Novel phosphoribosyl aminoimidazole-succinocarboxamide synthase variant and method for producing purine nucleotide using same

Abstract

Provided are: a phosphoribosyl aminoimidazole-succinocarboxamide synthase variant; a microorganism comprising the variant; a composition for producing a purine nucleotide, the composition comprising the microorganism; and a method for producing a purine nucleotide, the method comprising a step for culturing the microorganism.

Description

Novel phosphoribosyl aminoimidazole-succinocarboxamide synthetase variant and method for producing purine nucleotides using the same

[0001] Cross-citation with related application(s)

[0002] This disclosure claims the benefit of priority to Korean Patent Application No. 10-2023-0190928, filed January 26, 2023, the entire contents of which are incorporated herein by reference.

[0003] The present disclosure relates to a novel phosphoribosyl aminoimidazole-succinocarboxamide synthetase variant and a method for producing purine nucleotides using the same.

[0004] Purine nucleotides, such as 5'-inosine monophosphate (IMP), 5'-xanthosine monophosphate (XMP), and 5'-guanosine monophosphate (GMP), are intermediates in the nucleic acid biosynthesis metabolic chain, play important physiological roles in the body, and are widely used in foods, medicines, etc. Specifically, IMP is known to have a beefy flavor on its own, and GMP, which is derived from XMP, is known to have a mushroom flavor. Both substances are known to enhance the flavor of monosodium glutamate (MSG), and are thus attracting attention as a savory nucleic acid seasoning.

[0005] The biosynthetic pathway for producing purine nucleotides is very complex, and reactions occur sequentially with the additional participation of various amino acids and coenzymes. Among them, the reaction from CAIR (5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxylate) to SAICAR ((2S)-2-[5-amino-1-(5-phospho-beta-D-ribosyl)imidazole-4-carboxamido]succinate) is catalyzed by phosphoribosylaminoimidazole-succinocarboxamide synthase (purC). The substrates used for the phosphoribosyl aminoimidazole-succinocarboxamide synthetase reaction include CAIR (5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxylate), as well as aspartate and ATP.

[0006] Conventionally, a Corynebacterium strain with enhanced genes related to purine biosynthesis and a method for producing IMP or XMP using the same are known. For example, a Corynebacterium ammoniagenes strain with enhanced phosphoribosylpyrophosphate amidotransferase enzyme encoded by purF and a method for producing XMP using the same are disclosed (Korean Patent Publication No. 10-2007-0056491).

[0007] An example of the present disclosure provides a polypeptide having phosphoribosyl aminoimidazole-succinocarboxamide synthase activity.

[0008] The above polypeptide may include an amino acid sequence in which the amino acid corresponding to residue 69 in the amino acid sequence of SEQ ID NO: 5 is replaced with another amino acid.

[0009] Another example of the present disclosure provides a polynucleotide encoding the polypeptide.

[0010] Another example of the present disclosure provides a recombinant vector comprising the polynucleotide.

[0011] Another example of the present disclosure provides a microorganism producing purine nucleotides having enhanced activity of phosphoribosyl aminoimidazole-succinocarboxamide synthetase.

[0012] Another example of the present disclosure provides a microorganism comprising at least one member selected from the group consisting of the mutant polypeptide, a polynucleotide encoding the mutant polypeptide, and a vector comprising the polynucleotide.

[0013] Another example of the present disclosure provides a method for producing purine nucleotides, comprising the step of culturing the microorganism in a medium.

[0014] Another example of the present disclosure provides a composition for producing purine nucleotides, comprising the microorganism.

[0015] Another example of the present disclosure provides the use of the microorganism for the production of purine nucleotides.

[0016] Another example of the present disclosure provides the use of the microorganism for the preparation of a composition for producing purine nucleotides.

[0017]

[0018] This is specifically explained as follows. Meanwhile, each description and embodiment disclosed in this disclosure can also be applied to each other description and embodiment. That is, all combinations of various elements disclosed in this disclosure fall within the scope of this disclosure. Furthermore, the scope of this disclosure is not limited by the specific descriptions described below. Furthermore, numerous papers and patent documents are referenced and cited throughout this disclosure. The disclosure contents of the cited papers and patent documents are incorporated into this disclosure in their entirety by reference to more clearly explain the level of the technical field to which this disclosure belongs and the contents of this disclosure.

[0019]

[0020] In the present disclosure, a mutant that enhances the activity of phosphoribosyl aminoimidazole-succinocarboxamide synthase is searched for, and by introducing the mutant into a microorganism or producing a microorganism including the mutant, a microorganism having excellent purine nucleotide production ability is provided.

[0021] In the present disclosure, it was confirmed that when an amino acid substitution mutation was introduced at a specific position of phosphoribosyl aminoimidazole-succinocarboxamide synthetase, the purine nucleotide production ability was further increased.

[0022]

[0023] An example of the present disclosure provides a polypeptide having phosphoribosyl aminoimidazole-succinocarboxamide synthase activity. The polypeptide may be a variant of phosphoribosyl aminoimidazole-succinocarboxamide synthase derived from a microorganism of the genus Corynebacterium.

[0024] In one specific example, the polypeptide may include an amino acid sequence in which the amino acid corresponding to the 69th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 5 is replaced with another amino acid. Counting amino acids from the N-terminus in the amino acid sequence as described above may mean counting methionine (Met, M) translated from the start codon as the first amino acid.

[0025] In the present disclosure, the term “phosphoribosylaminoimidazole-succinocarboxamide synthase (purC)” has an activity that catalyzes the chemical reaction of 5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxylate + ATP + L-aspartate → (2S)-2-[5-amino-1-(5-phospho-beta-D-ribosyl)imidazole-4-carboxamido]succinate + ADP + 2 H+ + phosphate. Specifically, the phosphoribosylaminoimidazole-succinocarboxamide synthase of the present disclosure may be used interchangeably with “purC”. In the present disclosure, the sequence of the phosphoribosyl aminoimidazole-succinocarboxamide synthetase can be obtained from the NCBI's GenBank, a known database.

[0026] The protein to be subjected to the mutation introduction of the present disclosure may be a wild-type protein having the activity of phosphoribosyl aminoimidazole-succinocarboxamide synthetase. Specifically, the phosphoribosyl aminoimidazole-succinocarboxamide synthetase to be subjected to the mutation introduction may have, include, consist of, or essentially consist of the amino acid sequence of SEQ ID NO: 5, but is not limited thereto. That is, it does not exclude meaningless sequence additions before or after the amino acid sequence of SEQ ID NO: 5, mutations that may occur naturally, or silent mutations thereof, and if it has the same or corresponding activity as a protein including the amino acid sequence of SEQ ID NO: 5, it may correspond to the protein to be subjected to the mutation introduction of the present disclosure. For example, the protein that is the target of mutation introduction of the present disclosure may be a protein composed of an amino acid sequence that has a sequence homology or identity of 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.3%, 99.5%, 99.7%, or 99.9% or more, but less than 100%, to the amino acid sequence of SEQ ID NO: 5. In addition, a protein that has an amino acid sequence in which some sequences are deleted, modified, substituted, or added may also be included within the scope of the protein that is the target of mutation of the present disclosure, as long as it has such homology or identity and exhibits an effect corresponding to the protein.

[0027] In the present disclosure, the phosphoribosyl aminoimidazole-succinocarboxamide synthase may be derived from a microorganism of the genus Corynebacterium, specifically, but not limited to, Corynebacterium stationensis (Corynebacterium ammoniagenes).

[0028] In one example of the present disclosure, the amino acid corresponding to the 69th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 5 may be, but is not limited to, histidine (H, His).

