Compositions and methods for treating neurodegenerative disorders

Abstract

The present disclosure provides a pharmaceutical composition comprising at least one phosphodiesterase 5 inhibitor and at least one acetylcholinesterase inhibitor. The phosphodiesterase 5 inhibitor and the acetylcholinesterase inhibitor are present in a synergistic ratio effective to reduce levels of proinflammatory cytokines and amyloid beta in a subject. The composition can be used in methods for treating neurodegenerative disorders and reducing neuroinflammation by administering an effective amount to a subject in need thereof. The phosphodiesterase 5 inhibitor may be selected from mirodenafil, sildenafil, vardenafil, tadalafil, udenafil, dasantafil, and avanafil. The acetylcholinesterase inhibitor may be selected from donepezil, rivastigmine, and galantamine. The synergistic ratio of the inhibitors can range from 1:0.1 to 1:10.

Description

COMPOSITIONS AND METHODS FOR TREATING NEURODEGENERATIVEDISORDERSCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority from Korean Provisional Application Serial No. KR 10-2023-0190299 filed on December 22, 2023, which is incorporated herein by reference in its entirety.INCORPORATION-B Y-REFERENCE OF SEQUENCE LISTING

[0002] The Sequence Listing, which is a part of the present disclosure, includes a computer readable sequence listing comprising nucleotide and / or amino acid sequences of the present invention. The subject matter of the Sequence Listing is incorporated herein by reference in its entirety.FIELD

[0003] The present disclosure relates to compositions and methods for treating neurodegenerative disorders, and more particularly to pharmaceutical compositions comprising a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor for preventing or treating neurodegenerative disorders.INTRODUCTION

[0004] Neurodegenerative disorders are a group of disorders characterized by progressive loss of structure or function of neurons, including death of neurons. These diseases, which include conditions such as Alzheimer's disease, Parkinson's disease, Huntington's disease, and multiple sclerosis, pose significant challenges to public health systems worldwide due to their increasing prevalence in aging populations.

[0005] The pathophysiology of neurodegenerative disorders is complex and multifaceted, often involving a combination of genetic, environmental, and lifestyle factors. Common mechanisms underlying these disorders include protein aggregation, oxidative stress, mitochondrial dysfunction, and neuroinflammation. As neurons degenerate, patients experience a range of symptoms that can affect cognitive function, motor control, and behavior, leading to a significant decrease in quality of life.

[0006] Current therapeutic approaches for neurodegenerative disorders are primarilyfocused on managing symptoms and slowing disease progression. However, these treatments often have limited efficacy and may be associated with significant side effects. There is a pressing need for novel therapeutic strategies that can address the underlying mechanisms of neurodegeneration and potentially modify the course of these diseases.

[0007] Research in the field of neurodegenerative disorders has highlighted the importance of various signaling pathways and molecular targets in neuronal health and survival. Among these, the roles of neurotransmitter systems and intracellular signaling cascades have garnered significant attention. Modulation of these pathways presents potential opportunities for therapeutic intervention.

[0008] Despite advances in our understanding of neurodegenerative processes, the development of effective treatments remains challenging. Many promising drug candidates have failed in clinical trials, underscoring the complexity of these disorders and the need for innovative approaches. There is growing interest in combination therapies that target multiple aspects of disease pathology simultaneously, as well as in repurposing existing drugs for new indications in neurodegenerative disorders.

[0009] As the global burden of neurodegenerative disorders continues to rise, there is an urgent need for improved therapeutic options. Addressing this challenge requires ongoing research into disease mechanisms, identification of novel drug targets, and development of more effective and well-tolerated treatments. The pursuit of new approaches to prevent, treat, and potentially reverse neurodegenerative processes remains a critical area of focus in biomedical research and pharmaceutical development.SUMMARY

[0010] This summary is provided to introduce a selection of concepts in a simplified form that are further described below in the detailed description. This summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended to be used as an aid in determining the scope of the claimed subject matter.

[0011] According to an aspect of the present disclosure, a pharmaceutical composition is provided. The pharmaceutical composition includes at least one phosphodiesterase 5 inhibitor and at least one acetylcholinesterase inhibitor as active ingredients, and pharmaceutically acceptable salts, solvates, hydrates of said phosphodiesterase 5 inhibitor and said acetylcholinesterase inhibitor.

[0012] According to other aspects of the present disclosure, the pharmaceutical composition may include one or more of the following features. The phosphodiesterase 5inhibitor may comprise mirodenafil, sildenafil, vardenafil, tadalafil, udenafil, dasantafil, avanafil, and derivatives and mixtures thereof. The phosphodiesterase 5 inhibitor may be mirodanafil and derivatives thereof. The acetylcholinesterase inhibitor may comprise donepezil, rivastigmine, galantamine, physostigmine, tacrine, metrifonate, phenserine, tolserine, eseroline, huperizine A and B, galangin, cardanol, donepezil-AP2238, donepezil- tacrine, tacrine-ferulic acid hybrid, tacrine-hydroxyquinoline, ladostigil, indenyl derivatives, and mixtures thereof.

[0013] According to another aspect of the present disclosure, a method for preventing or treating neuroinflammation is provided. The method includes administering an effective amount of a pharmaceutical composition comprising the composition described above.

[0014] According to another aspect of the present disclosure, a method for prevention or inhibiting formation and / or accumulation of beta-amyloid is provided. The method includes administering an effective amount of a pharmaceutical composition comprising the composition described above.

[0015] According to another aspect of the present disclosure, a method for preventing or treating a neurodegenerative disorder is provided. The method includes administering an effective amount of a pharmaceutical composition comprising the composition described above.

[0016] According to other aspects of the present disclosure, the method may include one or more of the following features. The neurodegenerative disorder may comprise dementia, Parkinson's disease (PD), Parkinson’s disease dementia, Dementia with Lewy body (DLB), Alzheimer's disease (AD), Huntington's disease (HD), Multiple sclerosis (MS), Vascular Dementia (VaD), Amyotrophic Lateral Sclerosis (ALS), Down’s syndrome dementia, frontotemporal dementia, or mixed etiologies thereof.

[0017] According to another aspect of the present disclosure, a method for inhibiting Ap Oligomer / Fibril formation by reducing Ap aggregation is provided. The method includes administering an effective amount of a pharmaceutical composition comprising the composition described above.

[0018] According to another aspect of the present disclosure, a method for inhibiting P-Amyloidogenic processing by reducing BACE-1 is provided. The method includes administering an effective amount of a pharmaceutical composition comprising the composition described above.

[0019] According to another aspect of the present disclosure, a method for reducingextracellular Ap monomers, oligomers & Ap Fibril / Plaque by increasing the cerebral blood flow is provided. The method includes administering an effective amount of a pharmaceutical composition comprising the composition described above.

[0020] According to another aspect of the present disclosure, a method for suppressing neuronal cell death, promoting neurogenesis, synaptogenesis and / or angiogenesis by activating NO / cGMP / PKG / CREB Pathway is provided. The method includes administering an effective amount of a pharmaceutical composition comprising the composition described above.

[0021] According to another aspect of the present disclosure, a method for suppressing neuronal cell death, promotion of neurogenesis, synaptogenesis and / or angiogenesis by activating NO / cGMP / PKG / CREB Pathway is provided. The method includes administering an effective amount of a pharmaceutical composition comprising the composition described above.

[0022] According to another aspect of the present disclosure, a method for inhibiting production of APP and reducing Ap accumulation by suppressing positive feedback loop for Ap production is provided. The method includes administering an effective amount of a pharmaceutical composition comprising the composition described above.

[0023] According to another aspect of the present disclosure, a method for inhibiting formation of Ap Fibril / plaque by removal of intracellular toxic and soluble Ap oligomers by activating autophagy is provided. The method includes administering an effective amount of a pharmaceutical composition comprising the composition described above.

[0024] According to another aspect of the present disclosure, a composition for preventing and / or treating dementia is provided. The composition includes mirodenafil, or pharmaceutically acceptable salts, solvates, hydrates, derivatives thereof; and at least one of donepezil, galantamine, rivastigmine, or pharmaceutically acceptable salts, solvates, hydrates, derivatives, and / or mixtures thereof.

[0025] According to another aspect of the present disclosure, a method for preventing or treating neuroinflammation is provided. The method includes administering an effective amount of a pharmaceutical composition comprising the composition described above.

[0026] According to another aspect of the present disclosure, a method for prevention or inhibiting formation and / or accumulation of beta-amyloid is provided. The method includes administering an effective amount of a pharmaceutical compositioncomprising the composition described above.

[0027] According to another aspect of the present disclosure, a method for preventing or treating a neurodegenerative disorder is provided. The method includes administering an effective amount of a pharmaceutical composition comprising the composition described above.

[0028] According to other aspects of the present disclosure, the method may include one or more of the following features. The neurodegenerative disorder may comprise dementia, Parkinson's disease (PD), Parkinson’s disease dementia, Dementia with Lewy body (DLB), Alzheimer's disease (AD), Huntington's disease (HD), Multiple sclerosis (MS), Vascular Dementia (VaD), Amyotrophic Lateral Sclerosis (ALS), Down’s syndrome dementia, frontotemporal dementia, or mixed etiologies thereof.

[0029] According to another aspect of the present disclosure, a method for inhibiting Ap Oligomer / Fibril formation by reducing Ap aggregation is provided. The method includes administering an effective amount of a pharmaceutical composition comprising the composition described above.

[0030] According to another aspect of the present disclosure, a method for inhibiting P-Amyloidogenic processing by reducing BACE-1 is provided. The method includes administering an effective amount of a pharmaceutical composition comprising the composition described above.

[0031] According to another aspect of the present disclosure, a method for reducing extracellular Ap monomers, oligomers and Ap Fibril / Plaque by increasing the cerebral blood flow is provided. The method includes administering an effective amount of a pharmaceutical composition comprising the composition described above.

[0032] According to another aspect of the present disclosure, a method for suppressing neuronal cell death, promoting neurogenesis, synaptogenesis and / or angiogenesis by activating NO / cGMP / PKG / CREB Pathway is provided. The method includes administering an effective amount of a pharmaceutical composition comprising the composition described above.

[0033] According to another aspect of the present disclosure, a method for suppressing neuronal cell death, promoting neurogenesis, synaptogenesis and / or angiogenesis by activating NO / cGMP / PKG / CREB Pathway is provided. The method includes administering an effective amount of a pharmaceutical composition comprising the composition described above.

[0034] According to another aspect of the present disclosure, a method forinhibiting the production of APP and reducing Ap accumulation by suppressing positive feedback loop for Ap production is provided. The method includes administering an effective amount of a pharmaceutical composition comprising the composition described above.

[0035] According to another aspect of the present disclosure, a method for inhibiting formation of Ap Fibril / plaque by removal of intracellular toxic and soluble Ap oligomers by activating autophagy is provided. The method includes administering an effective amount of a pharmaceutical composition comprising the composition described above.

[0036] The foregoing general description of the illustrative embodiments and the following detailed description thereof are merely exemplary aspects of the teachings of this disclosure and are not restrictive.DRAWINGS

[0037] Those of skill in the art will understand that the drawings, described below, are for illustrative purposes only. The drawings are not intended to limit the scope of the present teachings in any way.

[0038] FIG. 1 illustrates effects of Mirodenafil and Donepezil on ILip decrease, according to aspects of the present disclosure.

[0039] FIG. 2 depicts TNFa decrease percentages for Mirodenafil and Donepezil combinations, according to aspects of the present disclosure.

[0040] FIG. 3 shows ILip decrease percentages for Mirodenafil and Galantamine combinations, according to aspects of the present disclosure.

[0041] FIG. 4 depicts TNFa decrease percentages for Mirodenafil and Galantamine treatments, according to aspects of the present disclosure.

[0042] FIG. 5 shows ILip decrease percentages for Mirodenafil and Rivastigmine combinations, according to aspects of the present disclosure.

[0043] FIG. 6 depicts TNFa decrease percentages for Mirodenafil and Rivastigmine treatments, according to aspects of the present disclosure.

[0044] FIG. 7 shows AP42 reduction rates for Mirodenafil and Donepezil combinations, according to aspects of the present disclosure.

[0045] FIG. 8 depicts Ap42 reduction rates for Mirodenafil and Galantamine combinations, according to aspects of the present disclosure.

[0046] FIG. 9 shows AP42 reduction rates for Mirodenafil and Rivastigmine combinations, according to aspects of the present disclosure.DETAILED DESCRIPTION

[0047] Abbreviations and Definitions

[0048] To facilitate understanding of the invention, a number of terms and abbreviations as used herein are defined below as follows:

[0049] All patents, applications, published applications and other publications cited herein are incorporated by reference in their entirety. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention belongs. The chemical structures and formulae set forth herein are constructed according to the standard rules of chemical valency known in the chemical arts. Should a discrepancy exist between a depicted structure and a name given for that structure, the depicted structure is to be accorded more weight. Where the stereochemistry of a structure or a portion of a structure is not indicated in a depicted structure or a portion of the depicted structure, the depicted structure is to be interpreted as encompassing all of its possible stereoisomers.

[0050] Any methods, devices and materials similar or equivalent to those described herein can be used in the practice of this invention. The following definitions are provided to facilitate understanding of certain terms used frequently herein and are not meant to limit the scope of the present disclosure. In the event that there is a plurality of definitions for a term herein, those in this section prevail unless stated otherwise. Headings used herein are for organizational purposes only and in no way limit the invention described herein.

[0051] The term “administering” refers to the act of delivering a combination or composition described herein into a subject by such routes as oral, mucosal, topical, suppository, intravenous, parenteral, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal or subcutaneous administration. Parenteral administration includes intravenous, intramuscular, intra-arteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial administration. Administration generally occurs after the onset of the disease, disorder, or condition, or its symptoms but, in certain instances, can occur before the onset of the disease, disorder, or condition, or its symptoms (e.g., administration for patients prone to such a disease, disorder, or condition).

[0052] The terms “coadministering” or “coadministration” or “combination” refers to administration of two or more agents (e.g., a combination described herein including, optionally, another active agent such as an anti-neurodegenerative agent described herein). The timing of coadministration depends in part of the combination and individualcompositions administered and can include administration at the same time, just prior to, or just after the administration of one or more additional therapies, for example therapies such as an anti-neurodegenerative agent including, for example, immunotherapy. Coadministration is meant to include simultaneous or sequential administration of each compound of the combination. Thus, the preparations can also be combined, when desired, with other active substances (e.g., to reduce metabolic degradation). The compounds described herein can be used in combination with one another, with other active agents known to be useful in treating neurodegeneration.

[0053] The terms “therapies” and “therapy” refer to any protocol(s), method(s), and / or agent(s) that can be used in the prevention, treatment, management, and / or amelioration of a disease, disorder, or condition or one or more symptoms thereof. In certain instances the term refers to active agents such as an anti-neurodegenerative agent described herein. The terms “therapy” and “therapy” can also refer to anti-viral therapy, anti-bacterial therapy, anti-fungal therapy, anti-neurodegenerative therapy, biological therapy, supportive therapy, and / or other therapies useful in treatment, management, prevention, or amelioration of a disease, disorder, or condition or one or more symptoms thereof known to one skilled in the art, for example, a medical professional such as a physician.

[0054] The term “patient” or “subject” refers to a mammal, such as a human, bovine, rat, mouse, dog, monkey, ape, goat, sheep, cow, or deer. Generally a patient as described herein is human. The subject according to the present disclosure may be a human subject suffering from Alzheimer's disease (e.g., AD, Alzheimer's type dementia) or a human subject possibly suffering from Alzheimer's disease. In these cases, whether a human subject is suffering from or likely to suffer from Alzheimer's disease may be determined by the methods disclosed in the Examples provided herein, and by methods commonly practiced by those skilled in the art. Human subjects suffering from or potentially suffering from Alzheimer's disease include, for example, those for whom a cognitive function test such as the Clinical Dementia Rating Scale Sum of Boxes (CDR-SB), the Alzheimer's Disease Assessment Scale-Cognitive Subscale (ADAS-Cog), or the Mini-Mental State Examination (MMSE) suggests a decline in cognitive function or the possibility thereof. The subject may be a human subject with brain deposits or cerebrospinal fluid concentrations of proteins known to accumulate in Alzheimer's disease patients, such as amyloid-P and tau proteins, a human subject with decreased metabolic function of the brain or atrophy of brain tissue.

