Antibiotic-resistant neisseria mutant
By identifying specific mutations in the ribosomal proteins of Neisseria gonorrhea gonorrhea, detection methods and kits were developed to solve the accuracy of drug resistance detection of Neisseria gonorrhea gonorrhea and to achieve sensitive treatment options for macrolide antibiotics.
Patent Information
- Application Number
- PCT/CN2025/070884
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-24
- Filing Date
- 2025-01-06
- Publication Date
- 2025-07-10
AI Technical Summary
Neisseria gonorrhea has been increasing its resistance to antibiotics, and it is difficult for the existing technology to effectively identify drug-resistant mutations to develop targeted treatment plans.
By identifying specific amino acid mutations and nucleotide insertions of ribosomal proteins L22, L4, L16, L17 and rplD genes, methods and kits for detecting the resistance of Neisseria to macrolide antibiotics are developed to determine whether Neisseria is resistant and to select appropriate antibiotic treatment based on the test results.
It improves the accuracy of detection of drug-resistant mutations of Neisseria gonorrhea, can effectively select sensitive antibiotic treatments, and slows down the progress of drug-resistant mutations.
Smart Images

Figure PCTCN2025070884-FTAPPB-I100001 
Figure PCTCN2025070884-FTAPPB-I100002 
Figure PCTCN2025070884-FTAPPB-I100003
Abstract
Description
Antibiotic-resistant Neisseria mutants Technical Field
[0001] The present invention relates to the field of Neisseria antibiotic resistance, in particular to Neisseria macrolide antibiotic resistance mutation. Background Art
[0002] Globally, the increasing resistance of pathogens to antibiotics is becoming a public health concern. Neisseria gonorrhoeae (also known as gonococci) is a prime example. Gonorrheal drug resistance has become a serious public health issue, and the World Health Organization has listed gonococci as one of twelve drug-resistant bacteria of particular concern.
[0003] To address this issue, it is necessary to select sensitive antibiotics for treatment based on the resistance phenotype of the pathogen, thereby slowing the progression of its resistance mutation. Therefore, it is necessary to further identify the resistance mutations of the pathogen so that more effective treatment can be carried out to slow the progression of its resistance mutation. Summary of the Invention
[0004] The present application provides novel Neisseria gonorrhoeae resistant to macrolide antibiotics, as well as a method and a kit for detecting whether Neisseria gonorrhoeae is resistant or may be resistant to macrolide antibiotics.
[0005] In one aspect, the present disclosure provides a ribosomal protein L22 mutant having an amino acid insertion between amino acids 83 and 84 corresponding to ribosomal protein L22 of Neisseria gonorrhoeae strain TUM19854 or between amino acids 83 and 84 corresponding to the amino acid sequence shown in SEQ ID NO:2.
[0006] In another aspect, the present disclosure provides an rplV gene mutant encoding the ribosomal protein L22 mutant of the present disclosure.
[0007] In another aspect, the present disclosure provides a Neisseria comprising a mutation or mutant of the present disclosure.
[0008] In another aspect, the present disclosure provides a method for detecting whether Neisseria is resistant or likely to be resistant to macrolide antibiotics, comprising: a) detecting whether the Neisseria comprises a mutation or mutant of the present disclosure; b) if the Neisseria comprises one or more of the mutations or mutants defined in step a), the Neisseria is determined to be resistant or likely to be resistant to macrolide antibiotics.
[0009] In another aspect, the present disclosure provides a method for treating or preventing a Neisseria infection in a patient, comprising: determining whether the Neisseria is resistant to a macrolide antibiotic by the method of the present disclosure, and if resistant, administering a non-macrolide antibiotic, such as a cephalosporin antibiotic, to the patient to treat the Neisseria infection.
[0010] In another aspect, the present disclosure provides a kit comprising a detection reagent for detecting whether Neisseria comprises one or more of the mutations or mutants of the present disclosure. DETAILED DESCRIPTION
[0011] definition
[0012] Unless otherwise indicated, all definitions of relevant terms herein are consistent with the understanding of a skilled person on the relevant technical background of this document.
[0013] The term "sequence identity" refers to the relatedness between two nucleotide sequences or between two amino acid sequences. Algorithms for aligning sequences and determining the degree of sequence identity between them are well known in the art. For the purposes of this disclosure, for example, the degree of sequence identity between two nucleotide sequences or two amino acid sequences is determined using the multiple sequence alignment tool Clustal Omega (https: / / www.ebi.ac.uk / Tools / msa / clustalo / ; Sievers et al., 2011) with standard parameters.
[0014] For the purpose of the present disclosure, for example, use the Needleman-Wunsch algorithm (Needleman and Wunsch (1970) J.Mol.Biol.48:443-453) implemented in the Needle program of EMBOSS software package (EMBOSS:The European Molecular Biology Open Software Suite, Rice et al. (2000) Trends in Genetics 16:276-277), preferably 3.0.0 or higher version, determine the degree of identity between two amino acid sequences.The optional parameters used are gap opening penalty 10, gap extension penalty 0.5 and EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix.The Needle output (using-no brief30 option to obtain) marked with " longest identity " is used as identity percentage, and is calculated as follows:
[0015] (Identical residues x 100) / (alignment length - total number of gaps in the alignment).
[0016] For the purposes of this disclosure, the blastn method for nucleotide sequence alignment provided by the National Center for Biotechnology Information (NCBI) at https: / / blast.ncbi.nlm.nih.gov using standard parameters can be used.
[0017] In the present disclosure, conventional single-letter and three-letter codes for amino acid residues are used. For ease of reference, the amino acid changes in the mutants of the present disclosure are described using the following nomenclature: amino acid residue in the parent protein-position-substituted amino acid residue. According to this nomenclature, for example, the replacement of a G residue at position 70 with an A residue is represented as G70A.
[0018] In the context of the present disclosure, a mutation in a gene ("gene mutation" or "gene mutant") is understood to be a change in the nucleotide sequence of the genome of an organism that results in a change in the phenotype of the organism, wherein the change can be a deletion of a nucleotide, a substitution of a nucleotide by another nucleotide, an insertion of a nucleotide, or a frameshift. In the context of the present disclosure, "deletion" is understood to be a gene mutation that results in the removal of one or more nucleotides from the nucleotide sequence of the genome of an organism; "insertion" is understood to be the addition of one or more nucleotides to a nucleotide sequence; and "substitution" (or "point mutation") is understood to be a gene mutation in which a nucleotide of a nucleotide sequence is replaced by another nucleotide.
[0019] In the context of the present disclosure, a substitution or mutation of one amino acid or nucleotide for another amino acid or nucleotide at a position corresponding to a position in a sequence means that, in addition to the specific substitution or mutation at the specific position (or at a position corresponding to the specific position, for example, in the case of a deletion or insertion in the mutant sequence), there may be other mutations (e.g., deletions, insertions, substitutions, etc.) in the mutated amino acid or nucleotide sequence. Thus, in the context of the present disclosure, for example, the phrase "an amino acid insertion between amino acids 83 and 84 corresponding to ribosomal protein L22 of Neisseria gonorrhoeae strain TUM19854 or between amino acids 83 and 84 corresponding to the amino acid sequence set forth in SEQ ID NO: 2" may mean:
[0020] (i) having an amino acid insertion in the amino acid sequence of the ribosomal protein L22 mutant immediately between amino acids 83 and 84 corresponding to ribosomal protein L22 of Neisseria gonorrhoeae strain TUM19854, or between amino acids 83 and 84 corresponding to the amino acid sequence of SEQ ID NO: 2. Of course, other substitutions or mutations in SEQ ID NO: 2 are not excluded;
[0021] (ii) In the case where there are other mutations such as insertions or deletions in the sequence, the amino acid insertion between amino acids 83 and 84 may no longer be precisely located between amino acids 83 and 84 corresponding to ribosomal protein L22 of Neisseria gonorrhoeae strain TUM19854 or between amino acids 83 and 84 corresponding to the amino acid sequence set forth in SEQ ID NO: 2 due to other mutations such as insertions or deletions. In these cases, the amino acid insertion referred to should be located between amino acids 83 and 84 corresponding to ribosomal protein L22 of Neisseria gonorrhoeae strain TUM19854 or between amino acids 83 and 84 corresponding to the amino acid sequence set forth in SEQ ID NO: 2, taking into account the other mutations in the sequence. A skilled person is able to identify a "position corresponding to a position in a certain sequence", for example, by aligning the sequences and finding a position corresponding to a position in the original sequence.
[0022] Corresponding meanings will apply to other similar phrases in this document, such as the phrase "having a sequence insertion between nucleotides 249 and 250 corresponding to the rplV gene coding sequence of Neisseria gonorrhoeae strain TUM19854 or between nucleotides 249 and 250 corresponding to the nucleotide sequence shown in SEQ ID NO: 1".
[0023] In the context of the present disclosure, the position of a sequence insertion referred to in phrases such as "having a sequence insertion between nucleotides 249 and 250 of the rplV gene coding sequence corresponding to Neisseria gonorrhoeae strain TUM19854 or between nucleotides 249 and 250 of the nucleotide sequence set forth in SEQ ID NO: 1" and other similar phrases is determined based on the position in the gene coding sequence, and those skilled in the art can readily determine the corresponding nucleotide position in the genome of an organism. In the examples of the present disclosure, the target mutations detected are corresponding nucleotide positions in the Neisseria gonorrhoeae genome.
[0024] In this specification and claims, the conventional single-letter codes for nucleotides are used following a similar principle as described above for amino acid nomenclature.
[0025] As used herein, the term "approximately" means that the value is ±1% of the indicated value, or the term "approximately" means that the value is ±2% of the indicated value, or the term "approximately" means that the value is ±5% of the indicated value, the term "approximately" means that the value is ±10% of the indicated value, or the term "approximately" means that the value is ±20% of the indicated value, or the term "approximately" means that the value is ±30% of the indicated value; preferably, the term "approximately" refers exactly to the indicated value (±0%).
[0026] Throughout the specification and claims, the word "comprises / comprising" and variations of the word (e.g., "includes / comprising," "having," "containing") are generally not limiting and therefore do not exclude other features, which may be, for example, other technical features, mutations, components or steps. However, whenever the word "comprises / comprising" is used herein, this also includes specific embodiments in which the word is understood to be limiting; in this specific embodiment, the word "comprises / comprising" has the meaning of the term "consisting of" or "consisting essentially of."
[0027] In the context of describing the present invention (especially in the context of the following claims), the use of the terms "a / an" and "the" and similar referents are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. Recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value within the range, unless otherwise indicated herein or clearly contradicted by context, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or clearly contradicted by context.
