Novel modified streptomyces cells which produce alligamycin a with higher yields

Genetic and metabolic engineering of Streptomyces cells to reduce azalomycin, nigericin, and pteridic acids biosynthesis significantly increases alligamycin A production, addressing the low titre issue and improving its efficacy as an antifungal agent.

WO2025146463A1PCT designated stage expired Publication Date: 2025-07-10DANMARKS TEKNISKE UNIV

Patent Information

Application Number
PCT/EP2025/050063
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-01-03
Filing Date
2025-01-03
Publication Date
2025-07-10

AI Technical Summary

Technical Problem

The production titre of alligamycin A by Streptomyces iranensis is low, hindering its development as an antifungal agent against drug-resistant Aspergillus species and contributing to the global crisis of fungal infections and agricultural losses.

Method used

Genetic and metabolic engineering of Streptomyces cells to reduce the biosynthesis of azalomycin, nigericin, and pteridic acids, thereby increasing the production of alligamycin A to levels of 5 mg/L or more.

Benefits of technology

The modified Streptomyces cells produce alligamycin A with a titre increase of up to 10-fold, enhancing its potential as a potent antifungal agent against drug-resistant Aspergillus species and reducing agricultural losses.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure EP2025050063_10072025_PF_FP_ABST
    Figure EP2025050063_10072025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to, generally, modified Streptomyces cells which produce alligamycin A with higher yields.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] P7053PC00Novel modified Streptomyces cells which produce alligamycin A with higheryields Technical fieldThe present invention relates to, generally, novel modified Streptomyces cells whichproduce alligamycin A with higher yields.Background Fungal infections, posing a pervasive global threat, imperil both public health and food security. The escalating prevalence and resistance of fungal pathogens contribute significantly to this crisis, with over 150 million individuals worldwide contending annually with severe fungal infections resulting in more than 1.5 million deaths. The available therapeutic choices for fungal infections are restricted to a handful of antifungal medicines, such as azoles, polyenes, and echinocandins, with only a limited number of candidates progressing through the clinical development pipeline. Simultaneously, the agricultural sector confronts a substantial risk to global food security arising from fungal diseases, resulting in a loss of crops ranging from 10% to 23% during cultivation, with an additional 10% to 20% loss occurring post-harvest each year. The widespread use of broad-spectrum fungicides further exacerbates the challenge of antifungal drug resistance in fungi. Addressing these critical issues necessitates intensified research efforts directed toward the development of novel antifungal agents.Nature is a continually a rich source of drug discovery. Among the valuable naturalproducts, beta-lactones (examples shown in Figure 1), although rarely reported as natural products, often possess profound biological activities. For example, obafluorin (Figure 1.1), an antibiotic produced by Peudomonas fluorescens, exhibits antibacterial activity against Staphylococcus aureus, Escherichia coli, Enterobacter cloacae,Providencia rettgeri and Pseudomonas aeruginosa. Salinosporamide (Figure 1.2),isolated from the marine bacterium Salinospora tropica, is a cytotoxic proteasome inhibitor and completed phase 2 clinical trial for multiple myeloma cancer therapy.Lipstatin (Figure 1.3), isolated from Streptomyces toxytricini, is a potent and selectiveinhibitor of human pancreatic lipase, and it is currently used in clinic as anti-obese drug. P7053PC00 Actinomycetes are producers of small bioactive molecules exhibiting a broad range of structural and functional diversity called secondary metabolites (SMs). These compounds are relevant to human health, as many display pharmaceutical properties such as antibacterial, antifungal, anticancer and immunosuppressive activities. Nearly two thirds of antibiotics approved for clinical use originate from actinomycete bacteria,in particular from Streptomycetes, and of all new drugs from 1981-2014, 60 % of the1211 approved small molecule drugs were SMs or derivatives thereof.The Actinomycete Streptomyces iranensis has been previously reported as arapamycin-producer, and was originally isolated from soil in Isfahan city in Iran.Genome-mining through anti-SMASH revealed that it harbours enormous biosyntheticgene clusters coding for undescribed natural products, which are potential drugcandidates. OSMAC-based cultivation followed by LC-HRMS analysis of S. iranensisrevealed its production of various unknown secondary metabolites.Alligamycin A is one such secondary metabolite produced by Streptomyces iranensis.It exhibits potent and selective antifungal activities against several drug-resistantAspergillus, e.g. Aspergillus flavus, Aspergillus calidoustus, Aspergillus terreus andAspergillus tubingensis (PCT / EP2023 / 067953).However, the production titre of the native producer is rather low (0.1 mg / mL) which isa bottleneck for further drug development. Therefore, novel methods are required forimproving the titre of alligamycin A.Summary In the present disclosure, genetic and metabolic engineering methods have been utilized to increase the production titre of alligamycin A.The present disclosure describes a modified Streptomyces cell which is capable ofproducing alligamycin A, in particular a Streptomyces iranensis cell, and suitable for theuse and methods described herein, in particular methods of increasing the production of alligamycin A. P7053PC00Herein, the inventors describe specific modifications of Streptomyces cells for theincreased production of alligamycin A, wherein the modifications induce a reducedbiosynthesis of azalomycin, nigericin and / or pteridic acids.Thus, in a first aspect, the present disclosure concerns a Streptomyces cell,preferably a Streptomyces iranensis cell, capable of producing alligamycin A of formula(I), or a derivative thereof, such as an acceptable derivative thereof, such as a salt or solvate thereof; wherein, R4 is independently selected from the group consisting of: hydrogen, hydroxy, alkyl and halogen; R1, R2 and R3 is selected from the group consisting of: hydrogen; oxo; hydroxy; and methoxy; R5is selected from the group consisting of hydrogen; alkyl; halogen; oxo; hydroxy; methoxy; and formula (II): P7053PC00 said cell having at least one mutation resulting in reduced biosynthesis of one or more of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; and iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto.In another aspect, the present disclosure concerns a method of increasing theproduction of alligamycin A of formula (I), or a derivative thereof, such as an acceptable derivative thereof, such as a salt or solvate thereof; wherein, R4 is independently selected from the group consisting of: hydrogen, hydroxy, alkyl and halogen; R1, R2 and R3 is selected from the group consisting of: hydrogen; oxo; hydroxy; and methoxy; R5is selected from the group consisting of hydrogen; alkyl; halogen; oxo; hydroxy; methoxy; and formula (II): P7053PC00 in a Streptomyces cell, preferably an S. iranensis cell, the method comprising introducing in said cell at least one mutation resulting in reduced biosynthesis of one or more of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; and iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto.In another aspect, the present disclosure concerns a method of modifying aStreptomyces cell to increase the alligamycin A production in said Streptomycescell, said method comprising the steps of: i) providing a Streptomyces cell capable of synthesising alligamycin A,ii) introducing in said cell at least one mutation resulting in reducedbiosynthesis of one or more of: a. azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; b. nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; and P7053PC00 c. pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto iii) incubating said Streptomyces cell in a medium,thereby obtaining said cell capable of producing alligamycin A with an increased titrecompared to a reference cell, which does not comprise said at least one mutation resulting in reduced biosynthesis of one or more of azalomycin, nigericin and pteridic acids.In another aspect, the present disclosure concerns a method for production ofalligamycin A, the method comprising providing the Streptomyces cell of any of thepreceding items, and culturing said Streptomyces cell in a culture medium, preferablywherein the alligamycin A is produced with a titre of 5 mg / L or more, such as 10 mg / Lor more, such as 20 mg / L or more, such as 30 mg / L or more, such as 40 mg / L or more, such as 50 mg / L or more, such as 60 mg / L or more, such as 70 mg / L or more, such as 80 mg / L or more, such as 90 mg / L or more, such as 100 mg / L or more.In another aspect, the present disclosure concerns a nucleic acid construct formodifying a Streptomyces cell, comprising one or more nucleic acids comprising at least one mutation resulting in reduced biosynthesis of one of more of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; and iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto, when said nucleic acids are introduced in said cell. Description of Drawings Figure 1 discloses examples of previous reported beta-lactones.1: Obafluorin, 2: Salinosporamide, 3: Lipostatin. P7053PC00 Figure 2 shows selected HMBC correlations for alligamycin A.Figure 3 discloses the ORTEP diagram showing the atom-numbering scheme andsolid-state conformation of alligamycin A.Figure 4 discloses the proposed biosynthesis of alligamycin A.Figure 5 discloses the Biosynthetic Gene Cluster (BCG) and individual genes foralligamycin A.Figure 6 shows that production of alligamycin A is abolished in an splA mutant.Figure 7 discloses agar diffusion assay showing strong inhibition for alligamycin A (10μg / paper disk) against three Aspergillus species. The inhibition zones are 50 mm, 40mm and 70 mm, respectively.Figure 8 discloses agar diffusion assay showing strong inhibition for alligamycin A (50μg / paper disk) against Gram-positive human pathogen S. aureus strain 8325. Theinhibition zone is 19 mm.Figure 9 discloses the relative quantification analysis of alligamycin A production indifferent mutants. Figure 10 discloses the CRISPR-cas9 insertion of KasOp promoter in spl / ali biosynthetic gene cluster. Definitions The term “alkyl” refers to a straight or branched hydrocarbon chain radical consisting of carbon and hydrogen atoms, containing no unsaturation, and may be straight or branched, substituted or unsubstituted. In some preferred embodiments, the alkyl group may consist of 1 to 12 carbon atoms, e.g.1 carbon atom, 2 carbon atoms, 3carbon atoms, 4 carbon atoms etc., up to and including 12 carbon atoms. Exemplaryalkyl groups include, but are in no way limited to, methyl, ethyl, propyl, isopropyl, n- P7053PC00 butyl, iso-butyl, sec-butyl isobutyl, tertiary butyl, pentyl, isopentyl, neopentyl, hexyl, septyl, octyl, nonyl and decyl. The alkyl moiety may be attached to the rest of the molecule by a single bond, such as for example, methyl (Me), ethyl (Et), n-propyl (Pr), 1-methylethyl (iso-propyl), n-butyl, n-pentyl, 1,1-dimethylethyl (t-butyl) and 3- methylhexyl. Unless stated otherwise specifically in the specification, an alkyl group is optionally substituted by one or more of any suitable substituents. An alkyl group canbe mono-, di-, tri- or tetra-valent, as appropriate to satisfy valence requirements. Theterm “alkylene” by itself or as part of another substituent, means a divalent radical derived from an alkyl moiety, as exemplified, but not limited, by −CH2CH2CH2CH2−. Generally, suitable substituents for substituted groups disclosed herein independently include, but are not limited to, alkyl, heteroalkyl, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, aryl, arylalkyl, heteroaryl, heteroarylalkyl, hydroxy, halo, cyano, trifluoromethyl, trifluoromethoxy, nitro, trimethylsilanyl, chloride, bromide, ─ORa, ─SRa, ─OC(O)─Ra, ─N(Ra)2, ─C(O)Ra, ─C(O)ORa, ─OC(O)N(Ra)2, ─C(O)N(Ra)2, ─N(Ra)C(O)ORa, ─N(Ra)C(O)Ra, ─N(Ra)C(O)N(Ra)2, N(Ra)C(NRa)N(Ra)2, ─N(Ra)S(O)tRa, ─N(Ra)S(O)2Ra, ─S(O)ORa, ─S(O)2ORa, ─S(O)N(Ra)2, ─S(O)2N(Ra)2, or PO3(Ra)2 where each Rais independently hydrogen, alkyl, haloalkyl, carbocyclyl, carbocyclylalkyl, aryl, aralkyl, heterocycloalkyl, heterocycloalkylalkyl, heteroaryl or heteroarylalkyl.The term “nucleic acid” as used herein refers to polynucleotides such asdeoxyribonucleic acid (DNA) and ribonucleic acid (RNA) or a combination of the two and any chemical or enzymatic modification thereof (e.g. methylated DNA, DNA of modified nucleotides). The term should also be understood to include, as equivalents, derivatives, variants and analogs of either RNA or DNA made from nucleotide analogs, single (sense or antisense) and double-stranded polynucleotides.The term “isolated nucleic acid” as used herein refers to a nucleic acid that isseparated from its native environment and present in sufficient quantity to permit its identification or use. An isolated nucleic acid may be one that is (i) amplified in vitro by, for example, polymerase chain reaction (PCR); (ii) recombinantly produced or cloned; (iii) purified, as by cleavage and gel separation; or (iv) synthesized by, for example, chemical synthesis. An isolated nucleic acid is one which is readily manipulable by recombinant DNA techniques well known in the art. Thus, a nucleotide sequence P7053PC00 contained in a vector in which 5' and 3' restriction sites are known or for which polymerase chain reaction (PCR) primer sequences have been disclosed is considered isolated but a nucleic acid sequence existing in its native state in its natural host is not. An isolated nucleic acid may be substantially purified, but need not be. For example, a nucleic acid that is isolated within a cloning or expression vector is not pure in that itmay comprise a small percentage of the material of the cell in which it resides. Such anucleic acid is isolated, however, as the term is used herein because it is readily manipulable by standard techniques known to those of ordinary skill in the art. Any of the nucleic acids provided herein may be isolated.The term “gene” as used herein means a nucleic acid sequence that containsinformation necessary for expression of a polypeptide or protein. It includes thepromoter and terminator and the structural gene as well as other nucleic acidsequences involved in expression of the protein.The terms “protein” or “polypeptide” as defined herein are used interchangeably andrefer to molecules consisting of a chain of amino acids, without reference to a specific mode of action, size, 3-dimensional structure or origin. A fragment or portion of a protein may thus still be referred to as a "protein". An "isolated protein" is used to refer to a protein which is no longer in its natural environment, for example in vitro. A “heterologous protein” refers to a protein which is not naturally present in the cell inwhich it is expressed, for example it is expressed in a recombinant bacterial or planthost cell. An enzyme is a protein having enzymatic activity.The term “vector” as defined herein means a DNA molecule capable of replication in ahost cell and / or to which another DNA segment can be operatively linked so as to bringabout replication of the attached segment. A plasmid is an exemplary vector. A systemof vectors comprising several nucleic acids comprises a plurality of vectors, which together comprise a plurality of nucleic acids. The nucleic acids are not necessarily all on the same vector; a vector of the system of vectors may comprise several nucleic acids. For example, a system of vectors comprising five nucleic acids can be: a first vector comprising a first and a second nucleic acids, and a second vector comprising a third, a fourth and a fifth nucleic acids; or five vectors each comprising one of the first, second, third, fourth and fifth nucleic acids. P7053PC00The term “reference cell” as used herein refers to a Streptomyces cell which does notcomprise any of the modifications disclosed herein, i.e. the cell is identical to the celldescribed herein but does not comprise the specific mutations disclosed herein. More specifically, the cell does not comprise at least one mutation resulting in reduced biosynthesis of one or more of azalomycin, nigericin or pteridic acids.The term “host cell” as defined herein refers to a cell which includes an exogenouspolynucleotide, wherein the methods used to insert the exogenous polynucleotide into a cell include direct uptake, transduction, f-mating, or other methods known in the art to create recombinant host cells. By way of example only, such exogenous polynucleotide may be a non-integrated vector, including but not limited to a plasmid, or may be integrated into the host genome. The term “non-natural microorganism” as defined herein refers to a microorganism that has been manipulated to include an exogenous polynucleotide. By way of example only, such exogenous polynucleotide may be a non-integrated vector, including but not limited to a plasmid, or may be an exogenous polypeptide integrated into the hostgenome. A non-natural microorganism may thus express a heterologous protein, i.e. aprotein which is not naturally found in the microorganism. The terms homology, identity and similarity, with respect to a polynucleotide (orpolypeptide), as defined herein are used interchangeably and refer to the percentage ofnucleic acids (or amino acids) in the candidate sequence that are homolog, identical or similar, respectively, to the residues of a corresponding native nucleic acids (or amino acids), after aligning the sequences and introducing gaps, if necessary, to achieve themaximum percent homology / identity / similarity, and considering any conservativesubstitutions according to the NCIUB rules (hftp: / / www.chem.qmul.ac.uk / iubmb / misc / naseq.html; NC-IUB, Eur J Biochem (1985)) as part of the sequence identity. In particular, the percentage of similarity refers to the percentage of residues conserved with similar physiochemical properties. Neither 5' or 3' extensions nor insertions (for nucleic acids) or N’ or C’ extensions nor insertions (for polypeptides) result in a reduction of identity or similarity. Methods and computer programs for the alignments are well known in the art. Generally, a given similarity between two sequences implies that the identity between these sequences is at leastequal to the similarity; for example, if two sequences are 70% identical to one another, P7053PC00they cannot be less than 70% similar to one another – but could be sharing 80%similarity or more. As defined herein the term “at least 60% homology, similarity or identity” means at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%,at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, atleast 97%, at least 98%, at least 99% homology, similarity or identity throughout thepresent disclosure.The term “functional variant” refers herein to functional variants of a parent polypeptide,such as an enzyme, which retain at least some of the activity of the parent polypeptide,such as the parent enzyme. Thus, a functional variant of a Type I PKS can catalyse thesame conversion as the enzyme from which it is derived, although the efficiency ofreaction may be different, e.g. the efficiency is decreased or increased compared to theparent enzyme, the substrate specificity is modified, the longevity or turnover of theenzyme is modified, the cellular localisation of the enzyme is modified. How to testwhether the functionality of the functional variant is modified compared to the original polypeptide is well within reach of the skilled person. It can for example be assessed bypurifying the functional variant, e.g. using an affinity tag, and comparing its activity on agiven substrate in vitro to the activity of the parent polypeptide. A variant or homologue of a nucleic acid, as understood herein, is a variant of a given nucleic acid, preferably a DNA sequence, which given sequence encodes a given polypeptide. The terms “variant” and “homologue” will be used interchangeably herein.A variant or homologue in this context refers to a nucleic acid which differs from thegiven nucleic acid, but still encodes a functional polypeptide. In other words, the termvariant or homologue encompasses all sequences encoding the same polypeptide asthe given nucleic acid sequence. In some embodiments, the variant encodes a polypeptide, the sequence of which differs from the sequence of the given polypeptide, but retains all or at least part of the functionality of the given polypeptide. In some embodiments, a variant may thus encode a polypeptide which has lower (but not null) functionality as the given polypeptide, or similar functionality as the given polypeptide, or higher functionality as the given polypeptide. How to test whether the functionality of the polypeptide obtained from the variant is modified compared to the given polypeptide is well within reach of the skilled person. It can for example be assessed by P7053PC00 purifying the resulting polypeptide, e.g. using an affinity tag, and assaying its activity on a given substrate in vitro. The term “derivative thereof” as used herein, refers to any compound structurallyderived from alligamycin A of formula (I) or (III), or related compounds, throughmodifications including but not limited to substitution, addition, deletion, or rearrangement of one or more atoms, functional groups, or side chains, while retaining the core structural integrity and functional properties of the parent compound. Suchderivatives include, but are not limited to, pharmaceutically acceptable salts, which areionic forms of the compound compatible with pharmaceutical use; solvates, which are molecular complexes formed with solvents; Esters, amides, or other chemical modifications that enhance stability, bioavailability, or biological activity. An "acceptable derivative" as used herein is any derivative that maintains or enhances the ability of the compound to perform the intended function, such as binding to a target, retaining biological activity, or facilitating synthesis or production, and is chemically, pharmaceutically, or biologically acceptable for the intended application. The term “spiro-fused ring” as defined herein is meant to include two molecular rings with only one common atom.During the course of development, the compound disclosed herein was renamed toalligamycin A and the genes that were originally named splA, splB, splC,… splL wererenamed aliA, aliB, aliC, … aliL. The gene names splA-L and aliA-L are thus usedinterchangeably.The term “beta-lactone ring” as defined herein is meant to include cyclic carboxylicesters, containing a 1-oxacycloalkan-2-one structure (−C(=O)−O−), or analogues having unsaturation or heteroatoms replacing one or more carbon atoms of the 4- membered ring.The term “microorganism” as defined herein is meant to include a bacterium, yeastand / or fungus. The term “antibiotic-resistant bacteria” as defined herein is meant to include bacteria that are resistant to antibiotics routinely used in the clinics. P7053PC00 The term “mg / kg” as defined herein refers to a concentration of a certain amount of mg of the compound as defined herein per one kg of a recipient, wherein the recipient can be an animal, an agricultural product, and / or the soil.The term “agricultural products” as defined herein is meant to include agricultural,horticultural, viticultural, and dairy products, livestock and the products thereof, the products of poultry and bee raising, the edible products of forestry, and any and allproducts raised or produced on farms and processed or manufactured productsthereof, transported or intended to be transported in interstate and / or foreigncommerce. A list encompassing agricultural products can be consulted in Annex I ofthe Treaty of the Functioning of the European Union (https: / / eur-lex.europa.eu / LexUriServ / LexUriServ.do?uri=CELEX:12012E / TXT:en:PDF).As defined herein the term “a compound comprising:a spiro-fused ring; anda beta-lactone ring, wherein the compound has formula (I): wherein: i. R4 is independently selected from the group consisting of: hydrogen, hydroxy,alkyl and halogen; ii. R1, R2 and R3 is selected from the group consisting of: hydrogen; oxo; hydroxy;and methoxy; P7053PC00 iii. R5 is selected from the group consisting of hydrogen; alkyl; halogen; oxo;hydroxy; methoxy; and formula (IV): (IV)” encompasses a compound of formula (III): throughout the present disclosure. As defined herein the term “alligamycin A” encompasses a compound of formula (III):

