Off-the-shelf in-vivo in-situ car and tumor vaccine combined immunotherapy technology based on circular RNA and use thereof

Abstract

Provided is an in-vivo in-situ CAR immunotherapy and cancer vaccine combined therapy strategy based on circular RNA, which is a novel tumor immunotherapy that combines the cyclic RNA-based in-vivo in-situ CAR-T / M technology and the circular RNA cancer vaccine technology. This novel tumor immunotherapy enables rapid and efficient generation of CAR-T / M cells in vivo and further produces an enhanced collaborative anti-tumor immunotherapy effect with the synergistic action of the corresponding circular RNA cancer vaccine. In addition, a specific non-complementary region of an I-type intron from tetrahymena is split, and thus in-vitro efficient RNA cyclization can be achieved by means of self-splicing of the I-type intron without requiring homologous arms or additional GTP catalysis.

Description

An off-the-shelf in vivo in situ CAR immunotherapy technology based on circular RNA combined with tumor vaccines and its application Technical Field

[0001] The present invention relates to the field of biomedicine technology, and specifically to an off-the-shelf in vivo in situ CAR based on circular RNA combined with a tumor vaccine and its application. Background Art

[0002] The tumor microenvironment (TME) is a complex, integrated system formed by the interaction between tumor cells, surrounding tissues, and immune cells. Immune cells in the TME primarily include T lymphocytes, B lymphocytes, NK cells, macrophages, and DCs. T lymphocytes play a major role in tumor immunity, primarily killing tumor cells. However, due to the immunosuppressive effects of the TME and the immune escape mechanisms of tumor cells, they often evade T cell cytotoxicity and proliferate rapidly. Therefore, anti-tumor drugs that reactivate T cell immune responses have always played a crucial role in the biopharmaceutical field. In addition, single-cell sequencing has revealed that in the tumor microenvironment, a large number of immune cells are tumor-associated macrophages (TAMs), and most of them are the M2 type that promotes tumor growth. Some studies have shown that in breast cancer, M2 TAMs account for more than 50% of the tumor microenvironment. Therefore, reprogramming macrophages in the tumor microenvironment, promoting their polarization into anti-tumor M1 macrophages, and enhancing the phagocytic function of macrophages have gradually become popular among researchers in recent years.

[0003] The concept of CAR (chimeric antigen receptor) was first proposed by scientist G. Gross et al., Proc. Natl. Acad. Sci. USA, 1989, in 1989. Since then, CAR-T (chimeric antigen receptor T cell) therapy, which involves genetically engineering CAR molecules into T cells ex vivo, has become an important immunotherapy and has been approved for clinical use in the treatment of leukemia and lymphoma. With the remarkable efficacy of CAR-T in the treatment of hematological malignancies, increasing research and resources have been directed toward CAR technology. Current research on CAR technology focuses on optimizing CAR-T technology and applying CAR technology to other cell-based targeted therapies for various diseases. CARs are primarily composed of three domains: an extracellular domain, often a single-chain fragment variable (scFv), responsible for recognizing and binding the target antigen; a transmembrane domain, often a hinge region, which acts as an anchor; and an intracellular domain, consisting of costimulatory and signaling domains. Researchers use CAR technology to reprogram T cells, causing them to express tumor-associated antigen receptors (TAARs), thereby exerting their targeted anti-tumor effects. In 2008, the Fred Hutchison Cancer Research Institute and other institutions first used CAR-T technology to treat B-cell lymphoma.

[0004] To date, CAR-T therapy has become an important immunotherapy and has been approved for clinical use in the treatment of leukemia and lymphoma. Currently, approximately six CAR-T drugs have been approved for marketing, all for hematological malignancies. However, CAR-T therapy has been less effective in solid tumors due to the immunosuppressive effects of the tumor microenvironment. In recent years, increasing research and resources have been directed toward CAR technology. Current research focuses on optimizing CAR-T technology and applying it to other immune cells, such as NK cells and macrophages, for the targeted treatment of various diseases.

