Novel peptide

A novel 10-amino acid peptide enhances dentin, bone, and cementum regeneration by increasing gene expression, addressing the inadequacies of current treatments for dentin, pulp, and periodontal diseases, promoting tissue-like structure formation.

WO2025143579A1PCT designated stage expired Publication Date: 2025-07-03HYSENSBIO CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/018986
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-29
Filing Date
2024-11-27
Publication Date
2025-07-03

Smart Images

  • Figure KR2024018986_03072025_PF_FP_ABST
    Figure KR2024018986_03072025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a novel peptide, a polynucleotide encoding the peptide, an expression vector comprising the polynucleotide, and a pharmaceutical composition, a quasi-drug composition, and a health-functional food composition that include the peptide.
Need to check novelty before this filing date? Find Prior Art

Description

Novel peptides

[0001] The present invention relates to a novel peptide, and more specifically, to a novel peptide, a polynucleotide encoding the peptide, an expression vector comprising the polynucleotide, and a pharmaceutical composition, a quasi-drug composition, and a health functional food composition comprising the peptide.

[0002]

[0003] The pulp is the soft connective tissue that fills the pulp cavity within the tooth. It is rich in nerves and blood vessels and extends to the surface of the dentin. Lesions that occur in this pulp are called pulp diseases.

[0004] The causes of pulp disease are numerous, but most cases are caused by bacterial infection due to dental caries, and infection into the pulp through perforations, fractures, cracks, or periodontal pockets. Trauma, wear, tooth cracks, and heat and friction from dental instruments during treatment can also cause pulp disease. When pulp disease occurs, it progresses in the following order: pulp congestion, pulpitis, and pulp necrosis. Pulpitis caused by bacterial infection can progress to periapical disease and periodontal disease. In the case of pulp necrosis, the pulp dies and its blood supply is completely cut off, causing the loss of the entire periodontal tissue, which can then lead to periapical disease or abnormalities of the entire tooth.

[0005] Treatment of pulp and periapical diseases involves the use of pulp replicators and root canal filling materials. Commonly used materials include calcium hydroxide, MTA (Mineral Trioxide Aggregate), and gutta-percha. MTA exhibits excellent sealing properties and is biocompatible, making it effective in treating diseases. However, its relatively high cost as a dental treatment is problematic, and discoloration can occur over time, causing aesthetic problems. Gutta-percha, while economical and fluid, is an unphysiological treatment method that results in loss of pulp vitality. Current conservative treatments for dentin and pulp diseases can weaken or fracture treated teeth, and carry a risk of reinfection.

[0006] The periodontium is a complex organ composed of epithelial tissue, soft connective tissue, and calcified connective tissue. The periodontal tissue structure includes the gingiva, periodontal ligament (PDL), cementum, and alveolar bone. Gingival fibroblasts and periodontal ligament fibroblasts are the major cellular components of the gingival soft connective tissue and play a role in forming and maintaining the extracellular matrix. While gingival fibroblasts primarily maintain gingival connective tissue, periodontal ligament fibroblasts are known to play a unique role in forming the periodontal ligament as well as in the repair and regeneration of adjacent alveolar bone and cementum in vivo. Periodontal disease clinically manifests as gingival bleeding and swelling, periodontal pocket formation, and alveolar bone destruction, leading to tooth loss.

[0007] The fundamental treatment for periodontal disease is to restore damaged connective tissue, cementum, and alveolar bone. To achieve this, it is necessary to regenerate the periodontal ligament that supports the alveolar bone, as well as the alveolar bone and cementum to which the periodontal ligament can attach.

[0008] Accordingly, active research is being conducted to develop therapeutic agents that can effectively treat the above-mentioned dentin pulp diseases. For example, Korean Patent Publication No. 2012-0089547 discloses a composition for hard tissue formation and dentin or pulp tissue regeneration, comprising ameloblasts, apical bud cells, or a culture medium thereof as active ingredients. Korean Patent Publication No. 2009-0033643 discloses a novel dental follicle-derived dental stem cell and a method for culturing the same. Furthermore, Korean Patent Publication No. 2016-0105627 discloses a composition for treating periodontal disease, comprising an ameloblast culture medium.

[0009] In dentistry, various forms of desensitizers, bone grafts, and mixed proteins are used to regenerate or treat dentin, bone, and cementum damaged by dentin disease, pulp disease, and periodontal disease. However, these alone are insufficient for regenerative or therapeutic effects. To address this issue, methods utilizing various materials, growth factors, and proteins are being developed. However, these substances often have minimal effects or can even cause cancer.

[0010] Accordingly, the inventors of the present invention have conducted extensive research efforts to develop a preparation that can more effectively treat dentin and pulp diseases and periodontal diseases that cause damage to alveolar bone and cementum, and as a result, have developed a peptide that exhibits effects in regeneration of hard tissues including dentin, bone and cementum, cell therapy for promoting regeneration of pulp tissue, or treatment of dentin hypersensitivity, and have completed the present invention.

[0011]

[0012] The present invention aims to provide a peptide for regeneration of hard tissues including dentin, bone or cementum, promotion of regeneration of pulp tissue, and treatment of dentin disease, pulp disease and / or periodontal disease.

[0013] Another object of the present invention is to provide a polynucleotide encoding the above peptide.

[0014] Another object of the present invention is to provide an expression vector comprising the above polynucleotide.

[0015] Another object of the present invention is to provide a pharmaceutical composition for treating dentin disease, pulp disease and / or periodontal disease, comprising the above peptide.

[0016] Another object of the present invention is to provide a pharmaceutical composition for preventing or improving dentin disease, pulp disease, or periodontal disease.

[0017] Another object of the present invention is to provide a health functional food composition for preventing or improving dentin disease, pulp disease, or periodontal disease, comprising the above peptide.

[0018] Another object of the present invention is to provide a method for preventing or treating dentin disease, pulp disease and / or periodontal disease, comprising a step of administering to a subject a composition comprising the peptide.

[0019] Another object of the present invention is to provide a method for promoting regeneration of hard tissues including dentin, bone or cementum and regeneration of dental pulp tissue, comprising a step of administering to a subject a composition containing the peptide.

[0020]

[0021] The purpose of the present invention is not limited to what has been mentioned above, and other purposes not mentioned will be clearly understood by those skilled in the art to which the present invention pertains from the description below.

[0022]

[0023] The present inventors conducted various studies to develop a formulation that can more effectively treat dentin disease, pulp disease, and / or periodontal disease, and as a result, developed a novel peptide composed of 10 amino acids.

[0024] A novel peptide according to one aspect of the present invention for solving the above technical problem is composed of a 10 amino acid sequence and is used for the prevention or treatment of dentin disease, pulp disease and / or periodontal disease.

[0025] A novel peptide according to one aspect of the present invention is produced by partially replacing the amino acid sequence of the peptide, and can increase the expression level of the DSPP (Dentin sialophosphoprotein) gene, which is an odontoblast differentiation marker gene, the expression level of BSP (Bone sialoprotein) and DMP1 (Dentin matrix protein 1) genes, which are bone and cementum differentiation marker genes in periodontal ligament fibroblasts, or the expression level of CAP (Cementum attachment protein), which is a gene that attaches periodontal ligament fiber bundles to cementum and bone in periodontal ligament fibroblasts, thereby exhibiting the effect of promoting the regeneration of dentin, dental pulp tissue, bone, or cementum, and the effect of attaching periodontal ligament fiber bundles to cementum and bone.

[0026] In addition, a graft containing the peptide together with pulp tissue cells was produced, and the produced graft was transplanted into the subcutaneous tissue of a mouse with a damaged immune system. After 12 weeks, the grafted tissue was analyzed, and it was confirmed that the genes of DSPP, BSP, DMP1, and CAP were increased, and the regeneration of bone / cementum-like tissue and dentin / pulp tissue complex was promoted.

[0027] As one embodiment for achieving the above-described purpose, the present invention provides a peptide for regeneration of hard tissue, promotion of regeneration of pulp tissue, treatment of dentin disease, pulp disease and / or periodontal disease, comprising an amino acid sequence of the following general formula 1.

[0028] R1-R2-R3-R4-R5-R6-R7-R8-YK (general formula 1)

[0029] In the above general formula 1,

[0030] R1 and R2 are glutamic acid (E) or lysine (K), respectively;

[0031] R3 and R4 are glutamine (Q) or arginine (R), respectively;

[0032] R5 is lysine (K);

[0033] R6 and R7 are lysine (K) or arginine (R), respectively; and

[0034] R8 is asparagine (N) or serine (S).

[0035]

[0036] According to one embodiment, the peptide may be composed of any one of the amino acid sequences of SEQ ID NOs: 1 to 48.

[0037] According to one embodiment, the peptide may be composed of any one of the amino acid sequences of SEQ ID NOs: 1 to 16.