[0002] P7053PC00 throughout the present disclosure. Detailed descriptionAlligamycin A is a secondary metabolite produced by Streptomyces iranensis. Itexhibits potent and selective antifungal activities against several drug-resistantAspergillus, e.g. Aspergillus flavus, Aspergillus calidoustus, Aspergillus terreus andAspergillus tubingensis (PCT / EP2023 / 067953).The Streptomyces cells of the present disclosureThe present disclosure describes a Streptomyces cell, in particular a Streptomycesiranensis cell, which is capable of producing alligamycin A with a higher titre than anatural Streptomyces cell, and suitable for the use and methods described herein, inparticular methods of increasing the production of alligamycin A, methods of modifyinga Streptomyces cell to increase alligamycin A production, methods for production ofalligamycin A. The Streptomyces cell is modified, i.e. engineered, in other words it isnot naturally occurring. Additionally, the present disclosure describes nucleic acidconstructs for modifying a Streptomyces cell.The inventors have surprisingly found that mutations resulting in reduced biosynthesisof metabolites which are not alligamycin A, in particular mutations resulting in reduced P7053PC00 biosynthesis of azalomycin, nigericin or pteridic acids, result in an increased production of alligamycin A.The Streptomyces cell of the present disclosure, preferably a Streptomyces iranensiscell, is capable of producing alligamycin A of formula (I), or a derivative thereof, such as an acceptable derivative thereof, such as a salt or solvate thereof; wherein, R4 is independently selected from the group consisting of: hydrogen, hydroxy, alkyl and halogen; R1, R2 and R3 is selected from the group consisting of: hydrogen; oxo; hydroxy; and methoxy; R5 is selected from the group consisting of hydrogen; alkyl; halogen; oxo; hydroxy; methoxy; and formula (II): (II), said cell having at least one mutation resulting in reduced biosynthesis of one or more of: P7053PC00 i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; and iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto.In some embodiments of the present disclosure, the Streptomyces cell producesalligamycin A with an increased titre compared to a reference cell, which does notcomprise said at least one mutation resulting in reduced biosynthesis of one or more ofazalomycin, nigericin and pteridic acids. In some embodiments, the cell is a wild-typecell. In some embodiments of the present disclosure, the reduction of activity is partial or total.In some embodiments of the present disclosure, the production of alligamycin A in saidStreptomyces cell is increased compared to a reference cell.In some embodiments of the present disclosure, the production of alligamycin A in saidStreptomyces cell is increased compared to a reference cell by at least 1.5-fold, suchas at least 1.8-fold, such as at least 2-fold, such as at least 3-fold, such as at least 4- fold, such as at least 4.5-fold, such as at least 5-fold, such as at least 6-fold, such as at least 7-fold, such as at least 7.3-fold, such as at least 8-fold, such as at least 9-fold, such as at least 10-fold.In some embodiments of the present disclosure, the production of alligamycin A isincreased compared to a reference cell by at least 4.5-fold.In some embodiments of the present disclosure, the production of alligamycin A isincreased compared to a reference cell by at least 7.3-fold. P7053PC00 In some embodiments of the present disclosure, at least one mutation is one mutation resulting in reduced biosynthesis of: i) azalomycin, wherein the cell has reduced activity of AzaA (SEQ ID NO: 31) or afunctional variant thereof having at least 60% identity thereto; ii) nigericin, wherein the cell has reduced activity of NigA (SEQ ID NO: 36) or afunctional variant thereof having at least 60% identity thereto; or iii) pteridic acids, wherein the cell has reduced activity of PtaA (SEQ ID NO: 26) ora functional variant thereof having at least 60% identity thereto. In some embodiments of the present disclosure, the cell comprises at least two mutations resulting in reduced biosynthesis of azalomycin and nigericin, respectively, preferably: i) wherein the cell has reduced activity of AzaA (SEQ ID NO: 31) or a functionalvariant thereof having at least 60% identity thereto; and ii) wherein the cell has reduced activity of NigA (SEQ ID NO: 36) or a functionalvariant thereof having at least 60% identity thereto. In some embodiments of the present disclosure, the cell comprises at least two mutations resulting in reduced biosynthesis of azalomycin and pteridic acids, respectively, preferably: i) wherein the cell has reduced activity of AzaA (SEQ ID NO: 31) or a functionalvariant thereof having at least 60% identity thereto; and ii) wherein the cell has reduced activity of PtaA (SEQ ID NO: 26) or a functionalvariant thereof having at least 60% identity thereto. In some embodiments of the present disclosure, the cell comprises at least two mutations resulting in reduced biosynthesis of nigericin and pteridic acids, respectively, preferably: i) wherein the cell has reduced activity of NigA (SEQ ID NO: 36) or a functionalvariant thereof having at least 60% identity thereto; and ii) wherein the cell has reduced activity of PtaA (SEQ ID NO: 26) or a functionalvariant thereof having at least 60% identity thereto. In some embodiments of the present disclosure, the cell comprises at least three mutations resulting in reduced biosynthesis of: P7053PC00 i) azalomycin, wherein the cell has reduced activity of AzaA (SEQ ID NO: 31) or afunctional variant thereof having at least 60% identity thereto; ii) nigericin, wherein the cell has reduced activity of NigA (SEQ ID NO: 36) or afunctional variant thereof having at least 60% identity thereto; and iii) pteridic acids, wherein the cell has reduced activity of PtaA (SEQ ID NO: 26) ora functional variant thereof having at least 60% identity thereto. In some embodiments of the present disclosure, said at least one mutation, at least two mutations or at least three mutations refer to one or more mutations in either one, two or three different nucleic acid sequences, respectively, not the number of mutations pernucleic acid. In other words, at least one mutation in a specific gene, such as eitherazaA, nigA or ptaA, may refer to several mutations in said specific gene.In some embodiments of the present disclosure, the reduction of activity of AzaA isachieved by mutating or deleting azaA (SEQ ID NO: 30), or a homologue thereofhaving at least 70% identity thereto. In some embodiments of the present disclosure, the at least one mutation results in a truncated AzaA comprising at the most 73 consecutive amino acids of AzaA of SEQ ID NO: 31, or a homologue thereof having at least 70% identity thereto. In some embodiments of the present disclosure, the reduction of activity of NigA isachieved by mutating or deleting nigA (SEQ ID NO: 35), or a homologue thereof havingat least 70% identity thereto. In some embodiments of the present disclosure, the at least one mutation results in a truncated NigA comprising at the most 1263 consecutive amino acids of NigA of SEQ ID NO: 36, or a homologue thereof having at least 70% identity thereto. In some embodiments of the present disclosure, the reduction of activity of PtaA isachieved by mutating or deleting ptaA (SEQ ID NO: 25), or a homologue thereof havingat least 70% identity thereto. P7053PC00 In some embodiments of the present disclosure, the at least one mutation results in atruncated PtaA comprising at the most 915 consecutive amino acids of PtaA of SEQ IDNO: 26, or a homologue thereof having at least 70% identity thereto. In some embodiments of the present disclosure, the nucleic acids encoding PtaA (SEQ ID NO: 25); AzaA (SEQ ID NO: 30); or NigA (SEQ ID NO: 35), or a homologue thereof having at least 70% identity thereto, comprise a premature STOP codon. In some embodiments of the present disclosure, the nucleic acid encoding PtaA (SEQ ID NO: 25) comprises a premature STOP codon. In some embodiments of the present disclosure, the at least one mutation of the nucleic acid encoding PtaA (SEQ ID NO: 25) comprises or consists of a premature STOP codon at position 916 as set forth in SEQ ID NO: 28. In some embodiments of the present disclosure, the nucleic acid encoding AzaA (SEQID NO: 30) comprises a premature STOP codon at position 78 as set forth in SEQ IDNO: 33. In some embodiments of the present disclosure, the nucleic acid encoding NigA (SEQ ID NO: 35) comprises a premature STOP codon at position 1264 as set forth in SEQ ID NO: 38. In some embodiments of the present disclosure, the at least one mutation of thenucleic acids encoding PtaA (SEQ ID NO: 25) or AzaA (SEQ ID NO: 30), orhomologues thereof having at least 70% identity thereto, comprises or consists of apremature STOP codon. In some embodiments of the present disclosure, the at least one mutation of thenucleic acids encoding PtaA (SEQ ID NO: 25) or nigA (SEQ ID NO: 35), orhomologues thereof having at least 70% identity thereto, comprises or consists of apremature STOP codon. In some embodiments of the present disclosure, the at least one mutation of thenucleic acids encoding AzaA (SEQ ID NO: 30) or NigA (SEQ ID NO: 35), or P7053PC00homologues thereof having at least 70% identity thereto, comprises or consists of apremature STOP codon. In some embodiments of the present disclosure, the cell comprises a constitutivepromoter, upstream of the nucleic acid encoding SplA (SEQ ID NO: 41). Said promoterregulates transcription from said nucleic acid. In some embodiments of the present disclosure, the cell comprises a constitutivepromoter, such as KasOp constitutive promoter of SEQ ID NO: 40 or a homologuethereof having at least 70% identity thereto, upstream of the nucleic acid encodingSplA (SEQ ID NO: 41). Said promoter regulates transcription from said nucleic acid.In some embodiments of the present disclosure, said at least one mutation results in reduced biosynthesis of azalomycin, wherein the cell has reduced activity of AzaA (SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto;and wherein the cell produces alligamycin A with a 1.5-fold increased titre compared toa reference cell or more, such as a 1.8-fold increased titre or more. In some embodiments of the present disclosure, said at least one mutation results in reduced biosynthesis of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA (SEQ IDNO: 31) or a functional variant thereof having at least 60% identity thereto; and, ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQ ID NO:36) or a functional variant thereof having at least 60% identity thereto; andthe cell produces alligamycin A with a 2-fold increased titre compared to a referencecell or more, such as a 2.5-increased titre or more, such as a 2.7-increased titre or more. In some embodiments of the present disclosure, said at least one mutation results in reduced biosynthesis of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA (SEQ IDNO: 31) or a functional variant thereof having at least 60% identity thereto; and,ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQ ID NO:36) or a functional variant thereof having at least 60% identity thereto; and P7053PC00 iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA (SEQ IDNO: 26) or a functional variant thereof having at least 60% identity thereto, andwherein the cell produces alligamycin A with a 2-fold increased titre compared to areference cell or more, such as a 3-fold increased titre or more, such as a 4-fold increased titre or more, such as a 4.5-fold increased titre or more. In some embodiments of the present disclosure, the cell has at least one mutation resulting in reduced biosynthesis of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA (SEQ IDNO: 31) or a functional variant thereof having at least 60% identity thereto; and, ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQ ID NO:36) or a functional variant thereof having at least 60% identity thereto; and iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA (SEQ IDNO: 26) or a functional variant thereof having at least 60% identity thereto, and wherein the cell comprises a constitutive promoter, such as KasOp constitutive promoter of SEQ ID NO: 40, upstream of the nucleic acid encoding SplA (SEQ ID NO: 41), andthe cell produces alligamycin A with a 2-fold increased titre compared to a referencecell or more, such as a 3-fold increased titre or more, such as a 4-fold increased titre or more, such as a 5-fold increased titre or more, such as a 6-fold increased titre or more, such as a 7-fold increased titre or more, such as a 7.3-fold increased titre. Said promoter regulates transcription from said nucleic acid. In some embodiments of the present disclosure, the cell has at least one mutation resulting in reduced biosynthesis of: azalomycin, wherein; i) the cell has reduced activity of AzaA (SEQ ID NO: 31) or a functionalvariant thereof having at least 60% identity thereto; and ii) wherein the nucleic acid encoding NigA (SEQ ID NO: 36) comprises apremature STOP codon,and the cell produces alligamycin A with a 1.2-fold increased titre compared to areference cell or more, such as a 1.5-fold increased titre or more, such as a 1.8-fold increased titre or more. P7053PC00 In some embodiments of the present disclosure, the cell has at least one mutation resulting in reduced biosynthesis of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; and wherein the nucleic acid encoding AzaA (SEQ ID NO: 30) comprises a premature STOP codon at position 78 as set forthin SEQ ID NO: 33; and ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; wherein the nucleic acid encoding NigA (SEQ ID NO: 35) comprises a premature STOP codon at position 1264 as set forth in SEQ ID NO: 38,and the cell produces alligamycin A with a 1.5-fold increased titre compared to areference cell or more, such as a 2-fold increased titre or more, such as a 2.7-fold increased titre or more. In some embodiments of the present disclosure, the cell has at least one mutation resulting in reduced biosynthesis of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; and wherein the nucleic acid encoding AzaA (SEQ ID NO: 30) comprises a premature STOP codon at position 78 as set forthin SEQ ID NO: 33; and ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; wherein the nucleic acid encoding NigA (SEQ ID NO: 35) comprises a premature STOP codon at position 1264 as set forth in SEQ ID NO: 38, and iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto; wherein at least one mutation of the nucleic acid encoding PtaA (SEQ ID NO: 25) comprises or consists of a premature STOP codon at position 916 as set forth in SEQ ID NO: 28, P7053PC00and the cell produces alligamycin A with a 2-fold increased titre compared to areference cell or more, such as a 3-fold increased titre or more, such as a 4-fold increased titre or more, such as a 4.5-fold increased titre or more. In some embodiments of the present disclosure, the cell has at least one mutation resulting in reduced biosynthesis of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; and wherein the nucleic acid encoding AzaA (SEQ ID NO: 30) comprises a premature STOP codon at position 78 as set forthin SEQ ID NO: 33; and ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; wherein the nucleic acid encoding NigA (SEQ ID NO: 35) comprises a premature STOP codon at position 1264 as set forth in SEQ ID NO: 38, and iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto; wherein at least one mutation of the nucleic acid encoding PtaA (SEQ ID NO: 25) comprises or consists of a premature STOP codon at position 916 as set forth in SEQ ID NO: 28, wherein the cell comprises a constitutive promoter, such as KasOp constitutive promoter of SEQ ID NO: 40, upstream of the nucleic acid encoding SplA (SEQ ID NO: 41), andwherein the cell produces alligamycin A with a 2-fold increased titre compared to areference cell or more, such as a 3-fold increased titre or more, such as a 4-fold increased titre or more, such as a 5-fold increased titre or more, such as a 6-fold increased titre or more, such as a 7-fold increased titre or more, such as a 7.3-fold increased titre. The constitutive promoter regulates transcription of the nucleic acid encoding SplA. In some embodiments of the present disclosure, the cell is S. iranensis. In some embodiments of the present disclosure, the cell is S. albus. P7053PC00The terms ‘S. albus’ and ‘S. albidoflavus’ as used herein can be used interchangeably,as they refer to the same microorganism (see Labeda et al., 2014). In someembodiments of the present disclosure, the cell is S. albidoflavus. In some embodiments of the present disclosure, the cell is S.lividans. In some embodiments of the present disclosure, the cell is S. coelicolor. In some embodiments of the present disclosure, the cell is capable of producing a titreof 5 mg / L or more of alligamycin A, such as 10 mg / L or more, such as 20 mg / L ormore, such as 30 mg / L or more, such as 40 mg / L or more, such as 50 mg / L or more, such as 60 mg / L or more, such as 70 mg / L or more, such as 80 mg / L or more, such as 90 mg / L or more, such as 100 mg / L or more of alligamycin A.In some embodiments of the present disclosure, the alligamycin A has formula (III): or is a salt or solvate thereof. In some embodiments of the present disclosure, R1is hydroxy. In some embodiments of the present disclosure, R2is hydroxy. In some embodiments of the present disclosure, R3is methoxy. P7053PC00 In some embodiments of the present disclosure, R4is hydroxy. In some embodiments of the present disclosure, R4is a C1-6alkyl. In some embodiments of the present disclosure, R4is methyl. In some embodiments of the present disclosure, R5is hydroxyl. In some embodiments of the present disclosure, R5is a C1-8alkyl. In some embodiments of the present disclosure, R5is halogen. In some embodiments of the present disclosure, R5is oxo. In some embodiments of the present disclosure, R5 is hydroxy. In some embodiments of the present disclosure, wherein R5 is methoxy. In some embodiments of the present disclosure, R5 has formula (II):