[0028] The use of any and all examples or exemplary language (e.g., "optionally," "such as," or "for example") provided herein is intended merely to better illustrate the invention and does not limit the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
[0029] The present inventors have surprisingly identified novel mutations that confer resistance to macrolide antibiotics (e.g., azithromycin) on Neisseria gonorrhoeae (e.g., Neisseria gonorrhoeae). More specifically, the inventors have surprisingly discovered that a sequence insertion mutation between nucleotides 249 and 250 of the rplV gene coding sequence corresponding to Neisseria gonorrhoeae strain TUM19854, or between nucleotides 249 and 250 of the nucleotide sequence set forth in SEQ ID NO: 1, can confer resistance to macrolide antibiotics (e.g., azithromycin) on Neisseria gonorrhoeae (e.g., Neisseria gonorrhoeae) harboring the insertion mutation.
[0030] Therefore, the first aspect of the present disclosure provides a ribosomal protein L22 mutant having an amino acid insertion between amino acids 83 and 84 corresponding to the ribosomal protein L22 of Neisseria gonorrhoeae strain TUM19854 or between amino acids 83 and 84 corresponding to the amino acid sequence shown in SEQ ID NO: 2. In some embodiments, the amino acid insertion is an amino acid fragment of 4-10 (e.g., 5, 6, 7, 8, or 9) amino acids in length. In some embodiments, the amino acid insertion is an amino acid repeat sequence, such as an amino acid repeat sequence of the ribosomal protein L22 from Neisseria gonorrhoeae strain TUM19854, such as an amino acid insertion or an amino acid repeat sequence comprising or consisting of GPSLK or FQAR, such as an amino acid insertion or an amino acid repeat sequence comprising or consisting of QGPSLK or TFQARGLK. In some embodiments, the amino acid insertion is located between K83 and R84 of ribosomal protein L22 corresponding to strain TUM19854 or between K83 and R84 corresponding to the amino acid sequence set forth in SEQ ID NO: 2. The amino acid insertion can confer resistance to a macrolide antibiotic on Neisseria sp., for example, a macrolide antibiotic selected from the group consisting of: (1) erythromycin and its ester derivatives, including erythromycin, erythromycin ethylsuccinate, erythromycin stearate, erythromycin ethyl carbonate, erythromycin acetate stearate, erythromycin lactobionate, and erythromycin estolate; (2) azithromycin, roxithromycin, clarithromycin, dirithromycin, and fluoxetine; (3) telithromycin; and (4) any combination of the foregoing, such as azithromycin. In some embodiments, the Neisseria species can be a species such as a pathogenic Neisseria, e.g., N. meningitidis or N. gonorrhoeae, N. sicca, N. subflava, N. flavescens, or N. mucosa.
[0031] The second aspect of the present disclosure provides an rplV gene mutant encoding the ribosomal protein L22 mutant of the first aspect. In some embodiments, the coding sequence of the gene mutant has a sequence insertion between nucleotides 249 and 250 corresponding to the rplV gene coding sequence of Neisseria gonorrhoeae strain TUM19854 or between nucleotides 249 and 250 corresponding to the nucleotide sequence shown in SEQ ID NO: 1, for example, a sequence insertion of 12-30 (e.g., 15, 18, 21, 24 or 27) nucleotides in length, for example, a sequence insertion including or consisting of a sequence shown in SEQ ID NO: 7 or 8.
[0032] The present inventors also surprisingly found that, unlike the existing knowledge in the prior art, a ribosomal protein L4 mutant having an amino acid substitution (e.g., G70A) at position 70 of ribosomal protein L4 corresponding to Neisseria gonorrhoeae strain TUM19854 or at position 70 of the amino acid sequence shown in SEQ ID NO: 22 not only increases the resistance level of Neisseria (e.g., Neisseria gonorrhoeae) to macrolide antibiotics (e.g., azithromycin), but can also independently confer resistance to macrolide antibiotics (e.g., azithromycin) on Neisseria (e.g., Neisseria gonorrhoeae).
[0033] Therefore, a third aspect of the present disclosure provides a ribosomal protein L4 mutant having an amino acid substitution at position 70 corresponding to ribosomal protein L4 of Neisseria gonorrhoeae strain TUM19854 or at position 70 corresponding to the amino acid sequence set forth in SEQ ID NO: 22. In some embodiments, the ribosomal protein L4 mutant has an amino acid substitution at position 70 corresponding to ribosomal protein L4 of Neisseria gonorrhoeae strain TUM19854 or at position 70 corresponding to the amino acid sequence set forth in SEQ ID NO: 22, with a basic amino acid selected from the group consisting of A, V, L, I, and F, for example, with A.
[0034] The fourth aspect of the present disclosure thus provides an rplD gene mutant encoding the ribosomal protein L4 mutant of the third aspect. In some embodiments, the coding sequence of the rplD gene mutant has a G209C mutation at position 209 corresponding to the rplD gene coding sequence of Neisseria gonorrhoeae strain TUM19854 or at position 209 corresponding to the nucleotide sequence set forth in SEQ ID NO:21.
[0035] In addition, the present inventors have surprisingly discovered other mutations that can increase the resistance level of Neisseria (such as Neisseria gonorrhoeae) to macrolide antibiotics (such as azithromycin) or can confer resistance to Neisseria (such as Neisseria gonorrhoeae) to macrolide antibiotics (such as azithromycin).
[0036] Thus, the fifth aspect of the present disclosure provides a ribosomal protein L16 mutant having an amino acid substitution at position 95 corresponding to ribosomal protein L16 of Neisseria gonorrhoeae strain TUM19854 or at position 95 corresponding to the amino acid sequence of SEQ ID NO: 10. In some embodiments, the amino acid at position 95 corresponding to ribosomal protein L16 of Neisseria gonorrhoeae strain TUM19854 or at position 95 corresponding to the amino acid sequence of SEQ ID NO: 10 in the ribosomal protein L16 mutant is substituted with a hydrophobic amino acid selected from the group consisting of V, L, and I, for example, substituted with V. The sixth aspect of the present disclosure further provides an rplP gene mutant encoding the ribosomal protein L16 mutant of the fifth aspect.
[0037] A seventh aspect of the present disclosure provides a ribosomal protein L17 mutant, which has an amino acid substitution at position 45 and / or 89 corresponding to the ribosomal protein L17 of Neisseria gonorrhoeae strain TUM19854 or at position 45 and / or 89 corresponding to the amino acid sequence shown in SEQ ID NO: 14. In some embodiments, the amino acid at position 45 of the ribosomal protein L17 of Neisseria gonorrhoeae strain TUM19854 or at position 45 corresponding to the amino acid sequence shown in SEQ ID NO: 14 in the ribosomal protein L17 mutant is substituted by a basic amino acid selected from the group consisting of H and K, for example, substituted by H, and / or the amino acid at position 89 of the ribosomal protein L17 of the ribosomal protein L17 of Neisseria gonorrhoeae strain TUM19854 or at position 89 corresponding to the amino acid sequence shown in SEQ ID NO: 14 in the ribosomal protein L17 mutant is substituted by a neutral amino acid selected from the group consisting of T, G, C, S, Y, N and Q, for example, substituted by T. The eighth aspect of the present disclosure further provides an rplQ gene mutant, which encodes the ribosomal protein L17 mutant of the fifth aspect.
[0038] Based on one or more of the above findings herein, the ninth aspect of the present disclosure provides a Neisseria, such as Neisseria gonorrhoeae, comprising a ribosomal protein mutant of one or more or all of the first to eighth aspects of the present disclosure, a gene mutant encoding the ribosomal protein mutant, and / or a mutation described in one or more or all of the first to eighth aspects, and / or any combination thereof. In some embodiments, the Neisseria is selected from pathogenic Neisseria, such as Neisseria meningitidis or Neisseria gonorrhoeae, Neisseria dry, Neisseria flavescens, Neisseria flavescentis, or Neisseria mucosa, such as Neisseria gonorrhoeae.
[0039] The inventors have also found that the mutations described in the present disclosure in combination with other drug-resistant mutations known in the art can significantly improve the accuracy of drug-resistant mutation detection in Neisseria, such as Neisseria gonorrhoeae. Therefore, in some embodiments, Neisseria, such as Neisseria gonorrhoeae, of the present disclosure may also include one or more of the following mutations: 23SrRNA C2611T, 23S rRNA A2059G, rplD G70S, rplD G68D, or rplD G70 repeats (i.e., "G70G71"). These mutations can increase the resistance level of Neisseria (e.g., Neisseria gonorrhoeae) to macrolide antibiotics (e.g., azithromycin), or can confer resistance to macrolide antibiotics (e.g., azithromycin) on Neisseria (e.g., Neisseria gonorrhoeae) as known in the art.
[0040] As used herein, the term "rplD G70 repeat" refers to a G repeat mutation, i.e., a "G" to "GG" mutation, in the ribosomal protein L4 encoded by the rplD gene at or corresponding to amino acid position 70. Similarly, as used herein, the terms "rplD G70S" and "rplD G68D" refer to a G70S mutation and a G68D mutation, respectively, in the ribosomal protein L4 encoded by the rplD gene at or corresponding to amino acid position 70. As used herein, the terms "23S rRNA C2611T" and "23S rRNA A2059G" refer to a C2611T mutation at or corresponding to nucleotide position 2611 of the 23S rRNA and an A2059G mutation at or corresponding to nucleotide position 2059 of the 23S rRNA, respectively.
[0041] The tenth aspect of the present disclosure provides a method for detecting whether Neisseria, such as Neisseria gonorrhoeae, is resistant or may be resistant to macrolide antibiotics, comprising: a) detecting whether the Neisseria contains the ribosomal protein mutants of one or more or all aspects of the first to eighth aspects of the present disclosure, the gene mutants encoding the ribosomal protein mutants, and / or the mutations described in one or more or all aspects of the first to eighth aspects, and / or any combination thereof; and b) if the Neisseria contains one or more of the mutations or mutants defined in step a), the Neisseria is judged to be resistant or may be resistant to macrolide antibiotics.
[0042] The present disclosure is not limited to a specific method for detecting mutations, as long as the method can be used to detect mutations disclosed herein. In some embodiments, the detection can be performed by techniques based on Sanger sequencing, high-throughput sequencing technology (NGS) or PCR (e.g., RT-qPCR or ddPCR). The drug-resistant mutation detection disclosed herein can also be performed by detecting protein mutants, such as immune-based methods.
[0043] The eleventh aspect of the present disclosure provides a method for treating or preventing Neisseria (e.g., Neisseria gonorrhoeae) infection in a patient, comprising: determining whether the Neisseria is resistant to macrolide antibiotics by the method described in the tenth aspect of the present disclosure, and if resistant, administering a non-macrolide antibiotic (e.g., azithromycin) to the patient to treat Neisseria infection, such as a cephalosporin antibiotic. In some embodiments, if the Neisseria is not resistant to macrolide antibiotics, administering a macrolide antibiotic (e.g., azithromycin) to the patient to treat Neisseria infection.
[0044] In addition, the twelfth aspect of the present disclosure also provides a kit that can be used to implement the method described in the tenth and / or eleventh aspects of the present disclosure. In some embodiments, the kit comprises a detection reagent that can be used to detect whether Neisseria (e.g., Neisseria gonorrhoeae) contains a ribosomal protein mutant of one or more or all aspects of the first to eighth aspects of the present disclosure, a gene mutant encoding the ribosomal protein mutant, and / or a mutation described in one or more or all aspects of the first to eighth aspects, and / or any combination thereof. In some embodiments, the kit may also comprise a reagent for detecting whether the Neisseria contains one or more of the following mutations: 23S rRNA C2611T, 23S rRNA A2059G, rplD G70S, rplD G68D, or rplD G70 repeats.