[0029]

[0030] One example of the present disclosure provides a polypeptide, wherein the amino acid corresponding to the 69th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 5 is replaced with another amino acid. The polypeptide may be a variant of phosphoribosyl aminoimidazole-succinocarboxamide synthetase. The variant of phosphoribosyl aminoimidazole-succinocarboxamide synthetase may increase the activity and / or purine nucleotide production ability of phosphoribosyl aminoimidazole-succinocarboxamide synthetase.

[0031] In one example, the variant of the phosphoribosyl aminoimidazole-succinocarboxamide synthetase comprises an amino acid sequence having an amino acid sequence of SEQ ID NO: 5, wherein the amino acid corresponding to the 69th amino acid residue of the phosphoribosyl aminoimidazole-succinocarboxamide synthetase is replaced with another amino acid, for example, glutamine (Q, Gln), alanine (A, Ala), valine (V, Val), leucine (L, Leu), methionine (M, Met), isoleucine (I, Ile), threonine (T, Thr), asparagine (N, Asn), cysteine ​​(C, Cys), proline (P, Pro), tyrosine (Y, Tyr), tryptophan (W, Trp), lysine (K, Lys), arginine (R, Arg), glycine (G, Gly), aspartic acid (D, Asp), glutamic acid (E, Glu), and serine (S, Ser). It may be selected from the group and substituted with an amino acid different from the original amino acid. In one specific example, the variant of the phosphoribosyl aminoimidazole-succinocarboxamide synthase may be one in which the amino acid corresponding to the 69th amino acid residue in the amino acid sequence of SEQ ID NO: 5 is substituted with another amino acid, such as glutamine (Q, Gln), alanine (A, Ala), valine (V, Val), leucine (L, Leu), threonine (T, Thr), asparagine (N, Asn), proline (P, Pro), or serine (S, Ser). It is obvious that even if some amino acid sequences except the amino acid corresponding to the 69th amino acid residue in the amino acid sequence of SEQ ID NO: 5 are deleted, modified, substituted, or added, it can be included in the variant of the present disclosure as long as it exhibits the activity of phosphoribosyl aminoimidazole-succinocarboxamide synthase.

[0032] Additionally, in one example, the variant may comprise a polypeptide in which the amino acid corresponding to residue 69 of the amino acid sequence of SEQ ID NO: 5 is substituted with another amino acid in an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology or identity with the amino acid sequence of SEQ ID NO: 5. That is, a polypeptide comprising / consisting of an amino acid sequence having a substitution with another amino acid at a position corresponding to the 69th residue of the amino acid sequence of SEQ ID NO: 5, and having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99%, but less than 100% sequence homology or identity with the amino acid sequence of SEQ ID NO: 5, and having the activity of phosphoribosyl aminoimidazole-succinocarboxamide synthetase can be included in the variant of the present disclosure.

[0033] In one specific example, the variant of the phosphoribosyl aminoimidazole-succinocarboxamide synthetase has an amino acid sequence selected from the group consisting of SEQ ID NOs: 20 to 27 that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 96.3%, at least 96.5%, at least 96.7%, at least 96.9%, at least 97%, at least 97.1%, at least 97.2%, at least 97.4%, at least 97.6%, at least 97.8%, at least 98%, at least 98.2%, at least 98.4%, at least 98.6%, at least 98.9%, at least 99%, at least 99.1%, at least 99.3%, or at least 99.5% It may comprise or consist of an amino acid sequence having a homology or identity of at least 99.7% or 99.9%.

[0034] In addition, if a polypeptide has such homology or identity and exhibits an activity corresponding to a variant of the phosphoribosyl aminoimidazole-succinocarboxamide synthase, it may be included in the variant of the present disclosure even if it has an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted and / or added. For example, the variant of the phosphoribosyl aminoimidazole-succinocarboxamide synthase of the present disclosure may have an addition or deletion of a sequence, a naturally occurring mutation, a silent mutation or a conservative substitution at the N-terminus, C-terminus and / or within the amino acid sequence that does not alter the activity of the variant polypeptide.

[0035] The term "conservative substitution" refers to the replacement of one amino acid with another amino acid with similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of a protein or polypeptide.

[0036] The variants of the phosphoribosyl aminoimidazole-succinocarboxamide synthetase of the present disclosure may have properties that allow for increased purine nucleotide production compared to a wild-type polypeptide having phosphoribosyl aminoimidazole-succinocarboxamide synthetase activity.

[0037] In the present disclosure, the term "purine nucleotide" may specifically be at least one nucleotide selected from the group consisting of 5'-inosine monophosphate (hereinafter referred to as IMP), 5'-xanthosine monophosphate (hereinafter referred to as XMP), and 5'-guanosine monophosphate (hereinafter referred to as GMP). The IMP is a compound in which adenine is deaminated and refers to a nucleotide composed of one molecule each of hypoxanthine, ribose, and phosphate. It can be biosynthesized from 5'-phosphoribosyl-1-pyrophosphate (PRPP), and specifically, it can be formed by replacing the pyrophosphate group bonded to carbon 1 of PRPP with a nitrogen atom, and forming an imidazole ring and a pyrimidine ring over nine steps. The XMP refers to a nucleotide dehydrogenated from IMP. It can be synthesized from IMP by 5'-inosine-5'-monophosphate dehydrogenase. The GMP refers to a nucleotide having a structure in which a phosphate group forms an ester bond with the ribose portion of a guanosine molecule. The GMP can be synthesized by adding an ammonia molecule to XMP by 5'-guanine acid biosynthetic enzyme (GMP synthase). The method for producing GMP from XMP and / or the means used in the method can be selected from known techniques.

[0038] As used herein, the term "variant" refers to a polypeptide in which one or more amino acids are conservatively substituted and / or modified, thereby differing from the amino acid sequence of the variant before the mutation, but retaining functions or properties. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the ability of the variant may be increased, unchanged, or decreased compared to the polypeptide before the mutation. Additionally, some variants may include variants in which one or more portions, such as the N-terminal leader sequence or the transmembrane domain, are deleted. Other variants may include variants in which portions are deleted from the N- and / or C-terminus of the mature protein. The above term "variant" may be used interchangeably with terms such as variant, modification, variant polypeptide, mutated protein, mutation, and variant (in English, modification, modified polypeptide, modified protein, mutant, mutein, divergent, variant, etc.), and is not limited thereto as long as the term is used in the meaning of mutation. For the purpose of the present disclosure, the variant may be a polypeptide in which the amino acid corresponding to the 69th residue in the amino acid sequence of SEQ ID NO: 5 is substituted with a different amino acid.

[0039] Additionally, variants may include deletions or additions of amino acids that have minimal impact on the properties and secondary structure of the polypeptide. For example, the N-terminus of the variant may be conjugated with a signal (or leader) sequence involved in co-translational or post-translational protein translocation. Furthermore, the variant may be conjugated to other sequences or linkers to facilitate identification, purification, or synthesis.

[0040] In one example, the variant may be encoded by a polynucleotide comprising / consisting of a nucleic acid sequence selected from any one of SEQ ID NO: 29 to SEQ ID NO: 36.

[0041]

[0042] Another example of the present disclosure provides a polynucleotide encoding a variant of the phosphoribosyl aminoimidazole-succinocarboxamide synthetase.

[0043] In the present disclosure, the term "polynucleotide" means a DNA or RNA strand of a certain length or longer, which is a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain.