[0005] Circular RNAs (circular RNAs) are single-stranded RNAs lacking a 5' cap and a 3' poly(A) tail, instead forming a closed circular topology linked by covalent bonds. This circular structure protects them from degradation by nucleases and provides them with high stability. For a period after their discovery, circular RNAs were considered rare, nonfunctional byproducts of aberrant splicing. However, the past decade has seen a fundamental shift in the recognition of circular RNAs as ubiquitous and functionally important molecules in biology. This is largely attributed to the advent of RNA-seq technology, which has revealed the ubiquity and evolutionary conservation of circular RNAs in eukaryotes. Circular RNAs have specific biological functions, including as RNA ligands, miRNA sponges, protein sponges, antisense circular molecules, innate immune activators, innate immune suppressors, protein translation, and biomarkers.

[0006] In organisms, pre-mRNA removes introns and connects to form mRNA. This is achieved by the spliceosome acting on the 5' and 3' splice sites of the intron, resulting in the intron being spliced ​​and the exons being connected to form mRNA, which is called forward splicing. However, circular RNA produced in most organisms is not achieved through forward splicing, but rather through back splicing. Back splicing does not occur at the ends of the intron, but at the ends of the exon (i.e., the 3' end of the first intron and the 5' end of the second intron). This type of splicing will circularize the exon and form circular RNA.

[0007] Due to its high stability, circular RNA has attracted attention for its application in nucleic acid drugs, especially for its in vitro preparation. Current methods include: chemical synthesis, which involves the synthesis and ligation of specific nucleotide derivatives; ligation of the ends of linear RNA catalyzed by nucleic acid ligases; and ligation of the ends of linear RNA based on the self-splicing properties of intronic ribozymes.

[0008] Nucleic acid drugs are another area of ​​intense research, following small molecule and protein drugs. Driven by the development of linear RNA, circular RNA has seen significant development. Endogenous circular RNAs can serve as novel drug targets or biomarkers for disease diagnosis, while artificially generated circular RNAs can target a variety of targets and exert their effects within cells. Currently, circular RNAs have achieved significant breakthroughs in areas such as infectious vaccines, tumor vaccines, CAR-T, protein replacement therapy, and gene editing, making their preparation crucial for their application.

[0009] Tumor vaccines have been a hot topic of research in recent years. Their principle involves introducing tumor antigens into the patient's body in various forms, such as tumor cells, tumor-associated proteins or peptides, or genes expressing tumor antigens. This approach overcomes the immunosuppression caused by the tumor, enhances immunogenicity, activates the patient's own immune system, and induces both cellular and humoral immune responses, thereby controlling or eliminating the tumor. Using genetic engineering techniques, genes encoding tumor-specific antigens are loaded onto recombinant viral vectors or plasmid DNA and injected directly into the human body. Leveraging the vector itself or the human gene expression system, these vaccines can sustainably elicit specific humoral and cellular immunity, a significant advantage over other tumor vaccines, making them a hot topic in tumor biotherapy research.

[0010] The use of circular RNA for the preparation of in situ CAR and tumor vaccines in vivo, and their combined use to amplify immune responses, is a novel technological development. In light of this, the present invention is proposed.

[0011] Summary of the Invention

[0012] To solve the above technical problems, the present invention provides a therapeutic drug containing disease antigens and / or CAR molecules. First, a circular RNA drug prepared from a ribonucleic acid construct containing CAR enters the body through a delivery carrier with a targeting function to produce in situ CAR, which is a "spot-type" immunotherapy, in which the targeted immune cells include T cells, macrophages, natural killer cells, neutrophils, γδT cells, etc., and engineered immune cells are produced in situ; second, a tumor vaccine prepared from a ribonucleic acid construct containing a tumor antigen produces tumor-specific T cells by specifically stimulating T cells to achieve immunotherapy; third, the combination of a circular RNA drug containing CAR and a tumor vaccine containing an antigen can achieve good therapeutic effects without the need for adjuvants.

[0013] The first object of the present invention is to provide a circular RNA-based drug comprising at least one of the following:

[0014] (1) RNA construct with antigen as target gene;

[0015] (2) RNA constructs with chimeric antigen receptor as the target gene;

[0016] The RNA construct comprises the following elements from the 5' end to the 3' end:

[0017] Part of the P9 and P10 regions of the group I intron containing the 3' splice site (the target splice site contains ωG),

[0018] target gene,

[0019] The P1-P8 region of the group I intron, including the 5' splice site, and part of the P9 region (the target splice site has a U:G pairing with the IGS);

[0020] The type I intron contains 10 paired double helical regions P1-P10 from the 5' end to the 3' end. The above elements are obtained by segmenting the type I intron, and the segmentation is to split the type I intron into two fragments at the non-complementary region or adjacent to the non-complementary region near the 9th helical region P9 at the 3' end.