[0055] The terms “treating” or “treatment” refer to any indicia of success or amelioration of the progression, severity, and / or duration of a disease, pathology or condition,including any objective or subjective parameter such as abatement; remission; diminishing of symptoms or making the injury, pathology or condition more tolerable to the patient; slowing in the rate of degeneration or decline; making the final point of degeneration less debilitating; or improving a patient’s physical or mental well-being.

[0056] The terms “AR1001” and “mirodenafil” refer to the chemical compound, 5- ethyl-2-[5-[4-(2 -hydroxy ethyl)piperazin-l-yl]sulfonyl-2-propoxyphenyl]-7-propyl-37 / - pyrrolo[3,2-d]pyrimidin-4-one, which has the following chemical formula:Mirodenafil is a member of the class of pyrrolopyrimidines that is 3,5-dihydro-4H- pyrrolo[3,2-d]pyrimidin-4-one having a 5-{[4-(2-hydroxyethyl)piperazin-l-yl]sulfonyl}-2- propoxyphenyl group at positon 2, ethyl group at position 5, and a propyl group at position 7. It is a phosphodiesterase type 5 inhibitor which is used for the treatment of erectile dysfunction. It has a role as an EC 3.1.4.35 (3',5'-cyclic-GMP phosphodiesterase) inhibitor and a vasodilator agent. It is a sulfonamide, a pyrrolopyrimidine, a N-alkylpiperazine, a primary alcohol and an aromatic ether. Mirodenafil has been used in trials studying the treatment and supportive care of Kidney Diseases, Urologic Diseases, Renal Insufficiency, Erectile Dysfunction, and Male Erectile Dysfunction. More information about mirodenafil can be found in U.S. Pat. No. 9,750,743, and at Kang, B.W., Kim, F., Cho, JY. et al. Phosphodiesterase 5 inhibitor mirodenafil ameliorates Alzheimer-like pathology and symptoms by multimodal actions. Alz Res Therapy 14, 92 (2022). https: / / doi.org / 10.1186 / sl3195-022-01034-3. Mirodenafil is commercially available from vendors including Cooke Chemical Co., Ltd. (#M4050735), AstaTech, Inc. (#C16519), and RR Scientific (#R772058), among others.

[0057] The term “anti-neurodegenerative agent” is used in accordance with its plain ordinary meaning and refers to a composition having neuronal protective properties or the ability to inhibit degeneration of neuronal cells. The term can include neuroprotective agents known to those of skill in the art. In embodiments, an anti-neurodegenerative agent is an agent identified herein having utility in methods of treating neurodegeneration. In embodiments, an anti-neurodegenerative agent is an agent approved by the US FDA orsimilar regulatory agency of a country other than the US, for treating neurodegeneration. This term includes, but is not limited to, the combinations described herein, and in the context of the present disclosure other anti-neurodegenerative agents.

[0058] The term “neurodegenerative disorder” or “neurodegeneration” refers to a condition primarily characterized by neuron ( / .< ., neuronal cell) loss. The most common neurodegenerative disorders include Alzheimer’s disease and Parkinson’s disease. Although there are several medicines currently approved for managing neurodegenerative disorders, a large majority of them only help with associated symptoms. A listing of over 500 Neurological Disorders is provided by the US National Institute of Neurological Disorders and Stroke (NINDS) currently available at: https: / / www.ninds.nih.gov / health- information / disorders. See also, Wolfe, M. The Molecular and Cellular Basis of Neurodegenerative Diseases: Underlying Mechanisms. Academic Press, April 18, 2018; Lewis, P. The Molecular and Clinical Pathology of Neurodegenerative Disease. Academic Press, December 14, 2018. For the purposes of the present disclosure, the term “neurodegenerative disorders” includes those disorders, and specifically the synucleinopathies and amyloidoses and amyloidosis-associated condition described herein.

[0059] The term “alpha-synuclein” refers to a protein or polypeptide (aS or aS protein), as used herein, includes a single, monomeric protein or polypeptide, as well as such aS proteins and polypeptides in the form of oligomers, e.g., in the form of dimers, trimers, tetramers, or in the form of lipid-associated complexes, or lipid-free forms, or in the form of aggregates, and any of these forms can be soluble or insoluble. The terms also include the aS proteins found in complexes with other molecules.

[0060] The term “synucleinopathy” is used herein to name a group of neurodegenerative disorders characterized by the presence of increased levels, e.g., steadystate levels, of any one or more of soluble non-fibrillary variants, soluble oligomeric isoforms, insoluble non-fibrillary variants, complexes, and insoluble fibrillary aggregates of aS protein within cellular compartments of selective populations of neurons and glia. Thus, the aS steady-state level is understood to encompass all soluble as well as insoluble and intermediate (metastable) forms of the SNCA gene product. See, UniProt P37840; Gene ID: 6622; NCBI Reference Sequence: NG 011851.1. These disorders include any one of the following grouped as “invariable” (or “primary”) synucleinopathies: Parkinson's disease (PD) e.g., sporadic Parkinson disease / parkinsonism and familial Parkinson disease / parkinsonism; Parkinson’s disease dementia (PDD); sporadic or heritable dementia with Lewy bodies (DLB) (aka diffuse Lewy body disease); pure autonomic failure (PAF) with aS deposition;multiple system atrophy (MSA) (of cerebellar, parkinsonian, or mixed type); hereditary neurodegeneration with brain iron accumulation (aka, Hallervordern Spatz disease or pantothenate kinase 2-linked neurodegeneration); and incidental Lewy body disease of advanced age. Furthermore, “variable” (or “secondary”) synucleinopathies have been identified, where dysregulation of the alpha-synuclein metabolism is recognized to be a secondary event (given the abundance of the protein in the nervous system), which nevertheless contributes significantly to the course, penetrance, age-of-onset, severity and expressivity of the primary illness. Disorders with variable synucleinopathy include, but are not limited to, Alzheimer's disease of the Lewy body variant; Down’s syndrome; Down’s syndrome dementia; progressive supranuclear palsy; essential tremor with Lewy bodies; familial parkinsonism with or without dementia resulting from a mutant gene and loci where no gene mutation has yet been identified; Creutzfeldt Jakob disease and related prion diseases such as bovine spongiform encephalopathy (mad cow disease); secondary Parkinson disease / parkinsonism resulting from neurotoxin exposure / drug-induced parkinsonism with a- synuclein deposition; sporadic or heritable spinocerebellar ataxia; amyotrophic lateral sclerosis (ALS); idiopathic rapid eye movement sleep behavior disorder; and other conditions associated with central and / or peripheral a-synuclein accumulation in mammals accompanying a primary disease process. See, Schlossmacher MG a-synuclein and synucleinopathies. The Dementias 2 Blue Books of Practical Neurology; Editors: Growdon J H & Rossor M N. Butterworth Heinemann, Inc., Oxford. 2007; Chapter 8: pp 184-213. Clinically, all of these related disorders are characterized by a chronic and progressive decline in motor, cognitive, behavioral, and / or autonomic functions, depending on the distribution of the alpha-synuclein abnormalities.

[0061] The terms “amyloidosis” and “amyloidoses” refer to a group of diseases that involve the accumulation of amyloid proteins in the body. Amyloid proteins can be deposited in one part of the body, called localized amyloidosis, or in multiple parts, called systemic amyloidosis. Many forms of amyloidosis exist, and the disease can be classified into four groups: primary amyloidosis, secondary amyloidosis, hereditary amyloidosis, and amyloidosis associated with normal aging. Primary amyloidosis (light chain amyloidosis) occurs with abnormalities of plasma cells, and some people with primary amyloidosis also have multiple myeloma (cancer of the plasma cells). Typical sites of amyloid buildup in primary amyloidosis are the heart, lungs, skin, tongue, thyroid gland, intestines, liver, kidneys, and blood vessels. Secondary amyloidosis may develop in response to various diseases that cause persistent infection or inflammation, such as tuberculosis, rheumatoidarthritis, and familial Mediterranean fever. Typical sites of amyloid buildup in secondary amyloidosis are the spleen, liver, kidneys, adrenal glands, and lymph nodes. Hereditary amyloidosis has been noted in some families, particularly those from Portugal, Sweden, and Japan. The amyloid-producing defect occurs because of mutations in specific proteins in the blood. Typical sites for amyloid buildup in hereditary amyloidosis are the nerves, heart, blood vessels, and kidneys. Alzheimer's disease is a type of localized amyloidosis where amyloidbeta proteins build up in the brain. This is the most common type of amyloidosis in humans and the most common form of dementia. The “amyloid hypothesis” is the prevailing theory that Alzheimer's disease is caused by the accumulation of beta-amyloid proteins in the brain. Some studies have shown that amyloid triggers a binding of two proteins in the brain's neurons, which can lead to the rapid accumulation of tau proteins. Tau proteins are a primary driver of neurodegeneration in Alzheimer's disease. Amyloidosis can be caused by chronic inflammation or genetic mutation. There are many different types of amyloid proteins involved in amyloidosis, and each type of amyloid deposit can characterize a different disease.

[0062] The term “amyloidosis-associated condition” refers to a disease that is associated with amyloid deposition and can include but not be limited to Alzheimer's Disease, mild cognitive impairment due to Alzheimer's disease, mild Alzheimer's disease dementia, prodromal stage of Alzheimer’s disease, early-onset Alzheimer’s disease, mild Alzheimer’s disease, moderate Alzheimer’s disease, early Alzheimer’s disease, preclinical Alzheimer’s disease, frontotemporal dementia, idiopathetic myeloma, amyloid polyneuropathy, amyloid cardiomyopathy, systemic senile amyloidosis, amyloid polyneuropathy, hereditary cerebral hemorrhage with amyloidosis, Down's syndrome, Scrapie, medullary carcinoma of the thyroid, isolated atrial amyloid, p2-microglobulin amyloid in dialysis patients, inclusion body myositis, p2-amyloid deposits in muscle wasting disease, and Islets of Langerhans diabetes Type II insulinoma, Type 2 diabetes mellitus, hereditary cerebral hemorrhage amyloidosis (Dutch), amyloid A (reactive), secondary amyloidosis, familial Mediterranean fever, familial amyloid nephropathy with urticaria and deafness (Muckle-wells Syndrome), amyloid lambda L-chain or amyloid kappa L-chain (idiopathic, myeloma or macroglobulinemia-associated) A beta 2M (chronic hemodialysis), ATTR (familial amyloid polyneuropathy (Portuguese, Japanese, Swedish)), familial amyloid cardiomyopathy (Danish), isolated cardiac amyloid, systemic senile amyloidoses, AIAPP or amylin insulinoma, atrial naturetic factor (isolated atrial amyloid), procalcitonin (medullary carcinoma of the thyroid), gelsolin (familial amyloidosis (Finnish)), cystatin C (hereditary cerebral hemorrhage with amyloidosis(Icelandic)), AApo-A-1 (familial amyloidotic polyneuropathy-Iowa), AApo-A-II (accelerated senescence in mice), head injuries (traumatic brain injury), dementia, fibrinogen-associated amyloid; and Asor or Pr P-27 (scrapie, Creutzfeld Jacob disease, Gertsmann-Straussler- Scheinker syndrome, bovine spongiform encephalitis) or in cases of persons who are homozygous for the apolipoprotein E4 allele, and the condition associated with homozygosity for the apolipoprotein E4 allele or Huntington's disease.

[0063] The term “early-onset Alzheimer’s disease” or “EOAD” refers to AD cases where symptoms appear before age 65. EOAD includes, but is not limited to: Genetic (Familial) Alzheimer's Disease and its phenotypic variants including Logopenic Variant Primary Progressive Aphasia, Posterior Cortical Atrophy, Behavioral / Dysexecutive Alzheimer's Disease, and Acalculia Variant.

[0064] As used herein, the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.

[0065] As used herein, the term “pharmaceutically acceptable carrier” refers to a diluent, adjuvant, excipient, or vehicle with which a compound is administered. Such carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like, polyethylene glycols, glycerine, propylene glycol, or other synthetic solvents. Water is a preferred carrier when a compound is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol, and the like. A compound, if desired, can also combine minor amount of wetting or emulsifying agents, or pH buffering agents such as acetates, citrates, or phosphates. Antibacterial agents such as a benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; and agents for the adjustment of tonicity such as sodium chloride or dextrose may also be a carrier. Methods for producing compounds in combination with carriers are known to those of skill in the art.

[0066] As used herein, the term “pharmaceutically acceptable salt” includes those salts of a pharmaceutically acceptable compound formed with free amino groups such as those derived from hydrochloric, phosphoric, acetic, oxalic, and tartaric acids, and thoseformed with free carboxyl groups such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, and procaine. If the compound is basic, salts may be prepared from pharmaceutically acceptable non-toxic acids including inorganic and organic acids. Such acids include acetic, benzene-sulfonic (besylate), benzoic, camphorsulfonic, citric, ethenesulfonic, fumaric, gluconic, glutamic, hydrobromic, hydrochloric, isethionic, lactic, maleic, malic, mandelic, methanesulfonic, mucic, nitric, pamoic, pantothenic, phosphoric, succinic, sulfuric, tartaric, p-toluenesulfonic, and the like. Particularly preferred are besylate, hydrobromic, hydrochloric, phosphoric, and sulfuric acids. If the compound is acidic, salts may be prepared from pharmaceutically acceptable organic and inorganic bases. Suitable organic bases include, but are not limited to, lysine, N,N’ -dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylene diamine, meglumine (N-methyl-glucamine) and procaine. Suitable inorganic bases include, but are not limited to, alkaline and earth-alkaline metals such as aluminum, calcium, lithium, magnesium, potassium, sodium, and zinc. Methods for synthesizing such salts are known to those of skill in the art.

[0067] The term “effective amount” refers to the amount of a therapy (e.g., a combination provided herein or another active agent such as an anti-neurodegenerative agent described herein) which is sufficient to accomplish a stated purpose or otherwise achieve the effect for which it is administered. An effective amount can be sufficient to reduce and / or ameliorate the progression, development, recurrence, severity and / or duration of a given disease, disorder or condition and / or a symptom related thereto. An effective amount can be a “therapeutically effective amount” which refers to an amount sufficient to provide a therapeutic benefit such as, for example, the reduction or amelioration of the advancement or progression of a given disease, disorder or condition, reduction or amelioration of the recurrence, development or onset of a given disease, disorder or condition, and / or to improve or enhance the prophylactic or therapeutic effect(s) of another therapy. A therapeutically effective amount of a composition described herein can enhance the therapeutic efficacy of another therapeutic agent.

[0068] The term “therapeutically effective amount” refers to the amount of a therapy which is sufficient to accomplish a stated purpose or otherwise achieve the effect for which it is administered. An effective amount can be sufficient to reduce and / or ameliorate the progression, development, recurrence, severity and / or duration of a given disease, disorder or condition and / or a symptom related thereto. An effective amount can be a “therapeutically effective amount” which refers to an amount sufficient to provide atherapeutic benefit such as, for example, the reduction or amelioration of the advancement or progression of a given disease, disorder or condition, reduction or amelioration of the recurrence, development or onset of a given disease, disorder or condition, and / or to improve or enhance the prophylactic or therapeutic effect(s) of another therapy. A therapeutically effective amount of a composition described herein can enhance the therapeutic efficacy of another therapeutic agent.