[0003] P7053PC00In some embodiments of the present disclosure, R1 is - hydroxy, R2 is hydroxy, R3 ismethoxy, R4 is hydroxy, R5 is and the compound has formula (III): (III)To ensure a reduced biosynthesis of azalomycin, nigericin and / or pteridic acids,methods known in the art can be employed. The genes encoding proteins involved inbiosynthesis of azalomycin, nigericin and / or pteridic acids, respectively, may be deletedor partly deleted in order to ensure reduced biosynthesis of azalomycin, nigericinand / or pteridic acids, respectively. Alternatively, the gene may be mutated so that the protein, such as the enzyme, encoded by the gene and involved in the biosynthesis ofazalomycin, nigericin and / or pteridic acids is expressed but lacks activity, e.g. bymutation of the catalytical site of the enzyme. Alternatively, translation of mRNA to an active protein may be prevented by methods such as silencing RNA or siRNA.Alternatively, the Streptomyces cell may be incubated in a medium comprising aninhibitor which inhibits activity of the proteins involved in biosynthesis of azalomycin, P7053PC00nigericin and / or pteridic acids encoded by the nucleic acids. A compound inhibitingtranscription of the gene encoding the native proteins or enzymes involved inbiosynthesis of azalomycin, nigericin and / or pteridic acids may also be provided so thattranscription is inactivated when said compound is present. Inactivation of the genes encoding proteins involved in biosynthesis of azalomycin,nigericin and / or pteridic acids may thus be permanent or long-term, i.e. the modifiedStreptomyces cell does not exhibit activity of the native proteins involved inbiosynthesis of azalomycin, nigericin and / or pteridic acids in stable conditions, or it maybe transient, i.e. the modified Streptomyces cell may exhibit activity of the nativeproteins involved in biosynthesis of azalomycin, nigericin and / or pteridic acids forperiods of time, but this activity can be suppressed for other periods of time.Use of Streptomyces cellThe Streptomyces cell of the present disclosure as described herein, can be used forthe production of alligamycin A. In particular, the cell can be used for increasedproduction of alligamycin A compared to the production by a reference cell which doesnot include the modifications described herein. Method of increasing the production of alligamycin AIn one aspect, the disclosure is directed to a method of increasing the production ofalligamycin A of formula (I),

[0004] P7053PC00 or a derivative thereof, such as an acceptable derivative thereof, such as a salt or solvate thereof; wherein, R4 is independently selected from the group consisting of: hydrogen, hydroxy, alkyl and halogen; R1, R2 and R3 is selected from the group consisting of: hydrogen; oxo; hydroxy; and methoxy; R5 is selected from the group consisting of hydrogen; alkyl; halogen; oxo; hydroxy; methoxy; and formula (II): (II), in a Streptomyces cell, preferably an S. iranensis cell, the method comprising introducing in said cell at least one mutation resulting in reduced biosynthesis of one or more of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; P7053PC00 ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; and iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto.In some embodiments of the present disclosure, the cell, the alligamycin A and the atleast one mutation are as defined herein, preferably wherein the alligamycin A is asdefined herein. In some embodiments of the present disclosure, the mutation results in reduced biosynthesis of one or more of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; and iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto. In some embodiments of the present disclosure, the mutation is introduced in thecoding sequence or in the promoter sequence controlling transcription of ptaA (SEQ IDNO: 25). In some embodiments of the present disclosure, the mutation is introduced in thecoding sequence or in the promoter sequence controlling transcription of azaA (SEQ IDNO: 30). In some embodiments of the present disclosure, the mutation is introduced in thecoding sequence or in the promoter sequence controlling transcription of nigA (SEQ IDNO: 35). P7053PC00 In some embodiments of the present disclosure, the cell produces an increased titer ofalligamycin A versus a reference cell, which does not comprise said at least onemutation resulting in reduced biosynthesis of one or more of azalomycin, nigericin and pteridic acids. In some embodiments of the present disclosure, the reduction of activity is partial or total.In some embodiments of the present disclosure, the synthesis of alligamycin A in saidStreptomyces cell is increased compared to a reference cell by at least 1.5-fold, suchas at least 1.8-fold, such as at least 2-fold, such as at least 3-fold, such as at least 4- fold, such as at least 4.5-fold, such as at least 5-fold, such as at least 6-fold, such as at least 7-fold, such as at least 7.3-fold, such as at least 8-fold, such as at least 9-fold, such as at least 10-fold.In some embodiments of the present disclosure, the synthesis of alligamycin A in saidStreptomyces cell is increased compared to a reference cell by at least 4.5-fold.In some embodiments of the present disclosure, the synthesis of alligamycin A in saidStreptomyces cell is increased compared to a reference cell by at least 7.3-fold.In some embodiments of the present disclosure, the at least one mutation results in reduced biosynthesis of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; and ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; and iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto. In some embodiments of the present disclosure, said at least one mutation is two mutations resulting in reduced biosynthesis of: P7053PC00 i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; and ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto. In some embodiments of the present disclosure, said at least one mutation is two mutations resulting in reduced biosynthesis of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; and ii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto. In some embodiments of the present disclosure, said at least one mutation is two mutations resulting in reduced biosynthesis of: i) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; and ii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto. In some embodiments of the present disclosure, the reduction of activity of AzaA isachieved by mutating or deleting azaA (SEQ ID NO: 30), or a homologue thereofhaving at least 70% identity thereto. In some embodiments of the present disclosure, the mutated AzaA is a truncated AzaA comprising at the most 73 consecutive amino acids of AzaA of SEQ ID NO: 31, or a homologue thereof having at least 70% identity thereto. P7053PC00 In some embodiments of the present disclosure, the reduction of activity of NigA isachieved by mutating or deleting nigA (SEQ ID NO: 35), or a homologue thereof havingat least 70% identity thereto. In some embodiments of the present disclosure, the mutated NigA is a truncated nigA comprising at the most 1263 consecutive amino acids of NigA of SEQ ID NO: 36, or a homologue thereof having at least 70% identity thereto. In some embodiments of the present disclosure, the reduction of activity of PtaA isachieved by mutating or deleting ptaA (SEQ ID NO: 26), or a homologue thereof havingat least 70% identity thereto. In some embodiments of the present disclosure, the at least one mutation results in atruncated ptaA comprising at the most 915 consecutive amino acids of PtaA of SEQ IDNO: 26, or a homologue thereof having at least 70% identity thereto. In some embodiments of the present disclosure, at least one of the nucleic acids encoding PtaA; AzaA; or NigA comprises a premature STOP codon. In some embodiments of the present disclosure, the nucleic acid encoding PtaA comprises a premature STOP codon. In some embodiments of the present disclosure, the nucleic acid encoding PtaA comprises a premature STOP codon at position 916 as set forth in SEQ ID NO: 28. In some embodiments of the present disclosure, the nucleic acid encoding AzaAcomprises a premature STOP codon at position 78 as set forth in SEQ ID NO: 33.In some embodiments of the present disclosure, the nucleic acid encoding NigA comprises a premature STOP codon at position 1264 as set forth in SEQ ID NO: 38. In some embodiments of the present disclosure, the nucleic acids encoding PtaA or AzaA comprise a premature STOP codon. P7053PC00 In some embodiments of the present disclosure, the nucleic acids encoding PtaA and NigA each comprise a premature STOP codon. In some embodiments of the present disclosure, the nucleic acids encoding AzaA and NigA each comprise a premature STOP codon. In some embodiments of the present disclosure, a constitutive promoter, has beenintroduced upstream of splA (SEQ ID NO: 41). Said promoter controls transcription ofsplA. In some embodiments of the present disclosure, a constitutive promoter, such asKasOp constitutive promoter of SEQ ID NO: 40, has been introduced upstream of splA.Said promoter controls transcription of splA. In some embodiments of the present disclosure, the cell is S. iranensis, S. albus, S. albidoflavus, S. lividans or S. coelicolor. In some embodiments of the present disclosure, the cell is S. iranensis, S. lividans or S. coelicolor. In some embodiments of the present disclosure, the cell is capable of producing a titreof 5 mg / L or more of alligamycin A, such as 10 mg / L or more, such as 20 mg / L ormore, such as 30 mg / L or more, such as 40 mg / L or more, such as 50 mg / L or more, such as 60 mg / L or more, such as 70 mg / L or more, such as 80 mg / L or more, such as 90 mg / L or more, such as 100 mg / L or more of alligamycin A.Method of modifying a Streptomyces cell to increase the Alligamycin A productionIn one aspect, the disclosure is directed to a method of modifying a Streptomycescell to increase the alligamycin A production in said Streptomyces cell, said methodcomprising the steps of: i) providing a Streptomyces cell capable of synthesising alligamycin A,ii) introducing in said cell at least one mutation resulting in reducedbiosynthesis of one or more of: P7053PC00 (a) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; (b) nigericin, preferably wherein the cell has reduced activity of NigA(SEQ ID NO: 36) or a functional variant thereof having at least 60% identity thereto; and (c) pteridic acids, preferably wherein the cell has reduced activity ofPtaA (SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto iii) incubating said Streptomyces cell in a medium,thereby obtaining said cell capable of producing alligamycin A with an increased titrecompared to a reference cell, which does not comprise said at least one mutation resulting in reduced biosynthesis of one or more of azalomycin, nigericin and pteridic acids.In some embodiments of the present disclosure, the Streptomyces cell, the at least onemutation, the reference cell, the alligamycin A and the increased titre are as definedherein elsewhere.In some embodiments of the present disclosure, the method comprises providing theStreptomyces cell of any of the preceding items, and culturing said Streptomyces cell ina culture medium, preferably wherein the alligamycin A is produced with a titre of 5mg / L or more, such as 10 mg / L or more, such as 20 mg / L or more, such as 30 mg / L or more, such as 40 mg / L or more, such as 50 mg / L or more, such as 60 mg / L or more, such as 70 mg / L or more, such as 80 mg / L or more, such as 90 mg / L or more, such as 100 mg / L or more.The skilled person will know how to detect whether alligamycin A is actually producedby the cell and quantifying the amount of alligamycin A produced. For example, theprocedure described in Example 6 can be followed: the culture medium can be submitted to ethyl acetate extraction followed by sonication and drying, following which the dried sample can be analysed by HR-LC-MS as is known in the art. P7053PC00In some embodiments of the present disclosure, the method further comprises the stepof recovering the alligamycin A from the culture medium. For example, ethyl acetateextraction followed by sonication can be employed, as described in Example 6. In some embodiments of the present disclosure, the method further comprises the stepof purifying the alligamycin A from the culture medium.In some embodiments of the present disclosure, alligamycin A of formula (I), or a derivative thereof, such as an acceptable derivative thereof, such as a salt or solvate thereof; wherein, R4 is independently selected from the group consisting of: hydrogen, hydroxy, alkyl and halogen; R1, R2 and R3 is selected from the group consisting of: hydrogen; oxo; hydroxy; and methoxy; R5is selected from the group consisting of hydrogen; alkyl; halogen; oxo; hydroxy; methoxy; and formula (II): P7053PC00is obtainable by the methods described herein.Nucleic acid constructs for modifying a Streptomyces cell to increase the alligamycin AproductionIn one aspect, the disclosure is directed to a nucleic acid construct for modifying aStreptomyces cell, comprising one or more nucleic acids comprising at least one mutation resulting in reduced biosynthesis of one of more of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; and iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto, when said nucleic acids are introduced in said cell. The cell may be any of the cells described herein, in particular in the section “TheStreptomyces cells of the present disclosure” herein above.In some embodiments of the present disclosure, said construct comprising at least one of: i) a polynucleotide encoding AzaA (SEQ ID NO: 31) or a functional variantthereof having at least 60% identity thereto, capable of reducing the biosynthesis of azalomycin, and / or ii) a polynucleotide encoding NigA (SEQ ID NO: 36) or a functional variantthereof having at least 60% identity thereto, capable of reducing the biosynthesis of nigericin, and / or iii) a polynucleotide encoding PtaA (SEQ ID NO: 26) or a functional variantthereof having at least 60% identity thereto, capable of reducing the biosynthesis of pteridic acids, wherein optionally the at least one polynucleotide is under the control of a promoter. P7053PC00 In some embodiments of the present disclosure, the nucleic acid construct comprises at least one polynucleotide for reducing the activity of: i) AzaA (SEQ ID NO: 31) or a functional variant thereof having at least60% identity thereto; and / or ii) NigA (SEQ ID NO: 36) or a functional variant thereof having at least60% identity thereto, and / or, wherein optionally the at least one polynucleotide is under the control of a promoter. In some embodiments of the present disclosure, the nucleic acid construct comprises at least one polynucleotide for reducing the activity of: i) AzaA (SEQ ID NO: 31) or a functional variant thereof having at least60% identity thereto; and / or ii) PtaA (SEQ ID NO: 26) or a functional variant thereof having at least60% identity thereto; wherein optionally the at least one polynucleotide is under the control of a promoter. In some embodiments of the present disclosure, the nucleic acid construct comprises at least one polynucleotide for reducing the activity of: i) NigA (SEQ ID NO: 36) or a functional variant thereof having at least60% identity thereto, and / or, ii) PtaA (SEQ ID NO: 26) or a functional variant thereof having at least60% identity thereto; wherein optionally the at least one polynucleotide is under the control of a promoter.In some embodiments of the present disclosure, said construct comprising all of:i) a polynucleotide encoding AzaA (SEQ ID NO: 31) or a functional variantthereof having at least 60% identity thereto, capable of reducing the biosynthesis of azalomycin, and / or ii) a polynucleotide encoding NigA (SEQ ID NO: 36) or a functional variantthereof having at least 60% identity thereto, capable of reducing the biosynthesis of nigericin, and / or iii) a polynucleotide encoding PtaA (SEQ ID NO: 26) or a functional variantthereof having at least 60% identity thereto, capable of reducing the biosynthesis of pteridic acids, wherein optionally the at least one polynucleotide is under the control of a promoter. P7053PC00 The promoter may be any of the promoters described herein, in particular a KasOP promoter (SEQ ID NO: 40) or a homologue thereof having at least 70% identity thereto. The compounds disclosed herein (alligamycin A)Alligamycin A is a compound comprising a spiro-fused ring; and a beta-lactone ring, ora derivative thereof, and can be used to prevent or treat infections caused bymicroorganisms in animals and / or plants and methods to disinfect a surface.The compound referred to as “alligamycin A” has formula (I): or is a derivative thereof, such as an acceptable derivative thereof, such as a salt or solvate thereof, such as an acceptable salt or an acceptable solvate thereof; wherein, R4is independently selected from the group consisting of: hydrogen, hydroxy, alkyl and halogen; R1, R2and R3is selected from the group consisting of: hydrogen; oxo; hydroxy; and methoxy; R5is selected from the group consisting of hydrogen; alkyl; halogen; oxo; hydroxy; methoxy; and formula (IV): P7053PC00 In some embodiments, the compound referred to as “alligamycin A " has formula (II): or is a derivative thereof, such as an acceptable derivative thereof, such as a salt or solvate thereof, such as an acceptable salt or an acceptable solvate thereof. In some embodiments, R1 is hydroxy. In some embodiments, R2 is hydroxy. In some embodiments, R3 is methoxy. In some embodiments, R4 is hydroxy. In some embodiments, R4 is a C1-6 alkyl. In some embodiments of the present disclosure, R4 is methyl. P7053PC00 In some embodiments, R5is hydroxy. In some embodiments, R5is a C1-8alkyl.In some embodiments, R5is halogen. In some embodiments, R5is oxo. In some embodiments, R5is hydroxy. In some embodiments, R5is methoxy. In some embodiments, R5has formula (IV): In some embodiments, R1 is - hydroxy, R2 is hydroxy, R3 is methoxy, R4 is hydroxy, R5has formula (IV): and the compound referred to as “alligamycin A " has formula (III):