[0045] In some embodiments, the kit comprises:
[0046] - a specific primer pair and a specific probe for detecting the insertion of a sequence defined in any one of Schemes 10 to 15 below, for example, the specific primer pair has a length of 15 to 30 nucleotides and at least 10 consecutive nucleotides of the sequences of SEQ ID NOs: 47 and 48, and the specific probe has a length of 20 to 35 nucleotides and comprises at least 15 consecutive nucleotides of the sequence of SEQ ID NO: 49; or the specific primer pair has a length of 15 to 30 nucleotides and at least 10 consecutive nucleotides of the sequences of SEQ ID NOs: 56 and 57, and the specific probe has a length of 20 to 35 nucleotides and comprises at least 15 consecutive nucleotides of the sequence of SEQ ID NO: 58;
[0047] - a specific primer pair and a specific probe for detecting a nucleotide mutation as defined in any one of Schemes 38 to 42 below, for example, the specific primer pair has a length of 15 to 30 nucleotides and comprises at least 10 consecutive nucleotides of the sequences of SEQ ID NOs: 50 and 51, and the specific probe has a length of 20 to 35 nucleotides and comprises at least 15 consecutive nucleotides of the sequence of SEQ ID NO: 52;
[0048] - a specific primer pair and a specific probe for detecting 23S rRNA C2611T, for example, the specific primer pair has a length of 15 to 30 nucleotides and comprises at least 10 consecutive nucleotides of the sequences of SEQ ID NOs: 41 and 42, and the specific probe has a length of 20 to 35 nucleotides and comprises at least 15 consecutive nucleotides of the sequence of SEQ ID NO: 43;
[0049] - a specific primer pair and a specific probe for detecting 23S rRNA A2059G, for example, the specific primer pair has a length of 15 to 30 nucleotides and comprises at least 10 consecutive nucleotides of the sequences of SEQ ID NOs: 44 and 45, and the specific probe has a length of 20 to 35 nucleotides and comprises at least 15 consecutive nucleotides of the sequence of SEQ ID NO: 46; and / or
[0050] - A specific primer pair and a specific probe for detecting the nucleotide mutation sequence corresponding to the mutant rplD G70 repeat, for example, the specific primer pair has a length of 15 to 30 nucleotides and contains at least 10 consecutive nucleotides of the sequences of SEQ ID NOs: 53 and 54, and the specific probe has a length of 20 to 35 nucleotides and contains at least 15 consecutive nucleotides of the sequence of SEQ ID NO: 55.
[0051] In one embodiment, the detection of the present disclosure can be quantitative PCR, such as fluorescence-based quantitative real-time PCR.
[0052] In one embodiment, detection of the probe is based on amplification-mediated displacement of the probe.
[0053] In one embodiment, the probe is a dual-labeled probe comprising a fluorescent reporter group and a fluorescent quencher group.
[0054] In one embodiment, the kit may further comprise a DNA polymerase.
[0055] In one embodiment, the kit further comprises at least one pair of reference gene-specific primers and at least one reference gene-specific probe. In one embodiment, the reference gene is selected from a gonococcal reference gene, such as a gonococcal conserved 3-copy gene sequence and / or one or more human reference genes selected from the following: CALM2, B2M, RPL37A, GUSB, HPRT1, and GAPDH, such as GUSB.
[0056] In some embodiments, the probe as defined above is a dual-labeled probe comprising a fluorescent reporter group and a fluorescent quencher group.
[0057] As used herein, the term "test kit" refers to a product item comprising one or more containers and, optionally, a data carrier. The one or more containers may be filled with one or more of the above-mentioned detection reagents. The test kit may include additional containers containing, for example, diluents, buffers, and other reagents such as dNTPs. The data carrier may be a non-electronic data carrier, such as a graphic data carrier such as an information booklet, an information sheet, a bar code, or an accession code, or an electronic data carrier such as a floppy disk, a compact disc (CD), a digital versatile disc (DVD), a microchip, or another semiconductor-based electronic data carrier. The accession code may allow access to a database, such as an internet database, a central or decentralized database. The data carrier may include instructions for using the test kit in the method of the present disclosure. The data carrier may include a detection threshold value or a reference level. In the case where the data carrier includes an accession code that allows access to a database, the threshold value or reference level is stored in the database. In addition, the data carrier may include information and instructions on how to implement the method of the present disclosure.
[0058] The present disclosure provides various embodiments, including but not limited to the following:
[0059] 1. A ribosomal protein L22 mutant having an amino acid insertion between amino acids 83 and 84 corresponding to ribosomal protein L22 of Neisseria gonorrhoeae strain TUM19854 or between amino acids 83 and 84 corresponding to the amino acid sequence shown in SEQ ID NO: 2.
[0060] 2. The ribosomal protein L22 mutant according to claim 1, wherein the amino acid insertion is an amino acid fragment having a length of 4-10 (eg, 5, 6, 7, 8 or 9) amino acids.
[0061] 3. The ribosomal protein L22 mutant according to any one of schemes 1-2, wherein the amino acid insertion is an amino acid repeat sequence.
[0062] 4. The ribosomal protein L22 mutant according to claim 3, wherein the amino acid insertion or the amino acid repeat sequence comprises GPSLK or FQAR or consists of GPSLK or FQAR.
[0063] 5. The ribosomal protein L22 mutant according to claim 4, wherein the amino acid insertion or the amino acid repeat sequence comprises QGPSLK or TFQARGLK or consists of QGPSLK or TFQARGLK.
[0064] 6. The ribosomal protein L22 mutant according to any one of schemes 1 to 5, wherein the amino acid insertion is located between K83 and R84 of the ribosomal protein L22 corresponding to strain TUM19854 or between K83 and R84 corresponding to the amino acid sequence shown in SEQ ID NO: 2.
[0065] 7. The ribosomal protein L22 mutant according to any one of schemes 1 to 6, wherein the ribosomal protein L22 mutant is from Neisseria sp., such as pathogenic Neisseria sp., for example, N. meningitidis or N. gonorrhoeae, N. sicca, N. subflava, N. flavescens, or N. mucosa.
[0066] 8. The ribosomal protein L22 mutant according to claim 7, wherein the amino acid insertion confers resistance to a macrolide antibiotic on the Neisseria species, optionally selected from the group consisting of: (1) erythromycin and its ester derivatives, including erythromycin, erythromycin ethylsuccinate, erythromycin stearate, erythromycin ethyl carbonate, erythromycin acetate stearate, erythromycin lactobionate, and erythromycin estolate; (2) azithromycin, roxithromycin, clarithromycin, dirithromycin, and fluoxetine; (3) telithromycin; and (4) any combination of the foregoing.
[0067] 9. The ribosomal protein L22 mutant according to any one of schemes 1 to 8, wherein the L22 mutant has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or higher sequence identity with the amino acid sequence shown in SEQ ID NO: 4 or 6, has the amino acid sequence shown in SEQ ID NO: 4 or 6, or consists of the amino acid sequence shown in SEQ ID NO: 4 or 6.
[0068] 10. An rplV gene mutant encoding the ribosomal protein L22 mutant according to any one of Schemes 1-9.
[0069] 11. The rplV gene mutant according to scheme 10, wherein its coding sequence has a sequence insertion between nucleotides 249 and 250 corresponding to the rplV gene coding sequence of Neisseria gonorrhoeae strain TUM19854 or between nucleotides 249 and 250 corresponding to the nucleotide sequence shown in SEQ ID NO: 1, for example, a sequence insertion of 12-30 (e.g., 15, 18, 21, 24 or 27) nucleotides in length, for example, a sequence insertion including or consisting of a sequence shown in SEQ ID NO: 7 or 8.
[0070] 12. The rplV gene mutant according to scheme 10 or 11, wherein the sequence is inserted between A249 and C250 of the rplV gene coding sequence corresponding to Neisseria gonorrhoeae strain TUM19854 or between A249 and C250 corresponding to the nucleotide sequence shown in SEQ ID NO:1.
[0071] 13. The rplV gene mutant according to any one of schemes 10-12, wherein the rplV gene mutant is from the genus Neisseria, such as pathogenic Neisseria such as Neisseria meningitidis or Neisseria gonorrhoeae, Neisseria sicca, Neisseria flavescens, Neisseria flavescentis, or Neisseria mucosum.
[0072] 14. The rplV gene mutant according to claim 13, wherein the sequence insertion confers resistance to macrolide antibiotics on the Neisseria species, optionally, the macrolide antibiotics are selected from the group consisting of: (1) erythromycin and its ester derivatives, including erythromycin, erythromycin ethylsuccinate, erythromycin stearate, erythromycin ethyl carbonate, erythromycin acetate stearate, erythromycin lactobionate, and erythromycin estolate; (2) azithromycin, roxithromycin, clarithromycin, dirithromycin, and fluoxetine; (3) telithromycin; and (4) any combination of the foregoing.
[0073] 15. The rplV gene mutant according to any one of schemes 10-14, wherein the coding sequence has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or higher sequence identity with the nucleotide sequence shown in SEQ ID NO: 3 or 5, has the nucleotide sequence shown in SEQ ID NO: 3 or 5, or is composed of the nucleotide sequence shown in SEQ ID NO: 3 or 5.
[0074] 16. A ribosomal protein L16 mutant having an amino acid substitution at position 95 corresponding to the ribosomal protein L16 of Neisseria gonorrhoeae strain TUM19854 or at position 95 corresponding to the amino acid sequence shown in SEQ ID NO: 10.
[0075] 17. The ribosomal protein L16 mutant according to Scheme 16, wherein the amino acid at position 95 corresponding to the ribosomal protein L16 of Neisseria gonorrhoeae strain TUM19854 or the amino acid sequence shown in SEQ ID NO: 10 is A before mutation.
[0076] 18. The ribosomal protein L16 mutant according to claim 16 or 17, wherein the amino acid at position 95 corresponding to the ribosomal protein L16 of Neisseria gonorrhoeae strain TUM19854 or the amino acid at position 95 corresponding to the amino acid sequence shown in SEQ ID NO: 10 is substituted by a hydrophobic amino acid selected from the group consisting of: V, L, and I, for example, by V.
[0077] 19. The ribosomal protein L16 mutant according to any one of schemes 16 to 18, wherein the amino acid substitution is selected from the group consisting of: A95V, A95L and A95I, for example, A95V.
[0078] 20. The ribosomal protein L16 mutant according to any one of schemes 16 to 19, wherein the ribosomal protein L16 mutant is from the genus Neisseria, such as pathogenic Neisseria such as Neisseria meningitidis or Neisseria gonorrhoeae, Neisseria sicca, Neisseria flavescens, Neisseria flavescentis, or Neisseria mucosae.