[0038] According to one embodiment, the peptide may be composed of any one of the amino acid sequences of SEQ ID NOs: 17 to 32.

[0039] According to one embodiment, the peptide may be composed of any one of the amino acid sequences of SEQ ID NOs: 33 to 48.

[0040] According to one embodiment, the peptide may be acetylated or amidated at the N-terminus or C-terminus.

[0041] According to one embodiment, the hard tissue may include dentin, bone, and cementum.

[0042] In another aspect, the present invention provides a polynucleotide encoding the peptide.

[0043] In another aspect, the present invention provides an expression vector comprising the polynucleotide.

[0044] In another aspect, the present invention provides a pharmaceutical composition for preventing or treating dentin disease and / or pulp disease, comprising the peptide.

[0045] In one embodiment, the dentin disease or pulp disease may be dentin hypersensitivity, pulp hyperemia, pulpitis, pulp degeneration, or pulp necrosis and gangrene.

[0046] In another aspect, the present invention provides a pharmaceutical composition for preventing or treating periodontal disease comprising the peptide.

[0047] In one embodiment, the periodontal disease may be gingivitis, periodontitis, periodontal pocket or periodontal abscess.

[0048] In another aspect, the present invention provides a pharmaceutical composition for preventing or improving dentin disease, pulp disease, and / or periodontal disease, comprising the peptide.

[0049] In another aspect, the present invention provides a health functional food composition for preventing or improving dentin disease, pulp disease, and / or periodontal disease, comprising the peptide.

[0050] In another aspect, the present invention provides a method for preventing or treating dentin disease and / or pulp disease, comprising administering a composition comprising the peptide to a subject other than a human.

[0051] In another aspect, the present invention provides a method for preventing or treating periodontal disease, comprising administering a composition comprising the peptide to a subject other than a human.

[0052] In another aspect, the present invention provides a method for promoting regeneration of hard tissues and / or dental pulp tissues, including dentin, bone and cementum, comprising administering to a non-human subject a composition comprising the peptide.

[0053]

[0054] The term "dentine" of the present invention, also called "dentin", refers to a hard, yellowish-white tissue that makes up most of a tooth. Since the dentin is covered with enamel at the crown and cementum at the root, it is not exposed on the surface of the tooth. However, as the enamel wears away with age, the dentin may be exposed at the tip of the crown or the occlusal surface. The dentin is a type of bone tissue, but it is distinguished from general bone tissue in that the main body of the cells that make up the dentin is located in the pulp, and only their projections extend into the dentin.

[0055] The term "dental pulp" in the present invention, also known as "pulp," refers to the soft connective tissue that fills the pulp cavity within a tooth. Anatomically, it can also refer to the area rich in nerves and blood vessels, extending to the surface of the dentin.

[0056] The term "hard tissue" in the present invention refers to relatively hard skeletal tissues including bone, hyaline cartilage, and fibrocartilage. In one embodiment according to the present invention, the hard tissue may include dentin, bone, and cementum.

[0057] The term "cementum" of the present invention refers to a thin membrane in the form of a slightly deformed bone that covers the tooth root (dentin root) and other parts of mammals. The cementum is composed of 50% inorganic matter and 50% water-organic matter, is yellow in color, and exhibits a hardness lower than dentin or enamel. The cementum includes periodontal ligament fibers that fix the tooth to the alveolar bone. When bacteria infect the gums, the cementum surrounding the tooth degenerates, and the periodontal ligament fibers that connect the tooth to the alveolar bone cannot adhere to the degenerated cementum, causing the tooth to become loose. In order to treat such degeneration of cementum, a method of removing the degenerated cementum and promoting the formation of new cementum is used.

[0058] Periodontal ligament fibroblasts, along with gingival fibroblasts, are the major cellular components of the soft connective tissue of the periodontium. Periodontal ligament fibroblasts not only form the periodontal ligament, but also participate in the repair and regeneration of adjacent alveolar bone and cementum in vivo. However, the substances that promote this process are unknown, and they are distinct from gingival fibroblasts, which are involved in maintaining gingival connective tissue. Periodontal ligament fibroblasts can differentiate into osteoblasts or cementoblasts upon appropriate stimulation, but the mechanism by which periodontal ligament fibroblasts differentiate into cementoblasts is unclear. Known osteoblast and cementoblast differentiation markers include bone sialoprotein (BSP) and osteocalcin (OC), while cementum attachment protein (CAP) is known to play a crucial role in the attachment of periodontal ligament fibers to cementum. The periostin gene is also known as a periodontal ligament marker. Recent studies have reported that periostin is an important regulator of periodontal tissue formation and plays an important role in the regeneration of periodontal ligament and alveolar bone after periodontal surgery by promoting collagen fiber production and the migration of fibroblasts and osteoblasts.

[0059] The peptide provided in the present invention can increase the expression level of DSPP, DMP1 and CAP genes, which are odontoblast differentiation marker genes, without exhibiting cytotoxicity, and when transplanted into a living body together with dental pulp tissue cells, the dental pulp tissue cells can exhibit the characteristic of forming dentin / dentin tissue-like tissue or bone / cementum-like tissue.

[0060] The peptide provided in the present invention, as long as it can exhibit the effect of promoting regeneration of dentin or pulp tissue and treating dentin hypersensitivity, also includes a mutant peptide having a sequence that differs in one or more amino acid residues from the amino acid sequence constituting the peptide.

[0061] The peptide of the present invention can exhibit the same effects as the peptide provided by the present invention even if it has a form in which any amino acid is added to its N-terminus or C-terminus, and therefore is included in the category of the peptide provided by the present invention. As an example, the peptide may have 1 to 300 amino acids added to its N-terminus or C-terminus, and as another example, the peptide may have 1 to 100 amino acids added to its N-terminus or C-terminus, and as yet another example, the peptide may have 1 to 24 amino acids added to its N-terminus or C-terminus.

[0062] The peptide of the present invention may be chemically modified or protected with an organic group at its N-terminus or / and C-terminus, or may be modified by adding an amino acid to the peptide terminus, etc., in order to protect it from protein cleavage enzymes in the body and increase its stability. In particular, in the case of a chemically synthesized peptide, since the N- and C-termini are charged, the N-terminus may be acetylated, the N-terminus may be methylated, and / or the C-terminus may be amidated in order to remove such charges, or may include, but is not limited to, introduction of D-amino acids, peptide bond modifications such as CH2-NH, CH2-S, CH2S=O, and CH2-CH2, backbone modification, and side chain modification. Methods for preparing peptide mimetic compounds are known in the art, see, for example, Quantitative Drug Design, CA Ramsden Gd., Choplin Pergamon Press (1992).

[0063] The term "backbone modification" of the present invention refers to a chain-shaped or ring-shaped skeleton that forms the main structure of amino acids constituting a peptide, called a backbone (main chain: backbone), and directly modifying the amino acids constituting these peptide backbones into amino acid analogs is called backbone modification. An amino acid analog refers to an amino acid in which a hydrogen atom at the nitrogen or α-carbon of the amino acid backbone is modified by a substitution reaction.

[0064] The term "side chain modification" of the present invention refers to the atomic groups that branch off from the main chain-shaped or ring-shaped backbone of the amino acid constituting the peptide, which are called side chains of amino acids, and modifying these side chains using chemicals is called side chain modification. Examples of peptide side chain modification include reductive alkylation; amidation with methylacetimidate; alkylation with acetic anhydride; carbamoylation of an amino group with cyanate; trinitrobenzylation of an amino acid with 2,4,6-trinitrobenzene sulfonic acid (TNBS); alkylation of an amino group with succinic anhydride; or modification of an amino group such as pyridosylation reduced with NaBH4 after treatment with pyridoxal-5 phosphate.

[0065] In addition, the peptide of the present invention may be used alone, but may be mixed with a pharmaceutically approved carrier such as an organic solvent, and may also be used with carbohydrates such as glucose, sucrose, or dextran, antioxidants such as ascorbic acid or glutathione, chelating agents, low-molecular-weight proteins, or other stabilizers to enhance stability and efficacy.

[0066] According to one embodiment of the present invention, 48 kinds of peptides corresponding to general formula 1 provided in the present invention were synthesized, and the effect of the synthesized peptides on the expression level of the DSPP gene, which is an odontoblast differentiation marker gene, was verified. As a result, it was confirmed that the mRNA level of the DSPP gene, which is an odontoblast differentiation marker, in human dental pulp cells treated with the 48 kinds of peptides was all 2 to 6 times higher than the mRNA level of the DSPP gene measured in human dental pulp cells (control group) that were not treated with the peptides of the present invention (Fig. 1, Table 5). Since the DSPP gene is known to be a gene involved in the process of odontoblast differentiation and dentin calcification, it was analyzed that the peptides provided in the present invention would exhibit an effect of promoting dentin regeneration.