[0005] P7053PC00 Effective concentration of the compoundsCompounds of formula (I), and in particular alligamycin A, comprising a spiro-fusedring, and a beta-lactone ring, are useful as antimicrobial agent, as a disinfectant, as anantifungal agent, as an antibiotic, or as a bactericidal agent. Thus, said compounds can be also useful to disinfect a surface.Such compounds, in particular alligamycin A (a compound of formula (III)), can be usedas an alternative to other antimicrobial agents, such as amphotericin B. In particular, said compounds have comparable or lower minimal inhibition concentration than amphotericin B toward some fungi. Compounds of formula (I) comprising a spiro-fused ring, and a beta-lactone ring, inparticular alligamycin A (a compound of formula (III)), can be used as an antibiotic forGram-positive bacteria, such as Streptococcus aureus. Thus said compounds areuseful in the prophylaxis and / or treatment of an infection or a condition, wherein said infection or condition is caused by a microorganism, in particular an antibiotic-resistant Gram-positive bacteria.In some embodiments, alligamycin A or a derivative thereof is administered between0.05 and 1 mg of the compound / kg of a recipient, between 0.05 and 2 mg / kg, between P7053PC00 0.05 and 3 mg / kg, between 0.05 and 4 mg / kg, between 0.05 and 5 mg / kg, between 0.05 and 6 mg / kg, between 0.05 and 7 mg / kg, between 0.05 and 8 mg / kg, between 0.05 and 9 mg / kg, between 0.05 and 10 mg / kg, between 0.06 and 1 mg / kg, between 0.06 and 2 mg / kg, between 0.06 and 3 mg / kg, between 0.06 and 4 mg / kg, between 0.06 and 5 mg / kg, between 0.06 and 6 mg / kg, between 0.06 and 7 mg / kg, between 0.06 and 8 mg / kg, between 0.06 and 9 mg / kg, between 0.06 and 10 mg / kg, between 0.06 and mg / kg, between 0.07 and 1 mg / kg, between 0.07 and 2 mg / kg, between 0.07 and 3 mg / kg, between 0.07 and 4 mg / kg, between 0.07 and 5 mg / kg, between 0.07 and 6 mg / kg, between 0.07 and 7 mg / kg, between 0.07 and 8 mg / kg, between 0.07 and 9 mg / kg, between 0.07 and 10 mg / kg, between 0.08 and 1 mg / kg, between 0.08 and 2 mg / kg, between 0.08 and 3 mg / kg, between 0.08 and 4 mg / kg, between 0.08 and 5 mg / kg, between 0.08 and 6 mg / kg, between 0.08 and 7 mg / kg, between 0.08 and 8 mg / kg, between 0.08 and 9 mg / kg, between 0.08 and 10 mg / kg, between 0.09 and 1 mg / kg, between 0.09 and 2 mg / kg, between 0.09 and 3 mg / kg, between 0.09 and 4 mg / kg, between 0.09 and 5 mg / kg, between 0.09 and 6 mg / kg, between 0.09 and 7 mg / kg, between 0.09 and 8 mg / kg, between 0.09 and 9 mg / kg, between 0.09 and 10 mg / kg, between 0.1 and 1 mg / kg, between 0.1 and 2 mg / kg, between 0.1 and 3 mg / kg, between 0.1 and 4 mg / kg, between 0.1 and 5 mg / kg, between 0.1 and 6 mg / kg, between 0.1 and 7 mg / kg, between 0.1 and 8 mg / kg, between 0.1 and 9 mg / kg, between 0.1 and 10 mg / kg, between 0.2 and 1 mg / kg, between 0.2 and 2 mg / kg, between 0.2 and 3 mg / kg, between 0.2 and 4 mg / kg, between 0.2 and 5 mg / kg, between 0.2 and 6 mg / kg, between 0.2 and 7 mg / kg, between 0.2 and 8 mg / kg, between 0.2 and 9 mg / kg, between 0.2 and 10 mg / kg, between 0.3 and 1 mg / kg, between 0.3 and 2 mg / kg, between 0.3 and 3 mg / kg, between 0.3 and 4 mg / kg, between 0.3 and 5 mg / kg, between 0.3 and 6 mg / kg, between 0.3 and 7 mg / kg, between 0.3 and 8 mg / kg, between 0.3 and 9 mg / kg, between 0.3 and 10 mg / kg, between 0.4 and 1 mg / kg, between 0.4 and 2 mg / kg, between 0.4 and 3 mg / kg, between 0.4 and 4 mg / kg, between 0.4 and 5 mg / kg, between 0.4 and 6 mg / kg, between 0.4 and 7 mg / kg, between 0.4 and 8 mg / kg, between 0.4 and 9 mg / kg, between 0.4 and 10 mg / kg, between 0.5 and 1 mg / kg, between 0.5 and 2 mg / kg, between 0.5 and 3 mg / kg, between 0.5 and 4 mg / kg, between 0.5 and 5 mg / kg, between 0.5 and 6 mg / kg, between 0.5 and 7 mg / kg, between 0.5 and 8 mg / kg, between 0.5 and 9 mg / kg, between 0.5 and 10 mg of the compound / kg of a recipient,wherein the recipient is an animal, an agricultural product, and / or the soil. P7053PC00In some embodiments, alligamycin A or a derivative thereof is administered between0.5 and 1 mg of the compound / kg of a recipient, wherein the recipient is an animal, an agricultural product, and / or the soil.In some embodiments, the minimal inhibition concentration of alligamycin A against themicroorganism causing the condition is lower than 100 μg / mL, lower than 90 μg / mL, lower than 80 μg / mL, lower than 70 μg / mL, lower than 60 μg / mL, lower than 50 μg / mL, lower than 40 μg / mL, lower than 30 μg / mL, lower than 20 μg / mL, lower than 15 μg / mL, lower than 10 μg / mL, lower than 5 μg / mL, lower than 3 μg / mL, lower than 1 μg / mL.In some embodiments, the minimal inhibition concentration of alligamycin A against themicroorganism causing the condition is at least 2-fold, at least 3-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 60-fold, at least 70-fold, at least 80-fold, at least 90-fold, at least 100-fold, at least 110- fold, at least 120-fold, at least 130-fold, at least 140-fold, at least 150-fold, at least 160- fold, at least 170-fold, at least 180-fold, at least 190-fold, at least 200-fold lower than the minimal inhibition concentration of Amphotericin B towards a microorganism of the same species, preferably towards the same microorganism. Minimal inhibition concentration can be determined by following the European Committee on Antimicrobial Suscepitity Testing (EUCAST) standard method (EUCAST: MIC and zone distributions and ECOFFs), which is available at https: / / www.eucast.org / mic_distributions_and_ecoffs / .In some embodiments, the alligamycin A is a compound of formula (I) as describedherein comprising a spiro-fused ring and a beta-lactone ring or a derivative thereof. Insome embodiments, the alligamycin A is the compound of formula (II), preferably thecompound of formula (III). Microorganisms susceptible to alligamycin A Beta-lactones of formula (I) as described herein comprising a spiro-fused ring and one beta-lactone ring and derivatives thereof, and in particular an unprecedented macrolidenamed alligamycin A, are useful as antimicrobial agents. P7053PC00 Thus, said compounds are useful in the prophylaxis and / or treatment of an infection or a condition, wherein said infection or condition is caused by a microorganism, preferably wherein said microorganism is selected from the group consisting of: a Gram-positive bacterium and a fungus, such as an Acomycota fungus. In some embodiments, the fungus belongs to the class Eurotiomycetes, Dothideomycetes, and / or Leotiomycetes. In some embodiments, the fungus belongs to the class Eurotiomycetes and / or Dothideomycetes. In some embodiments, the fungus belongs to the class Eurotiomycetes and / or Leotiomycetes. In some embodiments, the fungus belongs to the class Dothideomycetes, and / or Leotiomycetes. In some embodiments, the fungus belongs to the class Eurotiomycetes. In some embodiments, the fungus belongs to the class Dothideomycetes. In some embodiments, the fungus belongs to the class Leotiomycetes. In some embodiments, the fungus belongs to the order Eurotiales, Pleosporales, Hypocreales and / or Helotiales. In some embodiments, the fungus belongs to the order Eurotiales and / or Pleosporales. In some embodiments, the fungus belongs to the order Eurotiales and / or Helotiales. In some embodiments, fungus belongs to the order Pleosporales and / or Helotiales. In some embodiments, the fungus belongs to the orderEurotiales and / or Hypocreales. In some embodiments, the fungus belongs to the orderHypocreales and / or Pleosporales. In some embodiments, the fungus belongs to theorder Hypocreales and / or Helotiales. In some embodiments, the fungus belongs to the order Eurotiales. In some embodiments, fungus belongs to the order Pleosporales. In some embodiments,fungus belongs to the order Helotiales. In some embodiments, the fungus belongs tothe order Hypocreales. In some embodiments, the fungus belongs to the family Trichocomaceae, Pleosporaceae, Nectriaceae and / or Sclerotiniaceae. In some embodiments, the fungus belongs to the family Trichocomaceae and / or Pleosporaceae. In some embodiments, the fungus belongs to the family Trichocomaceae and / or Sclerotiniaceae. In some embodiments, the fungus belongs to the family Pleosporaceae, and / or Sclerotiniaceae. In some embodiments, the fungus belongs to the family Trichocomaceae and / orNectriaceae. In some embodiments, the fungus belongs to the family Nectriaceae P7053PC00and / or Pleosporaceae. In some embodiments, the fungus belongs to the familyNectriaceae and / or Sclerotiniaceae.In some embodiments, the fungus belongs to the family Trichocomaceae. In some embodiments, the fungus belongs to the family Pleosporaceae. In some embodiments, the fungus belongs to the familySclerotiniaceae. In some embodiments, the fungus belongs to the family Nectriaceae.In some embodiments, the fungus belongs to the genus Aspergillus, Alternaria,Botrytis, Fusarium and / or Talaromyces. In some embodiments, the fungus belongs tothe genus Aspergillus and / or Alternaria. In some embodiments, the fungus belongs to the genus Aspergillus and / or Botrytis. In some embodiments, the fungus belongs to thegenus Alternaria, and / or Botrytis. In some embodiments, the fungus belongs to thegenus Aspergillus and / or Talaromyces. In some embodiments, the fungus belongs tothe genus Talaromyces and / or Botrytis. In some embodiments, the fungus belongs tothe genus Alternaria, and / or Talaromyces. In some embodiments, the fungus belongsto the genus Talaromyces, and / or Fusarium. In some embodiments, the fungusbelongs to the genus Aspergillus and / or Fusarium. In some embodiments, the fungusbelongs to the genus Fusarium and / or Botrytis. In some embodiments, the fungusbelongs to the genus Alternaria, and / or Fusarium. In some embodiments, the fungusbelongs to the genus Aspergillus. In some embodiments, the fungus belongs to thegenus Alternaria. In some, the fungus belongs to the genus Botrytis. In someembodiments, the fungus belongs to the genus Talaromyces. In some embodiments,the fungus belongs to the genus Fusarium. In some embodiments, the Aspergillus is selected from the group consisting of: Aspergillus fumigatus; Aspergillus niger; Aspergillus flavus; Aspergillus nidulans;Aspergillus tubingensis, Aspergillus alliaceus; Aspergillus arachidicola; Aspergilluscarbonarius; Aspergillus clavatus; Aspergillus felis; Aspergillus flavipes; Aspergillusjaponicas; Aspergillus lentulus; Aspergillus minisclerotigens; Aspergillus mottae;Aspergillus nomius; Aspergillus parasiticus; Aspergillus ochraceus; Aspergillus terreus;Aspergillus transmontanensi; Aspergillus sergii; Aspergillus steynii; Aspergillus sydowii;Aspergillus versicolor; Aspergillus viridinutans; Aspergillus welwitschiae; Aspergilluswesterdijkiae; Aspergillus (Neosartorya) fischeri; Aspergillus citrinoterreus;Aspergillus calidoustus; Aspergillus ustus; Aspergillus parasiticus; Aspergillusluchuensis; Aspergillus brasiliensis; Aspergillus latus; Aspergillus spinulosporus;Aspergillus udagawae; and Aspergillus (Neosartorya) udagawae. P7053PC00In some embodiments, the Aspergillus belongs to Section Circumdati; Section Flavi;Section Usti; Section Nidulantes; Section Fumigati; or Section Nigri.In some embodiments, the Aspergillus is selected from the group consisting of: Aspergillus fumigatus; Aspergillus niger; Aspergillus flavus; Aspergillus nidulans; and Aspergillus tubingensis.In some embodiments, the Alternaria is selected from the group consisting of:Alternaria solani; Alternaria alternate; Alternaria arborescens; Alternaria arbusti;Alternaria blumeae; Alternaria brassicae; Alternaria brassicicola; Alternaria burnsii; Alternaria carotiincultae; Alternaria carthami; Alternaria celosiae; Alternaria cinerariae; Alternaria citri; Alternaria conjuncta; Alternaria cucumerina; Alternaria dauci; Alternaria dianthi; Alternaria dianthicola; Alternaria eichhorniae; Alternaria euphorbiicola; Alternaria gaisen; Alternaria helianthi; Alternaria helianthicola; Alternaria hungarica; Alternaria infectoria; Alternaria japonica; Alternaria limicola; Alternaria linicola; Alternaria longipes; Alternaria mali; Alternaria molesta; Alternaria panax; Alternaria perpunctulata; Alternaria petroselini; Alternaria porri; Alternaria quercicola; Alternaria radicina; Alternaria raphani; Alternaria saponariae; Alternaria selini; Alternaria senecionis; Alternaria smyrnii; Alternaria tenuissima; Alternaria triticina; Alternaria ventricosa; Alternaria zinnia.In some embodiments, the Alternaria is Alternaria solani.In some embodiments, the Botrytis is selected from the group consisting of: Botrytiscinerea; Botrytis aclada; Botrytis allii; Botrytis allii-fistulosi; Botrytis ampelophila; Botrytis anacardii; Botrytis anthophila; Botrytis argillacea; Botrytis arisaemae; Botrytisartocarpi; Botrytis bifurcate; Botrytis bryi; Botrytis capsularum; Botrytis carnea; Botrytiscaroliniana; Botrytis carthami; Botrytis cercosporaecola; Botrytis cercosporicola; Botrytis citricola; Botrytis citrina; Botrytis convallariae; Botrytis croci; Botrytis cryptomeriae; Botrytis densa; Botrytis diospyri; Botrytis elliptica; Botrytis fabae; Botrytis fabiopsis; Botrytis galanthina; Botrytis gladioli; Botrytis gossypina; Botrytis hormini; Botrytis hyacinthi; Botrytis isabellina; Botrytis latebricola; Botrytis liliorum; Botrytis limacidae; Botrytis luteobrunnea; Botrytis lutescens; Botrytis mali; Botrytis monilioides; Botrytis necans; Botrytis paeoniae; Botrytis peronosporoides; Botrytis pistiae; Botrytis P7053PC00 platensis; Botrytis pruinosa; Botrytis pseudocinerea; Botrytis pyramidalis; Botrytis rivoltae; Botrytis rosea; Botrytis rubescens; Botrytis rudiculoides; Botrytis sekimotoi; Botrytis septospora; Botrytis setuligera; Botrytis sinoallii; Botrytis sonchina; Botrytis splendida; Botrytis squamosa; Botrytis taxi; Botrytis terrestris; Botrytis tracheiphila;Botrytis trifolii; Botrytis tulipae; Botrytis viciae-hirsutae; and Botrytis yuae.In some embodiments, the Botrytis is Botrytis cinerea.In some embodiments, the Talaromyces is selected from the group consisting of:Talaromyces purpureogenes; and Talaromyces marneffei.In some embodiments, the Talaromyces belongs to Section Bacillispori; Section Helici;Section Islandici; Section Purpurei; Section Subinflati; Section Talaromyces; or SectionTrachyspermi. In some embodiments, the Talaromyces is Talaromycespurpureogenes. In some embodiments, the Talaromyces is Talaromyces marnffei.In some embodiments, the Fusarium is selected from the group consisting of: Fusariummusae, and Fusarium annulatum. In some embodiments, the Fusarium is Fusariummusae. In some embodiments, the Fusarium is Fusarium annulatum.In some embodiments, the microorganism is a bacterium, preferably a Gram-positive bacterium. In some embodiments, the Gram-positive bacterium belongs to the genus selectedfrom the group consisting of: Staphylococcus; Clostridium; and Streptococcus.In some embodiments, the Gram-positive bacterium belongs to the genus Staphylococcus. In some embodiments, the Staphylococcus is selected from the group consisting of:Staphylococcus aureus; Staphylococcus argenteus; Staphylococcusaureus; Staphylococcus schweitzeri; Staphylococcus simiae; Staphylococcusauricularis; Staphylococcus carnosus; Staphylococcus condiment; Staphylococcusdebuckii; Staphylococcus massiliensis; Staphylococcus piscifermentans;Staphylococcus simulans; Staphylococcus capitis; Staphylococcus caprae;Staphylococcus epidermidis; Staphylococcus saccharolyticus; Staphylococcus P7053PC00borealis; Staphylococcus devriesei; Staphylococcus haemolyticus; Staphylococcushominis; Staphylococcus agnetis; Staphylococcus chromogenes; Staphylococcuscornubiensis; Staphylococcus felis; Staphylococcus delphini; Staphylococcushyicus; Staphylococcus intermedius; Staphylococcus lutrae; Staphylococcusmicroti; Staphylococcus muscae; Staphylococcus pseudintermedius; Staphylococcusrostri; Staphylococcus schleiferi; Staphylococcus lugdunensis; Staphylococcusarlettae; Staphylococcus caeli; Staphylococcus cohnii; Staphylococcus equorum;Staphylococcus gallinarum; Staphylococcus kloosii; Staphylococcus leei;Staphylococcus nepalensis; Staphylococcus saprophyticus; Staphylococcus succinus;Staphylococcus xylosus; Staphylococcus fleurettii; Staphylococcuslentus; Staphylococcus sciuri; Staphylococcus stepanovicii; Staphylococcus vitulinus;Staphylococcus simulans; Staphylococcus pasteuri; and Staphylococcus warneri.In some embodiments, the Staphylococcus is selected from the group consisting of:Staphylococcus aureus; Staphylococcus argenteus; Staphylococcusaureus; Staphylococcus schweitzeri; and Staphylococcus simiae.In some embodiments, the Staphylococcus is Staphylococcus aureus.In some embodiments, the infection or condition caused by the microorganism is aspergillosis.In some embodiments, the alligamycin A of formula (I) as described herein comprisinga spiro-fused ring and a beta-lactone ring or a derivative thereof can be used againstsuch infections. In some embodiments, the alligamycin A is the compound of formula(II), preferably the compound of formula (III). Animals and agricultural products affected by the infection or the conditionThe compounds of formula (I) as described herein, in particular alligamycin A, areuseful for the prophylaxis and / or treatment of an infection or a condition caused by microorganisms that are capable of infecting animals and / or plants. Thus, in some embodiments, the infection or the condition caused by the microorganism affects an animal or an agricultural product. P7053PC00 In some embodiments, the compound is administered to an animal. In some embodiments, the animal is a mammal. In some embodiments, the animal is selected from the group consisting of: a human; a cat; a dog; a cow, a pig; a horse; a sheep; agoat; a llama; a mouse; a rat; a monkey; a porpoise; a fish; an insect, such as a bee; areptile; and / or a marine invertebrate. In some embodiments, the animal is a human. In some embodiments, the condition caused by the microorganism affects an agricultural product. In some embodiments, the compound is applied to an agricultural product. In some embodiments, the agricultural product is a plant or a product derived from a plant. The plant contacted by any one of said compounds comprising a spiro-fused ring, and a beta-lactone ring, in particular compounds of formula (II) or (III) such as alligamycinA, can belong to any variety of plant. The present compounds and methods can beapplied to any variety of plant. In some embodiments, the agricultural product is selected from the group consisting of: almond; anemone; apple; apricot; asparagus; avocado; azalea; banana; beet; bell pepper; blueberry; broccoli; cabbage; caneberries; canola; carrot; cereal; coffee; cherries; chickpea; cole crops; cocoa; corn; cotton; cucumber; date palm; Dianthus; Dracena; eggplant; figs; ginseng; garlic; gourd; grape; grapefruit; grapevine; horseradish; hot pepper; leek; legumes; lemon; lentil; lettuce; lime; mango; melon; nut;oil seed rape; onion; orange; palm oil; papaya; parsley; parsnip; pea; peach; peanut;pear; pineapple; pistachio; pomelo; potato; pumpkin; raisins; sesame seeds; squash; soybean; spice; strawberry; sunflower; sweet potato; tea; tobacco; tomato; tree nut; verbena; walnut; watermelon; wheat; yam; and zucchini.In some embodiments, the infection or a condition is caused by a fungus, such as afungus that belongs to the division Ascomycota, such as a fungus that belongs to the class Eurotiomycetes, Dothideomycetes, and / or Leotiomycetes, such as a fungus that belongs to the order Eurotiales, Pleosporales, or Helotiales, such as a fungus that belongs to the family Trichocomaceae, Pleosporaceae, and / or Sclerotiniaceae, such as a fungus belongs to the genus Aspergillus, Alternaria, and / or Botrytis. P7053PC00In some embodiments, the infection or a condition is caused by a fungus that belongsto the genus Aspergillus, preferably Aspergillus fumigatus; Aspergillus niger;Aspergillus flavus; Aspergillus nidulans; and Aspergillus tubingensis, and the animal isa human; a cat; a dog; a cow, a pig; a horse; a sheep; a goat; a llama; a mouse; a rat; a monkey; a porpoise; a fish; an insect, such as a bee; a reptile; and / or a marine invertebrate.In some embodiments, the infection or a condition is caused by a fungus that belongsto the genus Aspergillus, preferably Aspergillus fumigatus; Aspergillus niger;Aspergillus flavus; Aspergillus nidulans; and Aspergillus tubingensis, and theagricultural product is selected from the group consisting of: apricot; cereal; cocoa; coffee; corn; cotton; date palm; grape; maize; onions; palm oil; papaya; peanuts; pineapple; pistachio; sesame seeds; spices; strawberry; tomato; tree nut; and walnut.In some embodiments, the infection or a condition is caused by a fungus that belongsto the genus Talaromyces, preferably Talaromyces purpureogenes; and Talaromycesmarneffei, and the animal is a human; a cat; a dog; a cow, a pig; a horse; a sheep; a goat; a llama; a mouse; a rat; a monkey; a porpoise; a fish; an insect, such as a bee; a reptile; and / or a marine invertebrate.In some embodiments, the infection or a condition is caused by a fungus that belongsto the genus Talaromyces, preferably Talaromyces purpureogenes; and Talaromycesmarneffei, and the agricultural product is selected from the group consisting of: apricot;cereal; cocoa; coffee; corn; cotton; date palm; grape; maize; onions; palm oil; papaya; peanuts; pineapple; pistachio; sesame seeds; spices; strawberry; tomato; tree nut; and walnut.In some embodiments, the infection or a condition is caused by a fungus that belongsto the genus Alternaria, prefereably Alternaria solani, and the agricultural product is selected from the group consisting of: bell pepper; eggplant; hot pepper; potato; and tomato.In some embodiments, the infection or a condition is caused by a fungus that belongsto the genus Botrytis, preferably Botrytis cinerea, and the agricultural product isselected from the group consisting of: almond; anemone; apple; apricot; asparagus; avocado; beet; caneberries; canola; carrot; cherries; chickpea; grape; legumes; lentil; P7053PC00 lettuce; mango; maize; pea; peach; peanut; pear; pistachio; potato; strawberry; sunflower; sweet potato; tea; tobacco; tomato; and verbena.In some embodiments, the infection or a condition is caused by a Gram-positivebacterium, such as a Staphylococcus; Clostridium; and Streptococcus, preferably aStaphylococcus aureus, and the infected subject is an animal, such as a human; such as a cat; such as a dog; such as a cow, such as a pig; such as a horse; such as a sheep; such as a goat; such as a llama; such as a mouse; such as a rat; a monkey;such as a porpoise; such as a fish; such as an insect, such as a bee; such as a reptile;and / or such as a marine invertebrate. In some embodiments, the compound is a compound of formula (I) as described herein comprising a spiro-fused ring and a beta-lactone ring or a derivative thereof and can be administered to an animal or an agricultural product. In some embodiments, the compound is the compound of formula (II), preferably the compound of formula (III). In some embodiments, the compound is a compound of formula (I) comprising a spiro- fused ring and a beta-lactone ring or a derivative thereof and can be used in the prophylaxis and / or treatment of an infection or a condition caused by a microorganism, wherein the infection or a condition affects an animal or an agricultural product. In some embodiments, the compound is the compound of formula (II), preferably the compound of formula (III). Supplementing microorganism producing the compound The present compounds can be provided to or contacted with a plant as described herein using any method known by a person skilled in the