[0079] 21. The ribosomal protein L16 mutant according to claim 20, wherein the amino acid substitution confers resistance to a macrolide antibiotic on the Neisseria species, optionally selected from the group consisting of: (1) erythromycin and its ester derivatives, including erythromycin, erythromycin ethylsuccinate, erythromycin stearate, erythromycin ethyl carbonate, erythromycin acetate stearate, erythromycin lactobionate, and erythromycin estolate; (2) azithromycin, roxithromycin, clarithromycin, dirithromycin, and fluoxetine; (3) telithromycin; and (4) any combination of the foregoing.
[0080] 22. The ribosomal protein L16 mutant according to any one of schemes 16 to 21, wherein the L16 mutant has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or higher sequence identity with the amino acid sequence shown in SEQ ID NO: 12, has the amino acid sequence shown in SEQ ID NO: 12 or consists of the amino acid sequence shown in SEQ ID NO: 12.
[0081] 23. An rplP gene mutant encoding the ribosomal protein L16 mutant according to any one of Schemes 16 to 22.
[0082] 24. The rplP gene mutant according to claim 23, wherein the coding sequence thereof has a C284T mutation at position 284 of the rplP gene coding sequence corresponding to the Neisseria gonorrhoeae strain TUM19854 or at position 284 of the nucleotide sequence shown in SEQ ID NO: 9.
[0083] 25. The rplP gene mutant according to any one of schemes 23-24, wherein the rplP gene mutant is from the genus Neisseria, such as pathogenic Neisseria such as Neisseria meningitidis or Neisseria gonorrhoeae, Neisseria sicca, Neisseria flavescens, Neisseria flavescentis, or Neisseria mucosus.
[0084] 26. The rplP gene mutant according to claim 25, wherein the C284T mutation confers resistance to a macrolide antibiotic to the Neisseria species, optionally selected from the group consisting of: (1) erythromycin and its ester derivatives, including erythromycin, erythromycin ethylsuccinate, erythromycin stearate, erythromycin ethyl carbonate, erythromycin acetate stearate, erythromycin lactobionate, and erythromycin estolate; (2) azithromycin, roxithromycin, clarithromycin, dirithromycin, and fluoxetine; (3) telithromycin; and (4) any combination of the foregoing.
[0085] 27. The rplP gene mutant according to any one of schemes 23 to 26, wherein the coding sequence thereof has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or higher sequence identity with the nucleotide sequence shown in SEQ ID NO: 11, and has the nucleotide sequence shown in SEQ ID NO: 11 or consists of the nucleotide sequence shown in SEQ ID NO: 11.
[0086] 28. A ribosomal protein L17 mutant having an amino acid substitution at position 45 and / or 89 corresponding to the ribosomal protein L17 of Neisseria gonorrhoeae strain TUM19854 or at position 45 and / or 89 corresponding to the amino acid sequence shown in SEQ ID NO: 14.
[0087] 29. The ribosomal protein L17 mutant according to Scheme 28, wherein the amino acid at position 45 corresponding to the ribosomal protein L17 of Neisseria gonorrhoeae strain TUM19854 or the amino acid sequence shown in SEQ ID NO: 14 is R before mutation.
[0088] 30. The ribosomal protein L17 mutant according to claim 28 or 29, wherein the amino acid at position 45 corresponding to the ribosomal protein L17 of Neisseria gonorrhoeae strain TUM19854 or the amino acid sequence shown in SEQ ID NO: 14 is substituted by a basic amino acid selected from the group consisting of H and K, for example, by H.
[0089] 31. The ribosomal protein L17 mutant according to any one of schemes 28 to 30, wherein the amino acid substitution is selected from the group consisting of: R45H and R45K, for example, R45H.
[0090] 32. The ribosomal protein L17 mutant according to Scheme 28, wherein the amino acid at position 89 corresponding to the ribosomal protein L17 of Neisseria gonorrhoeae strain TUM19854 or the amino acid at position 89 corresponding to the amino acid sequence shown in SEQ ID NO: 14 is A before mutation.
[0091] 33. The ribosomal protein L17 mutant according to claim 28 or 32, wherein the amino acid at position 89 corresponding to the ribosomal protein L17 of Neisseria gonorrhoeae strain TUM19854 or the amino acid at position 89 corresponding to the amino acid sequence shown in SEQ ID NO: 14 is substituted by a neutral amino acid selected from the group consisting of T, G, C, S, Y, N and Q, for example, by T.
[0092] 34. The ribosomal protein L17 mutant according to any one of schemes 28 and 32-33, wherein the amino acid substitution is selected from the group consisting of: A89T, A89G, A89C, A89S, A89Y, A89N and A89Q, for example, A89T.
[0093] 35. The ribosomal protein L17 mutant according to any one of schemes 28 to 34, wherein the ribosomal protein L17 mutant is from the genus Neisseria, such as pathogenic Neisseria such as Neisseria meningitidis or Neisseria gonorrhoeae, Neisseria sicca, Neisseria flavescens, Neisseria flavescentis, or Neisseria mucosae.
[0094] 36. The ribosomal protein L17 mutant according to claim 35, wherein the amino acid substitution confers resistance to a macrolide antibiotic on the Neisseria species, optionally selected from the group consisting of: (1) erythromycin and its ester derivatives, including erythromycin, erythromycin ethylsuccinate, erythromycin stearate, erythromycin ethyl carbonate, erythromycin acetate stearate, erythromycin lactobionate, and erythromycin estolate; (2) azithromycin, roxithromycin, clarithromycin, dirithromycin, and fluoxetine; (3) telithromycin; and (4) any combination of the foregoing.
[0095] 37. The ribosomal protein L17 mutant according to any one of schemes 28 to 36, wherein the L17 mutant has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or higher sequence identity with the amino acid sequence shown in SEQ ID NO: 16, 18 or 20, has the amino acid sequence shown in SEQ ID NO: 16, 18 or 20, or consists of the amino acid sequence shown in SEQ ID NO: 16, 18 or 20.
[0096] 38. An rplQ gene mutant encoding the ribosomal protein L17 mutant according to any one of Schemes 28-37.
[0097] 39. The rplQ gene mutant according to claim 38, wherein its coding sequence has a G134A mutation at position 134 corresponding to the rplQ gene coding sequence of Neisseria gonorrhoeae strain TUM19854 or at position 134 corresponding to the nucleotide sequence shown in SEQ ID NO: 13, and / or has a G265A mutation at position 265 corresponding to the rplQ gene coding sequence of Neisseria gonorrhoeae strain TUM19854 or at position 265 corresponding to the nucleotide sequence shown in SEQ ID NO: 13.
[0098] 40. The rplQ gene mutant according to any one of schemes 38-39, wherein the rplQ gene mutant is from the genus Neisseria, such as pathogenic Neisseria such as Neisseria meningitidis or Neisseria gonorrhoeae, Neisseria sicca, Neisseria flavescens, Neisseria flavescentis, or Neisseria mucosum.
[0099] 41. The rplQ gene mutant according to claim 40, wherein the G134A mutation and / or the G265A mutation confers resistance to macrolide antibiotics on the Neisseria species, optionally selected from the group consisting of: (1) erythromycin and its ester derivatives, including erythromycin, erythromycin ethylsuccinate, erythromycin stearate, erythromycin ethyl carbonate, erythromycin acetate stearate, erythromycin lactobionate, and erythromycin estolate; (2) azithromycin, roxithromycin, clarithromycin, dirithromycin, and fluoxetine; (3) telithromycin; and (4) any combination of the foregoing.
[0100] 42. The rplQ gene mutant according to any one of schemes 38 to 41, wherein the coding sequence thereof has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or higher sequence identity with the nucleotide sequence shown in SEQ ID NO: 15, 17 or 19, and has the nucleotide sequence shown in SEQ ID NO: 15, 17 or 19 or consists of the nucleotide sequence shown in SEQ ID NO: 15, 17 or 19.
[0101] 43. A ribosomal protein L4 mutant having an amino acid substitution at position 70 corresponding to ribosomal protein L4 of Neisseria gonorrhoeae strain TUM19854 or at position 70 corresponding to the amino acid sequence shown in SEQ ID NO: 22.
[0102] 44. The ribosomal protein L4 mutant according to scheme 43, wherein the amino acid at position 70 corresponding to the ribosomal protein L4 of Neisseria gonorrhoeae strain TUM19854 or the amino acid sequence corresponding to position 70 of SEQ ID NO: 22 is substituted by a basic amino acid selected from the group consisting of A, V, L, I, and F, for example, by A.
[0103] 45. The ribosomal protein L4 mutant according to any one of schemes 43-44, wherein the amino acid substitution is selected from the group consisting of: G70A, G70V, G70L, G70I, and G70F, such as G70A.
[0104] 46. A ribosomal protein L4 mutant according to any one of schemes 43-44, wherein the ribosomal protein L4 mutant is from the genus Neisseria, such as pathogenic Neisseria such as Neisseria meningitidis or Neisseria gonorrhoeae, Neisseria sicca, Neisseria flavescens, Neisseria flavescentis, or Neisseria mucosus.
[0105] 47. The ribosomal protein L4 mutant according to claim 46, wherein the amino acid substitution confers resistance to a macrolide antibiotic on the Neisseria species, optionally selected from the group consisting of: (1) erythromycin and its ester derivatives, including erythromycin, erythromycin ethylsuccinate, erythromycin stearate, erythromycin ethyl carbonate, erythromycin acetate stearate, erythromycin lactobionate, and erythromycin estolate; (2) azithromycin, roxithromycin, clarithromycin, dirithromycin, and fluoxetine; (3) telithromycin; and (4) any combination of the foregoing.
[0106] 48. The ribosomal protein L4 mutant according to any one of schemes 43 to 47, wherein the L4 mutant has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or higher sequence identity with the amino acid sequence shown in SEQ ID NO: 24, has the amino acid sequence shown in SEQ ID NO: 24 or consists of the amino acid sequence shown in SEQ ID NO: 24.
[0107] 49. An rplD gene mutant encoding the ribosomal protein L4 mutant according to any one of schemes 43-48.
[0108] 50. The rplD gene mutant according to claim 49, wherein its coding sequence has a G209C mutation at position 209 corresponding to the rplD gene coding sequence of Neisseria gonorrhoeae strain TUM19854 or at position 209 corresponding to the nucleotide sequence shown in SEQ ID NO: 21.
[0109] 51. The rplD gene mutant according to any one of schemes 49-50, wherein the rplD gene mutant is from the genus Neisseria, such as pathogenic Neisseria such as Neisseria meningitidis or Neisseria gonorrhoeae, Neisseria sicca, Neisseria flavescens, Neisseria flavescentis, or Neisseria mucosus.
[0110] 52. The rplD gene mutant according to claim 51, wherein the G209C mutation confers resistance to a macrolide antibiotic to the Neisseria species, optionally selected from the group consisting of: (1) erythromycin and its ester derivatives, including erythromycin, erythromycin ethylsuccinate, erythromycin stearate, erythromycin ethyl carbonate, erythromycin acetate stearate, erythromycin lactobionate, and erythromycin estolate; (2) azithromycin, roxithromycin, clarithromycin, dirithromycin, and fluoxetine; (3) telithromycin; and (4) any combination of the foregoing.