[0067] Since it is known that when the mRNA expression level of DSPP increases, odontoblast differentiation and dentin regeneration are promoted, it can be seen that the 48 peptides that exhibit the effect of increasing the mRNA level of the DSPP gene exhibit the effect of promoting odontoblast differentiation and dentin regeneration (Taduru Sreenath et al., THE JOURNAL OF BIOLOGICAL CHEMISTRY, Vol. 278, No. 27, Issue of July 4, pp. 24874-24880, 2003; William T. Butler et al, Connective Tissue Research, 44(Suppl. 1): 171-178, 2003).

[0068] In addition, the effect of the synthesized peptide on the expression of BSP, DMP1, and CAP genes, which are osteoblast and cementoblast differentiation marker genes, was verified. As a result, the expression of BSP, DMP1, and CAP genes measured in human periodontal ligament fibroblasts that were not treated with the peptide of the present invention was confirmed by real-time PCR. As a result, it was confirmed that the peptides of SEQ ID NOS: 1 to 48 increased the expression of BSP and DMP1 genes by about 3 to 5 times or more and the expression of CAP gene by 2 to 3 times or more compared to the control group. Since the BSP, DMP1, and CAP genes are known to be used as osteoblast and cementoblast differentiation markers and are involved in the calcification process of bone and cementum, it was analyzed that the peptide provided by the present invention would exhibit an effect of promoting bone and cementum regeneration (Figs. 2 and 3).

[0069] In another aspect, the present invention provides a polynucleotide encoding the peptide. The polynucleotide may be mutated by one or more base substitutions, deletions, insertions, or a combination thereof. When producing a nucleotide sequence by chemical synthesis, a synthetic method widely known in the art, such as the method described in the literature (Engels and Uhlmann, Angew Chem IntEd Engl., 37:73-127, 1988), may be used, and the synthesis may be performed using triester, phosphite, phosphoramidite, and H-phosphate methods, PCR and other autoprimer methods, oligonucleotide synthesis on a solid support, etc. For example, a polynucleotide encoding the peptide of the present invention may comprise the base sequence of SEQ ID NO: 4.

[0070] In another aspect, the present invention provides an expression vector comprising the polynucleotide, a transformant comprising the expression vector, and a method for producing the peptide using the transformant.

[0071] The term "expression vector" of the present invention refers to a recombinant vector capable of expressing a target peptide in a target host cell, and refers to a genetic construct containing essential regulatory elements operably linked to enable expression of a gene insert. The expression vector contains expression regulatory elements such as an initiation codon, a stop codon, a promoter, and an operator. The initiation codon and the stop codon are generally considered to be part of a nucleotide sequence encoding a polypeptide, and must be functional in a subject when the genetic construct is administered and must be in frame with the coding sequence. The promoter of the vector may be constitutive or inducible.

[0072] The term "operably linked" in the present invention refers to a state in which a nucleic acid expression regulatory sequence and a nucleic acid sequence encoding a target protein or RNA are functionally linked to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein or RNA are operably linked to affect the expression of the coding sequence. The operably linked sequence with the expression vector can be produced using genetic recombination techniques well known in the art, and site-specific DNA cleavage and ligation can be performed using enzymes generally known in the art.

[0073] Additionally, the expression vector may include a signal sequence for the release of the peptide to facilitate its release from the cell culture medium. A specific initiation signal may also be required for efficient translation of the inserted nucleic acid sequence. These signals include the ATG initiation codon and adjacent sequences. In some cases, an exogenous translational control signal, which may include the ATG initiation codon, must be provided. These exogenous translational control signals and initiation codons may come from a variety of natural and synthetic sources. Expression efficiency may be increased by the introduction of appropriate transcriptional or translational enhancing factors.

[0074] In addition, the expression vector may additionally include a protein tag that can be optionally removed using an endopeptidase to facilitate detection of the peptide.

[0075] The term "tag" in the present invention means a molecule exhibiting a quantifiable activity or characteristic, and may be a fluorescent molecule including a chemical fluorophore such as fluorescein, a polypeptide fluorophore such as a fluorescent protein (GFP) or a related protein, or an epitope tag such as a Myc tag, a Flag tag, a histidine tag, a leucine tag, an IgG tag, or a streptavidin tag. In particular, when an epitope tag is used, a peptide tag preferably composed of 6 or more amino acid residues, and more preferably composed of 8 to 50 amino acid residues, can be used.

[0076] In the present invention, the expression vector may include a nucleotide sequence encoding the peptide for promoting regeneration of dentin or pulp tissue and treating dentin hypersensitivity of the present invention described above. In this case, the vector used is not particularly limited thereto as long as it can produce the peptide, but may preferably be plasmid DNA, phage DNA, etc., and more preferably, commercially developed plasmids (pUC18, pBAD, pIDTSAMRT-AMP, etc.), Escherichia coli-derived plasmids (pYG601BR322, pBR325, pUC118, pUC119, etc.), Bacillus subtilis-derived plasmids (pUB110, pTP5, etc.), yeast-derived plasmids (YEp13, YEp24, YCp50, etc.), phage DNA (Charon4A, Charon21A, EMBL3, EMBL4, λλλ, etc.), animal viruses. It can be a vector (retrovirus, adenovirus, vaccinia virus, etc.), or an insect virus vector (baculovirus, etc.). Since the amount of protein expression and the number of modifications of the expression vector vary depending on the host cell, it is desirable to select and use the host cell most suitable for the purpose.

[0077] The transformant provided in the present invention can be produced by introducing the expression vector provided in the present invention into a host and transforming it, and can be used to produce the peptide by expressing the polynucleotide included in the expression vector. The transformation can be performed by various methods, and is not particularly limited thereto, as long as the peptide can be produced, but may include, but is not limited to, the CaCl2 precipitation method, the Hanahan method which increases efficiency by using a reducing substance called DMSO (dimethyl sulfoxide) in the CaCl2 precipitation method, electroporation, calcium phosphate precipitation, protoplast fusion, stirring using silicon carbide fibers, Agrobacterium-mediated transformation, transformation using PEG, dextran sulfate, lipofectamine, and drying / inhibition-mediated transformation methods. In addition, the host used for producing the transformant is not particularly limited thereto, as long as it can produce the peptide, and may be a bacterial cell such as Escherichia coli, Streptomyces, or Salmonella Typhimurium; a yeast cell such as Saccharomyces cerevisiae or Schizosaccharomyces pombe; a fungal cell such as Pichia pastoris; an insect cell such as Drosophila or Spodoptera Sf9 cells; an animal cell such as CHO, COS, NSO, 293, or Bow melanoma cells; or a plant cell.

[0078] The transformant described above can also be used in a method for producing a peptide for promoting regeneration of dentin or pulp tissue and treating dentin hypersensitivity of the present invention. Specifically, the method for producing a peptide for promoting regeneration of dentin or pulp tissue and treating dentin hypersensitivity of the present invention can comprise the steps of (a) culturing the transformant to obtain a culture; and (b) recovering the peptide of the present invention from the culture.

[0079] The term "cultivation" in the present invention refers to a method of growing microorganisms under appropriately artificially controlled environmental conditions. In the present invention, the method of culturing the transformant can be performed using a method widely known in the art. Specifically, the culturing is not particularly limited thereto as long as it can express and produce the peptide for promoting regeneration of dentin or pulp tissue and treating dentin hypersensitivity of the present invention, but can be continuously cultured in a batch process or a fed batch or repeated fed batch process.

[0080] The medium used for cultivation should meet the requirements of a specific strain in an appropriate manner while controlling temperature, pH, etc. under aerobic conditions in a general medium containing appropriate carbon sources, nitrogen sources, amino acids, vitamins, etc. The carbon sources that can be used include mixed sugars such as glucose and xylose as the main carbon source, and other sugars and carbohydrates such as sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These substances can be used individually or as a mixture. Nitrogen sources that can be used include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate; Organic nitrogen sources such as amino acids such as glutamic acid, methionine, and glutamine, and peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product can be used. These nitrogen sources can be used alone or in combination. The medium can contain potassium phosphate monobasic, potassium phosphate dibasic, and the corresponding sodium-containing salts as phosphorus. Potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts can be used as phosphorus. In addition, inorganic compounds such as sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, and calcium carbonate can be used. Finally, in addition to the above substances, essential growth substances such as amino acids and vitamins can be used.

[0081] Additionally, suitable precursors may be used in the culture medium. The above-mentioned raw materials may be added to the culture in a batch, fed-batch, or continuous manner during the culture process, but are not particularly limited thereto. The pH of the culture may be adjusted using basic compounds such as sodium hydroxide, potassium hydroxide, or ammonia, or acid compounds such as phosphoric acid or sulfuric acid, in an appropriate manner.