[0044] A polynucleotide encoding a variant of the present disclosure may comprise a base sequence encoding an amino acid sequence of SEQ ID NO: 5. For example, the polynucleotide of the present disclosure may comprise a base sequence set forth in any one of SEQ ID NOs: 29 to 36, or may consist of or consist essentially of a base sequence set forth in any one of SEQ ID NOs: 29 to 36.

[0045] A polynucleotide composed of or including any one of the base sequences selected from SEQ ID NOs: 29 to 36 may each encode an amino acid sequence described by any one of the sequence numbers selected from SEQ ID NOs: 20 to 27.

[0046] The polynucleotide of the present disclosure may have various modifications in the coding region within a range that does not change the amino acid sequence of the variant of the present disclosure, taking into account the degeneracy of the codon or the codon preferred in the organism that is intended to express the variant of the present disclosure. Specifically, the polynucleotide of the present disclosure has or includes a base sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% homology or identity with any one base sequence selected from SEQ ID NO: 29 to SEQ ID NO: 36, or has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, It may consist of or consist essentially of a base sequence that is at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9%, but is not limited thereto.

[0047] The polynucleotide of the present disclosure may include, without limitation, a probe that can be prepared from a known genetic sequence, for example, a sequence that can hybridize under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence of the present disclosure. The term “stringent conditions” refers to conditions that allow specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, conditions in which polynucleotides having high homology or identity hybridize with each other, polynucleotides having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, or 99.9% or more homology or identity hybridize with each other, and polynucleotides having lower homology or identity do not hybridize with each other, or washing conditions of typical southern hybridization, such as 60°C, 1×SSC, 0.1% SDS, specifically 60°C, 0.1×SSC, 0.1% Conditions for washing once, specifically two to three times, at a salt concentration and temperature equivalent to SDS, more specifically 68°C, 0.1×SSC, 0.1% SDS can be listed.

[0048] Hybridization requires that two nucleotide sequences be complementary, but hybridized polynucleotides may contain some mismatches between bases, depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Accordingly, the polynucleotides of the present disclosure may also include isolated nucleic acid fragments that are complementary in their entirety, as well as substantially similar nucleic acid sequences.

[0049] Specifically, a polynucleotide having homology or identity with the polynucleotide of the present disclosure can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C, and can be appropriately adjusted by a person skilled in the art depending on the purpose.

[0050] The appropriate stringency for hybridizing the polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables which are well known in the art (e.g., J. Sambrook et al., supra).

[0051] In the present disclosure, the phrase "a polynucleotide (which may be used interchangeably with a "gene") or a polypeptide (which may be used interchangeably with a "protein") "comprises, consists of, or is represented by a specific nucleic acid sequence or amino acid sequence" may mean that the polynucleotide or polypeptide essentially includes the specific nucleic acid sequence or amino acid sequence, and may be interpreted as including (or not excluding) a "substantially equivalent sequence" in which a non-significant mutation (deletion, substitution, modification, and / or addition) is added to the specific nucleic acid sequence or amino acid sequence to the extent that the original function and / or the desired function of the polynucleotide or polypeptide is maintained.

[0052] As used herein, the terms "homology" or "identity" refer to the degree of similarity between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0053] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.

[0054] Whether any two polynucleotide or polypeptide sequences are homologous or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example, as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information database.

[0055] Homology or identity of polynucleotides or polypeptides can be determined by comparing sequence information using a GAP computer program, such as that disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482, or in, for example, Needleman et al. (1970), J Mol Biol. 48:443. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a coding sequence matrix, as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0056] As used herein, the term "corresponding to" refers to an amino acid residue at a position listed in a polypeptide, or an amino acid residue that is similar, identical, or homologous to the residue listed in the polypeptide. Identifying an amino acid at a corresponding position may be determining a specific amino acid in a sequence that references a particular sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related or reference protein.

[0057] For example, any amino acid sequence can be aligned with SEQ ID NO: 5, and based on this, each amino acid residue of the amino acid sequence can be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 5. For example, a sequence alignment algorithm such as that described in the present disclosure can identify the position of an amino acid, or the position at which a modification such as a substitution, insertion, or deletion occurs, by comparing it to a query sequence (also referred to as a “reference sequence”).

[0058] For such alignment, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) can be used, but is not limited thereto, and any sequence alignment program known in the art, pairwise sequence comparison algorithm, etc. can be appropriately used.

[0059]

[0060] Another example of the present disclosure provides a vector comprising a polynucleotide encoding a variant of the phosphoribosyl aminoimidazole-succinocarboxamide synthetase. The vector may be an insertion vector or an expression vector.

[0061] As used herein, the term "vector" refers to a DNA construct for delivering a target polynucleotide into a suitable host or host cell. For example, it may comprise, but is not limited to, a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the target polypeptide in a suitable host cell. The expression control sequence may include a promoter capable of initiating transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and / or a sequence for regulating the termination of transcription and / or translation. After being transformed into a suitable host cell, the vector may be maintained independently of the genome (genome) of the host cell, or may be integrated into the genome of the host cell. For example, the target polynucleotide may be integrated into a chromosome via an insertion vector. Insertion of the above polynucleotide into a chromosome can be accomplished by any method known in the art, for example, but not limited to, homologous recombination.

[0062] The vector usable in the present disclosure is not particularly limited as long as it is replicable in a host cell, and may be selected from all commonly used vectors. Examples of commonly used vectors include plasmids, cosmids, viruses, bacteriophages, etc., in a natural or recombinant state. For example, as the vector, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A, etc., can be used as a phage vector or a cosmid vector, and pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series, etc., can be used as a plasmid vector. Specifically, examples include, but are not limited to, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, and pDC24 vectors.

[0063] The above vector may further comprise a selection marker to determine whether the vector has been introduced into a transformed cell or has been integrated into the genome of the transformed cell. The selection marker is used to determine whether the vector-transformed cell or the polynucleotide has been integrated, and may be selected from genes that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or surface protein expression. In an environment treated with a selective agent, only cells expressing the selection marker will survive or exhibit other phenotypic characteristics, thereby enabling the selection of transformed cells.

[0064] Expression of the above mutant in a microorganism can be performed by introducing a polynucleotide encoding the mutant, or a vector containing the same, into a host cell and culturing a recombinant cell (e.g., a microorganism) containing the same.

[0065] The introduction of a polynucleotide encoding the above variant or a vector containing the same into a microorganism can be performed by a person skilled in the art by appropriately selecting a known transformation method. In the present disclosure, the term "transformation" means introducing a target polynucleotide or a vector containing the same into a host cell (microorganism) to change the genetic characteristics of the host cell (microorganism). The transformed polynucleotide may be positioned by insertion into the chromosome of the host cell or may be positioned extrachromosomally. The polynucleotide may be introduced in an appropriate form depending on the purpose of introduction. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all elements necessary for autonomous expression. The expression cassette may typically include expression control elements such as a promoter, a transcription termination signal, a ribosome binding site, and / or a translation termination signal that are operably linked to the polynucleotide. The expression cassette may be in the form of an expression vector capable of autonomous replication. Additionally, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell. The term "operably linked" as used herein may mean that the polynucleotide is functionally linked to an expression control element (e.g., a promoter) so that transcriptional regulation (e.g., transcription initiation) of the polynucleotide can be performed. Operable linkage can be performed using genetic recombination techniques known in the art.

[0066] The method for transforming the above polynucleotide into a host cell can be performed by any method for introducing a nucleic acid into a cell (microorganism), and can be performed by appropriately selecting a transformation technique known in the art depending on the host cell. Examples of the known transformation methods include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) precipitation, DEAE-dextran, cationic liposome, lipofection, and lithium acetate-DMSO.