[0021] Preferably, the drug is a combination drug, namely:

[0022] The present invention provides an anti-tumor preparation, comprising a container containing the following independently packaged preparations: a preparation containing a ribonucleic acid construct with a chimeric antigen receptor as a target gene; and a preparation containing a ribonucleic acid construct with an antigen (tumor antigen) as a target gene.

[0023] Furthermore, when the drug is a combination drug, the RNA construct containing the chimeric antigen receptor is injected intratumorally, and the RNA construct containing the antigen is injected intramuscularly.

[0024] Furthermore, in the RNA construct with the antigen as the target gene, the EPM-EABR sequence is connected to the end of the antigen, preferably the C-terminus.

[0025] Furthermore, the antigen may be a tumor antigen, including an antigen of a B cell epitope or a T cell epitope.

[0026] Furthermore, the ribonucleic acid construct is used to prepare a circular RNA drug, which enters the body through a liposome delivery carrier to produce neutralizing antibodies and T cell immune responses, and is characterized in that it is used to prepare vaccines against infectious diseases and tumors.

[0027] Furthermore, the sequence of the partial P9 region and P10 region of the group I intron containing the 3' splicing site is shown as SEQ ID NO.1.

[0028] Furthermore, the sequences of the P1-P8 region and a portion of the P9 region of the group I intron containing the 5' splicing site are shown in SEQ ID NO.3.

[0029] Furthermore, the RNA construct may or may not be codon optimized.

[0030] Furthermore, the secondary structure diagram of the group I intron is shown in FIG1 , and the specific sites of the P1-P10 complementary region and the non-complementary region are shown in FIG2 .

[0031] Furthermore, the P1-P10 complementary regions are modified, and the modification includes one or more of addition, deletion, and mutation.

[0032] Furthermore, it includes modifications to the non-complementary regions of P1-P10, wherein the modifications include one or more of addition, deletion, and mutation.

[0033] Furthermore, the RNA construct may optionally comprise one or more of a homology arm, an RNA trimer, a spacer sequence, and a UTR sequence that promotes circularization and expression.

[0034] Furthermore, the homology arms are located on the extension arms of the P1-P10 complementary regions, or at the 5' end of the split 3' intron and the 3' end of the 5' intron. Preferably, the homology arms in the RNA construct are 1-400 nt in length.

[0035] Furthermore, the RNA trimer triplex is located between P1 and P10.

[0036] Furthermore, the spacer sequence comprises a polyA sequence or a polyA-C sequence.

[0037] Furthermore, the target gene includes a sequence for initiating translation and a coding sequence (encoding CAR, antigen, etc.).

[0038] Furthermore, the sequence for initiating translation in the RNA construct includes one or more of an IRES sequence, an m6A motif, a CITE sequence, and a Kozak sequence.

[0039] Furthermore, the sequence of the ribosome entry site is shown as SEQ ID NO.2.

[0040] A second object of the present invention is to provide a method for preparing the above-mentioned drug, comprising the following steps: subjecting a ribonucleic acid construct linked to a tumor antigen and / or a chimeric antigen receptor to IVT, DNase I treatment, RNase R treatment, HPLC, and CIP treatment, and finally purifying and enriching to obtain circular RNA.

[0041] Furthermore, modified nucleotides are added during the preparation of the ribonucleic acid construct into circular RNA, with a ratio of 0%-100%.

[0042] Furthermore, the circular RNA prepared by the ribonucleic acid construct is transfected into cells to express the target protein.

[0043] Beneficial effects of the present invention:

[0044] The present invention uses circular RNA as a CAR molecule expression vector to treat diseases in situ in vivo. It is a new "off-the-shelf" immunotherapy. Compared with traditional adoptive CAR-T cell therapy, it does not require the extraction of patient T-cells for in vitro transduction and amplification, which is low-cost, simple to operate, and greatly saves medical resources. It uses targeted LNP as a transport carrier, which can target a variety of specific cells and transiently express CAR molecules on a large number of macrophages in solid tumors, and can also produce effective therapeutic effects on solid tumors, breaking through the therapeutic application limitation of existing adoptive CAR-T cell therapy that is only effective for some hematological tumors. Treatment with the present invention does not require the infusion of a large number of CAR-T cells, avoiding the related toxic effects caused by the infusion of a large number of T cells in a short period of time.