[0082] Additionally, foaming can be suppressed using antifoaming agents, such as fatty acid polyglycol esters. Oxygen or an oxygen-containing gas (e.g., air) is injected into the culture to maintain aerobic conditions. The culture temperature is typically 27°C to 37°C, preferably 30°C to 35°C. Cultivation is continued until the maximum production of the peptide is achieved. This is typically achieved within 10 to 100 hours.

[0083] In addition, the step of recovering the peptide from the culture can be performed by a method known in the art. Specifically, the recovery method is not particularly limited thereto, as long as it can be used to recover the produced peptide, but preferably, a method such as centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, differential dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) can be used.

[0084] In another aspect, the present invention provides a pharmaceutical composition for preventing or treating dentin disease or pulp disease, comprising the peptide.

[0085] As described above, the peptide of the present invention for promoting regeneration of hard tissues and / or pulp tissues including dentin, bone and cementum and for treating dentin disease, pulp disease and / or periodontal disease can promote the formation of dentin / pulp tissue-like tissues by human pulp cells when transplanted into a living body together with human pulp cells, and thus can be used as an effective ingredient of a pharmaceutical composition for treating dentin disease and pulp disease caused by damage to pulp tissue.

[0086] The peptide included in the above pharmaceutical composition may be used in the form of a single peptide, may be used in the form of a polypeptide in which the peptide is linked by repeating it two or more times, or may be used in the form of a complex in which a drug exhibiting a treatment effect for dentin disease or pulp disease is bound to the N-terminus or C-terminus of the peptide.

[0087] The term "dentin disease, pulp disease" of the present invention refers to a disease that occurs when the pulp tissue and the dentin attached thereto are damaged due to damage to the pulp tissue.

[0088] In the present invention, the dentin disease and pulp disease are not particularly limited as long as the peptide of the present invention exhibits a therapeutic effect, but may include, for example, dentin hypersensitivity, pulp congestion, pulpitis, pulp degeneration, pulp necrosis, and gangrene.

[0089] In another aspect, the present invention provides a pharmaceutical composition for preventing or treating periodontal disease comprising the peptide.

[0090] As described above, the peptide of the present invention for promoting regeneration of hard tissues and / or pulp tissues including dentin, bone and cementum and for treating dentin disease, pulp disease and / or periodontal disease can promote the formation of bone-like tissues by human pulp cells when transplanted into a living body together with human pulp cells, and thus can be used as an effective ingredient of a pharmaceutical composition for treating periodontal diseases that cause damage to bone and / or cementum.

[0091] The peptide included in the above pharmaceutical composition may be used in the form of a single peptide, may be used in the form of a polypeptide in which the peptide is linked by repeating it two or more times, or may be used in the form of a complex in which a drug exhibiting a periodontal disease treatment effect is bound to the N-terminus or C-terminus of the peptide.

[0092] The term "periodontal disease" of the present invention, also called periodontal disease, refers to a disease in which bacteria infect the gap between the gingiva (gums) and teeth, damaging the periodontal ligament and adjacent tissues. Depending on the severity of the disease, it is classified into gingivitis and periodontitis. When the periodontal disease develops, inflammation progresses and more tissues are damaged, forming a periodontal pocket. The more severe the periodontitis, the deeper the periodontal pocket becomes. As the periodontal pocket deepens, inflammation occurs in the periodontal ligament, and it is known that bone loss is ultimately induced.

[0093] In the present invention, the periodontal disease is not particularly limited as long as it exhibits a therapeutic effect by the peptide of the present invention, but may be, for example, gingivitis, periodontitis, periodontal pocket, or periodontal abscess.

[0094] The term "prevention" of the present invention means any act of inhibiting or delaying the occurrence of a dental disease by administering a pharmaceutical composition for preventing or treating a dental disease comprising the peptide of the present invention.

[0095] The term "treatment" of the present invention means all acts of promoting regeneration of dentin or pulp tissue by administering a pharmaceutical composition containing the peptide of the present invention as an active ingredient to a subject in need of treatment of a pulp disease, thereby performing treatment of a pulp disease.

[0096] The pharmaceutical composition of the present invention can be prepared in the form of a pharmaceutical composition for treating pulp disease, which additionally comprises an appropriate carrier (natural or non-natural carrier), excipient, or diluent commonly used in the manufacture of pharmaceutical compositions, in addition to the peptide. Specifically, the pharmaceutical composition can be formulated and used in the form of a sterile injectable solution that can be administered to the site of pulp disease according to a conventional method. In the present invention, carriers, excipients, and diluents that may be included in the pharmaceutical composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, mineral oil, collagen, and the like. When formulating, the composition may be prepared using diluents or excipients such as commonly used fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants. In particular, sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories, ointments (e.g., pulp lining materials, etc.), and the like. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases include witepsol, macrogol, Tween 61, cocoa butter, laurin, and glycerogelatin.

[0097] The content of the peptide included in the pharmaceutical composition of the present invention is not particularly limited thereto, but may be included in an amount of 0.0001 to 50 wt%, more preferably 0.01 to 20 wt%, based on the total weight of the final composition.

[0098] The pharmaceutical composition of the present invention may be administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount" as used herein means an amount sufficient to treat or prevent a disease at a reasonable benefit / risk ratio applicable to medical treatment or prevention, and the effective dosage level may be determined according to factors including the severity of the disease, the activity of the drug, the patient's age, weight, health, sex, the patient's sensitivity to the drug, the time of administration of the composition of the present invention used, the route of administration and the excretion rate, the treatment period, drugs used in combination or simultaneously with the composition of the present invention used, and other factors well known in the medical field. The pharmaceutical composition of the present invention may be administered alone or in combination with a known pharmaceutical composition for treating dental pulp disease. It is important to take all of the above factors into consideration and administer an amount that can achieve the maximum effect with the minimum amount without side effects.

[0099] The dosage of the pharmaceutical composition of the present invention can be determined by those skilled in the art in consideration of the intended use, the degree of toxicity of the disease, the patient's age, weight, sex, medical history, or the type of substance used as the active ingredient. For example, the pharmaceutical composition of the present invention can be administered at about 0.1 ng to about 100 mg / kg, preferably 1 ng to about 10 mg / kg, per adult, and the frequency of administration of the composition of the present invention is not particularly limited thereto, but can be administered once a day or administered in divided doses several times. The above dosage does not limit the scope of the present invention in any way.

[0100] "Administration" refers to introducing a given substance into a patient through any appropriate method. The route of administration can be any common route capable of reaching the target in the patient's body. Examples of such administration include, but are not limited to, intraperitoneal, intravenous, intramuscular, subcutaneous, intradermal, oral, topical, intranasal, and rectal administration.

[0101] In another aspect, the present invention provides a method for treating dentin disease or pulp disease, comprising administering a pharmaceutically effective amount of the pharmaceutical composition to a non-human subject suffering from dentin disease or pulp disease. In yet another aspect, the present invention provides a method for treating periodontal disease, comprising administering a pharmaceutically effective amount of the pharmaceutical composition to a non-human subject suffering from periodontal disease.

[0102] The term "subject" of the present invention may include, without limitation, humans, or mammals other than humans, including rats and livestock, etc., that require treatment for dentin disease, pulp disease, and / or periodontal disease.

[0103] "Effective amount" refers to the amount or dosage of the peptide or its pharmaceutically acceptable salt which, when administered to a patient in single or multiple doses, produces the desired effect in the patient under diagnosis or treatment. The effective amount can be readily determined by the attending physician diagnostician, as one of ordinary skill in the art, using known techniques or by observing results obtained under similar circumstances. When determining the effective amount for a patient, a number of factors are taken into consideration by the attending physician diagnostician, including but not limited to the mammalian species; its size, age, and general health; the specific disease or disorder involved; the degree or severity of the disease or disorder involved; the individual patient's response; the specific compound being administered; the mode of administration; the bioavailability characteristics of the formulation being administered; the selected dosing regimen; the use of concurrent medications; and other relevant circumstances.

[0104] The pharmaceutical composition of the present invention for treating dentin disease, pulp disease, and / or periodontal disease may be administered via any common route as long as it can reach the target tissue. The pharmaceutical composition of the present invention is not particularly limited thereto, but may be administered via routes such as intraoral administration or intraoral injection, depending on the intended purpose.

[0105] In another aspect, the present invention provides a pharmaceutical composition for preventing or improving dentin disease or pulp disease, comprising the peptide, or a pharmaceutical composition for preventing or improving periodontal disease, comprising the peptide.

[0106] The term "improvement" in the present invention means any action that at least reduces a parameter related to the condition being treated, for example, the severity of a symptom.

[0107] In the present invention, the improvement may be interpreted to mean any act of improving or benefiting the symptoms of dentin disease or pulp disease by administering a pharmaceutical composition containing the peptide of the present invention as an active ingredient to a subject requiring treatment of dentin disease or pulp disease, thereby promoting regeneration of dentin or pulp tissue, or any act of improving or benefiting the symptoms of periodontal disease by administering a pharmaceutical composition containing the peptide of the present invention as an active ingredient to a subject requiring treatment of periodontal disease, thereby promoting regeneration of bone and / or cementum.