[0069] The term “regimen” refers to a protocol for dosing and timing the administration of one or more therapies (e.g., combinations described herein including, optionally, another active agent such as an anti-neurodegenerative agent described herein) for treating a disease, disorder, or condition described herein. A regimen can include periods of active administration and periods of rest as known in the art. Active administration periods include administration of combinations and compositions described herein and the duration of time of efficacy of such combinations and compositions. Rest periods of regimens described herein include a period of time in which no compound is actively administered, and in certain instances, includes time periods where the efficacy of such compounds can be minimal. Combination of active administration and rest in regimens described herein can increase the efficacy and / or duration of administration of the combinations and compositions described herein.

[0070] The term “enhance” refers to an increase or improvement in the function or activity of a protein or cell after administration or contacting with a combination described herein compared to the protein or cell prior to such administration or contact.

[0071] Compositions and Methods for Treating Neurodegenerative Disorders

[0072] The following description sets forth exemplary aspects of the present disclosure. It should be recognized, however, that such description is not intended as a limitation on the scope of the present disclosure. Rather, the description also encompasses combinations and modifications to those exemplary aspects described herein.

[0073] The present disclosure relates to pharmaceutical compositions and methods for the prevention or treatment of neurodegenerative disorders. More specifically, the present disclosure provides combination therapies utilizing (1) a phosphodiesterase 5 inhibitor (PDE- 5 inhibitor) in conjunction with (2) an acetylcholinesterase inhibitor (AChE inhibitor) in molar ratios more fully described below.

[0074] Neurodegenerative disorders encompass a range of cognitive disorders characterized by impairment of memory, thinking, and social abilities. As the globalpopulation ages, the prevalence of neurodegenerative disorders continues to increase, posing significant challenges for healthcare systems and societies worldwide. Current treatments for neurodegenerative disorders primarily focus on managing symptoms and slowing disease progression, with limited success in addressing the underlying causes of cognitive decline.

[0075] In some cases, the phosphodiesterase 5 inhibitor and acetylcholinesterase inhibitor may be combined in specific weight ratios. These ratios may range from 1 :0.1 to 1 : 10. In other cases, the ratios may be 50: 1, 10: 1, 5: 1, 2: 1, 1 : 1, 1 :2, 1 :5, or 1 : 10, and ranges in between.

[0076] The combination may inhibit the growth and differentiation of nerve cells and degeneration of learning and memory. In some cases, the combination may induce a decrease in intracellular amyloid beta (AP). This decrease in intracellular Ap may increase the protection of nerve cells and enhance synaptic plasticity.

[0077] The combination of a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor may provide synergistic effects in treating neurodegenerative disorders. These synergistic effects may include reduction of neuroinflammation, inhibition of Ap aggregation, and promotion of neurogenesis and synaptic plasticity.

[0078] In some cases, the combination may be effective in treating various neurodegenerative disorders including the synucleinopathies and amyloidoses and amyloidosis-associated condition described herein. These disorders include dementia, Parkinson's disease, Alzheimer's disease, Huntington's disease, and multiple sclerosis. The combination may act through multiple pathways to address the complex pathology of these diseases.

[0079] The pharmaceutical compositions described herein may provide a novel approach to treating neurodegenerative disorders by combining agents that target multiple pathways involved in the disease process. Without being bound by a particular theory, phosphodiesterase 5 inhibitors may modulate signaling pathways related to neuronal function and survival. Without being bound by a particular theory, acetylcholinesterase inhibitors may compensate for the loss of cholinergic neurons in subjects, which is a hallmark of certain neurodegenerative disorders.

[0080] The pharmaceutical compositions described herein may be formulated for various routes of administration and may contain specific ratios of active ingredients to optimize therapeutic effects. The combinations may be used to treat or prevent various forms of neurodegenerative disorders, including but not limited to Alzheimer's disease, vascular dementia, and Lewy body dementia.

[0081] By targeting multiple aspects of neurodegenerative disorders pathology simultaneously, these combination therapies may offer potential advantages in efficacy and disease modification compared to existing single-agent treatments. The disclosed compositions and methods may provide new options for addressing the growing global burden of neurodegenerative disorders and improving outcomes for affected individuals.

[0082] Compounds of a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor in the molar ratios described in this disclosure include pharmaceutically acceptable salts, pharmaceutically acceptable stereoisomers, derivatives, prodrugs, enantiomers, diastereomers, hydrates, co-crystals, and polymorphs thereof.

[0083] PDE-5 inhibitors

[0084] The phosphodiesterase 5 inhibitor may be selected from mirodenafil, sildenafil, vardenafil, tadalafil, udenafil, dasantafil, avanafil, and pharmaceutically acceptable salts, solvates and hydrates thereof.

[0085] Acetylcholinesterase inhibitors

[0086] The acetylcholinesterase inhibitor may be selected from donepezil, rivastigmine, galantamine, and pharmaceutically acceptable salts, solvates, and hydrates thereof.

[0087] In certain instances, the combination includes a phosphodiesterase 5 inhibitor present at an amount of greater than about: 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 85 mg, 90 mg, 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 250 mg, or 300 mg. The combination can include a phosphodiesterase 5 inhibitor present at an amount greater than about: 25 mg, 50 mg, 100 mg, 200 mg, 250 mg, or 300 mg.

[0088] The combination can include a phosphodiesterase 5 inhibitor present at an amount greater than about: 1 mg to about 10 mg, 1 mg to about 25 mg, 1 mg to about 50 mg, 5 mg to about 10 mg, 5 mg to about 25 mg, 5 mg to about 50 mg, 10 mg to about 25 mg, 10 mg to about 50 mg, 50 mg to about 100 mg, 100 mg to about 200 mg, or 200 mg to about 300 mg.

[0089] The combination can include a phosphodiesterase 5 inhibitor in an amount of at least about: 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 85 mg, 90 mg, 100 mg, 125 mg, 150 mg, 175 mg,200 mg, 250 mg, or 300 mg. The combination can include a phosphodiesterase 5 inhibitor present at an amount of at least about: 25 mg, 50 mg, 100 mg, 200 mg, 250 mg, or 300 mg. The combination can include a phosphodiesterase 5 inhibitor present at an amount of at least about: 1 mg to about 10 mg, 1 mg to about 25 mg, 1 mg to about 50 mg, 5 mg to about 10 mg, 5 mg to about 25 mg, 5 mg to about 50 mg, 10 mg to about 25 mg, 10 mg to about 50 mg, 50 mg to about 100 mg, 100 mg to about 200 mg, or 200 mg to about 300 mg.

[0090] The combination can include a phosphodiesterase 5 inhibitor present in an amount of about: 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 85 mg, 90 mg, 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 250 mg, or 300 mg. The combination can include a phosphodiesterase 5 inhibitor present at an amount of about: 25 mg, 50 mg, 100 mg, 200 mg, 250 mg, or 300 mg. The combination can include a phosphodiesterase 5 inhibitor present at an amount of about: 1 mg to about 10 mg, 1 mg to about 25 mg, 1 mg to about 50 mg, 5 mg to about 10 mg, 5 mg to about 25 mg, 5 mg to about 50 mg, 10 mg to about 25 mg, 10 mg to about 50 mg, 50 mg to about 100 mg, 100 mg to about 200 mg, or 200 mg to about 300 mg.

[0091] A phosphodiesterase 5 inhibitor can be present in the combinations described herein relative to the weight of the patient (e.g., mg / kg). In some instances, the phosphodiesterase 5 inhibitor is present in an amount equivalent to about: 0.0001 mg / kg to about 200 mg / kg, 0.001 mg / kg to about 200 mg / kg, 0.01 mg / kg to about 200 mg / kg, 0.01 mg / kg to about 150 mg / kg, 0.01 mg / kg to about 100 mg / kg, 0.01 mg / kg to about 50 mg / kg, 0.01 mg / kg to about 25 mg / kg, 0.01 mg / kg to about 10 mg / kg, or 0.01 mg / kg to about 5 mg / kg, 0.05 mg / kg to about 200 mg / kg, 0.05 mg / kg to about 150 mg / kg, 0.05 mg / kg to about 100 mg / kg, 0.05 mg / kg to about 50 mg / kg, 0.05 mg / kg to about 25 mg / kg, 0.05 mg / kg to about 10 mg / kg, or 0.05 mg / kg to about 5 mg / kg, 0.5 mg / kg to about 200 mg / kg, 0.5 mg / kg to about 150 mg / kg, 0.5 mg / kg to about 100 mg / kg, 0.5 mg / kg to about 50 mg / kg, 0.5 mg / kg to about 25 mg / kg, 0.5 mg / kg to about 10 mg / kg, or 0.5 mg / kg to about 5 mg / kg. In other instances the phosphodiesterase 5 inhibitor is present in an amount equivalent to about: 1 mg / kg to about 200 mg / kg, 1 mg / kg to about 150 mg / kg, 1 mg / kg to about 100 mg / kg, 1 mg / kg to about 50 mg / kg, 1 mg / kg to about 25 mg / kg, 1 mg / kg to about 10 mg / kg, or 1 mg / kg to about 5 mg / kg.

[0092] In certain instances, the combination includes an acetylcholinesterase inhibitor present at an amount of greater than about: 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 85 mg, 90 mg, 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 250 mg, or 300 mg. The combination caninclude an acetylcholinesterase inhibitor present at an amount greater than about: 25 mg, 50 mg, 100 mg, 200 mg, 250 mg, or 300 mg.

[0093] The combination can include an acetylcholinesterase inhibitor present at an amount greater than about: 1 mg to about 10 mg, 1 mg to about 25 mg, 1 mg to about 50 mg, 5 mg to about 10 mg, 5 mg to about 25 mg, 5 mg to about 50 mg, 10 mg to about 25 mg, 10 mg to about 50 mg, 50 mg to about 100 mg, 100 mg to about 200 mg, or 200 mg to about 300 mg.

[0094] The combination can include an acetylcholinesterase inhibitor in an amount of at least about: 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 85 mg, 90 mg, 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 250 mg, or 300 mg. The combination can include an acetylcholinesterase inhibitor present at an amount of at least about: 25 mg, 50 mg, 100 mg, 200 mg, 250 mg, or 300 mg. The combination can include an acetylcholinesterase inhibitor present at an amount of at least about: 1 mg to about 10 mg, 1 mg to about 25 mg, 1 mg to about 50 mg, 5 mg to about 10 mg, 5 mg to about 25 mg, 5 mg to about 50 mg, 10 mg to about 25 mg, 10 mg to about 50 mg, 50 mg to about 100 mg, 100 mg to about 200 mg, or 200 mg to about 300 mg.

[0095] The combination can include an acetylcholinesterase inhibitor present in an amount of about: 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 85 mg, 90 mg, 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 250 mg, or 300 mg. The combination can include an acetylcholinesterase inhibitor present at an amount of about: 25 mg, 50 mg, 100 mg, 200 mg, 250 mg, or 300 mg. The combination can include an acetylcholinesterase inhibitor present at an amount of about: 1 mg to about 10 mg, 1 mg to about 25 mg, 1 mg to about 50 mg, 5 mg to about 10 mg, 5 mg to about 25 mg, 5 mg to about 50 mg, 10 mg to about 25 mg, 10 mg to about 50 mg, 50 mg to about 100 mg, 100 mg to about 200 mg, or 200 mg to about 300 mg.

[0096] An acetylcholinesterase inhibitor can be present in the combinations described herein relative to the weight of the patient (e.g., mg / kg). In some instances, acetylcholinesterase inhibitor is present in an amount equivalent to about: 0.0001 mg / kg to about 200 mg / kg, 0.001 mg / kg to about 200 mg / kg, 0.01 mg / kg to about 200 mg / kg, 0.01 mg / kg to about 150 mg / kg, 0.01 mg / kg to about 100 mg / kg, 0.01 mg / kg to about 50 mg / kg, 0.01 mg / kg to about 25 mg / kg, 0.01 mg / kg to about 10 mg / kg, or 0.01 mg / kg to about 5 mg / kg, 0.05 mg / kg to about 200 mg / kg, 0.05 mg / kg to about 150 mg / kg, 0.05 mg / kg to about 100 mg / kg, 0.05 mg / kg to about 50 mg / kg, 0.05 mg / kg to about 25 mg / kg, 0.05 mg / kg to about 10 mg / kg, or 0.05 mg / kg to about 5 mg / kg, 0.5 mg / kg to about 200 mg / kg, 0.5 mg / kgto about 150 mg / kg, 0.5 mg / kg to about 100 mg / kg, 0.5 mg / kg to about 50 mg / kg, 0.5 mg / kg to about 25 mg / kg, 0.5 mg / kg to about 10 mg / kg, or 0.5 mg / kg to about 5 mg / kg. In other instances the acetylcholinesterase inhibitor is present in an amount equivalent to about: 1 mg / kg to about 200 mg / kg, 1 mg / kg to about 150 mg / kg, 1 mg / kg to about 100 mg / kg, 1 mg / kg to about 50 mg / kg, 1 mg / kg to about 25 mg / kg, 1 mg / kg to about 10 mg / kg, or 1 mg / kg to about 5 mg / kg.

[0097] In certain instances the therapeutically effective amount of combination hereof is determined as an amount provided in a package insert provided with the combination. The term package insert refers to instructions customarily included in commercial packages of medicaments approved by the FDA or a similar regulatory agency of a country other than the US, which contains information about, for example, the usage, dosage, administration, contraindications, and / or warnings concerning the use of such medicaments.

[0098] The phosphodiesterase 5 inhibitor and acetylcholinesterase inhibitor can be administered in the molar ratios described in this disclosure can be provided in amounts that are synergistic with another member of the group. The term synergistic refers to a combination described herein (e.g., a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor - including, optionally, coadministration with another active agent such as an anti-neurodegenerative agent described herein) or a combination of regimens such as those described herein that is more effective than the additive effects of each individual therapy or regimen.

[0099] A synergistic effect of a combination described herein can permit the use of lower dosages of one or more of the components of the combination (e.g., a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor in the molar ratios described in this disclosure). A synergistic effect can permit less frequent administration of at least one of the administered therapies (e.g., a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor in the molar ratios described in this disclosure) to a subject with a disease, disorder, or condition described herein. Such lower dosages and reduced frequency of administration can reduce the toxicity associated with the administration of at least one of the therapies (e.g., a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor in the molar ratios described in this disclosure) to a subject without reducing the efficacy of the treatment. A synergistic effect as described herein avoid or reduce adverse or unwanted side effects associated with the use of any therapy.

[0100] Pharmaceutical Compositions

[0101] Combinations described herein can be provided as a pharmaceutical composition suitable for administration via any route to a patient described herein including but not limited to: oral, mucosal (e.g., nasal, inhalation, pulmonary, sublingual, vaginal, buccal, or rectal), parenteral (e.g., subcutaneous, intravenous, bolus injection, intramuscular, or intra-arterial), topical (e.g., eye drops or other ophthalmic preparations), transdermal or transcutaneous administration to a patient.

[0102] Exemplary of dosage forms include: tablets; caplets; capsules (e.g., gelatin capsules); cachets; lozenges; suppositories; powders; gels; liquid dosage forms suitable for parenteral administration to a patient; and sterile solids (e.g., crystalline or amorphous solids) that can be reconstituted to provide liquid dosage forms suitable for parenteral administration to a patient.

[0103] Pharmaceutical compositions and dosage forms described herein typically include one or more excipients. Suitable excipients are well known to those skilled in the art of pharmacy. Whether a particular excipient is suitable for incorporation into a pharmaceutical composition or dosage form depends on a variety of factors such as, for example, the intended route of administration to the patient. Pharmaceutical compositions described herein can include other agents such as stabilizers, lubricants, buffers, and disintegrants that can reduce the rate by which an active ingredient can decompose in a particular formulation.