[0045] Using circular RNA as a CAR molecular carrier has the advantages of being reversible and controllable. It can directly translate proteins and exert functions in the cytoplasm without the need for transport into the cell nucleus, and there is no safety risk of integration into genomic DNA.

[0046] Compared with mRNA, circular RNA as the CAR molecular carrier is more stable and less susceptible to degradation, and can produce higher levels and more stable expression in the body.

[0047] The present invention prepares circular RNA based on group I intron splicing, solves the cyclization of large-molecule RNA, and removes the limitation of molecular size.

[0048] Compared with the existing ribozyme self-splicing mechanism for preparing circular RNA, the present invention has a higher circularization efficiency without the addition of GTP, and less residual linear precursor (RNA precursor). The processing steps are relatively reduced, which is conducive to industrial preparation.

[0049] The exogenous sequence introduced by the present invention using the type I intron of Tetrahymena is much less than that of the existing type I intron, thereby reducing the innate immunogenicity and increasing the expression level.

[0050] The present invention utilizes the type I intron of Tetrahymena and can achieve efficient circularization without adding homology arm sequences.

[0051] The present invention pioneered a new method for splitting the structure of group I introns, splitting the non-complementary region of P9 to achieve the preparation of circular RNA. This method can be extended to splitting the non-complementary regions of different group I intron domains P1-P10 to also achieve RNA circularization.

[0052] The present invention combines the "off-the-shelf" new immunotherapy with tumor vaccines, which is a new technical strategy. The two complement each other and multiply the body's immune effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 is a schematic diagram of the secondary structure of the Tetrahymena type I intron.

[0054] FIG2 is a method for achieving in vitro circularization by splitting a specific non-complementary region of the Tetrahymena group I intron (STS-P9 circularization method).

[0055] Figure 3 shows CircRNA CAR Experimental results of expressing CAR protein on the membrane of T cells and macrophages (Note: CircRNA CAR was cyclized by the PIE method).

[0056] Figure 4 shows CircRNA CAR The transfected macrophages showed effective tumor phagocytosis and pro-inflammatory polarization in vitro (Note: CircRNA CAR was cyclized by the PIE method).

[0057] Figure 5 shows the transfection of CircRNA CAR The experimental results showed that macrophages and T cells showed effective tumor killing effect in vitro (Note: CircRNA CAR was cyclized by the PIE method).

[0058] Figure 6 shows LNP-circRNA Anti-HER2-CAR Experimental results of significantly inhibiting tumor growth and improving survival rate in mice (Note: CircRNA CAR was cyclized by the PIE method).

[0059] Figure 7 shows CircRNA Anti-HER2-CAR Combined CircRNA HER2-EPM-EABR The experimental results of the vaccine in tumor-bearing mice to achieve synergistically enhanced anti-tumor immunotherapy effect (Note: CircRNA CAR was cyclized by the PIE method). DETAILED DESCRIPTION

[0060] The present invention will be further described below with reference to the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it. However, the embodiments are not intended to limit the present invention.

[0061] Example 1

[0062] (1) Design and construction of the circRNA-STS-P9 structure: including T7 promoter, 3' intron, kozak sequence, target gene, IRES, and 5' intron;

[0063] (2) Design and construction of the CAR structure: including CD28 signal peptide, 1x flag tag, HER2-scFv (original, optimization 1-3), CD8 hinge region, CD28 transmembrane region, 4-1BB intracellular region, and CD3ζ intracellular region;

[0064] (3) Design and construction of the vaccine structure: including the HER2 antigen extracellular region, transmembrane domain, and EPM-EABR domain;

[0065] The specific nucleotide sequence is:

[0066] T7 promoter (SEQ ID NO. 1):

[0067] TAATACGACTCACTATAGG

[0068] 3' intron (SEQ ID NO. 2):

[0069] AAGTATATTGATTAGTTTTGGAGTACTCGTAAGGT

[0070] Kozak sequence (SEQ ID NO. 3):

[0071] GCCACC

[0072] CVB3-IRES (SEQ ID NO. 4):

[0073] 5' intron (SEQ ID NO.5):

[0074] The target gene is:

[0075] CAR original (SEQ ID NO.6):

[0076] CAR optimization 1(SEQ ID NO.7):

[0077] CAR optimization 2(SEQ ID NO.8):

[0078] CAR optimization 3(SEQ ID NO.9):

[0079] circRNA vaccine(SEQ ID NO.10):

[0080] (4) The plasmid containing the target gene is linearized and circular RNA is obtained through in vitro transcription (IVT) technology, DNase I treatment, and RNA purification. The circular RNA is further purified and enriched through different treatments (including RNase R, HPLC, and CIP) to prepare high-purity circular RNA;

[0081] (5) Treat the purified circular RNA with RNase R and observe the success of circularization by electrophoresis. Perform reverse transcription-PCR (RT-PCR) on the purified circular RNA and sequence the target band to confirm that the circular RNA is successfully prepared and the ligation site is correct.