[0111] 53. The rplD gene mutant according to any one of schemes 49 to 52, wherein the coding sequence thereof has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or higher sequence identity with the nucleotide sequence shown in SEQ ID NO: 23, and has the nucleotide sequence shown in SEQ ID NO: 23 or consists of the nucleotide sequence shown in SEQ ID NO: 23.
[0112] 54. A Neisseria comprising one or more of the following mutations or mutants:
[0113] (1) The rplV gene mutant according to any one of Schemes 10-15;
[0114] (2) The rplP gene mutant according to any one of Schemes 23-27;
[0115] (3) The rplQ gene mutant according to any one of Schemes 38-42;
[0116] (4) insertion of a sequence defined in any one of Schemes 10-15;
[0117] (5) Nucleotide mutations defined in any one of Schemes 23-27;
[0118] (6) Nucleotide mutations as defined in any one of Schemes 38-42;
[0119] (7) The rplD gene mutant according to any one of Schemes 49-53;
[0120] (8) Nucleotide mutations as defined in any one of Schemes 49-53;
[0121] (9) Any combination of the above.
[0122] 55. The Neisseria of claim 54, which is selected from the group consisting of pathogenic Neisseria such as Neisseria meningitidis or Neisseria gonorrhoeae, Neisseria sicca, Neisseria flavescent, Neisseria flavescens, or Neisseria mucosus, such as Neisseria gonorrhoeae.
[0123] 56. The Neisseria of claim 54 or 55, further comprising one or more of the following mutations: 23S rRNA C2611T, 23S rRNA A2059G, rplD G70S, rplD G68D, or rplD G70 repeat.
[0124] 57. The Neisseria according to any one of schemes 54-56, which is resistant to a macrolide antibiotic, optionally, the macrolide antibiotic is selected from the group consisting of: (1) erythromycin and its ester derivatives, including erythromycin, erythromycin ethylsuccinate, erythromycin stearate, erythromycin ethyl carbonate, erythromycin acetostearate, erythromycin lactobionate, and erythromycin estolate; (2) azithromycin, roxithromycin, clarithromycin, dirithromycin, and fluoxetine; (3) telithromycin; and (4) any combination of the foregoing.
[0125] 58. A method for detecting whether Neisseria is resistant or likely to be resistant to macrolide antibiotics, comprising:
[0126] a) detecting whether the Neisseria comprises one or more of the following mutations or mutants:
[0127] (1) The rplV gene mutant according to any one of Schemes 10-15;
[0128] (2) The rplP gene mutant according to any one of Schemes 23-27;
[0129] (3) The rplQ gene mutant according to any one of Schemes 38-42;
[0130] (4) insertion of a sequence defined in any one of Schemes 10-15;
[0131] (5) Nucleotide mutations defined in any one of Schemes 23-27;
[0132] (6) Nucleotide mutations as defined in any one of Schemes 38-42;
[0133] (7) The rplD gene mutant according to any one of Schemes 49-53;
[0134] (8) Nucleotide mutations as defined in any one of Schemes 49-53;
[0135] (9) Any combination of the above;
[0136] b) If the Neisseria comprises one or more of the mutations or mutants defined in step a), the Neisseria is determined to be resistant or potentially resistant to macrolide antibiotics.
[0137] 59. A method according to scheme 58, wherein the detection is performed by a technology based on Sanger sequencing, high-throughput sequencing technology (NGS) or PCR.
[0138] 60. The method of claim 58 or 59, wherein the Neisseria is selected from the group consisting of pathogenic Neisseria such as Neisseria meningitidis or Neisseria gonorrhoeae, Neisseria sicca, Neisseria flavescent, Neisseria flavescens, or Neisseria mucosus, such as Neisseria gonorrhoeae.
[0139] 61. The method of any one of schemes 58-60, further comprising detecting whether the Neisseria comprises one or more of the following mutations: 23S rRNA C2611T, 23S rRNA A2059G, rplD G70S, rplD G68D, or rplD G70 repeat.
[0140] 62. The method according to any one of schemes 58 to 61, wherein the macrolide antibiotic is selected from the group consisting of: (1) erythromycin and its ester derivatives, including erythromycin, erythromycin ethylsuccinate, erythromycin stearate, erythromycin ethyl carbonate, erythromycin acetostearate, erythromycin lactobionate, and erythromycin estolate; (2) azithromycin, roxithromycin, clarithromycin, dirithromycin, and fluoxetine; (3) telithromycin; and (4) any combination of the foregoing.
[0141] 63. The method according to any one of schemes 58-62, wherein the Neisseria is from a biological sample, such as a biological sample from the urethra, genital tract and / or rectum, such as urine, a genital tract swab or a rectal swab.
[0142] 64. A method for treating or preventing a Neisseria infection in a patient, comprising: determining whether the Neisseria is resistant to a macrolide antibiotic by the method of any one of schemes 58-63, and if resistant, administering a non-macrolide antibiotic to the patient to treat the Neisseria infection, such as a cephalosporin antibiotic.
[0143] 65. The method of claim 64, wherein, if not resistant, the patient is administered a macrolide antibiotic (e.g., azithromycin) to treat the Neisseria infection.
[0144] 66. The method of claim 64 or 65, wherein the Neisseria is selected from the group consisting of pathogenic Neisseria such as Neisseria meningitidis or Neisseria gonorrhoeae, Neisseria sicca, Neisseria flavescent, Neisseria flavescens, or Neisseria mucosus, such as Neisseria gonorrhoeae.
[0145] 67. A kit comprising a detection reagent for detecting whether Neisseria comprises one or more of the following mutations or mutants:
[0146] (1) The rplV gene mutant according to any one of Schemes 10-15;
[0147] (2) The rplP gene mutant according to any one of Schemes 23-27;
[0148] (3) The rplQ gene mutant according to any one of Schemes 38-42;
[0149] (4) insertion of a sequence defined in any one of Schemes 10-15;
[0150] (5) Nucleotide mutations defined in any one of Schemes 23-27;
[0151] (6) Nucleotide mutations as defined in any one of Schemes 38-42;
[0152] (7) The rplD gene mutant according to any one of Schemes 49-53;
[0153] (8) Nucleotide mutations as defined in any one of Schemes 49-53;
[0154] (9) Any combination of the above.
[0155] 68. The kit of claim 67, further comprising a reagent for detecting whether the Neisseria comprises one or more of the following mutations: 23S rRNA C2611T, 23S rRNA A2059G, rplD G70S, rplD G68D, or rplD G70 repeat.
[0156] 69. The kit according to scheme 67 or 68, which is used to detect whether the Neisseria is resistant or may be resistant to macrolide antibiotics.
[0157] 70. The kit according to any one of schemes 67-69, wherein the Neisseria is selected from the group consisting of: pathogenic Neisseria such as Neisseria meningitidis or Neisseria gonorrhoeae, Neisseria sicca, Neisseria flavescent, Neisseria flavescens, or Neisseria mucosus, such as Neisseria gonorrhoeae.
[0158] 71. The kit according to any one of schemes 67-70, wherein the macrolide antibiotic is selected from the group consisting of: (1) erythromycin and its ester derivatives, including erythromycin, erythromycin ethylsuccinate, erythromycin stearate, erythromycin ethyl carbonate, erythromycin acetostearate, erythromycin lactobionate, and erythromycin estolate; (2) azithromycin, roxithromycin, clarithromycin, dirithromycin, and fluoxetine; (3) telithromycin; and (4) any combination of the foregoing.
[0159] In some embodiments, the methods and / or kits disclosed herein are used to detect whether the Neisseria comprises one or more or all of the following mutations: (1) an rplV gene mutant according to any one of Schemes 10-15 or a sequence insertion as defined in any one of Schemes 10-15; (2) an rplD gene mutant according to any one of Schemes 49-53 or a nucleotide mutation as defined in any one of Schemes 49-53; (3) one, two, three, four or all of the following mutations: 23SrRNA C2611T, 23SrRNA A2059G, rplD G70S, rplD G68D and rplD G70 repeats, such as one, two, three or all of the following mutations: 23SrRNA C2611T, 23SrRNA A2059G, rplD G70S and rplD G70 repeats, such as one, two or all of the following mutations: 23SrRNA C2611T, 23SrRNA A2059G and rplD G70 repeats. In some embodiments, the methods and / or kits of the present disclosure are used to detect whether a Neisseria species comprises: a combination of the mutations listed in (1) and (2), a combination of the mutations listed in (1) and (3), a combination of the mutations listed in (2) and (3), or a combination of the mutations listed in (1)-(3).In some embodiments, the methods and / or kits of the present disclosure are used to detect whether a Neisseria species comprises: (1) a combination of the listed mutations, 23SrRNA C2611T, and 23SrRNA A2059G; (1) a combination of the listed mutations, 23SrRNA C2611T, 23SrRNA A2059G, and rplD G70S; (1) a combination of the listed mutations, 23SrRNA C2611T, 23SrRNA A2059G, and rplD G70 repeats; (1) a combination of the listed mutations, 23SrRNA C2611T, and rplD G70 repeats; (1) a combination of the listed mutations, 23SrRNA A2059G, and rplD G70 repeats; (1) a combination of the listed mutations, 23SrRNA C2611T, and rplD G70 repeats; G70S combination; (2) combination of the listed mutations, 23SrRNA C2611T, 23SrRNA A2059G, and rplD G70S; (2) combination of the listed mutations, 23SrRNA C2611T, 23SrRNA A2059G, and rplD G70 repeats; (2) combination of the listed mutations, 23SrRNA C2611T, and rplD G70 repeats; (2) combination of the listed mutations, 23SrRNA A2059G, and rplD G70 repeats; (2) combination of the listed mutations, 23SrRNA C2611T, and rplD G70S; (2) combination of the listed mutations, 23SrRNA A2059G, and rplD G70S; (1) and (2) the listed mutations, 23SrRNA C2611T, 23SrRNA A2059G, and rplD or a combination of the mutations listed in (1) and (2), 23SrRNA C2611T, 23SrRNA A2059G, and rplD G70 repeats. The combination of the mutations listed in (1) and (2), 23SrRNA C2611T, and rplD G70 repeats. The combination of the mutations listed in (1) and (2), 23SrRNA A2059G, and rplD G70 repeats. The combination of the mutations listed in (1) and (2), 23SrRNA A2059G, and rplD G70 repeats. The combination of the mutations listed in (1) and (2), 23SrRNA C2611T, and rplD G70S. Or a combination of the mutations listed in (1) and (2), 23SrRNA A2059G, and rplD G70S. In some embodiments, detecting rplD G70S or rplD G70 repeats refers to detecting a mutation in a gene encoding rplD G70S or rplD G70 repeats.In some embodiments, detecting the mutations listed in (1) includes detecting whether there is a sequence insertion (sequence insertion 1) between nucleotides 249 and 250 of the rplV gene coding sequence corresponding to Neisseria gonorrhoeae strain TUM19854 and / or whether there is a sequence insertion (sequence insertion 2) between nucleotides 249 and 250 of the nucleotide sequence set forth in SEQ ID NO: 1. In some embodiments, the methods and / or kits of the present disclosure can be used to detect whether Neisseria comprises one or more or all of the following mutations: sequence insertion 1, sequence insertion 2, a combination of the mutations listed in (2), 23SrRNA C2611T, 23SrRNA A2059G, and rplD G70 repeats, for example, one or more or all of the following mutations: the insertion sequence set forth in SEQ ID NO: 7, the insertion sequence set forth in SEQ ID NO: 8, rplD G70A, 23SrRNA C2611T, 23SrRNA A2059G, and rplD G70 repeats.