[0108] The term "quasi-drug" in the present invention refers to products that are used for the purpose of diagnosing, treating, improving, alleviating, managing or preventing diseases of humans or animals, and have a milder effect than drugs. For example, according to the Pharmaceutical Affairs Act, quasi-drugs are products other than those used for the purpose of drugs, and include fiber and rubber products used for the treatment or prevention of diseases of humans or animals, products that have a mild or no direct effect on the human body, are not instruments or machines and similar thereto, and sterilizers and insecticides for preventing infectious diseases.

[0109] In the present invention, the type or formulation of the over-the-counter pharmaceutical composition containing the peptide is not particularly limited, but may include, for example, an oral disinfectant, oral cleaning product, toothpaste, dental floss, oral ointment, etc.

[0110] In another aspect, the present invention provides a health functional food composition for preventing or improving dentin disease, pulp disease, and / or periodontal disease, comprising the peptide.

[0111] The term "food" of the present invention includes dairy products including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, ice cream, various soups, beverages, tea, drinks, alcoholic beverages, vitamin complexes, health functional foods, and health foods, and includes all foods in the conventional sense.

[0112] The above functional health food is the same term as food for special health use (FoSHU), and refers to a food with high medical and healthcare effects that is processed to efficiently exhibit a bioregulatory function in addition to providing nutrition. Here, "functionality" means regulating nutrients for the structure and function of the human body or obtaining a useful effect for health purposes such as physiological action. The food of the present invention can be manufactured by a method commonly used in the art, and during the manufacturing process, raw materials and ingredients commonly added in the art can be added. In addition, the formulation of the food can also be manufactured without limitation as long as it is a formulation recognized as a food. The food composition of the present invention can be manufactured in various forms of formulations, and unlike general drugs, it has the advantage of not having side effects that may occur with long-term use of drugs by using food as a raw material, and has excellent portability, so the food of the present invention can be consumed as a supplement to enhance the effect of preventing or improving dentin disease, pulp disease, and / or periodontal disease.

[0113] The term "health food" refers to foods that have a more active health maintenance or promotion effect than regular foods, while "health supplement food" refers to foods intended for health supplementation. In some cases, the terms "health functional food," "health food," and "health supplement food" may be used interchangeably.

[0114] Specifically, the health functional food means a food product manufactured by adding the peptide of the present invention to food materials such as beverages, teas, spices, gums, and confectionery, or by manufacturing it in the form of encapsulation, powder, suspension, etc., and which has a specific health effect when consumed, but unlike general drugs, it has the advantage of not having side effects that may occur with long-term use of drugs made from food as a raw material.

[0115] The food composition of the present invention can be used very usefully because it can be consumed on a daily basis and is expected to be highly effective in preventing or improving dentin disease, pulp disease, and / or periodontal disease.

[0116] The above food composition may additionally include a physiologically acceptable carrier. The type of the carrier is not particularly limited, and any carrier commonly used in the art may be used.

[0117] In addition, the food composition may include additional ingredients commonly used in food compositions to improve odor, taste, sight, etc. For example, it may include vitamins A, C, D, E, B1, B2, B6, B12, niacin, biotin, folate, pantothenic acid, etc. In addition, it may include minerals such as zinc (Zn), iron (Fe), calcium (Ca), chromium (Cr), magnesium (Mg), manganese (Mn), copper (Cu), etc. In addition, it may include amino acids such as lysine, tryptophan, cysteine, and valine.

[0118] In addition, the food composition may include food additives such as preservatives (potassium sorbate, sodium benzoate, salicylic acid, sodium dehydroacetate, etc.), sterilizers (bleaching powder and high-purity bleaching powder, sodium hypochlorite, etc.), antioxidants (butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), etc.), colorants (tar colorants, etc.), color developers (sodium nitrite, sodium nitrite, etc.), bleaching agents (sodium sulfite), seasonings (MSG, monosodium glutamate, etc.), sweeteners (dulcin, cyclamate, saccharin, sodium, etc.), flavorings (vanillin, lactones, etc.), leavening agents (alum, D-potassium hydrogen tartrate, etc.), reinforcing agents, emulsifiers, thickeners (glucose fillers), film-forming agents, gum-forming agents, foam suppressants, solvents, and improvers. The above additives can be selected according to the type of food and used in an appropriate amount.

[0119] The peptide of the present invention can be added as is or used together with other foods or food ingredients, and can be used appropriately according to a conventional method. The amount of the active ingredient mixed can be appropriately determined depending on its purpose of use (prevention, health, or therapeutic treatment). Generally, when manufacturing a food or beverage, the food composition of the present invention can be added to the food or beverage in an amount of 50 parts by weight or less, specifically 20 parts by weight or less. However, when consumed for a long period of time for health and hygiene purposes, the content below the above range can be included, and since there is no problem in terms of safety, the active ingredient can also be used in an amount above the above range.

[0120] As an example, the food composition of the present invention can be used as a health beverage composition, and in this case, it can contain various flavoring agents or natural carbohydrates as additional ingredients like a regular beverage. The above-mentioned natural carbohydrates can be monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; polysaccharides such as dextrin and cyclodextrin; sugar alcohols such as xylitol, sorbitol, and erythritol. The sweetener can be a natural sweetener such as thaumatin and stevia extract; a synthetic sweetener such as saccharin and aspartame, etc. The proportion of the natural carbohydrate can be generally about 0.01 to 0.04 g, specifically about 0.02 to 0.03 g per 100 ml of the health beverage composition of the present invention.

[0121] In addition to the above, the health beverage composition may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, or carbonating agents. In addition, it may contain fruit pulp for the production of natural fruit juice, fruit juice drinks, or vegetable drinks. These ingredients may be used independently or in combination. The proportion of these additives is not particularly important, but is typically selected within the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the health beverage composition of the present invention.

[0122] The food composition of the present invention may contain various weight % if it can exhibit the effect of preventing or improving dentin disease, pulp disease, and / or periodontal disease, but specifically, the peptide of the present invention may be contained in an amount of 0.00001 to 100 wt % or 0.01 to 80 wt % relative to the total weight of the food composition, but is not limited thereto.

[0123] As another aspect of the present invention, a method for preventing or treating dentin disease, pulp disease, and / or periodontal disease is provided, comprising a step of administering to a subject a composition comprising the peptide described above.

[0124] In another aspect, a method for promoting regeneration of dentin or pulp tissue, and / or a method for promoting regeneration of bone or cementum, is provided, comprising administering to a subject a composition comprising the above peptide.

[0125] In another aspect of the present invention, a peptide comprising an amino acid sequence of the following general formula 1 or a composition comprising the peptide is provided for use in promoting regeneration of hard tissues including dentin, bone and cementum and / or pulp tissue, and for use in preventing or treating dentin disease, pulp disease or periodontal disease.

[0126] R1-R2-R3-R4-R5-R6-R7-R8-YK (general formula 1)

[0127] In the above general formula 1,

[0128] R1 and R2 are glutamic acid (E) or lysine (K), respectively;

[0129] R3 and R4 are glutamine (Q) or arginine (R), respectively;

[0130] R5 is lysine (K);

[0131] R6 and R7 are lysine (K) or arginine (R), respectively; and

[0132] R8 is asparagine (N) or serine (S).

[0133]

[0134] In another aspect, the present invention provides a use of a peptide comprising any one of the amino acid sequences of SEQ ID NOs: 1 to 48 or a composition comprising the peptide for promoting regeneration of hard tissues including dentin, bone and cementum and / or pulp tissue and for preventing or treating dentin disease, pulp disease and / or periodontal disease.

[0135] In addition, as an embodiment of the present invention, the present invention provides a use of a peptide comprising any one of the amino acid sequences of SEQ ID NOs: 1 to 24 or a composition comprising the peptide for promoting regeneration of hard tissues including dentin, bone and cementum and / or dental pulp tissue, and for preventing or treating dentin disease, dental pulp disease and / or periodontal disease.

[0136]

[0137] The present invention can provide a peptide for regeneration of hard tissue including dentin, bone or cementum, promotion of regeneration of pulp tissue, and treatment of dentin disease, pulp disease and / or periodontal disease.

[0138] The present invention can provide a polynucleotide encoding the above peptide.

[0139] The present invention can provide an expression vector comprising the above polynucleotide.

[0140] The present invention can provide a pharmaceutical composition for treating dentin disease, pulp disease, and / or periodontal disease, comprising the above peptide.

[0141] The present invention can provide a non-medical composition for preventing or improving dentin disease, pulp disease, or periodontal disease.

[0142] The present invention can provide a health functional food composition for preventing or improving dentin disease, pulp disease, or periodontal disease, including the above peptide.