[0067]

[0068] Another example of the present disclosure provides a microorganism comprising the phosphoribosyl aminoimidazole-succinocarboxamide synthase variant.

[0069] Specifically, the microorganism may be a microorganism comprising at least one (e.g., at least one, at least two, or one, two, or three) selected from the group consisting of a polypeptide (variant) having phosphoribosyl aminoimidazole-succinocarboxamide synthetase activity described above, a polynucleotide encoding (or encoding) the polypeptide, and a vector comprising the polynucleotide.

[0070] As used herein, the term "microorganism (or strain)" may encompass both wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification. The microorganism may be a microorganism whose specific mechanism has been enhanced or weakened, such as by the insertion of an external gene or the enhancement or weakening of the activity of an endogenous gene, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein, or product (e.g., a purine nucleotide). The terms "microorganism," "strain," "host," and "host cell" may be used interchangeably as used herein.

[0071] The microorganism (or strain, recombinant cell) of the present disclosure may be a microorganism having enhanced activity of phosphoribosyl aminoimidazole-succinocarboxamide synthetase, having purine nucleotide production ability (or production amount), or having improved (or increased) purine nucleotide production ability.

[0072] For example, the microorganism of the present disclosure may be a microorganism that naturally lacks purine nucleotide production ability, or a microorganism that has purine nucleotide production ability, but is not limited thereto, by introducing a polypeptide (variant) having phosphoribosyl aminoimidazole-succinocarboxamide synthetase activity of the present disclosure or a polynucleotide encoding the same into a microorganism that has purine nucleotide production ability, thereby imparting or improving purine nucleotide production ability.

[0073] In the present disclosure, the term “microorganism comprising a phosphoribosyl aminoimidazole-succinocarboxamide synthase variant” may mean a microorganism that is engineered (mutated) to express a polypeptide (variant) having the phosphoribosyl aminoimidazole-succinocarboxamide synthase activity described above, thereby enhancing phosphoribosyl aminoimidazole-succinocarboxamide synthase activity, or a microorganism that has no purine nucleotide production ability is made to have purine nucleotide production ability, or has a purine nucleotide production ability higher than its original purine nucleotide production ability.

[0074] In the present disclosure, the term "unmodified microorganism" does not exclude a strain that contains a mutation that may occur naturally in a microorganism, and may refer to a wild-type strain or a natural strain itself, or a strain before its characteristics are changed by a genetic mutation caused by natural or artificial factors. For example, the unmodified microorganism may refer to a strain into which a polypeptide (variant) having phosphoribosyl aminoimidazole-succinocarboxamide synthase activity of the present disclosure or a polynucleotide encoding a polypeptide (variant) having phosphoribosyl aminoimidazole-succinocarboxamide synthase activity is not introduced, or before it is introduced. The term "unmodified microorganism" may be used interchangeably with "pre-modified strain", "pre-modified microorganism", "unmodified strain", "unmodified microorganism", or "reference microorganism".

[0075] In the present disclosure, the reference microorganism may be a wild-type microorganism known to produce purine nucleotides, for example, Corynebacterium stationarinis ATCC6872. Alternatively, the reference microorganism may be a microorganism known to produce purine nucleotides, for example, Corynebacterium stationarinis KCCM12151P (US 2023-0192780 A1) or Corynebacterium stationarinis CJX1664 (KCCM12285P, Republic of Korea Patent No. 10-1950141), but is not limited thereto.

[0076] The microorganism producing the purine nucleotide of the present disclosure is not particularly limited as long as it can produce a purine nucleotide, but may be a microorganism of the genus Corynebacterium. The above-mentioned Corynebacterium genus microorganisms are Corynebacterium stationis, Corynebacterium thermoaminogenes, Corynebacterium glutamicum, Brevibacterium flavum, Brevibacterium lactofermentum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium singulare, and Corynebacterium The microorganism may be at least one selected from the group consisting of Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris, and Corynebacterium flavescens, but is not limited thereto. Specifically, the microorganism of the genus Corynebacterium may be Corynebacterium stationis.

[0077]

[0078] Another example of the present disclosure provides a method for producing a purine nucleotide, comprising the step of culturing a microorganism having enhanced activity of phosphoribosyl aminoimidazole-succinocarboxamide synthetase in a medium.

[0079] The above microorganism may be a microorganism comprising at least one (e.g., at least one, at least two, or one, two, or three) selected from the group consisting of a polypeptide (variant) having phosphoribosyl aminoimidazole-succinocarboxamide synthetase activity described above, a polynucleotide encoding (or encoding) the polypeptide, and a vector comprising the polynucleotide.

[0080] The above phosphoribosyl aminoimidazole-succinocarboxamide synthetase, variant, microorganism and purine nucleotide are as described above.

[0081] In the present disclosure, "cultivation" means growing a microorganism, such as a microorganism of the genus Corynebacterium, into which a polypeptide having phosphoribosyl aminoimidazole-succinocarboxamide synthase activity of the present disclosure or a gene encoding the same has been introduced or whose activity has been enhanced, under appropriately controlled environmental conditions. The culturing process of the present disclosure can be performed using a suitable medium and culture conditions known in the art. Such a culturing process can be easily adjusted and used by a person skilled in the art depending on the selected strain. Specifically, the culturing may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0082] In the present disclosure, the "medium" means a substance mixed as a main component with nutrients required for culturing a microorganism, such as a microorganism of the genus Corynebacterium, into which a polypeptide having phosphoribosyl aminoimidazole-succinocarboxamide synthase activity of the present disclosure or a gene encoding the same has been introduced or its activity has been enhanced, and supplies nutrients and growth factors, including water essential for survival and growth. In addition, the medium may further contain XMP for GMP synthesis. Specifically, any medium and other culture conditions used for culturing the microorganism of the present disclosure may be used without particular limitation as long as it is a medium used for culturing a typical microorganism, but the microorganism of the present disclosure may be cultured under aerobic conditions while controlling temperature, pH, etc. in a typical medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compound, amino acid, and / or vitamin, etc.

[0083] In the present disclosure, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses (e.g., blackstrap molasses), rice bran, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted to reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

[0084] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; amino acids such as glutamic acid, methionine, glutamine, etc.; organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

[0085] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.

[0086] Additionally, during the cultivation of the microorganism of the present disclosure, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium. Furthermore, during the cultivation, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. Furthermore, to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or to maintain anaerobic and microaerobic states, nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection, but is not limited thereto.

[0087] In the culture of the present disclosure, the culture temperature can be maintained at 20 to 45°C, or 25 to 37°C, specifically 25 to 37°C, and the culture can be performed for about 10 to 160 hours, or about 20 to 120 hours, but is not limited thereto.

[0088] Purine nucleotides produced by the culture of the present disclosure may be secreted into the medium or remain within the cells.

[0089] The method for producing purine nucleotides of the present disclosure may include a step of adding an enzyme to a medium or a step of adding a microorganism expressing the enzyme. For example, the method may further include a step of adding an enzyme that converts XMP to GMP or a microorganism expressing the enzyme and / or a step of culturing the microorganism after the step of culturing a microorganism producing XMP.

[0090] In one example, the method for producing purine nucleotides of the present disclosure may further include a step of culturing a microorganism producing 5'-xanthylic acid (XMP) or a step of adding XMP to the medium prior to the step of culturing a microorganism having enhanced activity of phosphoribosyl aminoimidazole-succinocarboxamide synthetase in a medium.