[0160] In some embodiments, the methods and / or kits of the present disclosure can further be used to detect whether the Neisseria comprises one or more or all of the following mutations: (4) an rplP gene mutant according to any one of Schemes 23-27 or a nucleotide mutation as defined in any one of Schemes 23-27; and / or (5) an rplQ gene mutant according to any one of Schemes 38-42 or a nucleotide mutation as defined in any one of Schemes 38-42. In some embodiments, the mutation listed in (4) is an rplP C284T mutation. In some embodiments, the mutation listed in (5) is an rplQ G134A mutation and / or an rplQ G265A mutation.
[0161] In some embodiments, the methods and / or kits of the present disclosure can be used to detect whether Neisseria contains a protein mutant encoded by a gene having a mutation described above. Thus, in some embodiments, the present disclosure provides a kit for detecting whether Neisseria contains a protein mutant encoded by a gene having a mutation described above.
[0162] Example
[0163] Example 1
[0164] To explore the resistance targets of Neisseria gonorrhea to azithromycin, we performed an agar dilution azithromycin susceptibility test using 115 clinical isolates of Neisseria gonorrhea (numbered 1 to 115). A total of 51 azithromycin-resistant isolates with MIC values greater than or equal to 2 were identified.
[0165] Evidence has shown that 23S rRNA gene mutation is the main cause of azithromycin resistance in gonococci, so we first performed Sanger sequencing analysis of the 23S rRNA gene of gonococci. The results showed that among 51 resistant strains, 16 had the known C2611T homozygous mutation and 23 had the known A2059G homozygous mutation, and there was no strain with both C2611T and A2059G mutations.
[0166] After excluding strains with known 23S rRNA gene mutations, we performed whole-genome NGS sequencing on the remaining 12 resistant strains, plus 10 non-resistant strains, to identify and screen for azithromycin resistance targets in N. gonorrhoeae. The screening scope included 16S rRNA, 23S rRNA; ribosomal proteins L1-L33 and S1-S21 (a total of 54 ribosomal proteins); genes from the erm gene family; efflux pump-related genes mtrC, mtrD, mtrE, and mtrR; mef family genes; and ere family genes.
[0167] Based on the NGS sequencing results, we compared them with the gonococcal reference template TUM19854 and obtained candidate genes (see Table 1).
[0168] Table 1 Note: 1) AZM indicates the MIC value of azithromycin; 2) 0 indicates no mutation; 1 indicates mutation.
[0169] Based on the results, we first excluded mutations present in both resistant and non-resistant strains or only in non-resistant strains. The remaining mutations present in resistant strains originated from the rplD, rplV (L22), rplP (L16), and rplQ (L17) genes. Detailed information on these mutations is shown in Table 2.
[0170] Table 2
[0171] Although there have been reports that rplV gene mutations may cause macrolide resistance, we found for the first time that K83 and R84 insertions can cause azithromycin resistance.
[0172] Of the 13 non-23S rRNA-resistant strains, 5 harbored L7 gene mutations, which were not present in any of the 10 non-resistant strains. In particular, sample 39 harbored only the L17 mutation, with an AZM MIC of 16 mg / mL, confirming that the L17 mutation can cause high-level resistance.
[0173] In samples 41 and 42, only rplV and L16 mutations were present at the same time, with AZM concentrations of 4 mg / mL and 8 mg / mL, respectively, indicating that the simultaneous presence of rplV- and L16-related mutations can lead to a stronger level of resistance.
[0174] In samples 72, 77, and 95, rplD, rplV, and L16 mutations were present simultaneously at an AZM of 16 mg / mL, indicating that the rplD mutation had a synergistic resistance effect on the resistance level with the rplV and L16 mutations.
[0175] We further screened an additional 28 azithromycin-resistant gonococci and found through next-generation sequencing that 14 of these resistant gonococci were due to the rplD G70A mutation, as shown in Table 3. This is contrary to the prior art conclusion that the rplD G70A mutation does not cause drug resistance.
[0176] Table 3. Drug resistance results caused by rplD G70A mutation Note: The strain numbers with L come from the additional 28 resistant strains mentioned above, and the strain numbers without L come from the 115 strains mentioned above.
[0177] Example 2. Conversion of azithromycin-resistant mutation sites in Neisseria gonorrhoeae and azithromycin susceptibility testing
[0178] To further verify the effectiveness of our newly discovered azithromycin-resistant mutation site, we performed gonococcal transfection with the mutant sequence and azithromycin susceptibility testing.
[0179] Test plan:
[0180] 1. Amplification Primer Design
[0181] The requirements for amplification primer design are as follows:
[0182] ①Add DUS sequence to the 5' end of the primer: ATGCCGTCTGAA
[0183] ②The mutation site is located in the center of the sequence
[0184] ③Sequence length needs to be >1000bp
[0185] The reverse complementary sequence of the rplV gene DNA sequence of TUM19854 is shown in SEQ ID NO: 25. Amplification primers were designed based on SEQ ID NO: 25 to obtain the following primer pair:
[0186] rplV forward primer 1 (rplV-F1): GATACCATTCGCTACGGGCA (SEQ ID NO: 27; TM: 59.97°C)
[0187] rplV forward primer 2 containing DUS sequence (rplV-F2): ATGCCGTCTGAAGATACCATTCGCTACGGGCA (SEQ ID NO: 28)
[0188] rplV reverse primer 1 (rplV-R1): TGTTCGTCGCCGTTACTCAA (SEQ ID NO: 29; TM: 59.97°C) TM: 59.97
[0189] rplV reverse primer 2 containing DUS sequence (rplV-R2): TTCAGACGGCATTGTTCGTCGCCGTTACTCAA (SEQ ID NO: 30)
[0190] Product size: 1167BP.
[0191] The reverse complementary sequence of the rplD gene DNA sequence of TUM19854 is shown in SEQ ID NO: 26. Amplification primers were designed based on SEQ ID NO: 26 to obtain the following primer pair:
[0192] rplD forward primer 1 (rplD-F1): GCTCGACAGCAGCTTTGATT (SEQ ID NO: 31; TM: 59.20°C)
[0193] rplD forward primer 2 containing DUS sequence (rplD-F2): ATGCCGTCTGAAGCTCGACAGCAGCTTTGATT (SEQ ID NO: 32)
[0194] rplD reverse primer 1 (rplD-R1): GGTCGCGGTTTGATTGAGTT (SEQ ID NO: 33; TM: 59.13°C)
[0195] rplD reverse primer 2 containing DUS sequence (rplD-R2): TTCAGACGGCATGGTCGCGGTTTGATTGAGTT (SEQ ID NO: 34)
[0196] Product size: 1175BP.
[0197] 2. Mutant Sequence Amplification
[0198] PCR amplification of the transformation mutant sequences was performed using nucleic acid extracts from rplV 18bp insertion mutant J0041 (containing insertion sequence 1 as shown in SEQ ID NO: 7), rplV 24bp insertion mutant J0072 (containing insertion sequence 2 as shown in SEQ ID NO: 8), and rplD G70A mutant L139 as templates. PCR amplification was performed using a dUTP-free buffer with PUF high-fidelity DNA polymerase, an annealing temperature of 60°C, and an extension time of 2 minutes.
[0199] 3. Mutant Sequence Identification
[0200] ①qPCR identification
[0201] Using 1000-fold diluted PCR amplification products as templates, identification was performed using the rplV 18bp insertion mutation, rplV 24bp insertion mutation, and rplD G70A mutation identification systems. The results showed that all PCR amplification products were mutation-positive.
[0202] ② Identification by agarose gel electrophoresis
[0203] First, prepare a 2% agarose gel by mixing 1× TAE buffer and agarose in a conical flask. Mix thoroughly and microwave until the agarose is completely melted. Once cooled to 60°C, add Gelred nucleic acid dye, mix thoroughly, and pour onto a gel plate. Insert a suitable comb to create sample wells in the gel. After the gel solidifies, remove the agarose gel from the plate and place it on a DYY-6C electrophoresis instrument. Add 1× TAE buffer until the gel is submerged. A small amount of PCR amplification product is mixed with loading buffer and added to the sample wells. A DL2000 DNA marker is then added. The voltage is set to 100 V and the gel is run for 25 minutes. After completion of the run, the agarose gel is transferred to a GELDOC-IT2310 gel imaging system for visualization. Results show that the PCR fragment sizes at each mutation site are consistent with theoretical values.
[0204] 4. PCR Product Recovery and Concentration Determination
[0205] The PCR products of each mutation site were recovered using a column-based PCR product recovery kit (Cat. No. B518141-0050) from Shanghai Bioengineering. After recovery, the recovered products from multiple tubes at the same mutation site were combined, mixed evenly, and the concentration was measured using a UV spectrophotometer Nanodrop ONE. The products were then stored at -20°C for transformation experiments.
[0206] 5. Selection and Recovery of Azithromycin-Sensitive Strains for Transformation
[0207] Azithromycin-sensitive strains L221, L229, L296, and L496 (all with azithromycin resistance levels ≤ 0.0312 mg / L) were selected and removed from a -80°C freezer and placed in a -20°C refrigerator for 24 hours. Thawed bacteria were then collected using an inoculating loop and spread onto Neisseria gonorrhoeae™ medium without azithromycin. The bacteria were then incubated at 37°C in a 5% CO2 incubator for 36 hours. Observation of colony morphology revealed that strains L221, L229, and L296 had smaller colonies with dark rings at the edges, consistent with the colony characteristics of strains expressing pili. Therefore, strains L221, L229, and L296, with distinct genetic backgrounds, were selected for transformation experiments.
[0208] 6. Nucleic Acid Spot Preparation
[0209] Draw a 1cm diameter circle on the back of the gonococcal culture medium with a marker. In a biosafety cabinet, add the purified PCR product to the culture medium within the circle. Open the lid and wait for the liquid to air dry until the total DNA amount in the circle reaches 10ug.