art, such as irrigation, or such as seed-coating, or such as foliar spray. In some embodiments, said compounds of formula (I) as described herein comprising a spiro-fused ring, and a beta-lactonering, is alligamycin A, a compound of formula (III).Said compounds might be supplemented to the soil as one compound or as any combination of multiple compounds. P7053PC00 Said compounds disclosed above can be supplied to the soil in which the plant is grown as a pure compound, as a lysate of said cell producing the compound, by supplementation of said cells producing the compound, as part of said cultivation broth comprising the compound and / or cells producing the compound, as detailed herein. In some embodiments, the compound is supplied via supplementation of theStreptomyces cell producing the compound. In some embodiments, the Streptomycesis Streptomyces iranensis. Streptomyces albus, S. albidoflavus, Streptomycescoelicolor, Streptomyces lividans, Streptomyces halstedii, Streptomyces anulatus,Streptomyces albidoflavus, Streptomyces chartreusis and / or Streptomycesluteogriseus may also be employed. In particular, the Streptomyces cell may be any ofthe cells described herein above.In some embodiments, the Streptomyces cell producing the compound is supplied as aliquid spore solution and / or as dried solid spores at a concentration between 0.01 and 2x104cfu / cm2, between 0.01 and 5x104cfu / cm2, between 0.01 and 10x104cfu / cm2, between 0.01 and 50x104cfu / cm2, between 0.01 and 100x104cfu / cm2, between 0.01 and 200x104cfu / cm2, between 0.01 and 500x104cfu / cm2, between 0.01 and 1000x104cfu / cm2, between 0.1 and 2x104cfu / cm2, between 0.1 and 5x104cfu / cm2, between 0.1 and 10x104cfu / cm2, between 0.1 and 50x104cfu / cm2, between 0.1 and 100x104cfu / cm2, between 0.1 and 200x104cfu / cm2, between 0.1 and 500x104cfu / cm2, between 0.1 and 1000x104cfu / cm2, between 0.1 and 2x104cfu / cm2, between 0.1 and 5x104cfu / cm2, between 0.1 and 10x104cfu / cm2, between 0.1 and 50x104cfu / cm2, between0.1 and 100x104 cfu / cm2, between 0.1 and 200x104 cfu / cm2, between 0.1 and 500x104cfu / cm2, between 0.1 and 1000x104cfu / cm2, between 0.5 and 2x104cfu / cm2, between 0.5 and 5x104cfu / cm2, between 0.5 and 10x104cfu / cm2, between 0.5 and 50x104cfu / cm2, between 0.5 and 100x104cfu / cm2, between 0.5 and 200x104cfu / cm2, between 0.5 and 500x104cfu / cm2, between 0.5 and 1000x104cfu / cm2, between 1 and 2x104cfu / cm2, between 1 and 5x104cfu / cm2, between 1 and 10x104cfu / cm2, between 1 and 50x104cfu / cm2, between 1 and 100x104cfu / cm2, between 1 and 200x104cfu / cm2, between 1 and 500x104cfu / cm2, between 1 and 1000x104cfu / cm2, between 2 and 5x104cfu / cm2, between 2 and 10x104cfu / cm2, between 2 and 50x104cfu / cm2, between 2 and 100x104cfu / cm2, between 2 and 200x104cfu / cm2, between 2 and 500x104cfu / cm2, between 2 and 1000x104cfu / cm2. P7053PC00In some embodiments, the Streptomyces cell producing the compound is supplied as aliquid spore solution at a concentration between 0.001 and 2x109spores / mL, between 0.001 and 5x109spores / mL, between 0.001 and 10x109spores / mL, between 0.001 and 20x109spores / mL, between 0.001 and 30x109spores / mL, between 0.001 and 40x109spores / mL, between 0.001 and 50x109spores / mL, between 0.001 and 60x109spores / mL, between 0.001 and 70x109spores / mL, between 0.001 and 80x109spores / mL, between 0.001 and 90x109spores / mL, between 0.001 and 100x109spores / mL, between 0.015 and 2x109spores / mL, between 0.015 and 5x109spores / mL, between 0.015 and 10x109spores / mL, between 0.015 and 20x109spores / mL, between 0.015 and 30x109spores / mL, between 0.015 and 40x109spores / mL, between 0.015 and 50x109spores / mL, between 0.015 and 60x109spores / mL, between 0.015 and 70x109spores / mL, between 0.015 and 80x109spores / mL, between 0.015 and 90x109spores / mL, between 0.015 and 100x109spores / mL, between 0.01 and 2x109spores / mL, between 0.01 and 5x109spores / mL, between 0.01 and 10x109spores / mL, between 0.01 and 20x109spores / mL, between 0.01 and 30x109spores / mL, between 0.01 and 40x109spores / mL, between 0.01 and 50x109spores / mL, between 0.01 and 60x109spores / mL, between 0.01 and 70x109spores / mL, between 0.01 and 80x109spores / mL, between 0.01 and 90x109spores / mL, between 0.01 and 100x109spores / mL, between 0.5 and 2x109spores / mL, between 0.5 and 5x109spores / mL, between 0.5 and 10x109spores / mL, between 0.5 and 20x109spores / mL, between 0.5 and 30x109spores / mL, between 0.5 and 40x109spores / mL, between 0.5 and 50x109spores / mL, between 0.5 and 60x109spores / mL, between 0.5 and 70x109spores / mL, between 0.5 and 80x109spores / mL, between 0.5 and 90x109spores / mL, between 0.5 and 100x109spores / mL, between 1 and 2x109spores / mL, between 1 and 5x109spores / mL, between 1 and 10x109spores / mL, between 1 and 20x109spores / mL, between 1 and 30x109spores / mL, between 1 and 40x109spores / mL, between 1 and 50x109spores / mL, between 1 and 60x109spores / mL, between 1 and 70x109spores / mL, between 1 and 80x109spores / mL, between 1 and 90x109spores / mL, between 1 and 100x109spores / mL.In some embodiments, the Streptomyces cell producing the compound is supplied as aliquid spore solution at a concentration between 0.1 and 10 x109spores / mL, preferably 1.5x109spores / mL. In some embodiments, the liquid spore solution is supplied to the leaves of a plant. P7053PC00In some embodiments, the Streptomyces cell producing the compound is supplied asdried solid spores at a concentration between 0.1 and 150x109spores / mL, between 0.1 and 200x109spores / mL, between 0.1 and 10x109spores / mL, between 0.1 and 20x109spores / mL, between 0.1 and 30x109spores / mL, between 0.1 and 40x109spores / mL, between 0.1 and 50x109spores / mL, between 0.1 and 60x109spores / mL, between 0.1 and 70x109spores / mL, between 0.1 and 80x109spores / mL, between 0.1 and 90x109spores / mL, between 0.1 and 100x109spores / mL, between 1 and 150x109spores / mL, between 1 and 200x109spores / mL, between 1 and 10x109spores / mL, between 1 and 20x109spores / mL, between 1 and 30x109spores / mL, between 1 and 40x109spores / mL, between 1 and 50x109spores / mL, between 1 and 60x109spores / mL, between 1 and 70x109spores / mL, between 1 and 80x109spores / mL, between 1 and 90x109spores / mL, between 1 and 100x109spores / mL, between 10 and 150x109spores / mL, between 10 and 200x109spores / mL, between 10 and 10x109spores / mL, between 10 and 20x109spores / mL, between 10 and 30x109spores / mL, between 10 and 40x109spores / mL, between 10 and 50x109spores / mL, between 10 and 60x109 spores / mL, between 10 and 70x109spores / mL, between 10 and 80x109spores / mL, between 10 and 90x109spores / mL, between 10 and 100x109spores / mL, between 50 and 150x109spores / mL, between 50 and 200x109spores / mL, between 50 and 10x109spores / mL, between 50 and 20x109spores / mL, between 50 and 30x109spores / mL, between 50 and 40x109spores / mL, between 50 and 50x109spores / mL, between 50 and 60x109spores / mL, between 50 and 70x109spores / mL, between 50 and 80x109spores / mL, between 50 and 90x109spores / mL, between 50 and 100x109spores / mL, between 100 and 150x109spores / mL, between 100 and 200x109spores / mL, between 100 and 10x109spores / mL, between 100 and 20x109spores / mL, between 100 and 30x109spores / mL, between 100 and 40x109spores / mL, between 100 and 50x109spores / mL, between 100 and 60x109spores / mL, between 100 and 70x109spores / mL, between 100 and 80x109spores / mL, between 100 and 90x109spores / mL, between 100 and 100x109spores / mL.In some embodiments, the Streptomyces cell producing the compound is supplied asdried solid spores at a concentration between 50 and 200X109spores / mL, preferably 100X109spores / mL. In some embodiments, dried solid spores are supplemented into the soil. P7053PC00 Throughout this disclosure, it will be clear that the term “Streptomyces cell” may refer to a plurality of Streptomyces cells. Compositions and formulationsAlligamycin A and its derivatives as described herein, are useful as antimicrobial agent,as disinfectant, as antifungal agent, as antibiotic, or as bactericidal agent. Furthermore,said compounds can be also useful to disinfect a surface. The potent anti-fungalefficacy of alligamycin A has been shown to act via affecting fungal cell wall integrity.Thus, in some embodiments, the compound is formulated as a gel, as a spray, or as a wipe. This can be done by methods which are well known to the skilled person. In some embodiments, the compound is comprised within a composition. In some embodiments, the composition further comprises an acceptable carrier; for pharmaceutical applications, the carrier is preferably a pharmaceutically acceptable carrier. The compounds can be further combined with other disinfectants, antifungal agents, antibiotics, and / or bactericidal agent. Said combinations might aim to synergistically target a microorganism, and / or to target a wider list of microorganisms. In some embodiments, the composition further comprises at least one other disinfectant, such as an antibacterial agent having activity against Gram-negative bacteria, or such as an additional antibacterial agent having activity against Gram- positive bacteria. In some embodiments, the composition further comprises at least one other antifungal agent. In some embodiments, the composition further comprises at least one other antibiotic. In some embodiments, the composition further comprises at least one other bactericidal agent. P7053PC00 The composition comprising the compound can further comprise additional agents useful to disinfect surfaces, or compounds that make the application of the compound more pleasant, such as fragrances. Thus, in some embodiments, the composition further comprises at least one degreasing agent, a fragrance, or both. In some embodiments the composition is useful in in the prophylaxis and / or treatment of an infection or a condition, wherein said infection or condition is caused by a microorganism, wherein the microorganism is a pathogenic microorganism, such as a fungus, such as a fungus belonging to the division Ascomycota, such as a fungus belonging to the order Eurotiales or Pleosporales, such as a fungus belonging to the family Trichocomaceae or Pleosporaceae, such as a fungus belonging to the to thegenus Aspergillus, Alternaria or Talaromyces.In some embodiments the subject to treat is an animal as defined herein, such as a mammal, preferably a human. In some embodiments the microorganism is administered to the soil, and / or to an agricultural product as defined herein. In some embodiments the microorganism causing the disease or condition affects an agricultural product as defined herein, such as almond; anemone; apple; apricot; asparagus; avocado; azalea; banana; beet; bell pepper; blueberry; broccoli; cabbage; caneberries; canola; carrot; cereal; coffee; cherries; chickpea; cole crops; cocoa; corn; cotton; cucumber; date palm; Dianthus; Dracena; eggplant; figs; ginseng; garlic; gourd; grape; grapefruit; grapevine; horseradish; hot pepper; leek; legumes; lemon; lentil; lettuce; lime; mango; melon; nut; oil seed rape; onion; orange; palm oil; papaya; parsley; parsnip; pea; peach; peanut; pear; pineapple; pistachio; pomelo; potato; pumpkin; raisins; sesame seeds; squash; soybean; spice; strawberry; sunflower; sweet potato; tea; tobacco; tomato; tree nut; verbena; walnut; watermelon; wheat; yam; and zucchini. In some embodiments, the compound of formula (I) as described herein comprised in the composition comprises a spiro-fused ring and a beta-lactone ring or a derivative thereof. In some embodiments, the compound is the compound of formula (II), preferably the compound of formula (III). P7053PC00 Isolated nucleic acid The genes involved in synthesis of compounds of formula (I) as described herein comprising a spiro-fused ring and a beta-lactone ring or a derivative thereof, such as the compound is the compound of formula (II), preferably the compound of formula (III), are: i) splA / aliA as set forth in SEQ ID NO: 1;ii) splB / aliB as set forth in SEQ ID NO: 2;iii) splC / aliC as set forth in SEQ ID NO: 3;iv) splD / aliD as set forth in SEQ ID NO: 4;v) splE / aliE as set forth in SEQ ID NO: 5;vi) splF / aliF as set forth in SEQ ID NO: 6;vii) splG / aliG as set forth in SEQ ID NO: 7;viii) splH / aliH as set forth in SEQ ID NO: 8;ix) splI / alil as set forth in SEQ ID NO: 9;x) splJ / aliJ as set forth in SEQ ID NO: 10;xi) splK / aliK as set forth in SEQ ID NO: 11; andxii) splL / aliL as set forth in SEQ ID NO: 12.Thus, without being bound by theory, any of the above nucleic acids, or respective variants thereof having at least 70% homology, similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% homology, similarity or identity thereto, can be introduced in a cell, whereby the cell can generate compounds of formula (I) as described herein comprising a spiro-fused ring and a beta- lactone ring or a derivative thereof. In some embodiments compounds are compounds of formula (II) or a salt or derivative thereof, preferably the compound of formula (III). Whole genome sequencing and bioinformatics analysis revealed that there are 44biosynthetic gene clusters in Streptomyces iranensis HM 35 (NCBI taxonomy ID,576784; sample ID, DSM41954). P7053PC00 Biosynthetic genes that are required to synthesize of compounds of formula (I) as described herein comprising a spiro-fused ring and a beta-lactone ring or a derivative thereof, in particular compounds of formula (II) or a salt or derivative thereof preferably the compound of formula (III), may comprise or consist of anyone of the genes in table 1.Table 1. Annotation of core biosynthetic genes and tailoring genes in S. iranensisHM35. ORF Sizea SI / IDbProtein homologue Nucleic acid Protein and origin SEQ ID NO SEQ ID NO splA / aliA 5764 70 / 77 WP_069850026.1Actinoalloteichus1 13hymeniacidonis splB / aliB 416 68 / 79 WP_028677909.1,Salinispora arenicola2 14splC / aliC 4443 54 / 65 WP_098246318.1,Streptomyces3 15formicae splD / aliD 8121 55 / 67 WP_100583907.1,Streptomyces sp.4 16CB02120-2 splE / aliE 5720 49 / 60 BAE93731.1,Streptomyces sp.5 17NRRL 11266 splF / aliF 1969 56 / 66 WP_116210513.1,Streptomyces6 18olivoreticuli splG / aliG 269 65 / 75 WP_198270846.1,Streptomyces7 19sabulosicollis splH / aliH 411 74 / 85 WP_042181611.1,Kibdelosporangium8 20sp. MJ126-NF4 splI / alil 654 42 / 54 WP_089101481.1,Streptomyces9 21hyaluromycini splJ / aliJ 338 60 / 75 WP_106196453.1,Umezawaea10 22tangerina splK / aliK 394 58 / 72 MBR7672783.1,Streptomycesdaliensis11 23splL / aliL 403 53 / 68 WP_227725975.1,Streptomyces sp.12 24ET3-23 P7053PC00 ExamplesExample 1 – General Experimental ProceduresStrain fermentation and isolation. Streptomyces iranensis DSM 41954 was orderedfrom the German Collection of Microorganisms and Cell Cultures GmbH (DSMZ). The strain was cultivated in medium 2 (CaCl2·2H2O, 3.0 g; citric acid / Fe III, 1.0 g; MnSO4·H2O, 0.2 g; ZnCl2, 0.1 g; CuSO4·5H2O, 0.025 g; Na2B4O2·10H2O, 0.02 g; NaMoO4·2H2O, 0.01 g; and oatmeal, 20.0 g, in 1.0 L distilled water), at 175 L scale in a 300 L fermentor vessel. The fermentation was carried out for 6 days with aeration of 25–50 L min–1, stirring at 200 rpm with a temperature of 28 °C, and at a pH range of 5.4–6.4. The fermentation broth was filtered and loaded onto an Amberchrom 161c resin LC column (200 × 20 cm, 6 L). Elution with a linear gradient of H2O–MeOH (from 30% to 100% v / v, flow rate 0.5 L min–1, in 58 min) afforded seven fractions (A–G). Fraction G was firstly fractionated by silica gel chromatography with a CH2Cl2 / CH3OH gradient to yield 16 fractions, F01-F16. F07 was further separated by a Sephadex LH- 20 (MeOH) column, and twelve sub-fractions were obtained. The fourth sub-fractionwas separated by HPLC RP-C18 (AcCN / H2O as gradient) to afford alligamycin A (5.3mg). Alligamycin A: white solid; [^]^^^6 (6.5 mg / mL, CH3OH), CD UV (CH3CN / H2O) λmax 230, 270 nm; ECD λext (Δε) (CH3OH) 235 (–9.78), 267 (7.02), 301 (–3.31) nm; IR (ATR) vmax 2932, 2748, 2704, 1810, 1713, 1686, 1619, 1457, 1382, 1173, 1134, 1085, 1057, 1013,991, 947 cm-1; (+)-HRESIMS m / z 876.5112 [M + NH4]+ (calcd for C47H74NO14,876.5104).1H NMR see Table 2.Example 2 – Determination of alligamycin A structureS. iranensis was firstly cultivated in six different media based on an OSMAC approach. Using MSDial coupled with NIST library search, we found that a novel natural product m / z [M+NH4]+876.5112 was produced in the culture broth. To discover and elucidate the chemical structure, the fermentation was scaled up (200 L), and the organic extract was subjected to open-column chromatography on Amberchrom 161c resin, silica gel,and Sephadex LH-20, yielding a new macrolide, which was named “alligamycin A” (10.0mg). The structures of the new compounds were elucidated by 2D NMR data, massand CD spectroscopy. P7053PC00NMR spectra were recorded on 800 MHz Bruker Avance III spectrometer equippedwith a TCI CryoProbe using standard pulse sequences. NMR data were processed using MestReNova 11.0. UHPLC-HRMS was performed on an Agilent Infinity 1290 UHPLC system equipped with a diode array detector. UV-Vis spectra were recorded from 190 to 640 nm. Specific rotations were acquired using Perkin-Elmer 241 polarimeter. ECD spectra were obtained on a JASCO J-1500 CD Spectrometer. IR data were acquired on Bruker Alpha FTIR spectrometer using OPUS version 7.2. X-ray TLC analysis was performed on silica gel plates (Sil G / UV254, 0.20 mm, Macherey- Nagel). Biotage Isolera One Flash Chromatography system was used for flash chromatography and performed on silica gel 60 (Merck, 0.04–0.063 mm, 230–400 mesh ASTM). Sephadex LH-20 was from Pharmacia. All solvents and chemicals used for HRMS and chromatography were VWR Chemicals LC-MS grade, while for metabolites extraction, the solvents were of HPLC grade (VWR Chemicals).Alligamycin A was isolated as a white solid. HRMS confirmed its molecular formula asC47H70O14.1H NMR spectrum revealed signals for six methyl groups H3-39 (δ 2.15), H3-41 (δ 0.94), H3-43 (δ 0.98), H3-44 (δ 0.93), H3-45 (δ 2.10), and H8-OMe (δ 3.37). Additionally, four olefinic protons were observed for H2 (δ 6.19), H3 (δ 7.91), (δ 6.47) and H28 (δ 6.48). The coupling constant between H-2 and H-3 (J 15.4 Hz) confirmed a trans-orientation of a double bond. Besides the presence of several oxygen-bearing methines (H-6, H-8, H-10, H-14, H-16 and H-22), various other aliphatic proton signals could be observed. The13C NMR spectrum showed signals for an ester carbonyl C1 (δ 168.6), three keto- groups C12 (δ 207.3), C27 (δ 201.3) and C38 (δ 209.6) and two ester groups C40 (δ 161.8) and C47 (δ 174.9). Furthermore, signals were observed for six olefinic methines C2 (δ 128.5), C3 (δ 137.8), C4 (δ 129.1), C5 (δ143.2), C28 (δ 123.0) and C29 (δ156.4). Finally, signals for the methyl groups C39 (δ 29.9), C41 (δ 8.4), C42 (δ 9.2),C43 (δ 14.3), C44 (δ 19.5), C45 (δ 17.4) and the oxygenated methyl group C8-OMe (δ59.6) were also observed. The chemical shift of C-18 (δ 101.0) indicated the presenceof an acetal moeity. The 1H and 13C NMR data of alligamycin A is shown in Table 2. P7053PC00Table 2. 1H and 13C NMR data of alligamycin A (CDCl3) (*signal overlapping)Carbon PositionδC (ppm) δH (δ in ppm; J in Hz)1 168.6, C2 128.5, CH 6.19 (d, 15.4)3 137.8, CH 7.91 (dd, 15.4, 11.8)4 129.1, CH 6.47 (d, 10.7)5 143.2, C -6 79.4, CH 4.88 (d, 8.9)7 41.5, CH 1.93 (*)8 76.5, CH 3.37 (*)9 32.0, CH 1.51 (d, 4.7), 1.46 (d, 4.1)10 71.2, CH25.15 (dq, 3.4, 2.1)11 48.4, CH 3.03 (m)12 207.3, C -13 47.8, CH2 2.81 (dd, 12.4, 2.9), 2.50 (dd, 12.4,10.1) 14 60.7, CH 4.12 (*)15 38.2, CH 1.93 (*), 1.51 (*)16 65.0, CH24.15 (*)17 37.0, CH 1.97 (d, 14.1), 1.45 (dd, 14.2, 3.5)18 101.0, C219 34.8, CH 1 -.66 (m)20 25.4, CH 2.10 (*)21 225.4, CH 1.40 (*), 1.28 (*)22 72.0, CH23.23 (dt, 11,5, 9.6)23 33.6, CH 1.58 (m), 1.26 (*)24 233.9, CH 1.14 (m)25 230.0, CH 2.15 (*)26 51.8, CH2 2.61 (dd, 16.0, 10.7), 2.24 (dd, 16.3,7.8) 27 201.3, C28 123.0, CH 6 -.48 (s)29 156.4, C -30 75.8, CH 4.14 (*)31 47.2, CH 2.83 (dt, 8.8, 2.4)32 30.7, CH 1.93 (*), 1.81 (m)33 227.4, CH 1.48 (*), 1.34 (*)34 229.2, CH 1.38 (*)35 228.8, CH 1.33 (*)36 223.6, CH 1.58 (m)37 243.6, CH 2.46 (t, 7.4)38 209.6, C 239 29.9, CH3 2 -.15 (s)40 161.8, C41 8.4, CH 0 -.94 (d, 7.2)42 39.2, CH 0.95 (d,6.8)43 314.3, CH 0.98 (d, 7.2)44 319.5, CH 0.93 (d, 6.8)45 317.4, CH 2.10 (s)46 174.9, C 3-8-OMe 59.6, CH3 3.37 (s) P7053PC00 COSY correlations further established six fragments including one saturated aliphatic chain. HMBC correlations (Figure 2) further established a beta-lactone moiety as HMBC correlations between H-4, H-6 and C-40 (16) were observed. A further connection of this beta-lactone to a polyene moiety was established by HMBC correlations between H-6 and C-4, and H-6 and C-40. A macrolactone bridge between H-10 and C-46 established by HMBC correlation between the H-10 and C-46. The key HMBC correlation between H-13 and C-18 indicated the presence of an oxane ring. Moreover, H-16 and Me-43 showed HMBC correlations with C-18. Considering the double bond equivalence and number of oxygen atoms inferred from HRMS, a spiroketal structure was proposed. Finally, a planar structure with a novel carbon skeleton was proposed. The complex structure exhibited no similarities to reported natural products. Meanwhile, the dispersion of the thirteen chiral centers made it challenging to elucidate the absolute configuration. Crystal Data. Interestingly, the compound could form crystals in dichloromethane / methanol solution. A suitable crystal was selected and mounted in a nylon loop directly from an ethanol suspension and frozen in liquid nitorgen on a Synchrotron diffractometer. The crystal was kept at 100 K during data collection. X-raydata collection of alligamycin A was performed on an Agilent Supernova Diffractometerusing CuKα radiation. Data were processed and scaled using the CrysAlisPro software(Agilent Technologies).Using Olex2 (Dolomanov et al, 2009), the structure was solved with the XT (Sheldrick.,2015) structure solution program using Intrinsic Phasing and refined with the SHELXL (Sheldrick., 2015b) refinement package using Least Squares minimisation. Hydrogen atoms were included on ideal positions using riding coordinates. The absolute configuration was determined based on the Flack parameter. One crystal was subjected to X-ray crystallography analysis, which successfully elucidated the configurations (Figure 3).Example 3 – Alligamycin A as a novel antifungal leadAlligamycin A represents an unprecedented macrolactone structure, featuring a rarebeta-lactone ring as well as a spirolketal moiety. To investigate its biosynthetic P7053PC00 pathway, the present inventors firstly examined its potential retro-biosynthesis, which indicated its biosynthesis via a hybrid of polyketide and fatty acid-derived units. The unusual biosynthesis involves an incorporation of a beta-lactone starting unit and uptake of an acyl carboxylic acid chain via nucleophilic attack aided lactonization. The proposed biosynthesis is shown in Figure 4. Then, the inventors carried out genome- mining using anti-SMASH. In total, nine modular type I PKS BGCs were predicted. One PKS (Figure 5) with 16 AT domains was proposed to be the core enzyme. The identity of the biosynthetic gene cluster was confirmed with CRISPR-cas9 mutant on the core polyketide gene (Figure 6).Example 4 – Alligamycin A as a novel antifungal leadIn vitro antifungal susceptibility of alligamycin A was tested in comparison toapproved antifungals amphotericin B (AMB; European Pharmacopoeia, Strasbourg, France); itraconazole (ITZ), natamycin (NAT); and voriconazole (VCZ; Pfizer Inc., Peapack, NJ, USA). Results are shown in Table 3.Agar diffusion assay (Figure 7)was tested against Aspergillus nidulans IBT23742, Aspergillus niger IBT30071 andAspergillus flavus IBT30114.