[0091] The method for producing purine nucleotides of the present disclosure may further include a step of recovering purine nucleotides from the cultured microorganism (e.g., a microorganism of the genus Corynebacterium), the culture medium (the medium in which the culture is performed), or both. The recovering step may be additionally included after the culturing step.

[0092] The above recovery may be performed by collecting the desired purine nucleotide using a suitable method known in the art according to the culture method of the microorganism of the present disclosure, such as a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallized protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and the desired purine nucleotide may be recovered from the medium or microorganism using a suitable method known in the art.

[0093] Additionally, the purine nucleotide production method of the present disclosure may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, when the purine nucleotide production method of the present disclosure includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, regardless of order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.

[0094]

[0095] Another example of the present disclosure provides a composition for producing purine nucleotides, comprising a microorganism having enhanced activity of phosphoribosyl aminoimidazole-succinocarboxamide synthetase, a medium in which the microorganism is cultured, or a combination thereof.

[0096] The microorganism, medium, and purine nucleotide with enhanced activity of the phosphoribosyl aminoimidazole-succinocarboxamide synthetase are as described above.

[0097] Another example provides the use of the above microorganism for the production of purine nucleotides.

[0098] Another example provides the use of the microorganism for the preparation of a composition for producing purine nucleotides.

[0099] The composition of the present disclosure may further comprise any suitable excipient commonly used in compositions for producing purine nucleotides, including but not limited to preservatives, wetting agents, dispersing agents, suspending agents, buffers, stabilizers, or isotonic agents.

[0100]

[0101] The present disclosure relates to a novel phosphoribosyl aminoimidazole-succinocarboxamide synthase variant, a microorganism comprising the phosphoribosyl aminoimidazole-succinocarboxamide synthase variant, a composition for producing purine nucleotides comprising the microorganism, and a method for producing purine nucleotides comprising a step of culturing the microorganism, wherein high yields of purine nucleotides can be produced by culturing a Corynebacterium spp. microorganism into which the phosphoribosyl aminoimidazole-succinocarboxamide synthase variant of the present disclosure has been introduced.

[0102]

[0103] The present disclosure is described in more detail below through examples. However, the following examples are merely preferred embodiments intended to illustrate the present disclosure and are therefore not intended to limit the scope of the present disclosure. Furthermore, technical details not described in this disclosure can be readily understood and implemented by those skilled in the technical field of the present disclosure or similar technical fields.

[0104]

[0105] Example 1: Discovery of mutations in the phosphoribosyl aminoimidazole-succinocarboxylate synthase gene.

[0106] We created a mutant library of the purC gene encoding phosphoribosyl aminoimidazole-succinocarboxamide synthetase, one of the IMP biosynthetic enzymes, and aimed to discover enhanced mutants that increase IMP production.

[0107]

[0108] Example 1-1: Construction of a vector containing purC

[0109] To construct a purC library, a recombinant vector containing the purC gene was constructed as follows using plasmid pDC24 (SEQ ID NO: 37) for insertion and replacement of genes in the Corynebacterium chromosome.

[0110] Specifically, the chromosomal gene of the wild-type Corynebacterium stationensis ATCC6872 strain was isolated using the G-spin Total DNA extraction mini kit (Cat. No. 17045) from Intron according to the protocol provided in the kit, and the purC gene fragment was obtained by performing polymerase chain reaction using the primer pair of SEQ ID NO: 1 and SEQ ID NO: 2. The PCR conditions were denaturation at 94°C for 5 minutes, followed by 20 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, followed by polymerization at 72°C for 7 minutes.

[0111] The gene fragment obtained above was cloned into linear pDC24 digested with SmaI restriction enzyme using the Gibson assembly (NEB) method to obtain pDC24-purC. The Gibson assembly reaction (based on 20 ul) was performed at 50°C for 30 minutes by mixing 1 ul of linearized pDC24 vector, 3 ul of purCPCR DNA, 10 ul of Gibson assembly mater mix, and 3 ul of PCR grade water.

[0112]

[0113] 1-2: Creation of a purC mutant library

[0114] A purC mutant library was produced based on the vector produced in Example 1-1 above using the following method.

[0115] Specifically, the Error-Prone PCR technique was used to introduce random mutations into the purC gene. The reaction was performed using pDC24-purC, produced in Example 1-1, as a PCR template and a primer pair of SEQ ID NO: 1 and SEQ ID NO: 2. The PCR buffer conditions were set to introduce 2.0 bp mutations per 1 kb, and the reaction was performed referring to the manufacturer's manual (Diversify PCR Random Mutagenesis Kit, TAKARA). Error-prone PCR reaction (50 μl) was performed with the composition of 40 μl PCR grade water, 5 μl 10X TITANIUM Taq buffer, 1 μl 2 mM dGTP, 1 μl 50X Diversify dNTP Mix, 1 μl Primer mix, 1 μl Template DNA, and 1 μl TITANIUM Taq polymerase. PCR conditions were denaturation at 94°C for 30 sec, followed by 25 cycles of denaturation at 94°C for 30 sec and polymerization at 68°C for 2 min, and then polymerization at 68°C for 1 min. The purC gene fragment expected to have introduced random mutations was cloned into pDC24 to obtain pDC24-purC(Mut).

[0116]

[0117] 1-3: Construction of a Corynebacterium stationanis strain library containing a purC mutant vector library.

[0118] Using the pDC24-purC(Mut) mutant vector library constructed in Example 1-2, the IMP-producing strain Corynebacterium stationis KCCM12151P (US 2023-0192780 A1) was transformed by electroporation, and then spread on a selection medium containing 25 mg / L of kanamycin to secure 10,000 colonies of strains with inserted mutant genes, which were selected as the primary candidate group. The selected strain libraries were named KCCM12151P_purC(library_1) to KCCM12151P_purC(library_10000), respectively.

[0119] In addition, a strain was prepared by introducing the pDC24-purC vector into Corynebacterium stationanis KCCM12151P in the same manner to be used as a control group in the experiment, and the strain was named KCCM12151P_purC(WT).

[0120]

[0121] 1-4: Evaluation of the constructed purC library and selection of strains

[0122] Each of the 10,000 colonies obtained in the above Examples 1-3 was inoculated into 200 μl of autoclaved seed medium and cultured in a 96-deep well plate using a microplate shaker (TAITEC) at 30°C and 1200 rpm for 24 hours to be used as a seed culture. 290 μl of the autoclaved fermentation medium was dispensed into a 96-deep well plate, and 20 μl of the seed culture was inoculated into each plate, followed by shaking culture for 72 hours under the same conditions as above.

[0123] To analyze the production of 5'-inosinic acid produced in the culture medium, 3 μl of the culture supernatant was transferred to a 96-well UV-plate containing 197 μl of distilled water each after the culture was completed. Next, the plate was shaken for 30 seconds using a microplate reader, and the absorbance was measured with a spectrophotometer at 25°C and a wavelength of 270 nm. Fifty colonies of mutant strains showing an absorbance increased by 10% or more compared to the absorbance of the KCCM12151P_purC (WT) strain were selected. The other colonies showed similar or decreased absorbance compared to the control.

[0124] The 50 selected strains were repeatedly tested for 5'-inosinic acid production through absorbance measurement using the same method as above, and one strain, KCCM12151P_purC (library_708), which showed 5'-inosinic acid production at the same level as the KCCM12151P_purC (WT) strain, and one strain, KCCM12151P_purC (library_3291), which showed significantly improved 5'-inosinic acid production were selected.