[0210] 7. Strain coating culture and single clone selection
[0211] Use an inoculating loop to pick successfully revived L221, L229, or L296 colonies, streak across the nucleic acid spot, and incubate the inoculated dish in a 37°C, 5% CO2 incubator for 24 hours. After 24 hours, observe colony growth. When a single colony within the nucleic acid spot reaches an appropriate size, use an inoculating loop to pick the colony and transfer it to fresh TM medium. Place the inoculated dish in a 37°C, 5% CO2 incubator for 24 hours. In this experiment, a total of 12 colonies each with rplV18bp insertion mutation, rplV 24bp insertion mutation, and rplD G70A mutation transformation colonies in the L221, L229, and L296 backgrounds were selected and numbered L221-18BP-1~12, L221-24BP-1~12, L221-G70A-1~12; L229-18BP-1~12, L229-24BP-1~12, L229-G70A-1~12; L296-18BP-1~12, L296-24BP-1~12, L296-G70A-1~12.
[0212] 8. Nucleic Acid Extraction and Positive Strains Identification
[0213] The strain cultured in a carbon dioxide incubator for 24 hours was extracted using a nucleic acid extraction kit from Zhongkebaier, and the extracted products were then identified using identification primers and probes at each site. After identification, strains L221-18BP-1, L221-18BP-3, L221-18BP-4, L221-18BP-7, L221-18BP-8, L221-18BP-10, L221-18BP-11, L229-18BP-1, L229-18BP-3, L229-18BP-5, L229-18BP-6, L229-18BP-9, L229-18BP-12, L296-18BP-2, L296-18BP-3, L296-18BP-4, L296-18BP-8, L296-18BP-10, L296-18BP-11, and L296-18BP-12 were rp lV18BP insertion mutation-positive strains, L221-24BP-1, L221-24BP-2, L221-24BP-4, L221-24BP-6, L221-24BP-9, L221-24BP-10, L229-24BP-1, L229-24BP-4, L229-24BP-7, L229-24BP-8, L229-24BP-9, L229-24BP-11, L296-24BP-3, L296-24BP-4, L296-24BP-5, L296-24BP-6, L296-24BP-10, L296-24BP-11, and L296-24BP-12 were rplV The 24bp insertion mutation-positive strains, L221-G70A-2, L221-G70A-3, L221-G70A-4, L221-G70A-8, L221-G70A-12, L229-G70A-1, L229-G70A-3, L229-G70A-4, L229-G70A-7, L229-G70A-11, L296-G70A-1, L296-G70A-2, L296-G70A-4, L296-G70A-6, L296-G70A-9, L296-G70A-11, and L296-G70A-12 were rplD G70A mutation-positive strains.
[0214] 9. Azithromycin susceptibility test
[0215] Azithromycin susceptibility plates were prepared; each set contained azithromycin at the following concentrations: 0.0312, 0.0625, 0.125, 0.25, 0.5, 1.0, 2.0, 4.0, 8.0, 16.0, and 32.0 mg / L. Positive strains were inoculated onto the azithromycin susceptibility plates and incubated at 37°C in a 5% CO2 incubator for 36 h. The highest azithromycin level at which each strain grew was then observed and recorded, representing the azithromycin MIC for that strain, as shown in Table 4. Note: "√" indicates that colonies grew on the plate at that azithromycin level, "×" indicates that no colonies grew on the plate at that azithromycin level, and the "gray background" indicates the highest azithromycin level at which the strain can grow. According to the EUCAST antibiotic susceptibility test threshold table version 14.0, gonococci with an azithromycin MIC greater than 1.0 are considered resistant.
[0216] 10. Sequencing Confirmation
[0217] The nucleic acid extracts of the positive strains transformed at each mutation site were subjected to Sanger sequencing. The results showed that L221-18BP-1, L221-18BP-3, L221-18BP-4, L221-18BP-7, L221-18BP-8, L221-18BP-10, L221-18BP-11, L229-18BP-1, L229-18BP-3 , L229-18BP-5, L229-18BP-6, L229-18BP-9, L229-18BP-12, L296-18BP-2, L296-18BP-3, L296-18BP-4, L296-18BP-8, L296-18BP-10, L296-18BP-11, and L296-18BP-12 are rplV 18BP insertion mutants, strains L221-24BP-1, L221-24BP-2, L221-24BP-4, L221-24BP-6, L221-24BP-9, L221-24BP-10, L229-24BP-1, L229-24BP-4, L229-24BP-7, L229-24BP-8, L229-24BP-9, L229-24BP-11, L296-24BP-3, L296-24BP-4, L296-24BP-5, L296-24BP-6, L296-24BP-10, L296-24BP-11, and L296-24BP-12 were rplV 24bp insertion mutants, strains L221-G70A-2, L221-G70A-3, L221-G70A-4, L221-G70A-8, L221-G70A-12, L229-G70A-1, L229-G70A-3, L229-G70A-4, L229-G70A-7, L229-G70A-11, L296-G70A-1, L296-G70A-2, L296-G70A-4, L296-G70A-6, L296-G70A-9, L296-G70A-11, and L296-G70A-12 are rplD G70A mutants.
[0218] 11. Construction of artificial mutants by inserting the nucleotide sequence corresponding to the amino acids K83 / R84 of rplV and drug susceptibility testing
[0219] ① Construction of mutation vector
[0220] Artificial mutation vectors with 2 amino acids (6 bp), 4 amino acids (12 bp), and 7 amino acids (21 bp) inserted into the nucleotide sequence positions corresponding to K83 / R84 were synthesized by a gene synthesis company. The vector backbone was PUC19, and the insertion restriction sites were BAMH I and XBA I. The sequences of the vector inserts are as follows:
[0221] The sequence of vector NG001 containing 2 amino acid insertions (6 bp insertion sequence (SEQ ID NO: 36)) is shown in SEQ ID NO: 35, the sequence of vector NG001 containing 4 amino acid insertions (12 bp insertion sequence (SEQ ID NO: 38)) is shown in SEQ ID NO: 37, and the sequence of vector NG001 containing 7 amino acid insertions (21 bp insertion sequence (SEQ ID NO: 40)) is shown in SEQ ID NO: 39.
[0222] ②Vector enzyme digestion and verification
[0223] Using 2 amino acid insertion (6BP) vector NG001, 4 amino acid insertion (12BP) vector NG002, and 7 amino acid insertion (21BP) vector NG003 as templates, the target fragments for transformation were obtained by double digestion with BAMH I and XBA I, and agarose gel electrophoresis was used to verify that the fragment size met the requirements.
[0224] ③Tapping recovery and concentration determination
[0225] The agarose gel containing each target fragment was excised and recovered using a gel recovery kit. The concentration was then measured using a UV spectrophotometer Nanodrop ONE and stored at -20°C for transformation experiments.
[0226] ④ Gonococcal spot transformation
[0227] The transformation method was the same as above. In this experiment, 12 colonies each of rplV6BP insertion mutation, rplV 12bp insertion mutation, and rplV 21bp insertion mutation were selected from the genetic backgrounds of L221, L229, and L296, and numbered them L221-6BP-1~12, L221-12BP-1~12, L221-21BP-1~12, L229-6BP-1~12, L229-12BP-1~12, L229-21BP-1~12, L296-6BP-1~12, L296-12BP-1~12, and L296-21BP-1~12.
[0228] ⑤Nucleic acid extraction and positive colony identification
[0229] The strains cultured in a carbon dioxide incubator for 24 hours were extracted using a nucleic acid extraction kit from Zhongkebaier, and the extracted products were then identified using identification primers and probes at each site. After identification, strains L221-6BP-1, L221-6BP-2, L221-6BP-5, L221-6BP-8, L221-6BP-10, L229-6BP-2, L229-6BP-4, L229-6BP-9, L229-6BP-11, L229-6BP-12, L296-6BP-1, L296-6BP-3, L296-6BP-4, L296-6BP-5, L296-6BP-7, L296-6BP-10, and L296-6BP-12 were rplV The 6BP insertion mutation-positive strains, L221-12BP-1, L221-12BP-2, L221-12BP-5, L221-12BP-6, L221-12BP-8, L221-12BP-11, L229-12BP-2, L229-12BP-3, L229-12BP-5, L229-12BP-7, L229-12BP-8, L229-12BP-12, L296-12BP-1, L296-12BP-3, L296-12BP-4, L296-12BP-8, L296-12BP-9, and L296-12BP-11 were rplV The 12bp insertion mutation-positive strains, L221-21BP-1, L221-21BP-3, L221-21BP-7, L221-21BP-12, L229-21BP-3, L229-21BP-6, L229-21BP-8, L229-21BP-9, L229-21BP-11, L296-21BP-1, L296-21BP-3, L296-21BP-6, L296-21BP-8, L296-21BP-10, and L296-21BP-12 were rplV 21BP insertion mutation-positive strains.
[0230] ⑥ The results of the azithromycin susceptibility test are shown in Table 5: Note: "√" indicates that colonies grew on the plate at that azithromycin level, "×" indicates that no colonies grew on the plate at that azithromycin level, and the "gray background" indicates the highest azithromycin level at which the strain can grow. According to the EUCAST antibiotic susceptibility test threshold table version 14.0, gonococci with an azithromycin MIC greater than 1.0 are considered resistant.
[0231] ⑦Sequencing confirmation
[0232] The nucleic acid extracts of the positive strains transformed at each mutation site were subjected to Sanger sequencing. The results showed that strains L221-6BP-1, L221-6BP-2, L221-6BP-5, L221-6BP-8, L221-6BP-10, L229-6BP-2, L229-6BP-4, L229-6BP-9, L229-6BP-11, L229-6BP-12, L296-6BP-1, L296-6BP-3, L296-6BP-4, L296-6BP-5, L296-6BP-7, L296-6BP-10, and L296-6BP-12 were rplV The 6BP insertion mutation-positive strains, L221-12BP-1, L221-12BP-2, L221-12BP-5, L221-12BP-6, L221-12BP-8, L221-12BP-11, L229-12BP-2, L229-12BP-3, L229-12BP-5, L229-12BP-7, L229-12BP-8, L229-12BP-12, L296-12BP-1, L296-12BP-3, L296-12BP-4, L296-12BP-8, L296-12BP-9, and L296-12BP-11 were rplV The 12bp insertion mutation-positive strains, L221-21BP-1, L221-21BP-3, L221-21BP-7, L221-21BP-12, L229-21BP-3, L229-21BP-6, L229-21BP-8, L229-21BP-9, L229-21BP-11, L296-21BP-1, L296-21BP-3, L296-21BP-6, L296-21BP-8, L296-21BP-10, and L296-21BP-12 were rplV21BP insertion mutation-positive strains.
[0233] Conclusion: Gonorrheal transformation assays and azithromycin susceptibility testing confirmed that rplV 18bp insertion mutations, rplV 24bp insertion mutations, and rplD G70A mutations confer azithromycin resistance in gonococci. Construction of artificial mutants harboring rplV K83 / R84 amino acid insertions and susceptibility testing demonstrated the universality of azithromycin resistance caused by rplV K83 / R84 insertions.