[0143] Another object of the present invention is to provide a method for preventing or treating dentin disease, pulp disease, and / or periodontal disease, comprising a step of administering to a subject a composition comprising the peptide.

[0144] Another object of the present invention is to provide a method for promoting regeneration of hard tissues including dentin, bone or cementum and regeneration of dental pulp tissue, comprising a step of administering to a subject a composition containing the peptide.

[0145]

[0146] The effects of the present invention are not limited to those mentioned above, and other effects not mentioned will be clearly understood by those skilled in the art to which the present invention pertains from the description below.

[0147]

[0148] Figure 1 is a graph showing the average value of each group in Table 4, which was measured by quantitative real-time PCR for the level of DSPP mRNA in human dental pulp cells, as a result of grouping peptides with substituted amino acid sequences and confirming the effect of each group of peptides on the expression of DSPP (Dentin sialophosphoprotein), an odontoblast differentiation marker gene, in human dental pulp cells. The peptides were treated at a concentration of 10 ug / ml.

[0149] Figure 2 is a graph showing the results of quantitative real-time PCR measurements of the effects of novel peptides of each group on the expression of bone sialoprotein (BSP) and dentin matrix protein 1 (DMP1), which are bone and cementum differentiation marker genes, in human periodontal ligament fibroblasts. It is a graph showing the average values ​​of each group in Tables 5 and 6, in which the levels of BSP mRNA and DMP1 mRNA in human periodontal ligament fibroblasts were measured by quantitative real-time PCR. The peptides were treated at a concentration of 10 ug / ml.

[0150] Figure 3 is a graph showing the results of quantitative real-time PCR measurements of the effects of novel peptides of each group on the expression of CAP (Cementum Attachment Protein), a gene that attaches periodontal ligament fibroblasts to cementum and bone, in human periodontal ligament fibroblasts. It is a graph showing the average values ​​of each group in Table 7, in which CAP mRNA levels were measured by quantitative real-time PCR in human periodontal ligament fibroblasts. Peptides were treated at a concentration of 10 ug / ml.

[0151] Figure 4 shows the results of in vivo verification of the effect of novel peptides (sequence numbers 1, 13, and 15 of group 1) on dentin regeneration in an animal model of tooth damage. The dentin of adult dogs was exposed using a dental bur, 10 μg of each peptide was applied, and the tooth tissue was analyzed 3 weeks after application. The area indicated by the dotted line represents newly formed dentin (size bar: left 100 μm / right 50 μm).

[0152] Figure 5 shows histological analysis of hard tissue formation using human periodontal ligament fibroblasts (hPDLCs) in vivo. (A-C) hDPCs were mixed with 100 mg HA / TCP alone, (D-F) Group 1 peptide (10 μg of SEQ ID NO: 1 peptide), (G-I) Group 1 peptide (10 μg of SEQ ID NO: 13 peptide), and (J-L) Group 1 peptide (10 μg of SEQ ID NO: 15 peptide) in 0.5% fibrin gel and subcutaneously implanted in immunocompromised mice for 12 weeks. The formed tissues were stained with hematoxylin-eosin (scale bars: A, D, G, J 500 μm / B, E, H, K 200 μm / C, F, I, L 100 μm).

[0153]

[0154] The purposes and effects of the present invention, as well as the technical configurations for achieving them, will become clearer with reference to the embodiments described in detail below, along with the accompanying drawings. In describing the present invention, detailed descriptions of known functions or configurations will be omitted if they are deemed to unnecessarily obscure the gist of the invention. Furthermore, the terms described below are defined in consideration of the contributions made to the present invention and may vary depending on the intentions or practices of the user or operator.

[0155] However, the present invention is not limited to the embodiments disclosed below and can be implemented in various different forms. These embodiments are provided solely to ensure complete disclosure of the present invention and to fully inform those skilled in the art of the invention of the scope of the invention. The present invention is defined solely by the scope of the claims. Therefore, such definitions should be based on the contents of this specification.

[0156] Hereinafter, embodiments of the present invention will be described in detail.

[0157]

[0158] Experimental methods and materials

[0159] Example 1-1. Peptide synthesis

[0160] The peptides used in the manufacturing experiment for peptides for hard tissue regeneration were synthesized using the 9-fluorenylmethyloxycarbonyl (Fmoc) method, and the amino acids of the synthesized peptides were substituted to synthesize each group of peptides (Tables 1 to 3).

[0161]

[0162] N-EKQQKKKSYK-C (SEQ ID NO: 1)

[0163]

[0164] First, the peptide of group 1 was synthesized by substituting amino acid 1 of the peptide of sequence number 1 or the peptide of sequence number 1 with lysine, amino acid 2 with glutamic acid, amino acid 3 with arginine, amino acid 4 with glutamine, and amino acid 8 with asparagine (Table 1).

[0165]

[0166] Group 1 Peptide Sequence Number Amino Acid Sequence (NC) 1 EKQQKKKKSYK 2 EKQRKKKSYK 3 EKRQKKKKSYK 4 KEQQKKKKSYK 5 KERQKKKKSYK 6 KEQRKKKSYK 7 EKQQKKKKNYK 8 EKQRKKKNYK 9 EKRQKKKKNYK 10 KEQQKKKKNYK 11 KERQKKKKNYK 12 KEQRKKKNYK 13 KKQRKKKNYK 14 KKQRKKKSYK 15 KKRQKKKKSYK 16 KKRQKKKNYK

[0167] Next, the peptides of group 2 were synthesized by substituting amino acid 7 of the peptides of group 1 (SEQ ID NOs: 1 to 16) with arginine (Table 2).

[0168]

[0169] Group 2 Peptide Sequence Number Amino Acid Sequence (NC) 17EKQQKKRSYK 18EKQRKKRSYK 19EKRQKKRSYK 20KEQQKKRSYK 21KERQKKRSYK 22KEQRKKRSYK 23EKQQKKRNYK 24EKQRKKRNYK 25EKRQKKRNYK 26KEQQKKRNYK 27KERQKKRNYK 28KEQRKKRNYK 29KKQRKKRNYK 30KKQRKKRSYK 31KKRQKKRSYK 32KKRQKKRNYK

[0170] Next, group 3 peptides were synthesized by substituting amino acid 6 of group 2 peptides (SEQ ID NOs: 17 to 32) with arginine (Table 3).

[0171]

[0172] Group 3 peptide sequence number Amino acid sequence (NC) 33EKQQKRRSYK 34EKQRKRRSYK 35EKRQKRRSYK 36KEQQKRRSYK 37KERQKRRSYK 38KEQRKRRSYK 39EKQQKRRNYK 40EKQRKRRNYK 41EKRQKRRNYK 42KEQQKRRNYK 43KERQKRRNYK 44KEQRKRRNYK 45KKQRKRRNYK 46KKQRKRRSYK 47KKRQKRRSYK 48KKRQKRRNYK

[0173]

[0174] Example 1-2. Isolation and culture of human-derived dental pulp cells and periodontal ligament fibroblasts.

[0175] Human dental pulp cells and periodontal ligament fibroblasts were isolated from the dental pulp of 10 adults (aged 18-22 years) at Seoul National University Dental Hospital. Specifically, all experiments were approved by the hospital's Institutional Review Board and conducted with patient consent. Wisdom teeth were cut to expose the dental pulp, which was then separated with forceps according to the method of Jung HS et al (J Mol Histol. (2011)). The separated dental pulp was finely chopped into pieces using a double-edged knife, placed in a 60-mm cell culture dish, covered with a coverslip, and cultured in Dulbecco's modified Eagle's medium. Periodontal ligament fibroblasts were prepared by removing the periodontal ligament tissue attached to the root of the wisdom tooth using forceps, finely chopped into pieces using a double-edged knife, placed in a 60-mm cell culture dish, covered with a coverslip, and cultured in Dulbecco's modified Eagle's medium.

[0176]

[0177] Example 1-3. Reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR analysis

[0178] Total RNA from human dental pulp cells and mesenchymal stem cells was isolated using TRIzol reagent. cDNA was synthesized using 2 μg of total RNA, 1 μl of reverse transcriptase, and 0.5 μg of oligo (dT). The synthesized cDNA was used for real-time polymerase chain reaction. Real-time polymerase chain reaction was performed on an ABI PRISM 7500 sequence detection system (Applied Biosystems) using SYBR GREEN PCR Master Mix (Takara, Japan). Real-time polymerase chain reaction was performed under the following conditions: 94°C for 1 min; 40 cycles of 95°C for 15 s and 60°C for 34 s. The results were analyzed using the comparative cycle threshold (CT) method, and the primer sequences are listed in Table 4.