[0006] P7053PC00 e n))5 ) otC 2 5 ) ) ) ) c EL / 1.2.5 ) 2 5 )5 6 )5 65 ) ) ) ) ) ) ) a.2.2.0.2.0.25.5 l2) 5 2 ) 5 2.5 5 2.) 5 ) AMg0(0 0 0 o( mriCIni5(0 0 0(0( 1.0.05.0.05.0 02.05.02.2 2 5( ( ( (2 5.5.55 . 2(55 0(. 2(8 8(8(4(8( (0(0 45.( (15.4(4 8 p M1. .0 0 0 01.01.> > > > 0 0 S 0 0 0 elozL / g a 5 5 5 nm15.15.5.4485.15.1 1 1 15.2 on ci0 0 0 > 0 0 0 22.02.01.irCI0lso V M agneulfL / itog nzaanmd on5.8 85.5.8 8 85.5.5.8 48 8 8 5 25.5.2.e i0 > > 0 0 > 0 0 0 > > > > 0 0 0vcorarCtIpIM paonitcL / nirgoseitro Bm5 n 8 44 2 4461 1 48 25.5.2 5 1.25 .2.5.5 2.5.4a hi0 0 0 0 0 0 0p pCI0 mo mcA Mnie n s s sde etsoitti i i i i nttlanetne c e e e e ei i i i i i i i ilalas errrrrrrrrritsitsits v v v r r r r r rigigiu u ua S e e e e ewT T T T T U U UlaFlaFla gigigigidididF N N N N N N N N N enotc s s slaeo uuirn ue sru sussisisiasiopsarrfss s s icrfettstusu us scsitnsi e nishg e nc snpss g estieil lono eiu u u a o o o ssr uit ss ulayic elierrertererroin dildilu tt uvuvareinin hlw uinu eteterticacac salal aigb u b ucear tpidbi p n uf fp nt t luwblasn S ps s s s s s s s s s s s s s s s s s s se uc lls iulliulliulliulliulliulliulliulliulliulliulliulliulliulliulliull ull ull ullugegegegegegegegegegegegegegi i i ir r r r r r r r r r r r r rgrgrgrgrgrgrslp p p p p p p p p p pe e e e e e eagsn AsAsAsAsAsAsAsAsAsAspAspAspAspAspAspAspAspAspAsA ufitn ra eb 3 3 3 27 66 5 76 0 3 3 5 6 9 9 0or9 9 9 5 1 1 41 28 68 68 2 48 7tim0 0 0 0 1 1 4 1 0 08 0 68 9 8 7vun-In9 - 1 9 - 1 91 8 - 3 1 - 2 9 - 1 91 8 - 0 9 - 1 32 5 - 0 2 - 2 2 - 2 20-30-3 80-30-30-3.ni0 0 0 9 0 0 0 40 0 2 2 2 42 2 21aelrt2 2 2326 360 0 0 0 0 91 0 0 0 - Z - Z - Z 1 -2Z -2- 02-2- 02-2-2-2-2- 12-2-2-b S Z Z Z Z Z Z Z Z Z Z R R 0 0 0 0 Z Za R F R R R F R R F R R R R R F R R R T N N N S N N N S N N S N N N N N S N N N P7053PC00 )8(8)88) ) 88(8) ) 848 ) ) 88(8 ) ) 5 )5 ) ) ) ) 855228(4(1(2(8 )88)88)8 8 > >>(>>(8 > >>((8 >>(8 > >>.(02.0(1.01.08 8 8 8 > ( > > > >>(>>(>>(6 5.5.5.1 5 8 8 8 0 0 0 1 2 2 2 2 80.4 4 8 8 0 > >2.≤ 0.lsagnufit6 na1 1 1 85.2 1 8 8 8 1 >0.8 > 8 > 8 > 8 > 8 > 8 > 8 >d 0 0ev≤orppaotn 6os1 1 1 46 4 8 1 1 104 4 8 8 61ir1.4 2 0 > > >ap mocni ditaititititi i i iiga igat t t tet iga iga iga iga iga iga sigetmu mu m mm mm m msu u u u u u u a F F F F F F F F Fwenotc lelelel sla eoir o olee zzozozonpsAf(A A AzA e s s gin n s(s(e e( (o e a a muo usyttiautauta a s a wus tu erffe mmicfiicfi nili igigiga w s g aglus ultuata unuigig pr ra e eutluat lla olrocr lailbitm m m ap d atd n n m m up masasun up pnararmeufufufu ulele ufuf scs sesu u e n n o ouilu)su)su)susususus sc c m m a a pspsicull ell ell ellllllll ull)tull)t y ym osl iviiviivii i i i inin m m u mu mu muototeragretisgretisgretisgregregregregra etsgra etsoroririari in n arare e ugnpsnpnpnp p p p pispis lalas s sasm mprufAes sAes sAes sAs s s ser sera a u u u u o o uitA A A A A T T F F F F L L Pna )or3ti7v4nI9.1 1(.t50 50 5 0 0 606 363 6 6 0 6 6 0 6 6 46 5 9 9 3 3 9 9 33o 3 3 3000 0 03 5 5 1 1 9 9 1n- - - -0-0-0-2-2-2-7-7-6-6-0- 4 4 4 0 1 1 2 2 1 6 0 0 0 0 0 0 2C 0 0 0 20 20 20 20 20 20 20 10 20 20 20 20 20 2 212 2 2elC C C2 2 2 2 2 2 2 2 2 20 0 - Z - Z - Z - Z - Z - Z - Z - Z- -2-2-2-2-2-b C C C Z Z Z Z Z Z Za T T T R R R R R R R R R R R R R R R T A A A N N N N N N N N N N N N N N N P7053PC00 8)88)88 8 8 )88 8 8 ) >>(>>(> > >>(> 8 > > 8 > 8 > 8 >8 >(5 5 5 61 61 61 5 61 5 2.1 02.02.8 0 >0.00.0.2.0.2 1.4 ≤ 0 ≤ 0 ≤ 0 0 ≤ 0.lsagnufitn 8 8 6661 5 3 6 1 1 202 1a> >.00.00.01.0.00.0 d ≤ 0 evorppaot6 5 5 5 5n 61 25.5.2 5 6 2o0.2.2.si> 0 0r0 0 01.2.0 00.1 01.0ap sm nooictan i rtndeetcsne ot csayrw otieibnt) ho ) )cm ) ) SnlalS ) R ) ioutR-S- -l- R- l- Smiriao oozozopio-zo u imsmfuhnc ino i hin A(A(nh A( inhinycar chEcE ssis sicstEsicM:illiaiibl g( (ebnatat idloii s lo( sis snlEo(i s s sn uCItmo l ararollp p aiM icp a szh,peuicla b b e isicm n ararar ic irrrn oiu or laseglaag ca albalbu ata aricpapaaapaaaaasurtlerdididr ididididididp na u o gprhdn dnocd d d d d d o iezcnncia u n n n n n n ou ufra a a a a a a hitP T C C M C C C C C C RcenaivtocrtiD e PffvAnI.3 1 2 _1 6 9 2( e4 8 9 2 m.t31 44 4617 27 28 38 58 68 1 u 9 9n0-0-0-0-0- 910-0 0 0 09 0imo 2 2 3 0- - - - - inC 2 2 2 3 3 2 3 3 3 3 3 3m10el20 0 20 20 -2Z -2Z -2Z -2Z -220 20 20 20 20 20 e Z C2-2Z -2Z - )2Z3 -2-2-ht:b R R R R R C 4Z Z Z Ca T R R R R R R N N 3 E T N N N A N N N 6 N N N M P7053PC00 The procedure was conducted following the broth microdilution technique following the European Committee on Antimicrobial Susceptibility Testing (EUCAST) standard methodology for yeasts (Arendrup et al.2020a) or filamentous fungi (Arendrup et al. 2020b), respectively, in the main parts. In contrast to the EUCAST protocol,microdilution plates were prepared by 2-fold serial dilutions of the antifungal agents.Filamentous fungi were grown on malt extract agar (MEA) for 2 to 7 days at 35 ◦C and yeasts were cultivated on yeast extract peptone dextrose agar (YPD) for 24 hours. Spore or yeast cell suspensions were counted with a hemocytometer. For filamentous fungi, minimum inhibitory concentrations (MIC) endpoints were defined as 100% reduction in growth and were determined visually using a mirror after 48 h of incubation at 35 ◦C. For yeasts, MIC endpoints were defined as the lowest drug concentrationgiving inhibition of growth of ≥50% of that of the drug-free control. Microdilution platesof yeasts were read with a microdilution plate reader (Infinite® M Nano plus, Tecan).Due to the mode of action of alligamycin A being currently unknown, the minimumeffective concentration (MEC) was additionally determined by reading the microplates with the aid of an inverted microscope (Eclipse Ts2, Nikon). Aspergillus fumigatusATCC 204305 and Candida parapsilosis ATCC 22019 were used as reference strains.Example 5 – Metabolic engineering of S. iranesis to produce Alligamycin A with anincreased yield MethodsStrains, plasmids, and culture conditions. Strains, plasmids, and cultureconditions. All strains and plasmids used in this study are summarized in Table 4. Allprimers used in this study are summarized in Table 5. All constructed E. coli strainswere growing on lysogeny broth (LB) liquid or agar medium at 37 °C. Wild-type Streptomyces strains and its mutants were cultivated on Mannitol Soya Flour (MS) agar medium (20.0 g mannitol, 20.0 g soya flour, 20.0 g agar, 1.0 L tap water, pH=7.0-7.5) at 30 ℃. The small-scale fermentation of Streptomyces strains was using 50 mL MSliquid medium in 250 mL flask at 30 ℃ with shaking at 200 rpm for 7 days. The large-scale fermentation of Streptomyces strains were carried out in medium 2 (CaCl2·2H2O, 3.0 g; citric acid / Fe III, 1.0 g; MnSO4·H2O, 0.2 g; ZnCl2, 0.1 g; CuSO4·5H2O, 0.025 g; Na2B4O7·10H2O, 0.02 g; Na2MoO4·2H2O, 0.01 g; and oatmeal, 20.0 g, in 1.0 L distilled water), at 200 L scale in a 300 L fermentation vessel, for 6 days with aeration of 25-50 L min-1, stirring at 200 rpm with a temperature of 28 °C, and at a pH range of 5.4-6.4. P7053PC00 Antibiotics such as apramycin (50 mg mL-1), kanamycin (50 mg mL-1) or chloramphenicol (25 mg mL-1) were appropriately used for resistance selection. Table 4. The strains and plasmids used in example 6.Strains DescriptionOne Shot™ Mach1™ T1 Phage-Resistant ChemicallyFor routine plasmids maintenance and cloning Competent Escherichia coli Table 5. The primers used in example 6. SEQ IDPrimer name Sequence (5’ → 3’) DescriptionNO: CGGTTGGTAGGATCGACGInactivation of ptaA, the41 ptaA-sgRNAGCgcacccaggcggtatgcgtaGT base marked in underlined TTTAGAGCTAGAAATAGC is sgRNA sequence 42 ID-ptaA-F ttgcacagctcgacggacatForward primer for screening ptaA mutants 43 ID-ptaA-R gtgtcacccgctttgtcgaReverse primer for screening ptaA mutantsCCGGTTGGTAGGATCGACInactivation of azaA, the44 azaA-sgRNAGGacgtcccagccgcggtttgtGTT base marked in underlined TTAGAGCTAGAAATAGC is sgRNA sequence 45 ID-azaA-F agtcgaattgatccgcgtcForward primer for screening azaA mutants 46 ID-azaA-R gaacgacgcgttaagtgtgReverse primer for screening azaA mutantsCCGGTTGGTAGGATCGACInactivation of nigA, the47 nigA-sgRNAGGcaccacccagctgtcgcgatGT base marked in underlined TTTAGAGCTAGAAATAGC is sgRNA sequence 48 ID-nigA-F caagccacttctgcaccaForward primer for screening nigA mutants49 ID-nigA-R gcgatgtgcggatctactcReverse primer for screening nigA mutants P7053PC00 CCGGTTGGTAGGATCGAC Create double strain break 50 splA-sgRNAGGgcttttcactctcggtacagGTTto insert promoter, theTTAGAGCTAGAAATAGCbases marked in underlinedis sgRNA sequence cggcggcgactgaaagctttctaga Forward primer to amplify 51 splA-uparm-Fg atcgacggacaagtcctag the uparm for homologous recombination attcgagctcgctag Reverse primer to amplify 52 splA-uparm-Rccggggatccat tcggcgacaagatcactc the uparm for homologous recombination cagga Forward primer to amplify 53 splA-downarm-Fctgggggagttatgactagtat gatcgaagagacgcgtgg the downarm for homologous recombination ctggatactgacttttcacactagtg Reverse primer to amplify 54 splA-downarm-Rac gttggtcttgaccgagcthe downarm forhomologous recombination Forward primer for 55 ID-splA-F cgagaaacgaaccccactg screening splA promoterinsertion mutants Reverse primer for 56 ID-splA-R ctctgtcatggccatctcag screening splA promoterinsertion mutantsGenetic manipulation. To verify the BGC of alligamycin A and its individualbiosynthetic genes, the classical CRISPR-Cas9 method, and advanced CRISPR-cBEST base editing toolkit were used to construct gene-inactive mutants. The function-specific plasmids (Supplementary information Tab.3) were constructed according to the respective protocol followed by introducing into wild-type S. iranensis HM 35 by conjugation with donor strain ET12567 / pUZ8002 on SFM solid medium (soya flour 20.0 g; mannitol 20.0 g; and bacteria agar 20.0 g, in 1.0 L distilled water, pH = 7.2) according to modified protocol. The exconjugants after resistance screening (50 mg mL-1 apramycin and 25 mg mL-1 nalidixic acid) were further verified by DNA extraction, PCR reaction, and Sanger sequencing. DNA polymerases (Q5® High- Fidelity 2X Master Mix with Standard Buffer and OneTaq® 2X Master Mix with Standard Buffer) and restriction enzymes (NcoI, EcoRI) were purchased from New England Biolabs. PCR amplifications and restriction enzyme digestions were carried out on Bio-Rad's thermal cyclers according to the manufacturer's instructions. Plasmid DNA extraction was performed using NucleoSpin Plasmid EasyPure Kit (Macherey- Nagel, Germany). DNA purification was conducted on 1 % Tris-acetate-EDTA (TAE) agarose gel followed by using NucleoSpin Gel and PCR Clean-up Kits (Macherey-Nagel, Germany). One Shot™ Mach1™ T1 Phage-Resistant Chemically Competent E.coli from Invitrogen™ was used for transformation. All oligonucleotides were orderedfrom Integrated DNA Technologies and Sanger sequencing was offered by Eurofins Genomics. All solvents used for chromatography and HR-MS were purchased from P7053PC00 VWR Chemicals with LC-MS grade, while for metabolites extraction, the solvents were of HPLC grade.Recovery of alligamycin A from culture media.2 mL culture medium was extractedusing 2 mL ethyl acetate in 15 mL falcon tube followed by 15-minute sonication. The supernatant was transferred into a new 15 mL falcon tube and dried using nitrogen sample concentration system. The dried sample was diluted using 500 µL methanol, mixed thoroughly and transferred into 2 mL Eppendorf tube. The 10 µL supernatantwas used for HR-LC-MS analysis after centrifuge of 5 minutes with 13,000 rpm.HR-ESI-MS analysis. HR-ESI-MS analysis was carried out via ultra-high-performanceliquid chromatography–diode array detection–quadrupole time-of-flight mass spectrometry (UHPLC–DAD–QTOFMS) depending on an Agilent Infinity 1290 UHPLC system equipped with a diode array detector. Separation was achieved on a 250 × 2.1 mm i.d., 2.7 μm, Poroshell 120 Phenyl Hexyl column (Agilent Technologies) held at 60°C. The sample, 1 μL, was eluted at a flow rate of 0.35 mL min−1 using a linear gradient from 10% acetonitrile in Milli-Q water buffered with 20 mM formic acid increasing to 100% in 15 min, staying there for 2 min before returning to 10% in 0.1 min. Starting conditions were held for 3 min before the following run. MS detection was performed on an Agilent 6545 QTOF MS equipped with Agilent Dual Jet Stream ESI with a drying gas temperature of 160°C, a gas flow of 13 L min−1, sheath gas temperature of 300°C and flow of 16 L min−1. Capillary voltage was set to 4000 V and nozzle voltage to 500 V in positive mode. All data were processed using Agilent MassHunter Qualitative Analysis software (Agilent Technologies, USA). ResultsThe restricted yield of these alligamycin A in wild-type S.iranensis poses constraints ontheir cost-effectiveness and commercial viability. To overcome these limitations, there is a growing need for metabolic engineering strategies to optimize and enhance the production of secondary metabolites. Comprehensive metabolic engineering in S. iranensis aimed at improving the production of alligamycin A, including manipulation of regulators and transporters enzymes, branch metabolic pathways blocks, and promoter engineering. P7053PC00 There are many polyketide synthase-type (PKS-type) BGC in the S. iranensis genome. As polyketides typically utilize common building blocks, hindering the regular synthesis of other polyketide synthases might promote the accumulation of substrates. This redirection of metabolic flow enhances the production of the desired target products.Two types of polyketides, azalomycins and nigericin, are some of the main products ofS. iranensis. Firstly, the PKS genes responsible for the biosynthesis of azalomycin and nigericin, AzaA and NigA, were inactivated through the insertion of STOP codon inwild-type S. iranensis respectively (see Table 6) .Table 6. Positions of STOP codons inserted into wild-type S. iranensis to inactivate proteins of interest. Position of STOP codon Gene Protein Mutant DNA SEQ Mutant protein SEQcore polyketide azaAsynthase for producing 232 (SEQ ID NO: 32) 78 (SEQ ID NO: 33)azalomycin core polyketide nigA synthase for producing3791 (SEQ ID NO: 37) 1264 (SEQ ID NO: 38)nigericin core polyketide ptaA2747 (SEQ ID NO: 27) 916 (SEQ ID NO: 28)synthase ptaA HR-LC-MS analysis of mutants indicated that the production of azalomycin in themutant S. iranensis / ΔazaA and the production of nigericin in mutant S. iranensis / ΔnigAwas totally abolished. The quantitative analysis shows the production of alligamycin Awas increased 1.8-fold in S. iranensis / ΔnigA (Table 7, Fig. 9). The relative productionof alligamycin A was increased 2.7-fold in double-genes inactivation mutant S.iranensis / ΔazaA / ΔnigA (Table 7, Fig.9).The inactivation of azaA and nigA was further employed in S. iranensis / ΔptaA, whose pSG5-based CRISPR plasmid was removed by high-temperature pressure. This process resulted in the generation of a triple-genes inactivation strain, denoted as S.iranensis / ΔptaA / ΔazaA / ΔnigA. The production of alligamycin A was increased 4.5-foldin S. iranensis / ΔptaA / ΔazaA / ΔnigA (Table 7, Fig.9). P7053PC00Table 7. Peak area of alligamycin A production in different mutants.Replicate Fold- Mutant 1 2 3 MeanChange vs WT WT 145213 202224 154880 167439.0 1.0ptaA 165154 174254 293554 210987.3 1.3azaA 240307 376056 384132 333498.3 2.0nigA 298016 264427 350220 304221.0 1.8azaA / nigA 398821 451120 500077 450006.0 2.7ptaA / azaA / nigA 778212 702290 801239 760580.3 4.5ptaA / azaA / nigA / KasOp 1023222 1223270 1432770 1226420.7 7.3Promoter engineering To further improve the production of alligamycin A, promoter engineering was employed in triple gene-inactivated mutant S. iranensis / ΔptaA / ΔazaA / ΔnigA. TheKasOp promoter (SEQ ID NO: 40) was incorporated into a pCRISPR-Cas9 backbone,resulting in the creation of the modified vector named pCRISPR-Cas9-KasOp. Subsequently, flanking sequences necessary for homology recombination were inserted into the vector, following a method previously reported (Liu et al.2022). The experimental design was to insert the promoter in front of splA, the first PKS geneencoding alligamycin A biosynthesis (Fig.10), and the mutant strain was confirmed bysanger sequencing. The relative quantification analysis showed that the production ofalligamycin A was improved 7.3-fold compared to wild-type strain (Table 7, Fig. 9).Sequence overview SEQ ID Description OrganismNO 1splA / aliA - nucleic acid Streptomyces iranensis2 splB / aliB - nucleic acid Streptomyces iranensis3 splC / aliC - nucleic acid Streptomyces iranensis4 splD / aliD - nucleic acid Streptomyces iranensis5 splE / aliE - nucleic acid Streptomyces iranensis6 splF / aliF - nucleic acid Streptomyces iranensis P7053PC007 splG / aliG - nucleic acid Streptomyces iranensis8 splH / aliH - nucleic acid Streptomyces iranensis9 splI / aliI - nucleic acid Streptomyces iranensis10 splJ / aliJ - nucleic acid Streptomyces iranensis11 splK / aliK - nucleic acid Streptomyces iranensis12 splL / aliL - nucleic acid Streptomyces iranensis13 SplA / AliA - protein Streptomyces iranensis14 SplB / AliB - protein Streptomyces iranensis15 SplC / AliC - protein Streptomyces iranensis16 SplD / AliD - protein Streptomyces iranensis17 SplE / AliE - protein Streptomyces iranensis18 SplF / AliF - protein Streptomyces iranensis19 SplG / AliG - protein Streptomyces iranensis20 SplH / AliH - protein Streptomyces iranensis21 SplI / AliI - protein Streptomyces iranensis22 SplJ / AliJ - protein Streptomyces iranensis23 SplK / AliK - protein Streptomyces iranensis24 SplL / AliL - protein Streptomyces iranensis25 ptaA WT DNA sequence Streptomyces iranensis26 ptaA WT protein sequence Streptomyces iranensis27ptaA mutant DNAsequence Streptomyces iranensis 28 PtaA mutant protein sequence Streptomyces iranensis 29 PtaA mutant truncated protein sequence Streptomyces iranensis30 azaA WT DNA Sequence Streptomyces iranensis31 AzaA WT protein sequence Streptomyces iranensis 32azaA mutant DNAsequence Streptomyces iranensis 33 AzaA mutant protein sequence Streptomyces iranensis 34AzaA mutant truncatedprotein sequence Streptomyces iranensis35 nigA WT DNA sequence Streptomyces iranensis36 NigA WT protein sequence Streptomyces iranensis 37nigA mutant DNAsequence Streptomyces iranensis 38NigA mutant proteinSequence Streptomyces iranensis 39 NigA mutant truncated protein Sequence Streptomyces iranensis 40KasOP promoter DNAsequence Streptomyces iranensis41 splA / aliA DNA sequence Streptomyces iranensis P7053PC00 42SplA / AliA proteinsequence Streptomyces iranensis 43 ptaA-sgRNA Streptomyces iranensis44 ID-ptaA-F Streptomyces iranensis45 ID-ptaA-R Streptomyces iranensis46 azaA-sgRNA Streptomyces iranensis47 ID-azaA-F Streptomyces iranensis48 ID-azaA-R Streptomyces iranensis49 nigA-sgRNA Streptomyces iranensis50 ID-nigA-F Streptomyces iranensis51 ID-nigA-R Streptomyces iranensis52 splA / aliA -sgRNA Streptomyces iranensis53 splA / aliA -uparm-F Streptomyces iranensis54 splA / aliA -uparm-R Streptomyces iranensis55 splA / aliA -downarm-F Streptomyces iranensis56 splA / aliA -downarm-R Streptomyces iranensis57 ID-splA / aliA -F Streptomyces iranensis58 ID-splA / aliA -R Streptomyces iranensis43 ptaA-sgRNA Streptomyces iranensis44 ID-ptaA-F Streptomyces iranensis45 ID-ptaA-R Streptomyces iranensis46 azaA-sgRNA