[0125]

[0126] Example 1-5: Confirmation of purC mutation through gene sequencing

[0127] In order to confirm the genetic mutations of the two mutant strains selected in the above Example 1-4, PCR was performed on the KCCM12151P_purC (library_708) and KCCM12151P_purC (library_3291) strains using the primer pairs of SEQ ID NO: 3 and SEQ ID NO: 4, and sequencing was performed to compare with the wild-type purC gene sequence of the Corynebacterium stationenis KCCM12151P strain.

[0128] As a result, it was confirmed that both strains contained one amino acid mutation each in the purC gene. Specifically, it was confirmed that the KCCM12151P_purC (library_708) strain contained a mutation in which the 29th methionine was substituted with leucine in the amino acid sequence encoded by the purC gene represented by SEQ ID NO: 5, and the KCCM12151P_purC (library_3291) strain contained a mutation in which the 69th histidine was substituted with glutamine in the amino acid sequence encoded by the purC gene represented by SEQ ID NO: 5.

[0129]

[0130] The sequences of the primers used in Example 1 are shown in Table 1 below.

[0131] Name Sequence (5'->3') Sequence number Primer 1 TTCGAGCTCGGTACCCGTCAGCAGTGGAACGAAGGCGAC Sequence number 1 Primer 2 CTCTAGAGGATccccAGATATCGGTCAGGTGGTCATCG Sequence number 2 Primer 3 GGTAAGAGTCCAGAAGAA Sequence number 3 Primer 4 CGCATCCACTCATATTCA Sequence number 4

[0132] Example 2: Production of a strain introducing a purC mutation and evaluation of 5'-inosinic acid production.

[0133] Example 2-1: Construction of a recombinant vector introducing purC mutations

[0134] In order to confirm the influence of the M29L mutation and the H69Q mutation of the amino acid sequence encoded by the purC gene discovered in the above Example 1-5 on the IMP production ability, a vector introducing the mutation into the endogenous purC gene of the Corynebacterium stationensis strain was constructed.

[0135] Specifically, it was constructed as follows using plasmid pDC24 (SEQ ID NO: 37) for insertion and replacement of genes in the chromosome of Corynebacterium stationensis strain.

[0136] Using the genomes of the KCCM12151P_purC (library_708) strain and the KCCM12151P_purC (library_3291) strain selected in the above Examples 1-4 as templates, the primer pairs of SEQ ID NO: 1 and SEQ ID NO: 2 were used to obtain gene fragments purC-M29L and purC-H69Q, respectively, through polymerase chain reaction. The PCR conditions were denaturation at 94°C for 5 minutes, followed by 20 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, followed by polymerization at 72°C for 7 minutes. The gene fragments obtained above were cloned into linear pDC24 cut with SmaI restriction enzyme using the Gibson assembly (NEB) method to obtain pDC24-purC (M29L) and pDC24-purC (H69Q), respectively.

[0137]

[0138] Example 2-2: Production of a 5'-inosinic acid producing strain with a purC mutation introduced.

[0139] In order to confirm the influence of the M29L mutation and H69Q mutation of the amino acid sequence encoded by the purC gene discovered in the above Example 1-5 on IMP production ability, a strain was created in which the mutation was introduced into the endogenous purC gene of the Corynebacterium stationary strain.

[0140] The pDC24-purC(M29L) and pDC24-purC(H69Q) vectors constructed in Example 2-1 were each electroporated into Corynebacterium stationanis KCCM12151P, a strain capable of producing 5'-inosinic acid, and then strains in which the mutant gene and vector were inserted together on the chromosome were selected as primary candidates on a selection medium containing 25 mg / L of kanamycin. Afterwards, in the strains in which homologous recombination occurred, secondary confirmation was performed through PCR using the primer pair of SEQ ID NO: 3 and SEQ ID NO: 4, and final confirmation was performed through gene sequence analysis. The selected strains were named CJI-3414 (KCCM12151P_purC(M29L)) and CJI-3415 (KCCM12151P_purC(H69Q)), respectively.

[0141]

[0142] Example 2-3: Evaluation of 5'-inosinic acid production ability of 5'-inosinic acid producing strain with purC mutation introduced

[0143] In order to measure the 5'-inosinic acid production ability of the CJI-3414 and CJI-3415 strains produced in Example 2-2 above, a flask titer evaluation was performed.

[0144] Specifically, Corynebacterium stationensis KCCM12151P, CJI-3414, and CJI-3415 strains were each inoculated into a 14 ml tube containing 2.5 ml of the following seed medium, and cultured with shaking at 170 rpm at 30°C for 24 hours. 2 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 29 ml of the following production medium (24 ml of main medium + 5 ml of starch medium), and cultured with shaking at 170 rpm at 30°C for 72 hours. After completion of the culture, the optical density (OD) was measured at a wavelength of 562 nm using a spectrophotometer (Eppendorf). In addition, the production amount of 5'-inosinic acid was measured using HPLC (UC11-SIMAZU), specifically, inosine-5-monophsphate disodium salt hydrate (aldrich, 57510-5G) was used as a standard reagent, and the mobile phase for analysis was 5 L of distilled water, 10 g of 0.2%-Ammonium Dihydrogenphosphate, 1 g of 0.02%-Tetrabutylammonium phosphate monobasic, and 108 ml of 2.1% ACETONITRILE, adjusted to pH 2.4 with H3PO4. The column temperature was 40℃, the flow rate was 1.0 ml / min, and 2 ul of a 20-fold diluted cultured sample was injected for measurement. The culture results are shown in Table 2 below.

[0145]

[0146] <IMP 생산을 위한 종배지의 조성>

[0147] Glucose 1%, peptone 1%, meat juice 1%, yeast extract 1%, sodium chloride 0.25%, adenine 100 mg / L, guanine 100 mg / L, pH 7.2

[0148]

[0149] <IMP 생산을 위한 생산배지의 조성>

[0150] Monosodium glutamate 0.1%, ammonium chloride 1%, magnesium sulfate 1.2%, calcium chloride 0.01%, iron sulfate 20 mg / L, manganese sulfate 20 mg / L, zinc sulfate 20 mg / L, copper sulfate 5 mg / L, L-cysteine ​​23 mg / L, beta-alanine 24 mg / L, nicotinic acid 8 mg / L, biotin 45 μg / L, thiamine hydrochloride 5 mg / L, adenine 30 mg / L, phosphoric acid (85%) 1.9%, glucose 4.2%, fructose 2.4%

[0151]

[0152] Confirmation of 5'-inosinic acid production by introduction of purC gene mutation Name of strain Introduction type OD 5'-inosinic acid (g / L) Concentration increase rate (%) KCCM12151P Control 39.14.9-CJI-3414purC(M29L) 39.252 CJI-3415purC(H69Q) 39.65.4 10.2

[0153] As a result, as shown in Table 2, the CJI-3414 strain, which introduced the purC (M29L) mutation into the IMP producing strain, showed a similar result to the control group, with the concentration of 5'-inosinic acid increasing by approximately 2% compared to the KCCM12151P strain, whereas the CJI-3415 strain, which introduced the purC (H69Q) mutation, showed a similar result to the control group, with the concentration of 5'-inosinic acid increasing by approximately 10.2% compared to the KCCM12151P strain.

[0154]

[0155] Example 3: Production of a strain with a mutation in which the amino acid at position 69 in the amino acid sequence encoded by the purC gene is substituted with an amino acid other than glutamine, and evaluation of 5'-inosinic acid production ability.

[0156] Example 3-1: Construction of a vector for inserting a purC (H67) mutant amino acid substitution.