[0104] Pharmaceutical compositions described herein can in certain instances include additional active agents other than those in the combinations described herein (e.g., an anti-neurodegenerative agent such as those described herein) in an amount provided herein.

[0105] In one embodiment, one of a phosphodiesterase 5 inhibitor or an acetylcholinesterase inhibitor is provided in an oral dosage form such as a tablet or capsule. In another embodiment, one of a phosphodiesterase 5 inhibitor or an acetylcholinesterase inhibitor is supplied as a powder (e.g., lyophilized powder) that can be resuspended in a liquid suitable for parenteral administration.

[0106] The combinations described herein can be provided in forms convenient to or facilitate their administration to a patient. For example, the combination can be formulated as a tablet, capsule, or as a powder (e.g., lyophilized powder) that can be resuspended in a liquid suitable for parenteral administration.

[0107] Combinations described herein can be provided as controlled releasepharmaceutical products, which have a goal of improving drug therapy over that achieved by their non-controlled counterparts. Controlled release formulations can extend activity of the drug, reduce dosage frequency, and increase subject compliance. In addition, controlled release formulations can be used to affect the time of onset of action or other characteristics, such as blood levels of the drug, and can thus affect the occurrence of side (e.g., adverse) effects.

[0108] Methods

[0109] The combinations, pharmaceutical compositions, and kits described herein are useful for treating diseases, disorders, or alleviating, ameliorating, or eliminating the symptoms of diseases and disorders such as, for example, neurodegenerative disorders. It is to be understood that the methods described herein pertain to administration of combinations and pharmaceutical compositions described herein, and such combinations and pharmaceutical compositions can be provided in the form of a kit as described herein. Provided herein are methods of treating neurodegenerative disorders by administering a therapeutically effective amount of a combination described herein to a patient in need thereof. Also provided herein are methods of managing neurodegenerative disorders by administering therapeutically effective amount of a combination described herein to a patient in need thereof.

[0110] In an aspect the methods of treating neurodegenerative disorders provide for methods for reducing amyloid or Ap burden in an individual by administering a therapeutically effective amount of a combination described herein. In some embodiments, neurodegeneration related to the neurodegenerative disorder is reduced by at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%.

[0111] The methods of treating neurodegenerative disorders described herein also provide for methods for increasing or otherwise prolonging time to neurodegenerative disorder progression. Time to disease progression can be prolonged in a patient by administering a therapeutically effective amount of a combination described herein. In some embodiments, the increase is a comparison between the time to neurodegenerative disorder progression without treatment and with treatment with a combination described herein. In some embodiments, the methods described herein prolong the time to disease progression by at least 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 3 years, 4 years, 5 years, 10 years, 15 years, 20 years, 25 years, or more, including values inbetween.

[0112] The methods of treating neurodegenerative disorders described herein also provide for methods for increasing or otherwise prolonging survival of patients diagnosed with neurodegenerative disorders as described herein. Patient survival can be prolonged by administering a therapeutically effective amount of a combination described herein. In some embodiments, the increase is a comparison between the survival without treatment and with treatment with a combination as described herein. In some embodiments, the methods described herein prolong survival by at least 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 3 years, 4 years, 5 years, 10 years, 15 years, 20 years, 25 years, or more, including values in between.

[0113] The methods of treating neurodegenerative disorders described herein also provide for methods for increasing progression-free survival of patients diagnosed with neurodegenerative disorders as described herein. Patient progression-free survival can be prolonged by administering a therapeutically effective amount of a combination described herein. In some embodiments, the increase is a comparison between the progression-free survival without treatment and with treatment with a combination as described herein. In some embodiments, the methods described herein increase progression-free survival by at least 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 3 years, 4 years, 5 years, 10 years, 15 years, 20 years, 25 years, or more, including values in between.

[0114] T arget N eurodegenerative Disorders

[0115] Synucleinopathies are a group of neurodegenerative disorders characterized by the abnormal accumulation and aggregation of alpha-synuclein protein in various parts of the nervous system. In some cases, these disorders may share common pathological mechanisms, but they often present with distinct clinical features. The following outlines several known synucleinopathies:

[0116] Parkinson's Disease (PD): PD may be characterized by the loss of dopaminergic neurons in the substantia nigra pars compacta and the presence of Lewy bodies containing aggregated alpha-synuclein. In some cases, patients may experience motor symptoms such as tremor, rigidity, bradykinesia, and postural instability. Non-motor symptoms may include cognitive impairment, depression, sleep disorders, and autonomic dysfunction.

[0117] Parkinson's Disease Dementia (PDD): PDD may develop in some patients with long-standing PD. It may be characterized by cognitive decline, including impairments in attention, executive function, and visuospatial abilities. In some cases, PDD may be associated with a more widespread distribution of Lewy bodies in cortical and limbic regions.

[0118] Dementia with Lewy Bodies (DLB): DLB may share features with both PD and Alzheimer's disease. It may be characterized by fluctuating cognition, visual hallucinations, and parkinsonism. In some cases, patients may experience rapid eye movement (REM) sleep behavior disorder. The distribution of Lewy bodies in DLB may be more widespread than in PD, often affecting cortical areas.

[0119] Multiple System Atrophy (MSA): MSA may be characterized by a combination of parkinsonian, cerebellar, and autonomic symptoms. In some cases, it may be divided into two subtypes: MSA-P (predominant parkinsonism) and MSA-C (predominant cerebellar ataxia). Alpha-synuclein aggregates in MSA may primarily affect oligodendrocytes, forming glial cytoplasmic inclusions.

[0120] Pure Autonomic Failure (PAF): PAF may be characterized by progressive autonomic dysfunction without significant central nervous system involvement. In some cases, patients may experience orthostatic hypotension, gastrointestinal disturbances, and urogenital dysfunction. Alpha-synuclein aggregates may be found in peripheral autonomic neurons.

[0121] Lewy Body Variant of Alzheimer's Disease (LBV): LBV may represent a condition where patients exhibit pathological features of both Alzheimer's disease and DLB. In some cases, patients may show cognitive decline typical of Alzheimer's disease along with some features of DLB, such as visual hallucinations or fluctuating cognition.

[0122] In some aspects, these synucleinopathies may share common pathological mechanisms related to alpha-synuclein aggregation and neuronal dysfunction. However, the specific distribution of alpha-synuclein pathology and the affected cell types may vary among these disorders, contributing to their distinct clinical presentations.

[0123] The development of therapeutic strategies targeting alpha-synuclein aggregation, such as the combination of Lamotrigine and Rivastigmine described in this disclosure, may have potential applications across various synucleinopathies. In some cases, such approaches may address the underlying pathological processes common to these disorders, potentially offering new avenues for prevention, alleviation, or treatment of these debilitating neurodegenerative conditions.

[0124] Alzheimer's disease (AD) is a progressive neurodegenerative disorder thatmay be characterized by cognitive decline, memory loss, and behavioral changes. In some cases, AD may be the most common cause of dementia in older adults. The disease may be associated with the accumulation of Ap plaques and neurofibrillary tangles composed of hyperphosphorylated tau protein in the brain.

[0125] In some aspects, the pathological hallmarks of AD may include:

[0126] 1. Ap plaques: These extracellular deposits may consist of aggregated betaamyloid peptides, which may be derived from the amyloid precursor protein (APP).

[0127] 2. Neurofibrillary tangles: These intracellular aggregates may be composed of hyperphosphorylated tau protein, which may disrupt normal neuronal function.

[0128] 3. Neuronal loss: Progressive degeneration of neurons, particularly in regions such as the hippocampus and cortex, may occur.

[0129] 4. Synaptic dysfunction: Impairment of synaptic transmission and plasticity may contribute to cognitive decline.

[0130] In some cases, AD may progress through several stages, from mild cognitive impairment to severe dementia. The disease may affect various cognitive domains, including memory, language, executive function, and visuospatial abilities.

[0131] Other neurodegenerative disorders related to AD may include:

[0132] Vascular dementia: This form of dementia may be caused by reduced blood flow to the brain, often due to stroke or other vascular issues.

[0133] Frontotemporal dementia (FTD): FTD may be characterized by changes in behavior, personality, and language abilities, often with an earlier onset than AD.

[0134] Lewy body dementia (LBD): This condition may share features with both AD and Parkinson's Disease, and may be characterized by cognitive fluctuations, visual hallucinations, and parkinsonism.

[0135] Mixed dementia: In some cases, individuals may exhibit pathological features of multiple types of dementia, such as AD and vascular dementia.

[0136] Posterior cortical atrophy (PCA): This rare form of dementia may primarily affect visual processing and spatial awareness.

[0137] Primary progressive aphasia (PPA): PPA may be characterized by progressive language impairment, which may be a variant of FTD or AD.

[0138] Corticobasal degeneration (CBD): This rare neurological disorder may affect movement and cognition, often presenting with asymmetric motor symptoms and cognitive impairment.

[0139] Progressive supranuclear palsy (PSP): PSP may be characterized byproblems with balance, eye movements, and cognitive function.

[0140] Amyloidoses are also target neurodegenerative disorders of the present disclosure. In some aspects, these neurodegenerative disorders may share common pathological mechanisms, such as protein aggregation, mitochondrial dysfunction, and neuroinflammation, including mechanisms involved in synucleinopathies. However, the specific proteins involved, the regions of the brain affected, and the clinical presentations may vary among these disorders.

[0141] The development of therapeutic strategies targeting multiple pathological processes, such as the combination of a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor in the molar ratios described in this disclosure, may have potential applications across various neurodegenerative disorders. In some cases, such approaches may address the underlying pathological processes common to these disorders, potentially offering new avenues for prevention, alleviation, or treatment of these debilitating conditions.

[0142] The combinations described herein can include administration of each therapy (e.g., a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor in the molar ratios described in this disclosure, optionally including another anti -neurodegenerative agent), where the administration is performed simultaneously or sequentially (in either order). In one embodiment, a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor in the molar ratios provided herein are administered simultaneously (e.g., within at least 1 to 5 min of each other). In another embodiment, the phosphodiesterase 5 inhibitor and acetylcholinesterase inhibitor in the molar ratios provided herein are administered sequentially (e.g., within at least 10 min, 15 min, 30 min, 1 h, 2 h, 5 h, 10 h, 12 h, 1 day, 2 days, 5 days, 7 days, 14 days, or 21 days of each other).

[0143] The combinations of the present disclosure can be administered, for example, once a day (QD), twice daily (BID), once a week (QW), twice weekly (BIW), three times a week (TIW), or monthly (QM) regularly on a continuous basis or intermittent basis such as BIW for 3 months then resume a month later. For example, the combinations of the present disclosure can be administered BID. The combinations of the present disclosure can be administered TIW. In certain instances, the combinations of the present disclosure can be administered 2 to 3 times a week. In another embodiment, the combinations of the present disclosure is administered QD. The combinations of the present disclosure can be administered QD for about: 1 day to about 7 days, 1 day to about 14 days, 1 day to about 21 days, 1 day to about 28 days, or daily until disease progression changes or unacceptabletoxicity occurs. The administration of combinations of the present disclosure can, in part, depend upon the tolerance of the patient where greater tolerance can allow greater or more frequent administration. Alternatively, where a patient shows poor tolerance to a phosphodiesterase 5 inhibitor or an acetylcholinesterase inhibitor, a lesser amount of one individual compounds or a less frequent dosing of the combination can be performed. Combinations of the present disclosure can be administered in any regimen as described herein.

[0144] For example, combinations of the present disclosure can be administered at an amount of about: 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 85 mg, 90 mg, 100 mg, 125 mg, 150 mg, 175 mg, or 200 mg, QD. For example, combinations of the present disclosure can be administered at an amount of about: 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 85 mg, 90 mg, 100 mg, 125 mg, 150 mg, 175 mg, or 200 mg, BIW. For example, combinations of the present disclosure can be administered at an amount of about: 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 85 mg, 90 mg, 100 mg, 125 mg, 150 mg, 175 mg, or 200 mg, TIW. For example, combinations of the present disclosure can be administered at an amount of about: 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 85 mg, 90 mg, 100 mg, 125 mg, 150 mg, 175 mg, or 200 mg, QW. For example, combinations of the present disclosure can be administered at an amount of about: 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 85 mg, 90 mg, 100 mg, 125 mg, 150 mg, 175 mg, or 200 mg, Q2W. For example, combinations of the present disclosure can be administered at an amount of about 5 mg or about 10 mg, QD. For example, combinations of the present disclosure can be administered at an amount of about 5 mg or about 10 mg, BIW. For example, combinations of the present disclosure can be administered at an amount of about 5 mg or about 10 mg, TIW. For example, combinations of the present disclosure can be administered at an amount of about 5 mg or about 10 mg, QW. For example, combinations of the present disclosure can be administered at an amount of about 5 mg or about 10 mg, Q2W. Administration of combinations of the present disclosure can be continuous. Administration of combinations of the present disclosure can be intermittent.

[0145] For example, combinations of the present disclosure can be administered at an amount of about: 1 mg to about 10 mg, 1 mg to about 25 mg, 1 mg to about 50 mg, 5 mgto about 10 mg, 5 mg to about 25 mg, 5 mg to about 50 mg, 10 mg to about 25 mg, 10 mg to about 50 mg, 50 mg to about 100 mg, or 100 mg to about 200 mg, QD. For example, combinations of the present disclosure can be administered at an amount of about: 1 mg to about 10 mg, 1 mg to about 25 mg, 1 mg to about 50 mg, 5 mg to about 10 mg, 5 mg to about 25 mg, 5 mg to about 50 mg, 10 mg to about 25 mg, 10 mg to about 50 mg, 50 mg to about 100 mg, or 100 mg to about 200 mg, BIW. For example, combinations of the present disclosure can be administered at an amount of about: 1 mg to about 10 mg, 1 mg to about 25 mg, 1 mg to about 50 mg, 5 mg to about 10 mg, 5 mg to about 25 mg, 5 mg to about 50 mg, 10 mg to about 25 mg, 10 mg to about 50 mg, 50 mg to about 100 mg, or 100 mg to about 200 mg, TIW. For example, combinations of the present disclosure can be administered at an amount of about: 1 mg to about 10 mg, 1 mg to about 25 mg, 1 mg to about 50 mg, 5 mg to about 10 mg, 5 mg to about 25 mg, 5 mg to about 50 mg, 10 mg to about 25 mg, 10 mg to about 50 mg, 50 mg to about 100 mg, or 100 mg to about 200 mg, QW. For example, combinations of the present disclosure can be administered at an amount of about: 1 mg to about 10 mg, 1 mg to about 25 mg, 1 mg to about 50 mg, 5 mg to about 10 mg, 5 mg to about 25 mg, 5 mg to about 50 mg, 10 mg to about 25 mg, 10 mg to about 50 mg, 50 mg to about 100 mg, or 100 mg to about 200 mg, Q2W. Administration of combinations of the present disclosure can be continuous. Administration of combinations of the present disclosure can be intermittent.