[0082] (6) The purified circular RNA was transfected into 293T cells and detected by fluorescence microscopy and flow cytometry 24 hours later. Since the IRES sequence that initiates translation is located downstream of GFP, only the observation of green fluorescence indicates successful circularization.

[0083] (7) The target gene of the circular RNA construct is changed to a tumor antigen (HER2 tumor antigen is used as an example in this invention), and a circular RNA vaccine is prepared. The vaccine is injected into mice via an LNP delivery system to detect the innate immunogenicity, humoral immunity level, cellular immunity level, and anti-tumor ability.

[0084] (8) The target gene of the circular RNA construct was changed to a CAR molecule to prepare a circular RNA in situ CAR, which was injected into subcutaneous tumor-bearing model mice via a delivery vector with targeting function, and the tumor formation and death of the mice were recorded.

[0085] (9) Prepare and optimize lipid nanoparticle (LNP) complexes (LNP-circular RNA) targeting T cells / macrophages, and measure parameters such as particle size, encapsulation efficiency, and particle uniformity to characterize the nanoparticle complexes;

[0086] (10) The LNP-circular RNA complex was transfected into T cells / macrophages in vitro, and the expression level of cell surface CAR molecules was detected by Western blot and flow cytometry;

[0087] (11) The prepared CAR-T / M cells were respectively combined with tumor cells of different tumors such as HER2 + SK-OV-3-LUC cells, A549-LUC-CD19 cells, MC38-LUC-CD19 cells, and MC38-LUC-HER2 cells were co-cultured at an effector cell:tumor cell (E:T) ratio of 2:1, 4:1, and 8:1. After 48 hours, the cytotoxicity of effector cells against tumor cells was detected using a luciferase reporter gene assay. Simultaneously, the effect of effector cells on tumor cell apoptosis was detected using an Annexin V / PI assay.

[0088] (12) A subcutaneous tumor-bearing model was established by in vitro cultured tumor cell lines HER2 + SK-OV-3-LUC cells, A549-LUC-CD19, MC38-LUC-CD19, and MC38-LUC-HER2 were mixed with matrix gel and then implanted subcutaneously on the backs of C57BL / 6 mice. The tumor formation in the mice was observed and the tumor size was measured every day. When the subcutaneous tumor volume reached 60 mm 3 Experiment left and right;

[0089] (13) LNP-circular RNA was delivered into mice via intratumoral injection. The survival of each group of mice was observed daily. The changes in tumor size of the mice were observed using an in vivo imaging system, and the mouse survival curve and tumor growth curve were drawn.

[0090] (14) LNP-circular RNA was combined with circular RNA vaccine and delivered to mice via intratumoral injection. The survival of each group of mice was observed every day, and the changes in tumor size of the mice were observed using an in vivo imaging system. The mouse survival curve and tumor growth curve were drawn.

[0091] The specific steps are as follows:

[0092] Design and construction of the circRNA-STS-P9 structure: including T7 promoter, 3' intron, Kozak sequence, target gene, IRES, and 3' intron;

[0093] The plasmid containing the target gene GFP was linearized and obtained through in vitro transcription (IVT) technology, DNase I treatment, and purification to obtain circular RNA. Circular RNA was further enriched through RNase R treatment and purification, HPLC purification, and CIP treatment and purification to prepare high-purity circular RNA.

[0094] After RNase R treatment, perform gel electrophoresis on the circular RNA to verify successful circularization. Perform reverse transcription-PCR (RT-PCR) on the circular RNA and sequence the target band to confirm successful circular RNA preparation and correct ligation sites.

[0095] The purified circular RNA was transfected into 293T cells and detected by fluorescence microscopy and flow cytometry 24 hours later to obtain fluorescence imaging results, GFP positive rate, and MFI fluorescence expression.