[0157] Through the above Example 2, it was confirmed that the H69Q mutation in the amino acid sequence encoded by the purC gene can improve inosinic acid production. Accordingly, to confirm the positional importance of PurC (H67), a vector was constructed in which the 69th amino acid was substituted with an amino acid other than glutamine, and whether this affected 5'-inosinic acid production was confirmed.

[0158] Specifically, site-directed mutagenesis was performed using the pDC24-purC (H69Q) vector produced in Example 2-1 as a template. For the introduction of the purC (H69A) mutation, primer pairs of SEQ ID NO: 1 and SEQ ID NO: 6 and SEQ ID NO: 2 and SEQ ID NO: 7, for the introduction of the purC (H69V) mutation, primer pairs of SEQ ID NO: 1 and SEQ ID NO: 8 and SEQ ID NO: 2 and SEQ ID NO: 9, for the introduction of the purC (H69L) mutation, primer pairs of SEQ ID NO: 1 and SEQ ID NO: 10 and SEQ ID NO: 2 and SEQ ID NO: 11, for the introduction of the purC (H69T) mutation, primer pairs of SEQ ID NO: 1 and SEQ ID NO: 12 and SEQ ID NO: 2 and SEQ ID NO: 13, for the introduction of the purC (H69N) mutation, primer pairs of SEQ ID NO: 1 and SEQ ID NO: 14 and SEQ ID NO: 2 and SEQ ID NO: 15, for the introduction of the purC (H69P) mutation, primer pairs of SEQ ID NO: 1 and SEQ ID NO: 16 and SEQ ID NO: 2 and SEQ ID NO: 17, for the introduction of the purC (H69S) mutation, primer pairs of SEQ ID NO: 1 and Site-directed PCR was performed using primer pairs of SEQ ID NO: 18 and SEQ ID NO: 2 and SEQ ID NO: 19, respectively, and at this time, after denaturation at 94℃ for 5 minutes, denaturation at 94℃ for 30 seconds, annealing at 55℃ for 30 seconds, polymerization at 72℃ for 2 minutes was repeated 20 times, and then polymerization was performed at 72℃ for 7 minutes. As a result, each PCR product was obtained, and after DpnI treatment, it was cloned into linear pDC24 digested with SmaI restriction enzyme through Gibson assembly (NEB) method, thereby obtaining a plasmid in which the 69th amino acid of purC was modified with the target amino acid, and the information of the obtained plasmid is shown in Table 3 below.

[0159] List of vectors for inserting amino acid substitutions in purC (H69) Number Plasmid name 1 pDC24-purC (H69A) 2 pDC24-purC (H69V) 3 pDC24-purC (H69L) 4 pDC24-purC (H69T) 5 pDC24-purC (H69N) 6 pDC24-purC (H69P) 7 pDC24-purC (H69S)

[0160] The sequences of the primers used in the above Example 3-1 are shown in Table 1 and Table 4 below.

[0161] Name sequence (5' → 3') Sequence number 6CGATGGGTCCTGCCAAagcGTTCGGGAAATCGATGGCSequence number 7TCGATTTCCCGAACgctTTGGCAGGACCCATCGATGSequence number 8CGATGGGTCCTGCCAAcacGTTCGGGAAATCGATGGCSequence number 9TCGATTTCCCGAACgtgTTGGCAGGACCCATCGATGSequence number 10CGATGGGTCCTGCCAAgagGTTCGGGAAATCGATGGCSequence number 11TCGATTTCCCGAACctcTTGGCAGGACCCATCGATGSequence number 12CGATGGGTCCTGCCAAggtGTTCGGGAAATCGATGGCSequence number 13TCGATTTCCCGAACaccTTGGCAGGACCCATCGATGSequence number 14CGATGGGTCCTGCCAAgttGTTCGGGAAATCGATGGCSequence number 15TCGATTTCCCGAACaacTTGGCAGGACCCATCGATGSEQ ID NO: 16CGATGGGTCCTGCCAAtggGTTCGGGAAATCGATGGCSEQ ID NO: 17TCGATTTCCCGAACccaTTGGCAGGACCCATCGATGSEQ ID NO: 18CGATGGGTCCTGCCAAcgaGTTCGGGAAATCGATGGCSEQ ID NO: 19TCGATTTCCCGAACtcgTTGGCAGGACCCATCGATG

[0162] Example 3-2: Production of a strain with a mutation in which the amino acid at position 69 in PurC is substituted with an amino acid other than glutamine.

[0163] Each of the seven vectors constructed in Example 3-1 was transformed into Corynebacterium stationanis KCCM12151P, a strain capable of producing 5'-inosinic acid, by electroporation, and then strains in which the mutant gene and vector were inserted together on the chromosome were selected as primary candidates on a selection medium containing 25 mg / L of kanamycin. Afterwards, in strains in which homologous recombination occurred, secondary confirmation was performed through PCR using the primer pair of SEQ ID NO: 3 and SEQ ID NO: 4, followed by final confirmation through gene sequence analysis. The strain names according to the inserted mutations are shown in Table 5 below.

[0164] Number Strain Name1KCCM12151P::purC(H69A)2KCCM12151P::purC(H69V)3KCCM12151P::purC(H69L)4KCCM1215 1P::purC(H69T)5KCCM12151P::purC(H69N)6KCCM12151P::purC(H69P)7KCCM12151P::purC(H69S)

[0165] Example 3-3. Confirmation of 5'-inosinic acid production ability of a strain with a mutation in which the amino acid at position 69 of PurC is substituted with an amino acid other than glutamine.

[0166] In order to measure the 5'-inosinic acid production ability of the seven strains produced in the above Example 3-2, the flask titer evaluation was performed in the same manner as in Example 2-3 to measure the production amount of 5'-inosinic acid, and the culture results of the strain in which a mutation was introduced into the IMP producing strain Corynebacterium stationary KCCM12151P in which the amino acid at position 69 of PurC was substituted with an amino acid other than glutamine are shown in Table 6 below.

[0167] Strain numberIntroduction formOD5'-inosinic acid(g / L)Concentration increase rate (%)KCCM12151PControl39.14.9-CJI-3415purC(H69Q)39.75.512.21purC(H69A)39.25.14.12purC(H69V)39.15.26.13purC(H69L)39.45.14.14purC(H69T)39.85.38.25purC(H69N)39.85.38.26purC(H69P)39.55.14.17purC(H69S)39.65.26.1

[0168] As a result, as shown in Table 6, it was confirmed that the strain containing the purC mutant gene in which the 69th amino acid of the amino acid sequence encoded by the purC gene was substituted with another amino acid in the IMP-producing strain increased IMP production compared to the KCCM12151P strain that did not contain the mutation. That is, it was confirmed that the 69th amino acid of the amino acid sequence encoded by the purC gene is a major mutation position in inosinic acid production. More specifically, it was confirmed that the 5'-inosinic acid production of a microorganism containing a mutation in which the 69th amino acid of the amino acid sequence encoded by the purC gene was substituted with glutamine, alanine, valine, leucine, threonine, asparagine, proline, or serine was significantly increased.

[0169]

[0170] Example 4: Production of a strain with a purC mutation and evaluation of 5'-xanthrylic acid production.

[0171] Example 4-1: Production of a 5'-xanthrylic acid producing strain with a purC mutation

[0172] To determine whether a mutation in the purC gene could lead to increased XMP production, the purC(H69Q) mutation was introduced into the purC gene of the XMP-producing strain Corynebacterium stationenis CJX1664 (US 11697810 B2) using the following method.