[0146] For example, combinations of the present disclosure can be administered at an amount of about: 0.0001 mg / kg to about 200 mg / kg, 0.001 mg / kg to about 200 mg / kg, 0.01 mg / kg to about 200 mg / kg, 0.01 mg / kg to about 150 mg / kg, 0.01 mg / kg to about 100 mg / kg, 0.01 mg / kg to about 50 mg / kg, 0.01 mg / kg to about 25 mg / kg, 0.01 mg / kg to about 10 mg / kg, or 0.01 mg / kg to about 5 mg / kg, 0.05 mg / kg to about 200 mg / kg, 0.05 mg / kg to about 150 mg / kg, 0.05 mg / kg to about 100 mg / kg, 0.05 mg / kg to about 50 mg / kg, 0.05 mg / kg to about 25 mg / kg, 0.05 mg / kg to about 10 mg / kg, or 0.05 mg / kg to about 5 mg / kg, 0.5 mg / kg to about 200 mg / kg, 0.5 mg / kg to about 150 mg / kg, 0.5 mg / kg to about 100 mg / kg, 0.5 mg / kg to about 50 mg / kg, 0.5 mg / kg to about 25 mg / kg, 0.5 mg / kg to about 10 mg / kg, or 0.5 mg / kg to about 5 mg / kg, QD. For example, combinations of the present disclosure can be administered at an amount of about: 0.0001 mg / kg to about 200 mg / kg, 0.001 mg / kg to about 200 mg / kg, 0.5 mg / kg to about 200 mg / kg, 0.5 mg / kg to about 150 mg / kg, 0.5 mg / kg to about 100 mg / kg, 0.5 mg / kg to about 50 mg / kg, 0.5 mg / kg to about 25 mg / kg, 0.5 mg / kg to about 10 mg / kg, or 0.5 mg / kg to about 5 mg / kg, BIW. For example, combinations of the present disclosure can be administered at an amount of about: 0.0001 mg / kg to about 200 mg / kg,0.001 mg / kg to about 200 mg / kg, 0.5 mg / kg to about 200 mg / kg, 0.5 mg / kg to about 150 mg / kg, 0.5 mg / kg to about 100 mg / kg, 0.5 mg / kg to about 50 mg / kg, 0.5 mg / kg to about 25 mg / kg, 0.5 mg / kg to about 10 mg / kg, or 0.5 mg / kg to about 5 mg / kg, TIW. For example, combinations of the present disclosure can be administered at an amount of about: 0.0001 mg / kg to about 200 mg / kg, 0.001 mg / kg to about 200 mg / kg, 0.5 mg / kg to about 200 mg / kg, 0.5 mg / kg to about 150 mg / kg, 0.5 mg / kg to about 100 mg / kg, 0.5 mg / kg to about 50 mg / kg, 0.5 mg / kg to about 25 mg / kg, 0.5 mg / kg to about 10 mg / kg, or 0.5 mg / kg to about 5 mg / kg, QW. For example, combinations of the present disclosure can be administered at an amount of about: 0.0001 mg / kg to about 200 mg / kg, 0.001 mg / kg to about 200 mg / kg, 0.5 mg / kg to about 200 mg / kg, 0.5 mg / kg to about 150 mg / kg, 0.5 mg / kg to about 100 mg / kg, 0.5 mg / kg to about 50 mg / kg, 0.5 mg / kg to about 25 mg / kg, 0.5 mg / kg to about 10 mg / kg, or 0.5 mg / kg to about 5 mg / kg, Q2W. In one example, combinations of the present disclosure can be administered at an amount of about 15 mg / kg to about 75 mg / kg, QD. In another example, combinations of the present disclosure can be administered at an amount of about 20 mg / kg to about 50 mg / kg. In still another example, combinations of the present disclosure can be administered at an amount of about 0.001 mg / kg, 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.5 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 40 mg / kg, 50 mg / kg, 60 mg / kg, 70 mg / kg, 80 mg / kg, 90 mg / kg, 100 mg / kg, 125 mg / kg, 150 mg / kg, 175 mg / kg, or 200 mg / kg. Administration of combinations of the present disclosure can be continuous. Administration of combinations of the present disclosure can be intermittent.

[0147] For example, combinations of the present disclosure can be administered at an amount of about: 1 mg / kg to about 200 mg / kg, 1 mg / kg to about 150 mg / kg, 1 mg / kg to about 100 mg / kg, 1 mg / kg to about 50 mg / kg, 1 mg / kg to about 25 mg / kg, 1 mg / kg to about 10 mg / kg, or 1 mg / kg to about 5 mg / kg, QD. For example, combinations of the present disclosure can be administered at an amount of about: 1 mg / kg to about 200 mg / kg, 1 mg / kg to about 150 mg / kg, 1 mg / kg to about 100 mg / kg, 1 mg / kg to about 50 mg / kg, 1 mg / kg to about 25 mg / kg, 1 mg / kg to about 10 mg / kg, or 1 mg / kg to about 5 mg / kg, BIW. For example, combinations of the present disclosure can be administered at an amount of about: 1 mg / kg to about 200 mg / kg, 1 mg / kg to about 150 mg / kg, 1 mg / kg to about 100 mg / kg, 1 mg / kg to about 50 mg / kg, 1 mg / kg to about 25 mg / kg, 1 mg / kg to about 10 mg / kg, or 1 mg / kg to about 5 mg / kg, TIW. For example, combinations of the present disclosure can be administered at an amount of about: 1 mg / kg to about 200 mg / kg, 1 mg / kg to about 150 mg / kg, 1 mg / kg to about 100 mg / kg, 1 mg / kg to about 50 mg / kg, 1 mg / kg to about 25 mg / kg,1 mg / kg to about 10 mg / kg, or 1 mg / kg to about 5 rng / kg, QW. For example, combinations of the present disclosure can be administered at an amount of about: 1 mg / kg to about 200 mg / kg, 1 mg / kg to about 150 mg / kg, 1 mg / kg to about 100 mg / kg, 1 mg / kg to about 50 mg / kg, 1 mg / kg to about 25 mg / kg, 1 mg / kg to about 10 mg / kg, or 1 mg / kg to about 5 mg / kg, Q2W. In one example, combinations of the present disclosure can be administered at an amount of about 15 mg / kg to about 75 mg / kg, QD. In another example, combinations of the present disclosure can be administered at an amount of about 20 mg / kg to about 50 mg / kg. In still another example, combinations of the present disclosure can be administered at an amount of about 0.001 mg / kg, 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.5 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 40 mg / kg, 50 mg / kg, 60 mg / kg, 70 mg / kg, 80 mg / kg, 90 mg / kg, 100 mg / kg, 125 mg / kg, 150 mg / kg, 175 mg / kg, or 200 mg / kg. Administration of combinations of the present disclosure can be continuous. Administration of combinations of the present disclosure can be intermittent.

[0148] As used herein, the term daily is intended to mean that a therapeutic compound of a combination described herein, such as a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor, is administered once or more than once each day for a period of time. The term continuous is intended to mean that a therapeutic compound of a combination described herein, such as a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor, is administered daily for an uninterrupted period of at least 10 days to 52 weeks, to multiple years. The term intermittent or intermittently as used herein is intended to mean stopping and starting at either regular or irregular intervals. For example, intermittent administration of a therapeutic compound of a combination described herein, such as a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor, includes administration for one to six days per week (e.g., 2 to 3 times per week or QD), administration in cycles (e.g., daily administration for two to eight consecutive weeks, then a rest period with no administration at least one day), or, for example, administration on alternate days.

[0149] The combinations described herein can be administered in a regimen. The regimen can be structured to provide therapeutically effective amounts of a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor in the molar ratios provided herein, optionally including another anti-neurodegenerative agent, over a predetermined period of time (e.g., an administration time). The regimen can be structured to limit or prevent side-effects or undesired complications of each of the components of thecombination described herein. The regimen can be structured in a manner that results in increased effect for both therapies of the combination (e.g., synergy). Regimens useful for treating neurodegenerative disorders can include any number of days, months or years of administration which can be repeated as necessary. Administration periods can be broken by a rest period that includes no administration of at least one therapy. For example, a regimen can include administration periods that include 2, 3, 5, 7, 10, 15, 21, 28, or more days. These periods can be repeated. For example, a regimen can include a set number of days as previously described where the regimen is repeated 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or more times.

[0150] Regimens can include a rest period of at least 1, 2, 3, 5, 7, 10, or more days, where at least one therapy is no longer administered to a patient. The rest period can be determined by, for example, monitoring the reaction of the patient to the drug or by measuring the efficacy of the treatment. A rest period can be applicable to a single therapy, such that only one therapy of a combination described herein is discontinued in the rest period but the other therapy(ies) are still administered. Rest periods can be applied to all of the therapies administered to the subject such that the subject receives no therapy for a set period of time during the rest period.

[0151] Regimens described herein for the treatment of neurodegenerative disorders using the combinations described herein can be continued until disease progression is changed or unacceptable toxicity occurs.

[0152] Regimens for administration of combinations described herein include, for example administration one of a phosphodiesterase 5 inhibitor or an acetylcholinesterase inhibitor can be administered BIW, and administration of another member of the group TIW. For example, one of a phosphodiesterase 5 inhibitor or an acetylcholinesterase inhibitor can be administered QD for about 21 days, and another member of the group can be administered Q2W or Q4W. For example, one of a phosphodiesterase 5 inhibitor or an acetylcholinesterase inhibitor can be administered BIW or TIW, and another member of the group can be administered Q2W. In another exemplary regimen, one of a phosphodiesterase 5 inhibitor or an acetylcholinesterase inhibitor can be administered BIW or TIW, and another member of the group can be administered BIW for 2 or 3 weeks. In still another exemplary regimen, one of a phosphodiesterase 5 inhibitor or an acetylcholinesterase inhibitor can be administered BIW or TIW, and another member of the group can be administered Q4W. In still another exemplary regimen, one of a phosphodiesterase 5 inhibitor or an acetylcholinesterase inhibitor can be administered BIW, and another member of the group can be administeredQ2W, Q3W, or Q4W. In certain instances, such regimens include administration of another anti-neurodegenerative agent administered Q2W, Q3W, or Q4W. In yet another exemplary regimen, one of a phosphodiesterase 5 inhibitor or an acetylcholinesterase inhibitor can be administered TIW, and another member of the group can be administered Q2W, Q3W, or Q4W.

[0153] It should also be appreciated that the combinations described herein for treating neurodegenerative disorders can be coadministered with other active agents other than those present in the combinations described herein (e.g., anti-neurodegenerative agents). Regimens for administration of a combination described herein, including the exemplary regimens set forth above, can be modified as necessary to include administration of such active agents. Administration of such active agents, e.g., anti-neurodegenerative agents, can be performed QD, QW, QM, BID, BIW, TIW, Q2W, Q3W, or Q4W, or in accordance with prescribing information for such anti-neurodegenerative agents as set forth, for example, in a package insert.

[0154] The present disclosure demonstrates synergistic effects of combining a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor on reducing proinflammatory cytokines, particularly interleukin 1 beta (IL1 P). FIG. 1 illustrates the effects of various combinations of mirodenafil and donepezil on ILip reduction in a bar graph format.

[0155] As shown in FIG. 1, treatment with mirodenafil or donepezil alone resulted in modest decreases in ILip levels. However, when mirodenafil and donepezil were combined, a marked enhancement in ILip reduction was observed. This synergistic effect became more pronounced as the concentrations of both compounds increased.

[0156] Table 1 presents a detailed table of the data represented in FIG. 1, providing quantitative measurements of the ILip reduction for different concentration combinations of mirodenafil and donepezil.Table 1Ao: Percentage Decrease of ARI 001 treated alone; Bo; Percentage Decrease of Donepezil treated alone; A+B: Percentage Decrease of combined treatment of ARI 001 and Donepezil Synergistic Effect Evaluation: >1 Synergistic Effect; =1 Additive Effect; <1 Antagonistic Effect

[0157] The table includes a column for synergistic effect evaluation, calculated as (Ao + Bo) / (A+B), where Ao represents the percentage decrease with mirodenafil alone, Bo represents the percentage decrease with donepezil alone, and A+B represents the percentage decrease with combined treatment.

[0158] In some cases, the combination of 2 pM mirodenafil and 2 pM donepezil resulted in an 11.89% decrease in ILip levels, which was greater than the sum of their individual effects. The synergistic effect evaluation for this combination was 1.3, indicating a synergistic interaction.

[0159] In other cases, higher concentrations of both compounds led to even more pronounced synergistic effects. For example, the combination of 10 pM mirodenafil and 20 pM donepezil resulted in a 76.51% reduction in ILip levels, with a synergistic effect evaluation of 1.2.

[0160] The composition may inhibit other proinflammatory cytokines such as IL-6 or tumor necrosis factor alpha (TNFa) in addition to ILip. This inhibition of proinflammatory factors may contribute to the reduction of neuroinflammation, which may be beneficial in the treatment of neurodegenerative disorders.

[0161] The synergistic effects observed in the combination of mirodenafil and donepezil suggest that the composition may provide enhanced anti-inflammatory benefits compared to either compound alone. This synergistic interaction may allow for lower doses of each compound to be used while still achieving significant reductions in proinflammatory cytokine levels.

[0162] The present disclosure also demonstrates synergistic effects of combining a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor on reducing tumor necrosis factor alpha (TNFa) levels. FIG. 2 illustrates the effects of various combinations of mirodenafil and donepezil on TNFa reduction in a bar graph format.

[0163] As shown in FIG. 2, treatment with mirodenafil or donepezil alone resulted in modest decreases in TNFa levels. However, when mirodenafil and donepezil were combined, a marked enhancement in TNFa reduction was observed. This synergistic effect became more pronounced as the concentrations of both compounds increased.

[0164] Table 2 presents a detailed table of the data represented in FIG. 2, providing quantitative measurements of the TNFa reduction for different concentration combinations of mirodenafil and donepezil.Table 2Ao: Percentage Decrease of ARI 001 treated alone;Bo; Percentage Decrease of Donepezil treated alone;A+B: Percentage Decrease of combined treatment of ARI 001 and DonepezilSynergistic Effect Evaluation: >1 Synergistic Effect; =1 Additive Effect; <1 Antagonistic Effect

[0165] The table includes a column for synergistic effect evaluation, calculated as(Ao + Bo) / (A+B), where Ao represents the percentage decrease with mirodenafil alone, Bo represents the percentage decrease with donepezil alone, and A+B represents the percentage decrease with combined treatment.

[0166] In some cases, the combination of 2 pM mirodenafil and 2 pM donepezil resulted in an 11.68% decrease in TNFa levels, which was greater than the sum of their individual effects. The synergistic effect evaluation for this combination was 1.2, indicating a synergistic interaction.

[0167] In other cases, higher concentrations of both compounds led to even more pronounced synergistic effects. For example, the combination of 10 pM mirodenafil and 20 pM donepezil resulted in an 83.61% reduction in TNFa levels, with a synergistic effect evaluation of 1.1.

[0168] The synergistic effects observed in the combination of mirodenafil and donepezil on TNFa reduction suggest that the composition may provide enhanced antiinflammatory benefits compared to either compound alone. This synergistic interaction may allow for lower doses of each compound to be used while still achieving significant reductions in TNFa levels.

[0169] In some cases, the reduction of TNFa levels may contribute to the overall anti-inflammatory effects of the composition. TNFa may be a key mediator of inflammation in neurodegenerative disorders, and its reduction may help alleviate neuroinflammation associated with these conditions.

[0170] The data presented in FIG. 2 and Table 2 demonstrate that the combination of a phosphodiesterase 5 inhibitor (mirodenafil) and an acetylcholinesterase inhibitor (donepezil) may provide synergistic effects in reducing proinflammatory cytokines such as TNFa. This synergistic interaction may be beneficial in the treatment of neurodegenerative disorders where inflammation may play a significant role in disease progression.

[0171] The present disclosure demonstrates synergistic effects of combining a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor on reducing interleukin 1 beta (ILip) levels. FIG. 3 illustrates the effects of various combinations of mirodenafil and galantamine on ILip reduction in a bar graph format.

[0172] As shown in FIG. 3, treatment with mirodenafil or galantamine alone resulted in modest decreases in ILip levels. However, when mirodenafil and galantamine were combined, a marked enhancement in ILip reduction was observed. This synergistic effect became more pronounced as the concentrations of both compounds increased.

[0173] Table 3 presents a detailed table of the data represented in FIG. 3, providingquantitative measurements of the ILip reduction for different concentration combinations of mirodenafil and galantamine.Table 3Ao: Percentage Decrease of ARI 001 treated alone;Bo; Percentage Decrease of Galantamine treated alone;A+B: Percentage Decrease of combined treatment of ARI 001 and GalantamineSynergistic Effect Evaluation: >1 Synergistic Effect; =1 Additive Effect; <1 Antagonistic Effect

[0174] The table includes a column for synergistic effect evaluation, calculated as (Ao + Bo) / (A+B), where Ao represents the percentage decrease with mirodenafil alone, Bo represents the percentage decrease with galantamine alone, and A+B represents the percentage decrease with combined treatment.