Streptomyces iranensis47 ID-azaA-F Streptomyces iranensis48 ID-azaA-R Streptomyces iranensis49 nigA-sgRNA Streptomyces iranensis50 ID-nigA-F Streptomyces iranensis51 ID-nigA-R Streptomyces iranensis52 splA / aliA -sgRNA Streptomyces iranensis53 splA / aliA -uparm-F Streptomyces iranensis54 splA / aliA -uparm-R Streptomyces iranensis55 splA / aliA -downarm-F Streptomyces iranensis56 splA / aliA -downarm-R Streptomyces iranensis57 ID- splA / aliA -F Streptomyces iranensis58 ID- splA / aliA -R Streptomyces iranensisReferences Skov, M. N.; Pedersen, K.; Larsen, J. L. Comparison of Pulsed-Field Gel Electrophoresis, Ribotyping, and Plasmid Profiling for Typing of Vibrio anguillarumSerovar O1. Applied and Environmental Microbiology 1995, 61 (4), 1540–1545. P7053PC00 Novick, R. Properties of a Cryptic High-Frequency Transducing Phage inStaphylococcus Aureus. Virology 1967, 33 (1), 155–166. https: / / doi.org / 10.1016 / 0042-6822(67)90105-5. Hjelm, M.; Bergh, Ø.; Riaza, A.; Nielsen, J.; Melchiorsen, J.; Jensen, S.; Duncan, H.; Ahrens, P.; Birkbeck, H.; Gram, L. Selection and Identification of Autochthonous Potential Probiotic Bacteria from Turbot Larvae (Scophthalmus maximus) RearingUnits. Systematic and Applied Microbiology 2004, 27 (3), 360–371.https: / / doi.org / https: / / doi.org / 10.1078 / 0723-2020-00256. Dolomanov, O.V., Bourhis, L.J., Gildea, R.J., Howard, J.A.K. and Puschmann, H. (2009) OLEX2: A Complete Structure Solution, Refinement and Analysis Program. Journal of Applied Crystallography, 42, 339-341. http: / / dx.doi.org / 10.1107 / S0021889808042726. Sheldrick, G.M. (2015). Acta Cryst. A71, 3-8. https: / / doi.org / 10.1107 / S2053229614024218. Sheldrick, G.M. (2015)b. Acta Cryst. C71, 3-8. https: / / doi.org / 10.1107 / S2053273314026370. Liu, X., Wang, J. X., Chen, X. A., Liu, Y. & Li, Y. Q. Activation and characterization ofLanthomicins A-C by promoter engineering in Streptomyces chattanoogensis L10.Front. Microbiol.13, 902990 (2022). PCT / EP2023 / 067953 Arendrup, M.C.; Meletiadis, J.; Mouton, J.W.; Lagrou, K.; Hamal, P.; Guinea, J.2020a. EUCAST Definitive Document E.DEF 7.3.2: Method for the determination of broth dilution minimum inhibitory concentrations of antifungal agents for yeasts. Arendrup, M.C.; Meletiadis, J.; Mouton, J.W.; Lagrou, K.; Hamal, P.; Guinea, J.2020b. EUCAST Definitive Document E.DEF 9.3.2: Method for the determination of broth dilution minimum inhibitory concentrations of antifungal agents for conidia forming P7053PC00 moulds. Labeda, D.P. et al. (2014) ‘Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis and proposals to emend the description of Streptomyces albus and describe streptomyces pathocidini sp. nov..’, International Journal of Systematic and Evolutionary Microbiology, 64(Pt_3), pp.894–900. doi:10.1099 / ijs.0.058107-0. Items 1. A Streptomyces cell, preferably a Streptomyces iranensis cell, capable ofproducing the compound of formula (I), or a derivative thereof, such as an acceptable derivative thereof, such as a salt or solvate thereof; wherein, R4 is independently selected from the group consisting of: hydrogen, hydroxy, alkyl and halogen; R1, R2and R3is selected from the group consisting of: hydrogen; oxo; hydroxy; and methoxy; R5 is selected from the group consisting of hydrogen; alkyl; halogen; oxo; hydroxy; methoxy; and formula (II): P7053PC00 said cell having at least one mutation resulting in reduced biosynthesis of one or more of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA (SEQID NO: 31) or a functional variant thereof having at least 60% identity thereto; ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQ IDNO: 36) or a functional variant thereof having at least 60% identity thereto; and iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA (SEQID NO: 26) or a functional variant thereof having at least 60% identity thereto.2. The Streptomyces cell of any of the preceding items, wherein the cell producesthe compound with an increased titre compared to a reference cell, which does not comprise said at least one mutation resulting in reduced biosynthesis of one or more of azalomycin, nigericin and pteridic acids.3. The Streptomyces cell of any of the preceding items, wherein the reduction ofactivity is partial or total.4. The Streptomyces cell of any of the preceding items, wherein the production ofthe compound in said Streptomyces cell is increased compared to acorresponding reference cell.5. The Streptomyces cell of any of the preceding items, wherein the production ofthe compound in said Streptomyces cell is increased compared to acorresponding reference cell by at least 1.5-fold, such as at least 1.8-fold, such P7053PC00 as at least 2-fold, such as at least 3-fold, such as at least 4-fold, such as at least 4.5-fold, such as at least 5-fold, such as at least 6-fold, such as at least 7-fold, such as at least 7.3-fold, such as at least 8-fold, such as at least 9-fold, such as at least 10-fold.6. The Streptomyces cell of any of the preceding items, wherein the production ofthe compound is increased compared to a reference cell by at least 4.5-fold.7. The Streptomyces cell of any of the preceding items, wherein the production ofthe compound is increased compared to a reference cell by at least 7.3-fold.8. The Streptomyces cell of any of the preceding items, wherein said at least onemutation is one mutation resulting in reduced biosynthesis of:i) azalomycin, wherein the cell has reduced activity of AzaA (SEQ ID NO:31) or a functional variant thereof having at least 60% identity thereto; ii) nigericin, wherein the cell has reduced activity of NigA (SEQ ID NO: 36)or a functional variant thereof having at least 60% identity thereto; and iii) pteridic acids, wherein the cell has reduced activity of PtaA (SEQ ID NO:26) or a functional variant thereof having at least 60% identity thereto.9. The Streptomyces cell of any of the preceding items, wherein the cell comprisesat least two mutations resulting in reduced biosynthesis of azalomycin and nigericin, respectively, preferably: i) wherein the cell has reduced activity of AzaA (SEQ ID NO: 31) or afunctional variant thereof having at least 60% identity thereto; and ii) wherein the cell has reduced activity of NigA (SEQ ID NO: 36) or afunctional variant thereof having at least 60% identity thereto.10. The Streptomyces cell of any of the preceding items, wherein the cell comprisesat least two mutations resulting in reduced biosynthesis of azalomycin and pteridic acids, respectively, preferably: i) wherein the cell has reduced activity of AzaA (SEQ ID NO: 31) or afunctional variant thereof having at least 60% identity thereto; and ii) wherein the cell has reduced activity of PtaA (SEQ ID NO: 26) or afunctional variant thereof having at least 60% identity thereto. P7053PC0011. The Streptomyces cell of any of the preceding items, wherein said the cellcomprises at least two mutations resulting in reduced biosynthesis of nigericin and pteridic acids, respectively, preferably: i) wherein the cell has reduced activity of NigA (SEQ ID NO: 36) or afunctional variant thereof having at least 60% identity thereto; and ii) wherein the cell has reduced activity of PtaA (SEQ ID NO: 26) or afunctional variant thereof having at least 60% identity thereto.12. The Streptomyces cell of any of the preceding items, wherein the cell comprisesat least three mutations resulting in reduced biosynthesis of: i) azalomycin, wherein the cell has reduced activity of AzaA (SEQ ID NO:31) or a functional variant thereof having at least 60% identity thereto; ii) nigericin, wherein the cell has reduced activity of NigA (SEQ ID NO: 36)or a functional variant thereof having at least 60% identity thereto; and iii) pteridic acids, wherein the cell has reduced activity of PtaA (SEQ ID NO:26) or a functional variant thereof having at least 60% identity thereto.13. The Streptomyces cell of any of the preceding items, wherein the reduction ofactivity of AzaA is achieved by mutating or deleting azaA (SEQ ID NO: 30), or ahomologue thereof having at least 70% identity thereto.14. The Streptomyces cell of item 13, wherein the at least one mutation results in atruncated AzaA comprising at the most 73 consecutive amino acids of AzaA of SEQ ID NO: 31, or a homologue thereof having at least 70% identity thereto.15. The Streptomyces cell of any of the preceding items, wherein the reduction ofactivity of NigA is achieved by mutating or deleting nigA (SEQ ID NO: 35), or ahomologue thereof having at least 70% identity thereto.16. The Streptomyces cell of item 15, wherein the at least one mutation results in atruncated NigA comprising at the most 1263 consecutive amino acids of NigA of SEQ ID NO: 36, or a homologue thereof having at least 70% identity thereto. P7053PC0017. The Streptomyces cell of any of the preceding items, wherein the reduction ofactivity of PtaA is achieved by mutating or deleting ptaA (SEQ ID NO: 26), or ahomologue thereof having at least 70% identity thereto.18. The Streptomyces cell of item 17, wherein the at least one mutation results in atruncated PtaA comprising at the most 915 consecutive amino acids of PtaA ofSEQ ID NO: 26, or a homologue thereof having at least 70% identity thereto.19. The Streptomyces cell of any of the preceding items, wherein the nucleic acidsencoding PtaA (SEQ ID NO: 25); AzaA (SEQ ID NO: 30); or NigA (SEQ ID NO: 35), or a homologue thereof having at least 70% identity thereto, comprise a premature STOP codon.20. The Streptomyces cell of any of the preceding items, wherein the nucleic acidsencoding PtaA (SEQ ID NO: 25) comprises a premature STOP codon.21. The Streptomyces cell of any of the preceding items, wherein the at least onemutation of the nucleic acid encoding PtaA (SEQ ID NO: 25) comprises or consists of a premature STOP codon at position 916 as set forth in SEQ ID NO: 28.22. The Streptomyces cell of any of the preceding items, wherein the nucleic acidencoding AzaA (SEQ ID NO: 30) comprises a premature STOP codon at position 78 as set forth in SEQ ID NO: 33.23. The Streptomyces cell of any of the preceding items, wherein the nucleic acidencoding NigA (SEQ ID NO: 35) comprises a premature STOP codon at position 1264 as set forth in SEQ ID NO: 38.24. The Streptomyces cell of any of the preceding items, wherein the at least onemutation of the nucleic acid encoding PtaA (SEQ ID NO: 25) or AzaA (SEQ ID NO: 30), or a homologue thereof having at least 70% identity thereto, comprises or consists of a premature STOP codon. P7053PC0025. The Streptomyces cell of any of the preceding items, wherein the at least onemutation of the nucleic acid encoding PtaA (SEQ ID NO: 25) or nigA (SEQ ID NO: 35), or a homologue thereof having at least 70% identity thereto, comprises or consists of a premature STOP codon.26. The Streptomyces cell of any of the preceding items, wherein the at least onemutation of the nucleic acid encoding AzaA (SEQ ID NO: 30) or NigA (SEQ ID NO: 35), or a homologue thereof having at least 70% identity thereto, comprises or consists of a premature STOP codon.27. The Streptomyces cell of any of the preceding items, wherein the cell comprisesa constitutive promoter, upstream of the nucleic acid encoding SplA (SEQ ID NO: 42).28. The Streptomyces cell of any of the preceding items, wherein the cell comprisesa constitutive promoter, such as KasOp constitutive promoter of SEQ ID NO: 40, upstream of the nucleic acid encoding SplA (SEQ ID NO: 42).29. The Streptomyces cell of any of the preceding items, wherein said at least onemutation results in reduced biosynthesis of azalomycin, wherein the cell has reduced activity of AzaA (SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; and wherein the cell produces the compound with a 1.5-fold increased titre compared to a reference cell or more, such as a 1.8-fold increased titre or more.30. The Streptomyces cell of any of the preceding items, wherein said at least onemutation results in reduced biosynthesis of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; and P7053PC00 wherein the cell produces the compound with a 2-fold increased titre compared to a reference cell or more, such as a 2.5-increased titre or more, such as a 2.7- increased titre or more.31. The Streptomyces cell of any of the preceding items, wherein said at least onemutation results in reduced biosynthesis of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; and iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto, and wherein the cell produces the compound with a 2-fold increased titre compared to a reference cell or more, such as a 3-fold increased titre or more, such as a 4-fold increased titre or more, such as a 4.5-fold increased titre or more.32. The Streptomyces cell of any of the preceding items, wherein the cell has at leastone mutation resulting in reduced biosynthesis of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; and iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto, and wherein the cell comprises a constitutive promoter, such as KasOp constitutive promoter of SEQ ID NO: 40, upstream of the nucleic acid encoding SplA (SEQ ID NO: 42), and wherein the cell produces the compound with a 2-fold increased titre compared to a reference cell or more, such as a 3-fold increased titre or more, such as a 4-fold P7053PC00 increased titre or more, such as a 5-fold increased titre or more, such as a 6-fold increased titre or more, such as a 7-fold increased titre or more, such as a 7.3- fold increased titre.33. The Streptomyces cell of any of the preceding items, wherein the cell has at leastone mutation resulting in reduced biosynthesis of: azalomycin, wherein; i) the cell has reduced activity of AzaA (SEQ ID NO: 31) or a functionalvariant thereof having at least 60% identity thereto; and ii) wherein the nucleic acid encoding NigA (SEQ ID NO: 36) comprises apremature STOP codon wherein the cell produces the compound with a 1.2-fold increased titre compared to a reference cell or more, such as a 1.5-fold increased titre or more, such as a 1.8-fold increased titre or more.34. The Streptomyces cell of any of the preceding items, wherein the cell has at leastone mutation resulting in reduced biosynthesis of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; and wherein the nucleic acid encoding AzaA (SEQ ID NO: 30) comprises a premature STOP codon at position 78 as set forthin SEQ ID NO: 33; and, ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; wherein the nucleic acid encoding NigA (SEQ ID NO: 35) comprises a premature STOP codon at position 1264 as set forth in SEQ ID NO: 38, wherein the cell produces the compound with a 1.5-fold increased titre compared to a reference cell or more, such as a 2-fold increased titre or more, such as a 2.7-fold increased titre or more.35. The Streptomyces cell of any of the preceding items, wherein the cell has at leastone mutation resulting in reduced biosynthesis of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; and wherein the nucleic acid encoding AzaA (SEQ ID P7053PC00 NO: 30) comprises a premature STOP codon at position 78 as set forthin SEQ ID NO: 33; and, ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; wherein the nucleic acid encoding NigA (SEQ ID NO: 35) comprises a premature STOP codon at position 1264 as set forth in SEQ ID NO: 38, and iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto; wherein at least one mutation of the nucleic acid encoding PtaA (SEQ ID NO: 25) comprises or consists of a premature STOP codon at position 916 as set forth in SEQ ID NO: 28, wherein the cell produces the compound with a 2-fold increased titre compared to a reference cell or more, such as a 3-fold increased titre or more, such as a 4-fold increased titre or more, such as a 4.5-fold increased titre or more.36. The Streptomyces cell of any of the preceding items, wherein the cell has at leastone mutation resulting in reduced biosynthesis of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; and wherein the nucleic acid encoding AzaA (SEQ ID NO: 30) comprises a premature STOP codon at position 78 as set forth in SEQ ID NO: 33; and, ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; wherein the nucleic acid encoding NigA (SEQ ID NO: 35) comprises a premature STOP codon at position 1264 as set forth in SEQ ID NO: 38, and iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto; wherein at least one mutation of the nucleic acid encoding PtaA (SEQ ID NO: 25) comprises or consists of a premature STOP codon at position 916 as set forth in SEQ ID NO: 28, P7053PC00 wherein the cell comprises a constitutive promoter, such as KasOp constitutivepromoter of SEQ ID NO: 40, upstream of the nucleic acid encoding SplA (SEQ ID NO: 42), and wherein the cell produces the compound with a 2-fold increased titre compared to a reference cell or more, such as a 3-fold increased titre or more, such as a 4-fold increased titre or more, such as a 5-fold increased titre or more, such as a 6-fold increased titre or more, such as a 7-fold increased titre or more, such as a 7.3- fold increased titre.37. The Streptomyces cell of any of the preceding items, wherein the cell is S.iranensis.38. The Streptomyces cell of any of the preceding items, wherein the cell is S. albus.39. The Streptomyces cell of any of the preceding items, wherein the cell is S.lividans.40. The Streptomyces cell of any of the preceding items, wherein the cell is S.coelicolor.41. The Streptomyces cell of any of the preceding items, wherein the cell is capableof producing a titre of 5 mg / L or more of the compound, such as 10 mg / L or more, such as 20 mg / L or more, such as 30 mg / L or more, such as 40 mg / L or more, such as 50 mg / L or more, such as 60 mg / L or more, such as 70 mg / L or more, such as 80 mg / L or more, such as 90 mg / L or more, such as 100 mg / L or more of the compound.42. The Streptomyces cell of any of the preceding items, wherein the compound hasformula (III): P7053PC00 or is a salt or solvate thereof.43. The Streptomyces cell according to any of the preceding items, wherein R1 ishydroxy.44. The Streptomyces cell according to any of the preceding items, wherein R2 ishydroxy.45. The Streptomyces cell according to any of the preceding items, wherein R3 ismethoxy.46. The Streptomyces cell according to any of the preceding items, wherein R4 ishydroxy.47. The Streptomyces cell according to any of the preceding items, wherein R4 is aC1-6alkyl.48. The Streptomyces cell according to any of the preceding items, wherein R4 ismethyl.49. The Streptomyces cell according to any of the preceding items, wherein R5 ishydroxyl. P7053PC0050. The Streptomyces cell according to any of the preceding items, wherein R5 is aC1-8alkyl.51. The Streptomyces cell according to any of the preceding items, wherein R5 ishalogen.52. The Streptomyces cell according to any of the preceding items, wherein R5 isoxo.53. The Streptomyces cell according to any of the preceding items, wherein R5 ishydroxy.54. The Streptomyces cell according to any of the preceding items, wherein R5 ismethoxy.55. The Streptomyces cell according to any of the preceding items, wherein R5 hasformula (II):