[0234] Example 3. Performance of different resistance mutations in determining gonococcal resistance to azithromycin
[0235] 1. Primer and probe design and synthesis: Primer premier 5, Oligo 7 and other tools were used to design specific primers and probe sequences for the following six mutations: (1) C2611T: 23S rRNA C2611T mutation, (2) A2059G: 23S rRNA A2059G mutation, (3) 18 bp insertion: insertion sequence mutation shown in SEQ ID NO: 7 in rplV, (4) G70A: rplD G70A mutation, (5) G70 repeat: rplD G70 repeat (i.e., sequence "GGCGGC"), and (6) 24 bp insertion: insertion sequence mutation shown in SEQ ID NO: 8 in rplV; as well as primers and probe sequences for two internal reference genes: (1) NG internal reference gene "gonococcal conserved 3-copy gene" and human GUSB internal reference gene. The primer and probe sequences are given in Tables 6 and 7.
[0236] The primers and probes were diluted to 100 μM using enzyme-free sterile water according to the volume of water provided by the supplier. The actual concentration was diluted to 10 μM after measurement by Nanodrop ONE.
[0237] 2. Sample extraction: A total of 518 clinical isolates were extracted using an extraction kit from Zhongkebaier, of which 436 were non-azithromycin-resistant strains and 82 were azithromycin-resistant strains.
[0238] 3. PCR system preparation: Prepare mixed PCR system-M1 (Table 6) and mixed PCR system-M2 (Table 7) according to the system preparation table.
[0239] 4. Sample addition: Each sample is tested with the M1 and M2 systems, and 20uL of the system and 5uL of sample extraction product are added to each reaction well.
[0240] 5. PCR detection: SLAN-96S PCR instrument was used for detection. The reaction procedure was as follows: 37°C for 5 min; 95°C for 2 min; (94°C for 10 s, 52°C for 40 s)*45; 37°C for 1 min.
[0241] 6. Result Analysis: After setting appropriate thresholds for each channel, the CT value of each target in each sample was calculated minus the CT value of the gonococcal internal reference (NG internal reference gene "gonococcal conserved 3-copy gene sequence") to obtain the ΔCT value of each target in each sample. The positivity of each target was determined by comparing it with the positive judgment value of each target. The results are shown in Table 8, where "6-linked mutation" indicates the detection of a combination of all 6 mutations.
[0242] The sequence information in this disclosure is summarized in the table below.
Claims
1. A ribosomal protein L22 mutant that has an amino acid insertion between the 83rd and 84th amino acids corresponding to the ribosomal protein L22 of Neisseria gonorrhoeae strain TUM19854 or between the 83rd and 84th amino acids corresponding to the amino acid sequence shown in SEQ ID NO:
2.
2. The ribosomal protein L22 mutant according to claim 1, wherein the amino acid insertion is an amino acid fragment having a length of 4 - 10 (such as 5, 6, 7, 8, or 9) amino acids; Optionally, the amino acid insertion is an amino acid repeat sequence; Optionally, the amino acid insertion comprises GPSLK or FQAR or consists of GPSLK or FQAR; Optionally, the amino acid insertion comprises QGPSLK or TFQARGLK or consists of QGPSLK or TFQARGLK; and Optionally, the amino acid insertion is located between K83 and R84 corresponding to the ribosomal protein L22 of strain TUM19854 or between K83 and R84 corresponding to the amino acid sequence shown in SEQ ID NO:
2.
3. The ribosomal protein L22 mutant according to any one of claims 1 - 2, wherein the ribosomal protein L22 mutant is from the genus Neisseria, such as pathogenic Neisseria, for example Neisseria meningitidis or Neisseria gonorrhoeae, Neisseria sicca, Neisseria subflava, Neisseria flavescens, or Neisseria mucosa.
4. The ribosomal protein L22 mutant according to claim 3, wherein the amino acid insertion confers resistance of the genus Neisseria to macrolide antibiotics. Optionally, the macrolide antibiotics are selected from the group consisting of: (1) erythromycin and its ester derivatives, including erythromycin, erythromycin ethylsuccinate, erythromycin stearate, erythromycin ethyl carbonate, erythromycin acetate stearate, erythromycin lactobionate, and erythromycin estolate; (2) azithromycin, roxithromycin, clarithromycin, dirithromycin, and flurithromycin; (3) telithromycin; and (4) any combination of the foregoing.
5. The ribosomal protein L22 mutant according to any one of claims 1 - 4, wherein the L22 mutant has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or higher sequence identity with the amino acid sequence shown in SEQ ID NO:4 or 6, has the amino acid sequence shown in SEQ ID NO:4 or 6, or consists of the amino acid sequence shown in SEQ ID NO:4 or 6.
6. An rplV gene mutant that encodes the ribosomal protein L22 mutant according to any one of claims 1 - 5.
7. The rplV gene mutant according to claim 6, wherein its coding sequence has a sequence insertion between the 249th and 250th nucleotides corresponding to the rplV gene coding sequence of Neisseria gonorrhoeae strain TUM19854 or between the 249th and 250th nucleotides corresponding to the nucleotide sequence shown in SEQ ID NO:1, such as a sequence insertion with a length of 12 - 30 (such as 15, 18, 21, 24 or 27) nucleotides, such as a sequence insertion including or consisting of the sequence shown in SEQ ID NO:7 or 8.
8. The rplV gene mutant according to claim 6 or 7, wherein the sequence insertion is located between A249 and C250 corresponding to the rplV gene coding sequence of Neisseria gonorrhoeae strain TUM19854 or between A249 and C250 corresponding to the nucleotide sequence shown in SEQ ID NO:
1.
9. The rplV gene mutant according to any one of claims 6 - 8, wherein the rplV gene mutant is from the genus Neisseria, such as pathogenic Neisseria, for example Neisseria meningitidis or Neisseria gonorrhoeae, Neisseria sicca, Neisseria subflava, Neisseria flavescens, or Neisseria mucosa.
10. The rplV gene mutant according to claim 9, wherein the sequence insertion confers resistance to macrolide antibiotics in the genus Neisseria. Optionally, the macrolide antibiotics are selected from the group consisting of: (1) erythromycin and its ester derivatives, including erythromycin, erythromycin ethylsuccinate, erythromycin stearate, erythromycin ethyl carbonate, erythromycin acetate stearate, erythromycin lactobionate, and erythromycin estolate; (2) azithromycin, roxithromycin, clarithromycin, dirithromycin, and flurithromycin; (3) telithromycin; and (4) any combination of the foregoing.
11. The rplV gene mutant according to any one of claims 6 - 10, wherein its coding sequence has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or higher sequence identity with the nucleotide sequence shown in SEQ ID NO:3 or 5, has the nucleotide sequence shown in SEQ ID NO:3 or 5, or consists of the nucleotide sequence shown in SEQ ID NO:3 or 5.
12. A Neisseria bacterium comprising one or more of the following mutations or mutants: (1) The L22 mutant according to any one of claims 1 - 5; (2) The rplV gene mutant according to any one of claims 6 - 11; and / or (3) The sequence insertion defined according to any one of claims 6 - 11; Optionally, the Neisseria bacterium is selected from the group consisting of: pathogenic Neisseria, for example Neisseria meningitidis or Neisseria gonorrhoeae, Neisseria sicca, Neisseria subflava, Neisseria flavescens, or Neisseria mucosa, such as Neisseria gonorrhoeae.
13. The Neisseria according to claim 12, which further comprises one or more of the following mutations: 23S rRNA C2611T, 23S rRNA A2059G, rplD G68D, rplD G70S, rplD G70A, and / or rplD G70 duplication, such as 23S rRNA C2611T, 23S rRNA A2059G, rplD G70A, and / or rplD G70 duplication.
14. A method for detecting whether Neisseria is resistant or potentially resistant to macrolide antibiotics, which comprises: a) detecting whether the Neisseria comprises one or more of the following mutations or mutants: (1) the L22 mutant according to any one of claims 1-5; (2) the rplV gene mutant according to any one of claims 6-11; and / or (3) the sequence insertion defined according to any one of claims 6-11; b) if the Neisseria comprises one or more of the mutations or mutants defined in step a), then the Neisseria is determined to be resistant or potentially resistant to macrolide antibiotics; Optionally, the Neisseria is selected from the group consisting of: pathogenic Neisseria such as Neisseria meningitidis or Neisseria gonorrhoeae, Neisseria sicca, Neisseria subflava, Neisseria flavescens, or Neisseria mucosa, such as Neisseria gonorrhoeae; Optionally, the macrolide antibiotics are selected from the group consisting of: (1) erythromycin and its ester derivatives, including erythromycin, erythromycin ethylsuccinate, erythromycin stearate, erythromycin ethyl carbonate, erythromycin acetate stearate, erythromycin lactobionate, and erythromycin estolate; (2) azithromycin, roxithromycin, clarithromycin, dirithromycin, and flurithromycin; (3) telithromycin; and (4) any combination of the foregoing.
15. The method according to claim 14, which further comprises detecting whether the Neisseria comprises one or more of the following mutations: 23S rRNA C2611T, 23S rRNA A2059G, rplD G68D, rplD G70S, rplD G70A, and / or rplD G70 duplication, such as 23S rRNA C2611T, 23S rRNA A2059G, rplD G70A, and / or rplD G70 duplication.
16. A method for treating or preventing Neisseria infection in a patient, comprising: Determining whether the Neisseria is resistant to macrolide antibiotics by the method according to any one of claims 14-15, and if resistant, administering a non-macrolide antibiotic to the patient to treat Neisseria infection, such as cephalosporin antibiotics; Optionally, the Neisseria is selected from the group consisting of: pathogenic Neisseria such as Neisseria meningitidis or Neisseria gonorrhoeae, Neisseria sicca, Neisseria subflava, Neisseria flavescens, or Neisseria mucosa, such as Neisseria gonorrhoeae.
17. A kit, which comprises a detection reagent for detecting whether Neisseria comprises one or more of the following mutations or mutants: (1) the rplV gene mutant according to any one of claims 10-15; and / or (2) Insertion according to the sequence defined in any one of claims 10 - 15; Optionally, the Neisseria is selected from the group consisting of: pathogenic Neisseria such as Neisseria meningitidis or Neisseria gonorrhoeae, Neisseria sicca, Neisseria subflava, Neisseria flavescens, or Neisseria mucosa, such as Neisseria gonorrhoeae.
18. The kit according to claim 17, further comprising a reagent for detecting whether the Neisseria contains one or more of the following mutations: 23S rRNA C2611T, 23S rRNA A2059G, rplD G68D, rplD G70S, rplD G70A, and / or rplD G70 repeat, such as 23S rRNA C2611T, 23S rRNA A2059G, rplD G70A, and / or rplD G70 repeat.
19. The kit according to claim 17 or 18, which is used for detecting whether the Neisseria is resistant or potentially resistant to macrolide antibiotics; optionally, the macrolide antibiotics are selected from the group consisting of: (1) erythromycin and its ester derivatives, including erythromycin, erythromycin ethylsuccinate, erythromycin stearate, erythromycin ethyl carbonate, erythromycin acetate stearate, erythromycin lactobionate, and erythromycin estolate; (2) azithromycin, roxithromycin, clarithromycin, dirithromycin, and flurithromycin; (3) telithromycin; and (4) any combination of the foregoing.