[0175] In some cases, the combination of 2 pM mirodenafil and 2 pM galantamine resulted in a 9.52% decrease in ILip levels, which was greater than the sum of their individual effects. The synergistic effect evaluation for this combination was 1.1, indicating a synergistic interaction.

[0176] In other cases, higher concentrations of both compounds led to even more pronounced synergistic effects. For example, the combination of 20 pM mirodenafil and 20 pM galantamine resulted in an 83.74% reduction in ILip levels, with a synergistic effect evaluation of 1.2.

[0177] The data presented in FIG. 3 and Table 3 demonstrate that the combination of mirodenafil and galantamine may provide synergistic effects in reducing ILip levels across various concentration combinations. In some cases, the synergistic effect evaluationvalues ranged from 1.1 to 1.3, indicating consistent synergistic interactions between the two compounds.

[0178] The synergistic effects observed in the combination of mirodenafil and galantamine suggest that the composition may provide enhanced anti-inflammatory benefits compared to either compound alone. This synergistic interaction may allow for lower doses of each compound to be used while still achieving significant reductions in ILip levels.

[0179] In some cases, the reduction of ILip levels may contribute to the overall anti-inflammatory effects of the composition. ILip may be a key mediator of inflammation in neurodegenerative disorders, and its reduction may help alleviate neuroinflammation associated with these conditions.

[0180] The present disclosure demonstrates synergistic effects of combining a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor on reducing tumor necrosis factor alpha (TNFa) levels. FIG. 4 illustrates the effects of various combinations of mirodenafil and galantamine on TNFa reduction in a bar graph format.

[0181] As shown in FIG. 4, treatment with mirodenafil or galantamine alone resulted in modest decreases in TNFa levels. However, when mirodenafil and galantamine were combined, a marked enhancement in TNFa reduction was observed. This synergistic effect became more pronounced as the concentrations of both compounds increased.

[0182] Table 4 presents a detailed table of the data represented in FIG. 4, providing quantitative measurements of the TNFa reduction for different concentration combinations of mirodenafil and galantamine.Table 4Ao: Percentage Decrease of ARI 001 treated alone;Bo; Percentage Decrease of Galantamine treated alone;A+B: Percentage Decrease of combined treatment of ARI 001 and GalantamineSynergistic Effect Evaluation: >1 Synergistic Effect; =1 Additive Effect; <1 Antagonistic Effect

[0183] The table includes a column for synergistic effect evaluation, calculated as (Ao + Bo) / (A+B), where Ao represents the percentage decrease with mirodenafil alone, Bo represents the percentage decrease with galantamine alone, and A+B represents the percentage decrease with combined treatment.

[0184] In some cases, the combination of 2 pM mirodenafil and 2 pM galantamine resulted in a 12.01% decrease in TNFa levels, which was greater than the sum of their individual effects. The synergistic effect evaluation for this combination was 1.1, indicating a synergistic interaction.

[0185] In other cases, higher concentrations of both compounds led to even more pronounced synergistic effects. For example, the combination of 10 pM mirodenafil and 20 pM galantamine resulted in a 76.08% reduction in TNFa levels, with a synergistic effect evaluation of 1.2.

[0186] The data presented in FIG. 4 and Table 4 demonstrate that the combination of mirodenafil and galantamine may provide synergistic effects in reducing TNFa levels across various concentration combinations. In some cases, the synergistic effect evaluation values ranged from 1.1 to 1.4, indicating consistent synergistic interactions between the two compounds.

[0187] The synergistic effects observed in the combination of mirodenafil and galantamine suggest that the composition may provide enhanced anti-inflammatory benefits compared to either compound alone. This synergistic interaction may allow for lower doses of each compound to be used while still achieving significant reductions in TNFa levels.

[0188] In some cases, the reduction of TNFa levels may contribute to the overall anti-inflammatory effects of the composition. TNFa may be a key mediator of inflammation in neurodegenerative disorders, and its reduction may help alleviate neuroinflammation associated with these conditions.

[0189] The present disclosure demonstrates synergistic effects of combining a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor on reducing interleukin 1 beta (IL 113) levels. FIG. 5 illustrates the effects of various combinations of mirodenafil and rivastigmine on ILip reduction in a bar graph format.

[0190] As shown in FIG. 5, treatment with mirodenafil or rivastigmine aloneresulted in modest decreases in ILip levels. However, when mirodenafil and rivastigmine were combined, a marked enhancement in ILip reduction was observed. This synergistic effect became more pronounced as the concentrations of both compounds increased.

[0191] Table 5 presents a detailed table of the data represented in FIG. 5, providing quantitative measurements of the ILip reduction for different concentration combinations of mirodenafil and rivastigmine.Table 5Ao: Percentage Decrease of ARI 001 treated alone;Bo; Percentage Decrease of Rivastigmine treated alone;A+B: Percentage Decrease of combined treatment of ARI 001 and RivastigmineSynergistic Effect Evaluation: >1 Synergistic Effect; =1 Additive Effect; <1 Antagonistic Effect

[0192] The table includes a column for synergistic effect evaluation, calculated as (Ao + Bo) / (A+B), where Ao represents the percentage decrease with mirodenafil alone, Bo represents the percentage decrease with rivastigmine alone, and A+B represents the percentage decrease with combined treatment.

[0193] In some cases, the combination of 2 pM mirodenafil and 2 pM rivastigmine resulted in an 8.17% decrease in ILip levels, which was greater than the sum of their individual effects. The synergistic effect evaluation for this combination was 1.1, indicating a synergistic interaction.

[0194] In other cases, higher concentrations of both compounds led to even more pronounced synergistic effects. For example, the combination of 20 pM mirodenafil and 10 pM rivastigmine resulted in a 67.53% reduction in ILip levels, with a synergistic effectevaluation of 1.1.

[0195] The data presented in FIG. 5 and Table 5 demonstrate that the combination of mirodenafil and rivastigmine may provide synergistic effects in reducing ILip levels across various concentration combinations. In some cases, the synergistic effect evaluation values ranged from 1.0 to 1.1, indicating consistent synergistic interactions between the two compounds.

[0196] The synergistic effects observed in the combination of mirodenafil and rivastigmine suggest that the composition may provide enhanced anti-inflammatory benefits compared to either compound alone. This synergistic interaction may allow for lower doses of each compound to be used while still achieving significant reductions in ILip levels.

[0197] In some cases, the reduction of ILip levels may contribute to the overall anti-inflammatory effects of the composition. ILip may be a key mediator of inflammation in neurodegenerative disorders, and its reduction may help alleviate neuroinflammation associated with these conditions.

[0198] The present disclosure demonstrates synergistic effects of combining a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor on reducing tumor necrosis factor alpha (TNFa) levels. FIG. 6 illustrates the effects of various combinations of mirodenafil and rivastigmine on TNFa reduction in a bar graph format.

[0199] As shown in FIG. 6, treatment with mirodenafil or rivastigmine alone resulted in modest decreases in TNFa levels. However, when mirodenafil and rivastigmine were combined, a marked enhancement in TNFa reduction was observed. This synergistic effect became more pronounced as the concentrations of both compounds increased.

[0200] Table 6 presents a detailed table of the data represented in FIG. 6, providing quantitative measurements of the TNFa reduction for different concentration combinations of mirodenafil and rivastigmine.Table 6Ao: Percentage Decrease of ARI 001 treated alone;Bo; Percentage Decrease of Rivastigmine treated alone;A+B: Percentage Decrease of combined treatment of ARI 001 and RivastigmineSynergistic Effect Evaluation: >1 Synergistic Effect; =1 Additive Effect; <1 Antagonistic Effect

[0201] The table includes a column for synergistic effect evaluation, calculated as (Ao + Bo) / (A+B), where Ao represents the percentage decrease with mirodenafil alone, Bo represents the percentage decrease with rivastigmine alone, and A+B represents the percentage decrease with combined treatment.

[0202] In some cases, the combination of 2 pM mirodenafil and 2 pM rivastigmine resulted in an 11.93% decrease in TNFa levels, which was greater than the sum of their individual effects. The synergistic effect evaluation for this combination was 1.2, indicating a synergistic interaction.

[0203] In other cases, higher concentrations of both compounds led to even more pronounced synergistic effects. For example, the combination of 20 pM mirodenafil and 10 pM rivastigmine resulted in a 65.93% reduction in TNFa levels, with a synergistic effect evaluation of 1.1.

[0204] The data presented in FIG. 6 and Table 6 demonstrate that the combination of mirodenafil and rivastigmine may provide synergistic effects in reducing TNFa levels across various concentration combinations. In some cases, the synergistic effect evaluation values ranged from 1.0 to 1.2, indicating consistent synergistic interactions between the two compounds.

[0205] The synergistic effects observed in the combination of mirodenafil and rivastigmine suggest that the composition may provide enhanced anti-inflammatory benefits compared to either compound alone. This synergistic interaction may allow for lower doses of each compound to be used while still achieving significant reductions in TNFa levels.

[0206] In some cases, the reduction of TNFa levels may contribute to the overall anti-inflammatory effects of the composition. TNFa may be a key mediator of inflammation in neurodegenerative disorders, and its reduction may help alleviate neuroinflammation associated with these conditions.

[0207] The present disclosure demonstrates synergistic effects of combining a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor on reducing amyloid beta 42 (AP42) accumulation. FIG. 7 illustrates the effects of various combinations of mirodenafil and donepezil on Ap42 reduction in a bar graph format.

[0208] As shown in FIG. 7, treatment with mirodenafil or donepezil alone resulted in modest decreases in Ap42 levels. However, when mirodenafil and donepezil were combined, a marked enhancement in Ap42 reduction was observed. This synergistic effect became more pronounced as the concentrations of both compounds increased.

[0209] Table 7 presents a detailed table of the data represented in FIG. 7, providing quantitative measurements of the AP42 reduction for different concentration combinations of mirodenafil and donepezil.Table 7

[0210] The table includes columns for average concentration (pg / ml), average reduction rate (%), and p-values comparing the combination treatments to individual treatments.

[0211] In some cases, the combination of 0.1 pM mirodenafil and 0.1 pM donepezil resulted in a 5.487% decrease in Ap42 levels, which was greater than the sum of theirindividual effects. The p-value for this combination was 0.0141, indicating statistical significance.

[0212] In other cases, higher concentrations of both compounds led to even more pronounced synergistic effects. For example, the combination of 0.5 pM mirodenafil and 0.5 pM donepezil resulted in an 18.268% reduction in Ap42 levels, with a p-value of 0.0000, indicating high statistical significance.

[0213] The data presented in FIG. 7 and Table 7 demonstrate that the combination of mirodenafil and donepezil may provide synergistic effects in reducing Ap42 levels across various concentration combinations. In some cases, the reduction rates ranged from approximately 5% to 18%, with all combinations showing statistically significant synergistic effects.

[0214] The synergistic effects observed in the combination of mirodenafil and donepezil suggest that the composition may provide enhanced benefits in reducing AP42 accumulation compared to either compound alone. This synergistic interaction may allow for lower doses of each compound to be used while still achieving significant reductions in Ap42 levels.

[0215] In some cases, the reduction of AP42 levels may contribute to the inhibition of Ap Oligomer / Fibril formation by reducing Ap aggregation. Ap42 may be a key component in the formation of amyloid plaques associated with neurodegenerative disorders, and its reduction may help prevent or slow down the progression of these conditions.

[0216] The composition may inhibit Ap Oligomer / Fibril formation through multiple mechanisms. In addition to reducing Ap42 accumulation, the composition may also interfere with the aggregation process of Ap monomers into oligomers and fibrils. This multifaceted approach to reducing Ap aggregation may provide more comprehensive protection against the neurotoxic effects associated with Ap accumulation in neurodegenerative disorders.

[0217] The present disclosure demonstrates synergistic effects of combining a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor on reducing amyloid beta 42 (AP42) accumulation. FIG. 8 illustrates the effects of various combinations of mirodenafil and galantamine on AP42 reduction in a bar graph format.

[0218] As shown in FIG. 8, treatment with mirodenafil or galantamine alone resulted in modest decreases in Ap42 levels. However, when mirodenafil and galantamine were combined, a marked enhancement in Ap42 reduction was observed. This synergistic effect became more pronounced as the concentrations of both compounds increased.

[0219] Table 8 presents a detailed table of the data represented in FIG. 8, providing quantitative measurements of the Ap42 reduction for different concentration combinations of mirodenafil and galantamine.Table 8

[0220] The table includes columns for average concentration (pg / ml), average reduction rate (%), and p-values comparing the combination treatments to individual treatments.

[0221] In some cases, the combination of 0.1 pM mirodenafil and 0.1 pM galantamine resulted in a 4.318% decrease in Ap42 levels, which was greater than the sum of their individual effects. The p-value for this combination was 0.261, indicating a trend towards statistical significance.

[0222] In other cases, higher concentrations of both compounds led to even more pronounced synergistic effects. For example, the combination of 0.5 pM mirodenafil and 0.5 pM galantamine resulted in a 20.429% reduction in Ap42 levels, with a p-value of 0.004, indicating high statistical significance.

[0223] The data presented in FIG. 8 and Table 8 demonstrate that the combination of mirodenafil and galantamine may provide synergistic effects in reducing Ap42 levels across various concentration combinations. In some cases, the reduction rates ranged from approximately 4% to 20%, with higher concentration combinations showing statistically significant synergistic effects.

[0224] The synergistic effects observed in the combination of mirodenafil and galantamine suggest that the composition may provide enhanced benefits in reducing AP42 accumulation compared to either compound alone. This synergistic interaction may allow for lower doses of each compound to be used while still achieving significant reductions in Ap42 levels.

[0225] In some cases, the reduction of Ap42 levels may contribute to the inhibition of P-Amyloidogenic Processing by decreasing BACE-1 activity. BACE-1 may be a key enzyme involved in the production of Ap42, and its reduction may help prevent or slow down the accumulation of AP42 in neurodegenerative disorders.

[0226] The composition may reduce extracellular Ap monomers, oligomers & Ap Fibril / Plaque by increasing the cerebral blood flow. In some cases, the increased cerebral blood flow may enhance the clearance of Ap species from the brain, leading to reduced accumulation of these potentially neurotoxic molecules.

[0227] The multi-faceted approach of the composition, combining the reduction of AP42 production through BACE-1 inhibition and enhanced clearance through increased cerebral blood flow, may provide a more comprehensive strategy for addressing Ap-related pathology in neurodegenerative disorders.

[0228] The present disclosure demonstrates synergistic effects of combining a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor on reducing amyloid beta 42 (AP42) accumulation. FIG. 9 illustrates the effects of various combinations of mirodenafil and rivastigmine on Ap42 reduction in a bar graph format.

[0229] As shown in FIG. 9, treatment with mirodenafil or rivastigmine alone resulted in modest decreases in Ap42 levels. However, when mirodenafil and rivastigmine were combined, a marked enhancement in Ap42 reduction was observed. This synergistic effect became more pronounced as the concentrations of both compounds increased.

[0230] Table 9 presents a detailed table of the data represented in FIG. 9, providing quantitative measurements of the AP42 reduction for different concentration combinations of mirodenafil and rivastigmine.Table 9

[0231] The table includes columns for average concentration (pg / ml), average reduction rate (%), and p-values comparing the combination treatments to individualtreatments.

[0232] In some cases, the combination of 0.1 pM mirodenafil and 0.1 pM rivastigmine resulted in an 8.546% decrease in Ap42 levels, which was greater than the sum of their individual effects. The p-value for this combination was 0.017, indicating statistical significance.