[0179]

[0180] <Nucleotide Sequences of Real-Time PCR Primers> GenePrimer (5'-3')hBSPforwardGAATGGCCTGTGCTTTCTCAAreverseTCGGATGAGTCACTACTGCCChDMP1forwardACAGGCAAATGAAGACCCreverseTTCACTGGCTTGTATGGhCAPforwardGACGAGGACGGCACCAAC GGreverseCGCGGTCATGGCGATGTCGThDSPPforwardCAACCATAGAGAAAGCAAACGCGreverseTTTCTGTTGCCACTGCTGGGAChGAPDHforwardCCATGGAGAAGGCTGGGGreverseCAAAGTTCTCATGGATGACC

[0181]

[0182] Example 1-4. In vivo transplantation and histological analysis

[0183] Human dental pulp cells (hDPCs) were isolated and used for in vivo transplantation experiments. hDPCs (2 x 10 6 Cells) were mixed with 100 mg of hydroxy apatite / tricalcium phosphate (HA / TCP) ceramic powder (Zimmer, USA) alone or with peptides (10 μg) in 0.5% fibrin gel and then transplanted into immunocompromised mice (NIH-bg-nu-xid; Harlan Laboratories, Indianapolis, IN) for 12 weeks.

[0184] Afterwards, the samples were harvested, fixed in 4% paraformaldehyde, decalcified in 10% EDTA (pH 7.4), embedded in paraffin, and 5 μm thick tissue sections were obtained, and the obtained tissue sections were stained with hematoxylin-eosin (HE) (Vector Labs).

[0185]

[0186] Example 1-5. Effect of a novel peptide on dentin regeneration in a dentin damage model.

[0187] Three adult dogs (12-16 kg; 6-8 weeks old) were anesthetized by inhalation of Geloran and intravenously injected with Zoletil (5 mg / kg) and xylazine (0.2-0.5 mg / kg), followed by lidocaine (2% lidocaine with 1:80,000 epinephrine). The premolars and molars of the mandibles of the dogs were damaged to the dentin using a dental bur, and 10 μg of the peptide (SEQ ID NO: 1) was applied per tooth. Six weeks later, the dogs were sacrificed by administering an overdose (90-120 mg / kg) of pentobarbital. The teeth of the above adult dog were extracted, fixed with 10% formalin, calcium was removed by adding 5% formic acid, shaped, embedded in paraffin, and then 5 μm thick tissue sections were obtained. The obtained tissue sections were stained with hematoxylin and eosin, and then analyzed using an optical microscope (LEICA DM750, Germany) equipped with a digital camera (LEICA ICC50 camera, Germany).

[0188]

[0189] Example 1-6. Statistical Analysis

[0190] Statistical analyses were performed using Student's t-test. All statistical analyses were performed using SPSS software version 19.0.

[0191]

[0192] Example 2: Experimental Results

[0193] Example 2-1. Effect of a peptide for promoting regeneration of dentin or pulp tissue and treating dentin hypersensitivity on the expression level of the DSPP gene, an odontoblast differentiation marker gene.

[0194] The DSPP gene is used as a marker of odontoblast differentiation and is known to be important for dentin calcification. Therefore, in this study, we synthesized novel peptides that promote odontoblast differentiation and dentin formation by increasing the expression of the DSPP gene, an odontoblast differentiation marker, and confirmed their effects. The effects of each peptide group on DSPP mRNA expression were confirmed by real-time PCR (Table 5).

[0195]

[0196] <Effect of peptides of groups 1 to 3 on mRNA levels of DSPP gene> DSPP gene expression Amino acid sequence (NC) Sequence number Gene expression change Group 1 EKQQKKKSYK 16.53 EKQRKKKSYK 25.77 EKRQKKKKSYK 35.99 KEQQKKKSYK 45.71 KERQKKKSYK 55.31 KEQRKKKSYK 64.99 EKQQKKKNYK 75.78 EKQRKKKNYK 85.53 EKRQKKKKNYK 94.78 KEQQKKKNYK 104.99 KERQKKKNYK 115.47 KEQRKKKNYK 125.81KKQRKKKNYK136.38KKQRKKKSYK145.83KKRQKKKSYK156.73KKRQKKKNYK165.45Group2EKQQKKRSYK173.27EKQRKKR SYK182.99EKRQKKRSYK192.81KEQQKKRSYK202.53KERQKKRSYK212.88KEQRKKRSYK222.49EKQQKKRNYK232.73EKQRKKRNYK 242.13EKRQKKRNYK252.77KEQQKKRNYK262.51KERQKKRNYK272.99KEQRKKRNYK282.13KKQRKKRNYK292.67KKQRKKRSYK302 .63KKRQKKRSYK312.22KKRQKKRNYK322.38Group3EKQQKRRSYK333.99EKQRKRRSYK343.67EKRQKRRSYK353.34KEQQKRRSYK 363.57KERQKRRSYK373.44KEQRKRRSYK383.68EKQQKRRNYK393.71EKQRKRRNYK403.61EKRQKRRNYK413.28KEQQKRRNYK423 .67KERQKRRNYK433.33KEQRKRRNYK443.77KKQRKRRNYK454.32KKQRKRRSYK463.27KKRQKRRSYK474.02KKRQKRRNYK483.75

[0197]

[0198] Figure 1 is a graph showing the average DSPP mRNA expression values ​​from each group in Table 5. In Figure 1, DSPP mRNA expression was increased by about 2 to 6 times or more in all peptide groups compared to the control group, and in particular, the peptide group of Group 1 showed the highest DSPP mRNA expression value. Since the DSPP gene is known to be involved in the differentiation of odontoblasts and the calcification process of dentin, it was analyzed that the peptide provided by the present invention would exhibit an effect of promoting dentin regeneration.

[0199]

[0200] Example 2-2. Effect of peptides for promoting bone or cementum regeneration and treating periodontal disease on the expression levels of BSP, DMP1, and CAP genes, which are osteoblast and cementoblast differentiation marker genes.

[0201] From the results of Example 2-1 above, it was confirmed that the peptide of the present invention can increase the mRNA level of the DSPP gene.

[0202] Accordingly, it was determined whether the peptides of groups 1 to 3 could increase the levels of CAPdml, a gene that attaches periodontal ligament fiber bundles to cementum and bone, in other odontoblast genes and / or periodontal ligament fibroblasts.

[0203] The BSP and DMP1 genes are used as osteoblast and cementoblast differentiation markers, and are known to be important genes for bone and cementum calcification. Furthermore, CAP, a gene that attaches periodontal ligament fiber bundles to alveolar bone and cementum, is known as a differentiation marker for cementoblasts. The effects of each group of peptides on BSP, DMP1, and CAP mRNA expression were confirmed by real-time PCR (Tables 6 to 8).

[0204]

[0205] <Effect of peptides of groups 1 to 3 on mRNA level of BSP gene> BSP gene expression Amino acid sequence (NC) Sequence number Gene expression change Group 1 EKQQKKKSYK 15.32 EKQRKKKSYK 24.52 EKRQKKKKSYK 34.81 KEQQKKKSYK 44.14 KERQKKKSYK 54.44 KEQRKKKSYK 64.5 EKQQKKKNYK 74.58 EKQRKKKNYK 84.45 EKRQKKKKNYK 94.87 KEQQKKKNYK 104.66 KERQKKKNYK 114.19 KEQRKKKNYK 124.82KKQRKKKNYK135.49KKQRKKKSYK144.99KKRQKKKSYK155.56KKRQKKKNYK165.01Group2EKQQKKRSYK172.68EKQRKKR SYK182.87EKRQKKRSYK192.86KEQQKKRSYK202.77KERQKKRSYK212.89KEQRKKRSYK222.98EKQQKKRNYK232.12EKQRKKRNYK 242.78EKRQKKRNYK252.21KEQQKKRNYK262.99KERQKKRNYK272.81KEQRKKRNYK282.75KKQRKKRNYK292.31KKQRKKRSYK30 3.01KKRQKKRSYK313.11KKRQKKRNYK322.69Group3EKQQKRRSYK334.07EKQRKRRSYK343.95EKRQKRRSYK354.32KEQQKRRSY K363.85KERQKRRSYK373.88KEQRKRRSYK384.07EKQQKRRNYK394.1EKQRKRRNYK403.98EKRQKRRNYK413.72KEQQKRRNYK423 .53KERQKRRNYK434.29KEQRKRRNYK444.31KKQRKRRNYK454.11KKQRKRRSYK463.83KKRQKRRSYK474.17KKRQKRRNYK484.09