[0096] The target gene of the circular RNA construct was changed to a tumor antigen to prepare a circular RNA vaccine. 293T cells were first transfected, and antigen expression was verified by western blot and ELISA. Mice were then injected using a LNP delivery system, with dosing once every three days for three times. After the fourth week, innate immunogenicity (including MCP-1, IL-6, IP-10, TNF-α, IFN-α, RANTES), humoral immunity levels, cellular immunity levels (related cytokine detection such as IL-4, IL-6, IFN-γ, TNF-α, IL-2), and anti-tumor ability were tested.

[0097] The target gene of the circular RNA construct was changed to the HER2 CAR molecule, and circular RNA was prepared. First, the circular RNA HER2 CAR was transfected into Jurkat, THP-1 and RAW264.7 cells. The prepared CAR-T / M cells were co-incubated with SK-OV-3-LUC and MC38-HER2-LUC cells at different effector-target ratios, and the killing effect of CAR-T / M cells on tumor cells was detected by luciferase. The circular RNA HER2 CAR was injected into subcutaneous tumor-bearing mice (SK-OV-3-LUC, MC38-HER2-LUC cells) through a targeted delivery system. When the tumor volume reached 60mm 3LNP-circular RNA HER2 CAR was injected intravenously and intratumorally at multiple points for three times. The drug was administered once every three days for three times. At the end of the experiment, tumors, lymph nodes, spleens, and peripheral blood were collected, cells were isolated, and the proportion of T cells and M1 macrophages, as well as the circRNA in them, were detected by flow cytometry. Anti-HER2-CAR The expression of TNF-α and TNF-α was monitored and recorded every day.

[0098] The results are shown in Figure 3-7.

[0099] The above embodiments are merely preferred embodiments for the purpose of fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are within the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

Claims

1. A drug based on circular RNA, characterized in that, The drug comprises at least one of the following: (1) A ribonucleic acid construct with an antigen as the target gene; (2) A ribonucleic acid construct with a chimeric antigen receptor as the target gene; Wherein, the ribonucleic acid construct comprises the following elements from the 5'-end to the 3'-end: Partial P9 region and P10 region of type I intron containing a 3'-splice site, The target gene, P1-P8 region and partial P9 region of type I intron containing a 5'-splice site; The type I intron contains 10 paired double-helix regions P1-P10 from the 5'-end to the 3'-end. The above elements are obtained by splitting the type I intron, and the splitting is to split the type I intron into two fragments at the non-complementary region or adjacent non-complementary region near the 9th helix region P9 at the 3'-end.

2. The drug according to claim 1, characterized in that, The antigen includes tumor antigen.

3. The drug according to claim 1, characterized in that, The circular RNA drug prepared from the ribonucleic acid construct enters the body through a liposome delivery vector.

4. The drug according to claim 1, characterized in that, The sequence of the partial P9 region and P10 region of the type I intron containing a 3'-splice site is shown in SEQ ID NO.1; the sequence of the P1-P8 region and partial P9 region of the type I intron containing a 5'-splice site is shown in SEQ ID NO.

3.

5. The medicament according to claim 1, characterized in that, In the ribonucleic acid construct with an antigen as the target gene, an EPM-EABR sequence is linked to the end of the antigen.

6. The drug according to claim 1, characterized in that, When the drug contains both a ribonucleic acid construct with an antigen as the target gene and a ribonucleic acid construct with a chimeric antigen receptor as the target gene, the ribonucleic acid construct containing the chimeric antigen receptor is injected intratumorally, and the ribonucleic acid construct containing the antigen is injected intramuscularly.

7. The drug according to claim 1, characterized in that, The target gene includes a sequence for initiating translation.

8. The drug according to claim 7, characterized in that, The sequence for initiating translation includes one or more of IRES sequence, m6A motif, CITE sequence, kozak sequence.

9. A method for preparing the drug according to any one of claims 1-8, characterized in that, It includes the following steps: The ribonucleic acid construct linked with a tumor antigen and / or a chimeric antigen receptor is subjected to IVT, DNase I treatment, RNase R treatment, HPLC, CIP treatment, and finally purified and enriched to obtain circular RNA.

10. The preparation method according to claim 9, wherein, Modified nucleotides are added during the process of preparing the ribonucleic acid construct into circular RNA, and the proportion is 0%-100%.

Images