[0233] In other cases, higher concentrations of both compounds led to even more pronounced synergistic effects. For example, the combination of 0.5 pM mirodenafil and 0.5 pM rivastigmine resulted in a 17.665% reduction in Ap42 levels, with a p-value of 0.000, indicating high statistical significance.

[0234] The data presented in FIG. 9 and Table 9 demonstrate that the combination of mirodenafil and rivastigmine may provide synergistic effects in reducing Ap42 levels across various concentration combinations. In some cases, the reduction rates ranged from approximately 8% to 17%, with all combinations showing statistically significant synergistic effects.

[0235] The synergistic effects observed in the combination of mirodenafil and rivastigmine suggest that the composition may provide enhanced benefits in reducing Ap42 accumulation compared to either compound alone. This synergistic interaction may allow for lower doses of each compound to be used while still achieving significant reductions in Ap42 levels.

[0236] In some cases, the reduction of Ap42 levels may contribute to the restoration of synaptic plasticity. The composition may activate Wint Signaling through inhibition of DKK-1, which may play a role in maintaining synaptic function and plasticity in the presence of reduced Ap42 levels.

[0237] The composition may suppress neuronal cell death and promote neurogenesis, synaptogenesis and / or angiogenesis by activation of NO / cGMP / PKG / CREB Pathway. In some cases, the reduction in Ap42 levels may contribute to a more favorable environment for these neuroprotective and regenerative processes to occur.

[0238] The multi-faceted approach of the composition, combining the reduction of AP42 accumulation with the activation of neuroprotective pathways, may provide a comprehensive strategy for addressing the complex pathology of neurodegenerative disorders. The synergistic effects observed in Ap42 reduction may translate to enhanced neuroprotection and potential disease-modifying benefits in conditions characterized by Ap42 accumulation.

[0239] The experimental results presented in this disclosure demonstrate thesynergistic effects of combining a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor for treating neurodegenerative disorders. The key findings from these experiments highlight the potential of this pharmaceutical composition to address multiple pathological mechanisms associated with conditions such as Alzheimer's disease, Parkinson's disease, and other related disorders.

[0240] In some cases, the composition may inhibit the production of amyloid precursor protein (APP) and reduce amyloid beta (AP) accumulation by suppressing the positive feedback loop for Ap production. This mechanism may be particularly important in addressing the underlying pathology of Alzheimer's disease, where Ap accumulation may be a key driver of neurodegeneration.

[0241] The composition may also inhibit the formation of Ap Fibril / plaque by removing intracellular toxic and soluble Ap oligomers through the activation of autophagy. Autophagy may be a cellular process that helps clear abnormal protein aggregates, and its activation by the composition may provide an additional protective mechanism against the neurotoxic effects of Ap accumulation.

[0242] The synergistic effects observed in reducing proinflammatory cytokines such as ILip and TNFa suggest that the composition may have potent anti-inflammatory properties. In some cases, this anti-inflammatory action may help mitigate the chronic neuroinflammation associated with various neurodegenerative disorders.

[0243] The demonstrated ability of the composition to reduce Ap42 levels across multiple experiments with different acetylcholinesterase inhibitors (donepezil, galantamine, and rivastigmine) suggests a robust and consistent effect on Ap pathology. This consistency across different drug combinations may indicate a broader applicability of the phosphodiesterase 5 inhibitor and acetylcholinesterase inhibitor combination approach.

[0244] The potential applications of this pharmaceutical composition may extend beyond Alzheimer's disease to other neurodegenerative conditions where inflammation, protein aggregation, and synaptic dysfunction play significant roles. In some cases, the multifaceted approach of the composition, addressing both Ap pathology and neuroinflammation, may provide a more comprehensive treatment strategy compared to single-target approaches.

[0245] In conclusion, the synergistic effects observed with the combination of a phosphodiesterase 5 inhibitor and an acetylcholinesterase inhibitor present a promising approach for addressing the complex pathology of neurodegenerative disorders. The composition's ability to target multiple disease mechanisms, including Ap accumulation, neuroinflammation, and potentially synaptic dysfunction, may offer new avenues fordeveloping more effective treatments for these challenging neurological conditions.

[0246] A number of implementations have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the disclosure. Accordingly, other implementations are within the scope of the following claims.

[0247] EXAMPLES

[0248] Aspects of the present teachings may be further understood in light of the following examples, which should not be construed as limiting the scope of the present teachings in any way.

[0249] Experimental Example 1. Culture method of IMG cells

[0250] The IMG cell, mouse microglia cell line used in the experiment, and it was cultured in a CO2 incubator (311-TIF, Thermo Fisher Scientific Forma, MA, USA) under the conditions of 37°C and 5% CO2 using a DMEM Complete Medium (HyClone) containing 10% fetal bovine serum (FBS; Australian Orgin, HyClone, Logan, UT, USA) and 1% penicillin / streptomycin (P / S; HyClone).

[0251] 2xl05cells were seeded in each 6-well plate’s well and were incubated for 24 hours in the above condition.

[0252] After 24 hour incubation, 100 ng / ml of LPS and the drugs, AR1001 and AchEIs (Donepezil, Rivastigmine, Galantamine), were treated in the concentration of 2, 10, 20 pM individually or combined.

[0253] Experimental Example 2. RNA Extraction and cDNA Synthesis

[0254] Scrape the cells in the well using a scraper, put 2 mL of the culture solution in a 15 mL conical tube, centrifuge at 3,000 RPM for 5 minutes, discard the culture solution except for the pellets, and treat each cell with 1 mL of Trizol.

[0255] Transfer to 1.5 mL e-tube, add 0.2 mL of Chloroform, vortex for 1 minute, and store at room temperature for 2 minutes.

[0256] After centrifugation at 12,000 g, 4 °C for 10 minutes, 500 pL of the supernatant was separated and 500 pL of Iso-propanol was added to the separated supernatant and was put at room temperature for 10 minutes, and then centrifuged at 12,000 g, 4 °C for 10 minutes.

[0257] The supernatant was discarded and the pellet was washed with 75% EtOHtwice.

[0258] EtOH was discarded all, and the RNA pellet was dried and dissolved in 10 pL DEPC Treated Water.

[0259] cDNA Synthesis was done following the PrimeScript™ II 1st strand cDNA Synthesis Kit (Takara).

[0260] Experimental Example 3. Real Time RT-qPCR for pro-inflammatory cytokines

[0261] Real Time RT-qPCR was performed using the Quant Studio 5 (Applied biosystems). The primer sequence for ILlbeta forward primer was 5’- AGCTTCAGGCAGGCAGTATC -3’ (SEQ ID NO: 1); IL1 beta reverse primer was 5’- AAGGTCCACGGGAAAGACAC -3’ (SEQ ID NO:2); TNF alpha forward primer was 5’- AAATGGCCTCCCTCTCATCAG -3’ (SEQ ID NO:3); TNF alpha reverse primer was 5’- GTCACTCGAATTTTGAGAAGATGATC -3’ (SEQ ID NO:4); beta actin forward primer was 5’- CGTGCGTGACATCAAAGAGAA-3’ (SEQ ID NO:5); beta actin reverse primer was 5’ - TGGATGCCACAGGATTCCAT-3’ (SEQ ID NO: 6). SYBR Green PCR Master Mix (ThermoFisher) was used for the polymerase.

[0262] Experimental Example 4. Results of measuring the pro-inflammatory cytokines decrease rate.

[0263] FIG. 1 shows the results of an experiment for checking whether the combined use of mirodenafil and donepezil in the present invention has a synergistic effect on IL- Ip.

[0264] In FIG. 1, AR1001 refers to mirodenafil, and looking at Table 1, the IL-ip reduction rate of 11.89% for a combined treatment of 2 pM of mirodenafil and 2 pM of donepezil; the IL-ip reduction rate of 26.53% for a combined treatment of 2 pM of mirodenafil and 10 pM of donepezil; the IL-ip reduction rate of 54.49% for a combined treatment of 2 pM of mirodenafil and 20 pM of donepezil; and the IL-ip reduction rate of 27.44% for a combined treatment of 10 pM of mirodenafil and 2 pM of donepezil; and the IL-ip reduction rate of 41.36% for a combined treatment of 10 pM of mirodenafil and 10 pM of donepezil; and the IL-ip reduction rate of 76.51% for a combined treatment of 10 pM of mirodenafil and 20 pM of donepezil; and the IL-ip reduction rate of 50.28% for a combined treatment of 20 pM of mirodenafil and 2 pM of donepezil; and the IL-ip reduction rate of 78.92% for a combined treatment of 20 pM of mirodenafil and 10 pM of donepezil; weresignificantly higher than the sum of the increase rates A and B for a treatment of mirodenafil or donepezil alone, which confirmed that an effect beyond the additive effect can be recognized.

[0265] FIG. 2 shows the results of an experiment for checking whether the combined use of mirodenafil and donepezil in the present invention has a synergistic effect on TNF-a.

[0266] In FIG. 2, AR1001 refers to mirodenafil, and looking at Table 2, the TNF-a reduction rate of 11.68% for a combined treatment of 2 pM of mirodenafil and 2 pM of donepezil; the TNF-a reduction rate of 38.46% for a combined treatment of 2 pM of mirodenafil and 10 pM of donepezil; and the TNF-a reduction rate of 28.59% for a combined treatment of 10 pM of mirodenafil and 2 pM of donepezil; and the TNF-a reduction rate of 57.62% for a combined treatment of 10 pM of mirodenafil and 10 pM of donepezil; and the TNF-a reduction rate of 83.61% for a combined treatment of 10 pM of mirodenafil and 20 pM of donepezil; and the TNF-a reduction rate of 59.85% for a combined treatment of 20 pM of mirodenafil and 2 pM of donepezil; and the TNF-a reduction rate of 83.08% for a combined treatment of 20 pM of mirodenafil and 10 pM of donepezil; were significantly higher than the sum of the increase rates A and B for a treatment of mirodenafil or donepezil alone, which confirmed that an effect beyond the additive effect can be recognized.

[0267] FIG. 3 shows the results of an experiment for checking whether the combined use of mirodenafil and galantamine in the present invention has a synergistic effect on IL- Ip.

[0268] In FIG. 3, AR1001 refers to mirodenafil, and looking at Table 3, the IL-ip reduction rate of 9.52% for a combined treatment of 2 pM of mirodenafil and 2 pM of galantamine; the IL-ip reduction rate of 26.28% for a combined treatment of 2 pM of mirodenafil and 10 pM of galantamine; the IL-ip reduction rate of 38.57% for a combined treatment of 2 pM of mirodenafil and 20 pM of galantamine; and the IL-ip reduction rate of 27.34% for a combined treatment of 10 pM of mirodenafil and 2 pM of galantamine; and the IL-ip reduction rate of 40.29% for a combined treatment of 10 pM of mirodenafil and 10 pM of galantamine; and the IL-ip reduction rate of 59.91% for a combined treatment of 10 pM of mirodenafil and 20 pM of galantamine; and the IL-ip reduction rate of 56.17% for a combined treatment of 20 pM of mirodenafil and 2 pM of galantamine; and the IL-ip reduction rate of 71.15% for a combined treatment of 20 pM of mirodenafil and 10 pM of galantamine; and the IL-ip reduction rate of 83.74% for a combined treatment of 20 pM of mirodenafil and 20 pM were significantly higher than the sum of the increase rates A and Bfor a treatment of mirodenafil or galantamine alone, which confirmed that an effect beyond the additive effect can be recognized.

[0269] FIG. 4 shows the results of an experiment for checking whether the combined use of mirodenafil and galantamine in the present invention has a synergistic effect on TNF-a.

[0270] In FIG. 4, ARlOOl refers to mirodenafil, and looking at Table 4, the TNF-a reduction rate of 12.01% for a combined treatment of 2 pM of mirodenafil and 2 pM of galantamine; the TNF-a reduction rate of 25.22% for a combined treatment of 2 pM of mirodenafil and 10 pM of galantamine; and the TNF-a reduction rate of 38.08% for a combined treatment of 10 pM of mirodenafil and 2 pM of galantamine; and the TNF-a reduction rate of 47.14% for a combined treatment of 10 pM of mirodenafil and 10 pM of galantamine; and the TNF-a reduction rate of 76.08% for a combined treatment of 10 pM of mirodenafil and 20 pM of galantamine; and the TNF-a reduction rate of 72.41% for a combined treatment of 20 pM of mirodenafil and 10 pM of galantamine; were significantly higher than the sum of the increase rates A and B for a treatment of mirodenafil or galantamine alone, which confirmed that an effect beyond the additive effect can be recognized.

[0271] FIG. 5 shows the results of an experiment for checking whether the combined use of mirodenafil and rivastigmine in the present invention has a synergistic effect on IL- Ip.

[0272] In FIG. 5, ARlOOl refers to mirodenafil, and looking at Table 5, the IL-ip reduction rate of 8.17% for a combined treatment of 2 pM of mirodenafil and 2 pM of rivastigmine; the IL-ip reduction rate of 23.70% for a combined treatment of 2 pM of mirodenafil and 10 pM of rivastigmine; and the IL-ip reduction rate of 25.29% for a combined treatment of 10 pM of mirodenafil and 2 pM of rivastigmine; and the IL-ip reduction rate of 39.91% for a combined treatment of 10 pM of mirodenafil and 10 pM of rivastigmine; and the IL-ip reduction rate of 53.79% for a combined treatment of 10 pM of mirodenafil and 20 pM of rivastigmine; and the IL-ip reduction rate of 67.53% for a combined treatment of 20 pM of mirodenafil and 10 pM of rivastigmine; were significantly higher than the sum of the increase rates A and B for a treatment of mirodenafil or rivastigmine alone, which confirmed that an effect beyond the additive effect can be recognized.

[0273] FIG. 6 shows the results of an experiment for checking whether the combined use of mirodenafil and rivastigmine in the present invention has a synergistic effecton TNF-a.

[0274] In Table 6, ARI 001 refers to mirodenafil, and looking at Table 4, the TNF-a reduction rate of 11.93% for a combined treatment of 2 pM of mirodenafil and 2 pM of rivastigmine; the TNF-a reduction rate of 21.14% for a combined treatment of 2 pM of mirodenafil and 10 pM of rivastigmine; the TNF-a reduction rate of 34.44% for a combined treatment of 2 pM of mirodenafil and 20 pM of rivastigmine; and the TNF-a reduction rate of 30.21% for a combined treatment of 10 pM of mirodenafil and 2 pM of rivastigmine; and the TNF-a reduction rate of 44.63% for a combined treatment of 10 pM of mirodenafil and 10 pM of rivastigmine; and the TNF-a reduction rate of 55.00% for a combined treatment of 10 pM of mirodenafil and 20 pM of rivastigmine; and the TNF-a reduction rate of 65.93% for a combined treatment of 20 pM of mirodenafil and 10 pM of rivastigmine; were significantly higher than the sum of the increase rates A and B for a treatment of mirodenafil or rivastigmine alone, which confirmed that an effect beyond the additive effect can be recognized.

[0275] Experimental Example 5. Cell culture

[0276] The SH-SY5Y human neuroblastoma cell line used in the experiment was purchased from American Type Culture Collection (ATCC; Manassas, VA, USA), and it was cultured in a CO2 incubator (311-TIF, Thermo Fisher Scientific Forma, MA, USA) under the conditions of 37°C and 5% CO2 using a DMEM / F12 Complete Medium (HyClone) containing 10% fetal bovine serum (FBS; Australian Orgin, HyClone, Logan, UT, USA) and 1% penicillin / streptomycin (P / S; HyClone).