[0173] Specifically, the pDC24-purC (H69Q) vector constructed in Example 2-1 was transformed into the Corynebacterium stationanis CJX1664 strain, a strain capable of producing 5'-xanthrylic acid, by electroporation, and then a strain in which the mutant gene and the vector were inserted together on the chromosome was selected as a primary candidate in a selection medium containing 25 mg / L of kanamycin. Afterwards, in the strain in which homologous recombination occurred, secondary confirmation was performed through PCR using the primer pair of SEQ ID NO: 3 and SEQ ID NO: 4, and finally, a strain in which a mutation was introduced was selected through gene sequence analysis. The selected strain was named CJX1664_purC (H69Q).

[0174]

[0175] Example 4-2: Evaluation of 5'-xanthylic acid production ability of a 5'-xanthylic acid producing strain with a purC mutation

[0176] In order to measure the XMP production ability of the strain produced in Example 4-1 above, a flask titer evaluation was performed.

[0177] The produced strain was inoculated into a 14 ml tube containing 2.5 ml of the following seed medium and cultured with shaking at 170 rpm at 30°C for 24 hours. 1 ml of the seed culture was inoculated into a 300 ml corner-baffle flask containing 32 ml of the following production medium (24 ml of main medium + 8 ml of starch medium) and cultured with shaking at 170 rpm at 30°C for 72 hours. After completion of the culture, the amount of XMP production was measured using HPLC, and the culture results are shown in Table 7 below.

[0178]

[0179] <XMP 생산을 위한 종배지의 조성>

[0180] Glucose 1%, Peptone 1%, Meat Juice 1%, Yeast Extract 1%, Sodium Chloride 0.25%, Adenine 100 mg / L, Guanine 100 mg / L, pH 7.5

[0181]

[0182] <XMP 생산을 위한 생산배지(본배지)의 조성>

[0183] Glucose 40 g / L, Magnesium sulfate 10 g / L, Calcium chloride 100 mg / L, Iron sulfate 20 mg / L, Manganese sulfate 10 mg / L, Zinc sulfate 10 mg / L, Copper sulfate 0.8 mg / L, Histidine 20 mg / L, Cystine 15 mg / L, Beta-Alanine 15 mg / L, Biotin 100 μg / L, Thiamine 5 mg / L, Adenine 50 mg / L, Guanine 25 mg / L, Niacin 5 mg / L, pH 7.0

[0184]

[0185] <Composition of production medium (separately sterilized medium) for XMP production>

[0186] Monopotassium phosphate 18 g / L, Monopotassium phosphate 42 g / L, Urea 7 g / L, Ammonium sulfate 5 g / L

[0187] Confirmation of 5'-xanthlic acid production by introduction of purC gene H69Q mutation Name of strain Introduction type OD 5'-xanthlic acid (g / L) Concentration increase rate (%) CJX1664Control 54.84.63-CJX1664_purC(H69Q) purC(H69Q) 52.74.83 4.3

[0188] As a result, as shown in Table 7, the CJX1664_purC(H69Q) strain, which introduced the purC(H69Q) mutation into the XMP producing strain, showed a higher production yield than the control CJX1664 strain. It was confirmed that the concentration of 5'-xanthrylic acid increased by approximately 4.3%.

[0189]

[0190] Example 5: Evaluation of 5'-guanylic acid production ability of strains introducing purC mutations

[0191] The 5'-guanylic acid (GMP) production ability was evaluated using the XMP culture solution of the strain produced in Example 4-1 and the control parent strain obtained in Example 4-2, as follows.

[0192] Specifically, the strain was cultured using the fermentation activity evaluation method of Example 4-2, and the production amount of XMP (5'-xanthyl acid) was measured using HPLC after the culture was completed. In order to convert the produced XMP into GMP, the following conversion reaction additives and E. coli XMP aminase were added to the flask fermentation liquid, and the conversion reaction was performed at 40°C for 2.5 hours. As a result of the above experiment, the conversion rate results, which mean the amount of GMP produced relative to the amount of XMP consumed, are shown in Table 8 below.

[0193]

[0194] <Conversion reaction additive>

[0195] Phytic acid 1.8 g / L, magnesium sulfate 4.8 g / L, nymeen 3 ml / L, xylene 2%, adenine 100 mg / L, sodium hydrogen phosphate (Na2HPO4) 7.7 g / L, glutamine 2 g / L, glucose 46 g / L

[0196]

[0197] Confirmation of GMP production ability of strain introducing purC(H69Q) mutation Strain nameIntroduction type5'-Xanthrylic acid(g / L)5'-Guanine acid(g / L)Conversion rate (%)(GMP production amount / XMP consumption amount)CJX1664Control4.533.2571.9CJX1664_purC(H69Q)purC(H69Q)4.763.4572.5

[0198] As a result, as shown in Table 8 above, it was confirmed that GMP was produced through a conversion reaction from XMP produced by the strain, and it was confirmed that more GMP was produced in the CJX1664_purC (H69Q) strain, in which the H69Q mutation was introduced into the purC gene, compared to the parent strain.

[0199]

[0200] From the above description, those skilled in the art will understand that the present disclosure can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present disclosure should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.

Claims

1. A polypeptide having phosphoribosyl aminoimidazole-succinocarboxamide synthase activity, wherein the amino acid corresponding to the 69th residue from the N-terminus in the amino acid sequence of sequence number 5 is replaced with another amino acid.

2. A polypeptide in which the amino acid corresponding to the 69th residue in the amino acid sequence of sequence number 5 in paragraph 1 is substituted with glutamine, alanine, valine, leucine, threonine, asparagine, proline, or serine.

3. A polypeptide according to claim 1, wherein the amino acid corresponding to the 69th residue is histidine.

4. A polypeptide according to claim 1, wherein the polypeptide is composed of an amino acid sequence having any one of the sequence numbers selected from SEQ ID NO: 20 to SEQ ID NO:

27.

5. A polynucleotide encoding a polypeptide according to any one of claims 1 to 4.

6. In paragraph 5, the polynucleotide is a polynucleotide consisting of a nucleic acid sequence having any one sequence number selected from SEQ ID NO: 29 to SEQ ID NO:

36.

7. A recombinant vector comprising the polynucleotide of clause 5.

8. A microorganism comprising at least one selected from the group consisting of a polypeptide according to any one of claims 1 to 4, a polynucleotide encoding the polypeptide, and a vector comprising the polynucleotide.

9. In paragraph 8, the microorganism is a microorganism having increased purine nucleotide production ability.

10. A microorganism in claim 9, wherein the purine nucleotide is at least one selected from the group consisting of 5'-inosine monophosphate (IMP), 5'-xanthosine monophosphate (XMP), and 5'-guanosine monophosphate (GMP).

11. In paragraph 8, the microorganism is a microorganism of the genus Corynebacterium.

12. In claim 11, the microorganism is Corynebacterium stationis.

13. A method for producing a purine nucleotide, comprising the step of culturing a microorganism comprising at least one selected from the group consisting of a polypeptide according to any one of claims 1 to 4, a polynucleotide encoding the polypeptide, and a vector comprising the polynucleotide in a medium.

14. A method for producing purine nucleotides, further comprising a step of recovering purine nucleotides from the cultured microorganism, medium, or both of the above-described 13th paragraph.

15. A method for producing a purine nucleotide in claim 13, wherein the purine nucleotide is at least one selected from the group consisting of 5'-inosinic acid, 5'-xanthrylic acid, and 5'-guanine acid.

16. A composition for producing purine nucleotides, comprising a microorganism comprising at least one selected from the group consisting of a polypeptide according to any one of claims 1 to 4, a polynucleotide encoding the polypeptide, and a vector comprising the polynucleotide.