXE), and pharmaceutically acceptable salts, solvates, hydrates, derivatives, and mixtures thereof.

7. The pharmaceutical composition of claim 5, wherein the NMDA-receptor antagonist is memantine or pharmaceutically acceptable salts, solvates, derivatives, or hydrates thereof.

8. The pharmaceutical composition of claim 7, wherein the molar ratio of mirodenafil to memantine is from about 1 :0.1 to about 1 : 10.

9. The pharmaceutical composition of claim 5, wherein the molar ratio of mirodenafil to the NMDA-receptor antagonist is selected from the group consisting of 50: 1, 10: 1, 5: 1, 2: 1, 1 : 1, 1 :2, 1 :5, and 1 : 10.

10. A method for treating a neurodegenerative disorder, comprising: administering to a subject in need thereof an effective amount of a pharmaceutical composition comprising mirodenafil and at least one NMDA-receptor antagonist.

11. The method of claim 10, wherein the NMDA-receptor antagonist is selected from the group consisting of memantine, amantadine, ketamine, traxoprodil, lanicemine, rislenemdaz, pethidine, levorphanol, methadone, dextropropoxyphene, tramadol, ketobemidone, dextromethorphan (DXM), phencyclidine (PCP), methoxetamine (MXE), pharmaceutically acceptable salts, solvates, hydrates, derivatives, and mixtures thereof.

12. The method of claim 10, wherein the NMDA-receptor antagonist is memantine.

13. The method of claim 12, wherein the weight ratio of mirodenafil to memantine is from 1 :0.1 to 1: 10.

14. The method of claim 10, wherein the molar ratio of mirodenafil to the memantine is selected from the group consisting of 50: 1, 10: 1, 5: 1, 2: 1, 1 :1, 1 :2, 1 :5, and 1 : 10.

15. The method of claim 10, wherein the neurodegenerative disorder is selected from the group consisting of dementia, Parkinson's disease (PD), Parkinson’s disease dementia, Dementia with Lewy body (DLB), Alzheimer's disease (AD), Huntington's disease (HD), Multiple sclerosis (MS), Vascular Dementia (VaD), Amyotrophic Lateral Sclerosis (ALS), Down’s syndrome dementia, frontotemporal dementia, and mixed etiologies thereof.

16. The method of claim 10, wherein the composition is administered to the subject via a route selected from the group consisting of oral, mucosal, topical, suppository, intravenous, parenteral, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal, inhalation and subcutaneous administration.

17. The method of claim 10, wherein administering the pharmaceutical composition results in a synergistic reduction of at least one of interleukin 1 beta (ILip), tumor necrosis factor alpha (TNFa), or amyloid beta (AP) levels in the subject.

18. A method for reducing neuroinflammation, comprising: administering to a subject in need thereof an effective amount of a pharmaceuticalcomposition comprising mirodenafil and at least one NMDA-receptor antagonist.

19. The method of claim 18, wherein the NMDA-receptor antagonist is selected from the group consisting of memantine, amantadine, ketamine, traxoprodil, lanicemine, rislenemdaz, pethidine, levorphanol, methadone, dextropropoxyphene, tramadol, ketobemidone, dextromethorphan (DXM), phencyclidine (PCP), methoxetamine (MXE), pharmaceutically acceptable salts, solvates, hydrates, derivatives, and mixtures thereof.

20. The method of claim 18, wherein the NMDA-receptor antagonist is memantine or pharmaceutically acceptable salts, solvates, derivatives, or hydrates thereof.

21. The method of claim 20, wherein the molar ratio of mirodenafil to memantine is from 1 :0.1 to 1: 10.

22. The method of claim 18, wherein the molar ratio of mirodenafil to the memantine is selected from the group consisting of 50: 1, 10: 1, 5: 1, 2: 1, 1 :1, 1 :2, 1 :5, and 1 : 10.

23. The method of claim 18, wherein administering the pharmaceutical composition results in a synergistic reduction of at least one of interleukin 1 beta (ILip), tumor necrosis factor alpha (TNFa), or amyloid beta (AP) levels in the subject.

24. The method of claim 18, wherein the composition is administered to the subject via a route selected from the group consisting of oral, mucosal, topical, suppository, intravenous, parenteral, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal, inhalation and subcutaneous administration.

25. A pharmaceutical composition comprising: at least one phosphodiesterase 5 inhibitor; and at least one NMDA-receptor, or pharmaceutically acceptable salts, solvates, derivatives, hydrates of said phosphodiesterase 5 inhibitor and said NMDA-receptor.

26. The pharmaceutical composition of claim 25, wherein the phosphodiesterase 5 inhibitor comprises mirodenafil, sildenafil, vardenafil, tadalafil, udenafil, dasantafil, avanafil, and pharmaceutically acceptable salts, solvates, hydrates, derivatives, and mixtures thereof.

27. The pharmaceutical composition of claim 25, wherein the NMDA-receptor antagonist comprises memantine, amantadine, ketamine, traxoprodil, lanicemine, rislenemdaz, pethidine, levorphanol, methadone, dextropropoxyphene, tramadol, ketobemidone, dextromethorphan (DXM), phencyclidine (PCP), and methoxetamine (MXE), pharmaceutically acceptable salts, solvates, hydrates, derivatives, and mixtures thereof.