[0277] Experimental Example 6. Neuron-like differentiation of SH-SY5Y cells using all-trans-retinoic acid (RA)

[0278] 2 104cells / well were dispensed into a 96-well plate to evaluate cytotoxicity, and 2* 105cells were dispensed into a T-25 flask to check neuronal cell death, neuronal inflammatory response, protein expression changes related to neurotransmitters and synaptic plasticity, and activity of acetylcholinesterase (AChE) activity. For cell fixation and stabilization, a DMEM / F12 Complete Medium (HyClone) containing 10% FBS (HyClone) and 1% P / S (HyClone) was used to culture for 24 hours in a CO 2incubator (Thermo Fisher Scientific Forma) under the conditions of 37°C and 5% CO 2. 24 hours after cell dispensing, the cell culture medium was removed for neuron-like differentiation and replaced with a DMEM / F12 differentiation medium containing 1% FBS (HyClone), 1% P / S (HyClone), and10 pM all-trans-retinoic acid (RA; Sigma-Aldrich, St. Louis, MO, USA). On the third day of differentiation, the medium was replaced with a new DMEM / F12 differentiation medium. On the sixth day of differentiation, the medium for the untreated control group was replaced with a new DMEM / F12 differentiation medium, and the sample treated group was replaced by adding a new DMEM / F12 differentiation medium under various conditions.

[0279] Experimental Example 7. Formation and treatment of Amyloid P(AP)1- 42

[0280] To form Api-42 oligomers, human Api-42 (Abeam, Cambridge, MA, USA) was added to a DMEM / F12 Complete Medium (HyClone) containing 1% FBS (HyClone) and 1% P / S (HyClone) to make 10 pM and left for three hours in a CO 2incubator (Thermo Fisher Scientific Forma) under the conditions of 37°C and 5% CO 2to form Api-42 oligomers.

[0281] To check the Api-42 change, the existing cell culture medium was removed from the RA-differentiated SH-SY5Y neuron-like cell, and replaced with a DMEM / F12 Complete Medium (HyClone) containing Api-42 oligomers (10 pM), and cultured for 72 hours in a CO 2incubator (Thermo Fisher Scientific Forma) under the conditions of 37°C and 5% CO 2to induce Api-42 oligomer-induced cell damage.

[0282] After 72 hours, the culture medium was removed, and then the DMEM / F12 Complete Medium (HyClone) was treated alone or in combination with mirodenafil, donepezil, galantamine or rivastigmine and cultured for 24 hours in a CO 2incubator (Thermo Fisher Scientific Forma) under the conditions of 37°C and 5% CO 2, and then the experiment was carried out.

[0283] Experimental Example 8. Result of measuring Human Ap 42 ELISA (enzyme-linked immunosorbent assay)

[0284] To measure the amount of Ap42 in the cells (pg / mL), the cells were recovered and treated with a Cell Lysis buffer. Thereafter, after 10 minutes of centrifugation at 14,000 rpm at 4°C, the supernatant is transferred, and protein is recovered. The amount of protein was quantified using the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific). Then, the Human Ap42 ELISA Kit (Invitrogen) was used to measure the amount of Ap42 in the cells.

[0285] Table 7 shows the results of an experiment for checking whether the combined use of mirodenafil and donepezil in the present invention has a synergistic effecton Ap reduction.

[0286] In Table 7, ARI 001 refers to mirodenafil, and looking at Table 7, the Ap reduction rate of 5.49% for a combined treatment of 0.1 pM of mirodenafil and 0.1 pM of donepezil; the Ap reduction rate of 8.35% for a combined treatment of 0.1 pM of mirodenafil and 0.5 pM of donepezil; the Ap reduction rate of 11.65% for a combined treatment of 0.5 pM of mirodenafil and 0.1 pM of donepezil; and the Ap reduction rate of 18.27% for a combined treatment of 0.5 pM of mirodenafil and 0.5 pM of donepezil were significantly higher than the sum of the increase rates A and B for a treatment of mirodenafil or donepezil alone, which confirmed that an effect beyond the additive effect can be recognized.

[0287] Table 8 shows the results of an experiment for checking whether the combined use of mirodenafil and galantamine in the present invention has a synergistic effect on Ap reduction.

[0288] Looking at Table 8, the Ap reduction rate of 4.32% for a combined treatment of 0.1 pM of mirodenafil and 0.1 pM of galantamine; the Ap reduction rate of 19.08% for a combined treatment of 0.1 pM of mirodenafil and 0.5 pM of galantamine; the Ap reduction rate of 11.15% for a combined treatment of 0.5 pM of mirodenafil and 0.1 pM of galantamine; and the Ap reduction rate of 20.43% for a combined treatment of 0.5 pM of mirodenafil and 0.5 pM of galantamine were significantly higher than the sum of the increase rates A and B for a treatment of mirodenafil or galantamine alone, which confirmed that an effect beyond the additive effect can be recognized.

[0289] Table 9 shows the results of an experiment for checking whether the combined use of mirodenafil and rivastigmine in the present invention has a synergistic effect on Ap reduction.

[0290] Looking at Table 9, the Ap reduction rate of 8.43% for a combined treatment of 0.1 pM of mirodenafil and 0.1 pM of rivastigmine; the Ap reduction rate of 14.88% for a combined treatment of 0.1 pM of mirodenafil and 0.5 pM of rivastigmine; the Ap reduction rate of 8.94% for a combined treatment of 0.5 pM of mirodenafil and 0.1 pM of rivastigmine; and the Ap reduction rate of 17.91% for a combined treatment of 0.5 pM of mirodenafil and 0.5 pM of rivastigmine were significantly higher than the sum of the increase rates A and B for a treatment of mirodenafil or rivastigmine alone, which confirmed that an effect beyond the additive effect can be recognized.

[0291] The present invention described above is merely illustrative and a person skilled in the art to which the present invention appertains will understand that various modifications and other equivalent embodiments are possible therefrom. Therefore, it will beunderstood that the present invention is not limited to the form mentioned in the detailed description above. Therefore, the true scope of the technical protection of the present invention should be determined by the technical idea of the appended scope of claims. In addition, it is to be understood that the present invention covers all modifications, equivalents, and substitutions within the spirit and scope of the present invention defined by the appended scope of claims.

[0292] Other Embodiments

[0293] The detailed description set-forth above is provided to aid those skilled in the art in practicing the present invention. However, the invention described and claimed herein is not to be limited in scope by the specific embodiments herein disclosed because these embodiments are intended as illustration of several aspects of the invention. Any equivalent embodiments are intended to be within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description which do not depart from the spirit or scope of the present inventive discovery. Such modifications are also intended to fall within the scope of the appended claims.

[0294] References Cited

[0295] All publications, patents, patent applications and other references cited in this application are incorporated herein by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application or other reference was specifically and individually indicated to be incorporated by reference in its entirety for all purposes. Citation of a reference herein shall not be construed as an admission that such is prior art to the present invention.

Claims

CLAIMSWhat is claimed is:

1. A pharmaceutical formulation for preventing or treating a neurodegenerative disorder, comprising: a therapeutically effective amount of mirodenafil; a therapeutically effective amount of an acetylcholinesterase inhibitor; and a pharmaceutically acceptable carrier, wherein the formulation is configured for oral administration.

2. The pharmaceutical formulation of claim 1, wherein the acetylcholinesterase inhibitor is selected from the group consisting of donepezil, rivastigmine, galantamine, and pharmaceutically acceptable salts, solvates, and hydrates thereof.

3. The pharmaceutical formulation of claim 2, wherein the acetylcholinesterase inhibitor is selected from the group consisting of donepezil, rivastigmine, and galantamine.

4. The pharmaceutical formulation of claim 3, wherein the molar ratio of mirodenafil to donepezil, mirodenafil to rivastigmine, or mirodenafil to galantamine is from 1 :0.1 to 1 : 10.

5. A composition for preventing or treating a neurodegenerative disorder, comprising: mirodenafil; and an acetylcholinesterase inhibitor; and pharmaceutically acceptable salts, solvates, hydrates, and derivatives of both mirodenafil and the acetylcholinesterase inhibitor, wherein the composition synergistically inhibits proinflammatory cytokines and reduces beta-amyloid levels.

6. The composition of claim 5, wherein the acetylcholinesterase inhibitor is selected from the group consisting of donepezil, rivastigmine, galantamine, and pharmaceutically acceptable salts, solvates, hydrates, and derivatives thereof.

7. The composition of claim 6, wherein the acetylcholinesterase inhibitor is donepezil.

8. The composition of claim 5, wherein the molar ratio of mirodenafil to the acetylcholinesterase inhibitor is from 1 :0.1 to 1 : 10.

9. The composition of claim 8, wherein the molar ratio of mirodenafil to the acetylcholinesterase inhibitor is selected from the group consisting of 50: 1, 10:1, 5: 1, 2: 1, 1 : 1, 1 :2, 1 :5, and 1 : 10.

10. A method for preventing or treating a neurodegenerative disorder, comprising: administering to a subject in need thereof an effective amount of a composition comprising mirodenafil and an acetylcholinesterase inhibitor, and pharmaceutically acceptable salts, solvates, hydrates, and derivatives of both the mirodenafil and acetylcholinesterase inhibitor, wherein the composition synergistically inhibits proinflammatory cytokines and reduces beta-amyloid levels.

11. The method of claim 10, wherein the acetylcholinesterase inhibitor is selected from the group consisting of donepezil, rivastigmine, galantamine, and pharmaceutically acceptable salts, solvates, hydrates, and derivatives thereof.

12. The method of claim 11, wherein the acetylcholinesterase inhibitor is donepezil.

13. The method of claim 12, wherein the molar ratio of mirodenafil to donepezil, mirodenafil to rivastigmine, or mirodenafil to galantamine is from 1 :0.1 to 1 : 10.

14. The method of claim 10, wherein the neurodegenerative disorder is selected from the group consisting of dementia, Alzheimer's disease, Parkinson's disease, Parkinson’s disease dementia, Huntington's disease, multiple sclerosis, dementia with Lewy bodies, Amyotrophic Lateral Sclerosis, Down’s syndrome dementia, frontotemporal dementia, vascular dementia, and mixed etiologies thereof.

15. The method of claim 14, wherein the composition is administered to the subject via a route selected from the group consisting of oral, mucosal, topical, suppository, intravenous, parenteral, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal, inhalation and subcutaneous administration.

16. A pharmaceutical composition comprising: at least one phosphodiesterase 5 inhibitor; and at least one acetylcholinesterase inhibitor as active ingredients, and pharmaceutically acceptable salts, solvates, hydrates of said phosphodiesterase 5 inhibitor and said acetylcholinesterase inhibitor.

17. The composition of claim 16, wherein the phosphodiesterase 5 inhibitor comprises mirodenafil, sildenafil, vardenafil, tadalafil, udenafil, dasantafil, avanafil, and pharmaceutically acceptable salts, solvates, hydrates, derivatives and mixtures thereof.

18. The composition of claim 17, wherein the phosphodiesterase 5 inhibitor is mirodanafil and pharmaceutically acceptable salts, solvates, hydrates, and derivatives thereof.

19. The composition of claim 16, wherein the acetylcholinesterase inhibitorcomprises donepezil, rivastigmine, galantamine, physostigmine, tacrine, metrifonate, phenserine, tolserine, eseroline, huperizine A and B, galangin, cardanol, donepezil-AP2238, donepezil-tacrine, tacrine-ferulic acid hybrid, tacrine-hydroxyquinoline, ladostigil, indenyl derivatives, and pharmaceutically acceptable salts, solvates, hydrates, derivatives and mixtures thereof.

20. A method for preventing or treating neuroinflammation comprising: administering an effective amount of a pharmaceutical composition comprising the composition of claim 16.

21. A method for preventing or inhibiting formation and / or accumulation of betaamyloid comprising: administering an effective amount of a pharmaceutical composition comprising the composition of claim 16.

22. A method for preventing or treating a neurodeg enerative disorder comprising: administering an effective amount of a pharmaceutical composition comprising the composition of claim 16.

23. The method of claim 22, wherein the neurodegenerative disorder comprises dementia, Parkinson's disease (PD), Dementia with Lewy body (DLB), Alzheimer's disease (AD), Huntington's disease (HD), Multiple sclerosis (MS), Vascular Dementia (VaD), Amyotrophic Lateral Sclerosis (ALS), frontotemporal dementia, Parkinson’s disease dementia, Down’s syndrome dementia, and mixed etiologies thereof.

24. A method for inhibiting Ap Oligomer / Fibril formation by reducing Ap aggregation comprising: administering an effective amount of a pharmaceutical composition comprising the composition of claim 16.

25. A method for inhibiting P-Amyloidogenic processing by reducing BACE-1 comprising: administering an effective amount of a pharmaceutical composition comprising the composition of claim 16.

26. A method for reducing extracellular Ap monomers, oligomers & Ap Fibril / Plaque by increasing the cerebral blood flow comprising: administering an effective amount of a pharmaceutical composition comprising the composition of claim 16.

27. A method for suppressing neuronal cell death, promoting neurogenesis, synaptogenesis and / or angiogenesis by activating NO / cGMP / PKG / CREB Pathwaycompnsing: administering an effective amount of a pharmaceutical composition comprising the composition of claim 16.

28. A method for inhibiting production of APP or reducing Ap accumulation by suppressing positive feedback loop for Ap production comprising: administering an effective amount of a pharmaceutical composition comprising the composition of claim 16.

29. A method for inhibiting formation of Ap Fibril / plaque by removal of intracellular toxic and soluble Ap oligomers by activating autophagy comprising: administering an effective amount of a pharmaceutical composition comprising the composition of claim 16.

30. A composition for preventing and / or treating dementia comprising, mirodenafil, or pharmaceutically acceptable salts, solvates, hydrates, derivatives thereof; and at least one of donepezil, galantamine, rivastigmine, or pharmaceutically acceptable salts, solvates, hydrates, derivatives, and / or mixtures thereof.

31. A method for preventing or treating neuroinflammation comprising: administering an effective amount of a pharmaceutical composition comprising the composition of claim 30.

32. A method for prevention or inhibiting formation and / or accumulation of betaamyloid comprising: administering an effective amount of a pharmaceutical composition comprising the composition of claim 30.

33. A method for preventing or treating a neurodeg enerative disorder comprising: administering an effective amount of a pharmaceutical composition comprising the composition of claim 30.

34. The method of claim 33, wherein the neurodegenerative disorder comprises dementia, Parkinson's disease (PD), Dementia with Lewy body (DLB), Alzheimer's disease (AD), Huntington's disease (HD), Multiple sclerosis (MS), Vascular Dementia (VaD), Amyotrophic Lateral Sclerosis (ALS), frontotemporal dementia, Parkinson’s disease dementia, Down’s syndrome dementia, and mixed etiologies thereof.

35. A method for inhibiting Ap Oligomer I Fibril formation by reducing Ap aggregation comprising: administering an effective amount of a pharmaceutical composition comprising thecomposition of claim 30.

36. A method for inhibiting P-Amyloidogenic processing by reducing BACE-1 comprising: administering an effective amount of a pharmaceutical composition comprising the composition of claim 30.

37. A method for reducing extracellular Ap monomers, oligomers & Ap Fibril / Plaque by increasing the cerebral blood flow comprising: administering an effective amount of a pharmaceutical composition comprising the composition of claim 30.

38. A method for suppressing neuronal cell death, promoting neurogenesis, synaptogenesis and / or angiogenesis by activating NO / cGMP / PKG / CREB Pathway comprising: administering an effective amount of a pharmaceutical composition comprising the composition of claim 30.

39. A method for inhibiting the production of APP or reducing Ap accumulation by suppressing positive feedback loop for Ap production comprising: administering an effective amount of a pharmaceutical composition comprising the composition of claim 30.

40. A method for inhibiting formation of Ap Fibril / plaque by removal of intracellular toxic and soluble Ap oligomers by activating autophagy comprising: administering an effective amount of a pharmaceutical composition comprising the composition of claim 30.

41. A method for restoration of synaptic plasticity by activation of Wint Signaling by inhibition of DKK-1 comprising: administrating an effective amount of a pharmaceutical composition comprising the composition of claim 1.

Images