[0206] <Effect of peptides of groups 1 to 3 on mRNA levels of DMP1 gene> DMP1 gene expression Amino acid sequence (NC) Sequence number Gene expression change Group 1 EKQQKKKSYK 16.27 EKQRKKKSYK 25.71 EKRQKKKKSYK 35.01 KEQQKKKSYK 45.51 KERQKKKSYK 55.42 KEQRKKKSYK 65.41 EKQQKKKNYK 75.44 EKQRKKKNYK 84.79 EKRQKKKKNYK 95.81 KEQQKKKNYK 105.77 KERQKKKNYK 115.9 KEQRKKKNYK 125.5KKQRKKKNYK136.84KKQRKKKSYK145.23KKRQKKKSYK156.52KKRQKKKNYK165.34Group2EKQQKKRSYK173.59EKQRKKRS YK182.99EKRQKKRSYK193.18KEQQKKRSYK203.42KERQKKRSYK212.89KEQRKKRSYK222.73EKQQKKRNYK233.05EKQRKKRNYK2 43.42EKRQKKRNYK253.58KEQQKKRNYK263.12KERQKKRNYK272.93KEQRKKRNYK283.13KKQRKKRNYK293.33KKQRKKRSYK303 .01KKRQKKRSYK312.77KKRQKKRNYK323.09Group3EKQQKRRSYK334.58EKQRKRRSYK344.31EKRQKRRSYK354.29KEQQKRRSYK 364.33KERQKRRSYK373.99KEQRKRRSYK384.72EKQQKRRNYK394.01EKQRKRRNYK404.78EKRQKRRNYK414.85KEQQKRRNYK424 .51KERQKRRNYK434.89KEQRKRRNYK444.27KKQRKRRNYK453.92KKQRKRRSYK464.76KKRQKRRSYK474.39KKRQKRRNYK484.44

[0207] <Effect of peptides of groups 1 to 3 on the mRNA level of CAP gene> CAP gene expression Amino acid sequence (NC) Sequence number Gene expression change Group 1 EKQQKKKSYK 13.99 EKQRKKKSYK 23.11 EKRQKKKKSYK 33.47 KEQQKKKSYK 43.19 KERQKKKSYK 53.24 KEQRKKKSYK 63.13 EKQQKKKNYK 73.77 EKQRKKKNYK 83.15 EKRQKKKNYK 93.17 KEQQKKKNYK 103.37 KERQKKKNYK 113.64 KEQRKKKNY K123.26KKQRKKKNYK134.02KKQRKKKSYK143.87KKRQKKKSYK154.11KKRQKKKNYK163.42Group2EKQQKKRSYK173.05EKQRKK RSYK182.99EKRQKKRSYK192.87KEQQKKRSYK203.53KERQKKRSYK212.76KEQRKKRSYK223.17EKQQKKRNYK232.92EKQRKKRNY K243.15EKRQKKRNYK252.88KEQQKKRNYK263.11KERQKKRNYK273.2KEQRKKRNYK282.95KKQRKKRNYK292.85KKQRKKRSYK30 3.21KKRQKKRSYK312.93KKRQKKRNYK323.1Group3EKQQKRRSYK332.85EKQRKRRSYK343.01EKRQKRRSYK352.83KEQQKRRSYK 362.51KERQKRRSYK373.11KEQRKRRSYK382.77EKQQKRRNYK392.55EKQRKRRNYK403.18EKRQKRRNYK412.53KEQQKRRNYK422 .79KERQKRRNYK432.94KEQRKRRNYK443.07KKQRKRRNYK452.99KKQRKRRSYK462.54KKRQKRRSYK472.66KKRQKRRNYK483.05

[0208]

[0209] In FIGS. 2 and 3, in order to confirm the effect of novel peptides on the expression of BSP, DMP1, and CAP genes, which are osteoblast and cementoblast differentiation marker genes, human periodontal ligament fibroblasts were treated with each group of peptides, and then the expression of BSP, DMP1, and CAP genes was confirmed by real-time PCR. Compared to the control group, the peptides of all groups increased the expression of BSP and DMP1 genes by about 3 to 5 times or more, and the expression of CAP gene by 2 to 3 times or more. Since the BSP, DMP1, and CAP genes are known to be used as osteoblast and cementoblast differentiation markers and are involved in the calcification process of bone and cementum, it was analyzed that the peptides provided by the present invention would have the effect of promoting bone and cementum regeneration.

[0210]

[0211] In order to confirm whether the novel peptide induces physiological dentin regeneration in a dentin damage animal model, the dentin of adult dogs was damaged, 10 ug of the novel peptide (SEQ ID NO: 1, 13, 15) was applied, and histological evaluation was performed after 3 weeks. In the control group, there was no change below the damaged dentin, but in the test group treated with the novel peptide, physiological dentin was formed below the damaged dentin. These results imply that tooth hypersensitivity, dentin dental caries, and pain due to tooth fracture caused by damaged dentin can be treated through physiological dentin regeneration.

[0212]

[0213] In order to confirm the effect of the peptides of Group 1 (SEQ ID NOs: 1, 13, and 15) on hard tissue formation in vivo based on the in vitro experimental results shown in FIG. 2 and Tables 6 to 8, peptides of Group 1 (SEQ ID NOs: 1, 13, and 15) (10 ug) or control (cell only) human periodontal ligament fibroblasts (hPDLCs) were transplanted into the subcutaneous tissue of immune-compromised mice. After 12 weeks of transplantation, an increased rate of hard tissue formation was confirmed in the group treated with the novel peptides compared to the control group. Histological analysis using hematoxylin-eosin staining showed that more bone / cementum-like tissues with cell incorporation into the matrix of newly formed calcified tissue around the HA / TCP particles were formed in the groups treated with hPDLCs-only, Group 1 peptides SEQ ID NOs: 1, 13, and 15. In summary, the above results indicate that the novel peptide used in this experiment has the effect of promoting the regeneration of bone / cementum-like tissue and dentin / pulp tissue complex.

[0214] This study was supported by the 2023 Small and Medium Business Technology Information Promotion Agency research grant (1425179693, "Development of a liquid dental caries inhibitor formulation using bio-new material functional peptide").

[0215]

[0216] This specification and drawings disclose preferred embodiments of the present invention. Although specific terms are used, they are used in a general sense only to easily explain the technical content of the present invention and to aid in understanding the invention, and are not intended to limit the scope of the present invention. It will be apparent to those skilled in the art that other modifications based on the technical concept of the present invention are possible in addition to the embodiments disclosed herein.

Claims

1. A peptide consisting of an amino acid sequence of the following general formula 1: R1-R2-R3-R4-R5-R6-R7-R8-YK (general formula 1) In the above general formula 1, R1 and R2 are glutamic acid (E) or lysine (K), respectively; R3 and R4 are glutamine (Q) or arginine (R), respectively; R5 is lysine (K); R6 and R7 are lysine (K) or arginine (R), respectively; and R8 is asparagine (N) or serine (S).

2. In paragraph 1, The above peptide is a peptide consisting of any one of the amino acid sequences of SEQ ID NOs: 1 to 48.

3. In paragraph 1, The above peptide is a peptide whose N-terminus or C-terminus is acetylated or amidated.

4. A polynucleotide encoding the peptide of paragraph 1.

5. An expression vector comprising the polynucleotide of clause 4.

6. A pharmaceutical composition for preventing or treating dentin disease, pulp disease or periodontal disease, comprising the peptide of paragraph 1 or a pharmaceutically acceptable salt thereof.

7. In paragraph 6, A pharmaceutical composition wherein the above dentin disease and pulp disease are dentin hypersensitivity, pulp hyperemia, pulpitis, pulp degeneration, or pulp necrosis and gangrene.

8. A pharmaceutical composition for preventing or treating periodontal disease, comprising the peptide of clause 1.

9. In paragraph 8, A pharmaceutical composition wherein the above periodontal disease is gingivitis, periodontitis, periodontal pocket or periodontal abscess.

10. A pharmaceutical composition for treating fractures or osteoporosis comprising the peptide of clause 1.

11. A pharmaceutical composition for preventing or improving dentin disease, pulp disease or periodontal disease, comprising the peptide of clause 1.

12. A health functional food composition for preventing or improving dentin disease, pulp disease or periodontal disease, comprising the peptide of clause 1.

13. A method for preventing or treating dentin disease or pulp disease, comprising a step of administering a composition containing the peptide of paragraph 1 to a subject other than a human.

14. A method for preventing or treating periodontal disease, comprising a step of administering a composition containing the peptide of paragraph 1 to a subject other than a human.

15. A method for treating fracture or osteoporosis, comprising administering a composition comprising the peptide of claim 1 to a subject other than a human.

16. A method for promoting regeneration of hard tissue or pulp tissue including dentin, bone and cementum, comprising the step of administering a composition comprising the peptide of claim 1 to a subject other than a human.

Citation Information

Patent Citations

  • New rgd-containing peptide and dentine regenerative agent, bone regenerative agent, and periodontal tissue regenerative agent

    JP2009286767A

  • Dual functional peptide for cell penetration and bone tissue regeneration and use of the same

    KR101944517B1

  • Novel peptide

    KR1020180076996A

  • Composition for dentin adhesion and composition for pulp restoration comprising cpne7-derived peptide

    KR102522134B1

  • Novel peptide

    KR102596392B1