28. The pharmaceutical composition of claim 25, wherein the phosphodiesterase 5 inhibitor is mirodenafil.

29. A method for preventing and / or treating dementia, comprising administering an effective amount of the pharmaceutical composition of claim 25.

30. A method for preventing or treating neuroinflammation comprising: administering an effective amount of the pharmaceutical composition of claim 25.

31. A method for preventing or inhibiting formation and / or accumulation of betaamyloid comprising: administering an effective amount of the pharmaceutical composition of claim 25.

32. A method for preventing or treating a neurodeg enerative disorder comprising: administering an effective amount of the pharmaceutical composition of claim 25.

33. The method of claim 32, wherein the neurodegenerative disorder is dementia, Parkinson's disease (PD), Parkinson’s disease dementia, Dementia with Lewy body (DLB), Alzheimer's disease (AD), Huntington's disease (HD), Multiple sclerosis (MS), Vascular Dementia (VaD), Amyotrophic Lateral Sclerosis (ALS), Down’s syndrome dementia, frontotemporal dementia, or mixed etiologies thereof.

34. A method for inhibiting Ap Oligomer / Fibril formation by reducing of Ap aggregation comprising: administering an effective amount of the pharmaceutical composition of claim 25.

35. A method for inhibiting P-Amyloidogenic processing by reducing B ACE- 1 comprising: administering an effective amount of the pharmaceutical composition of claim 25.

36. A method for reducing extracellular Ap monomers, oligomers & Ap Fibril / Plaque by increasing cerebral blood flow comprising: administering an effective amount of the pharmaceutical composition of claim 25.

37. A method for suppressing neuronal cell death, promoting neurogenesis, synaptogenesis and / or angiogenesis by activating NO / cGMP / PKG / CREB Pathway comprising: administering an effective amount of the pharmaceutical composition of claim 25.

38. A method for restoring synaptic plasticity by activating Wint Signaling and / or inhibiting DKK-1 comprising: administering an effective amount of the pharmaceutical composition of claim 25.

39. A method for inhibiting production of APP and / or reducing Ap accumulation by suppressing positive feedback loop for Ap production comprising: administering an effective amount of the pharmaceutical composition of claim 25.

40. A method for inhibiting formation of Ap Fibril / plaque by removal ofintracellular toxic and soluble Ap oligomers by activating autophagy comprising: administering an effective amount of the pharmaceutical composition of claim 25.

41. A pharmaceutical composition comprising: mirodenafil and memantine, and pharmaceutically acceptable salts, solvates, derivatives, or hydrates thereof.

42. A method for preventing and / or treating dementia, comprising administering an effective amount of the pharmaceutical composition of claim 41.

43. A method for preventing or treating neuroinflammation comprising: administering an effective amount of the pharmaceutical composition of claim 41.

44. A method for preventing or inhibiting formation and / or accumulation of betaamyloid comprising: administering an effective amount of the pharmaceutical composition of claim 41.

45. A method for preventing or treating a neurodegenerative disorder comprising: administering an effective amount of the pharmaceutical composition of claim 41.

46. The method of claim 45, wherein the neurodegenerative disorder is dementia, Parkinson's disease (PD), Parkinson’s disease dementia, Dementia with Lewy body (DLB), Alzheimer's disease (AD), Huntington's disease (HD), Multiple sclerosis (MS), Vascular Dementia (VaD), Amyotrophic Lateral Sclerosis (ALS), Down’s syndrome dementia, frontotemporal dementia, or mixed etiologies thereof.

47. The method of claim 45, wherein the composition is administered to the subject via a route selected from the group consisting of oral, mucosal, topical, suppository, intravenous, parenteral, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal, inhalation and subcutaneous administration.

48. A method for inhibiting Ap Oligomer / Fibril formation by reducing Ap aggregation comprising: administering an effective amount of the pharmaceutical composition of claim 41.

49. method for inhibiting P-Amyloidogenic processing by reducing BACE-1 comprising: administering an effective amount of the pharmaceutical composition of claim 41.

50. A method for reducing extracellular Ap monomers, oligomers & Ap Fibril / Plaque by increasing the cerebral blood flow comprising: administering an effective amount of the pharmaceutical composition of claim 41.

51. A method for suppressing neuronal cell death, promoting neurogenesis, synaptogenesis and / or angiogenesis by activating NO / cGMP / PKG / CREB Pathwaycomprising: administering an effective amount of the pharmaceutical composition of claim 41.

52. A method for restoring synaptic plasticity by activating Wint Signaling and / or inhibiting DKK-1 comprising: administering an effective amount of the pharmaceutical composition of claim 41.

53. A method for inhibiting production of APP and / or reducing Ap accumulation by suppressing positive feedback loop for Ap production comprising: administering an effective amount of the pharmaceutical composition of claim 41.

54. A method for inhibiting formation of Ap Fibril / plaque by removal of intracellular toxic and soluble Ap oligomers by activating autophagy comprising: administering an effective amount of the pharmaceutical composition of claim 25.

Citation Information

Patent Citations

  • Composition for preventing and treating dementia

    KR102272907B1

  • Composition for preventing and treating neurodegenerative diseases

    WO2024003784A1