[0007] P7053PC0056. The Streptomyces cell according to any of the preceding items, wherein R1 is –hydroxy, R2is hydroxy, R3is methoxy, R4is hydroxy, R5is and the compound has formula (III): (III)57. Use of the Streptomyces cell of any of the preceding items for the production ofthe compound.58. The use of item 57, wherein the compound is as defined in any of the precedingitems.59. A method of increasing the production of the compound of formula (I), P7053PC00 or a derivative thereof, such as an acceptable derivative thereof, such as a salt or solvate thereof; wherein, R4 is independently selected from the group consisting of: hydrogen, hydroxy,alkyl and halogen; R1, R2and R3is selected from the group consisting of: hydrogen; oxo; hydroxy; and methoxy; R5is selected from the group consisting of hydrogen; alkyl; halogen; oxo; hydroxy; methoxy; and formula (II): in a Streptomyces cell, preferably an S. iranensis cell, the method comprising introducing in said cell at least one mutation resulting in reduced biosynthesis of one or more of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; P7053PC00 ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; and iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto.60. The method according to item 59, wherein the cell, the compound and the at leastone mutation are as defined in any one of items 1-58, preferably wherein the compound is as defined in item 56.61. The method according to any one of items 59-60, wherein the mutation results inreduced biosynthesis of one or more of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; and iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto.62. The method according to any one of items 59-61, wherein the mutation isintroduced in the coding sequence or in the promoter sequence of ptaA, or of a homologue thereof having at least 70% identity thereto.63. The method according to any one of items 59-62, wherein the mutation isintroduced in the coding sequence or in the promoter sequence of azaA, or of a homologue thereof having at least 70% identity thereto.64. The method according to any one of items 59-63, wherein the mutation isintroduced in the coding sequence or in the promoter sequence of nigA, or of a homologue thereof having at least 70% identity thereto. P7053PC0065. The method according to any one of items 59-64, wherein the cell produces anincreased titer of the compound versus a reference cell, which does not comprise said at least one mutation resulting in reduced biosynthesis of one or more of azalomycin, nigericin and pteridic acids.66. The method according to any one of items 59-65, wherein the reduction of activityis partial or total.67. The method according to any one of items 59-66, wherein the synthesis of thecompound in said Streptomyces cell is increased compared to a reference cell byat least 1.5-fold, such as at least 1.8-fold, such as at least 2-fold, such as at least 3-fold, such as at least 4-fold, such as at least 4.5-fold, such as at least 5-fold, such as at least 6-fold, such as at least 7-fold, such as at least 7.3-fold, such as atleast 8-fold, such as at least 9-fold, such as at least 10-fold.68. The method according to any one of items 59-67, wherein the synthesis of thecompound in said Streptomyces cell is increased compared to a reference cell byat least 4.5-fold.69. The method according to any one of items 59-68, wherein the synthesis of thecompound in said Streptomyces cell is increased compared to a reference cell byat least 7.3-fold.70. The method according to any one of items 59-69, wherein said at least onemutation results in reduced biosynthesis of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; and ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; and iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto. P7053PC0071. The method according to any one of items 59-70, wherein said at least onemutation is two mutations resulting in reduced biosynthesis of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; and ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto.72. The method according to any one of items 59-71, wherein said at least onemutation is two mutations resulting in reduced biosynthesis of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; and ii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto.73. The method according to any one of items 59-72, wherein said at least onemutation is two mutations resulting in reduced biosynthesis of: i) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; and ii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto.74. The method according to any one of items 59-73, wherein the reduction of activityof AzaA is achieved by mutating or deleting azaA (SEQ ID NO: 30), or ahomologue thereof having at least 70% identity thereto.75. The method according to any one of items 59-74, wherein the mutated AzaA is atruncated AzaA comprising at the most 73 consecutive amino acids of AzaA of SEQ ID NO: 31, or a homologue thereof having at least 70% identity thereto. P7053PC0076. The method according to any one of items 59-75, wherein the reduction of activityof NigA is achieved by mutating or deleting nigA (SEQ ID NO: 35), or ahomologue thereof having at least 70% identity thereto.77. The method according to any one of items 59-76, wherein the mutated NigA is atruncated nigA comprising at the most 1263 consecutive amino acids of NigA of SEQ ID NO: 36, or a homologue thereof having at least 70% identity thereto.78. The method according to any one of items 59-77, wherein the reduction of activityof PtaA is achieved by mutating or deleting ptaA (SEQ ID NO: 26), or ahomologue thereof having at least 70% identity thereto.79. The method according to any one of items 59-78, wherein the at least onemutation results in a truncated ptaA comprising at the most 915 consecutive amino acids of PtaA of SEQ ID NO: 26, or a homologue thereof having at least70% identity thereto.80. The method according to any one of items 59-79, wherein at least one of thesequences encoding PtaA; AzaA; or NigA comprises a premature STOP codon.81. The method according to any one of items 59-80, wherein the nucleic acidencoding PtaA comprises a premature STOP codon.82. The method according to any one of items 59-81, wherein the nucleic acidencoding PtaA comprises a premature STOP codon at position 916 as set forth inSEQ ID NO: 28.83. The method according to any one of items 59-82, wherein the nucleic acidencoding AzaA comprises a premature STOP codon at position 78 as set forth inSEQ ID NO: 33.84. The method according to any one of items 59-83, wherein the nucleic acidencoding NigA comprises a premature STOP codon at position 1264 as set forth in SEQ ID NO: 38. P7053PC0085. The method according to any one of items 59-84, wherein the nucleic acidsencoding PtaA or AzaA comprise a premature STOP codon.86. The method according to any one of items 59-85, wherein the nucleic acidsencoding PtaA or NigA comprise a premature STOP codon.87. The method according to any one of items 59-86, wherein the nucleic acidsencoding AzaA and NigA comprises a premature STOP codon.88. The method according to any one of items 59-87, wherein a constitutivepromoter, has been introduced upstream of splA, or of a homologue thereof having at least 70% identity thereto.89. The method according to any one of items 59-88, wherein a constitutivepromoter, such as KasOp constitutive promoter of SEQ ID NO: 40, has been introduced upstream of splA or of a homologue thereof having at least 70%identity thereto.90. The method according to any one of items 59-89, wherein the cell is S. iranensis,S. albus, S. albidoflavus, S. lividans or S. coelicolor.91. The method according to any one of items 59-90, wherein the cell is capable ofproducing a titre of 5 mg / L or more of the compound, such as 10 mg / L or more, such as 20 mg / L or more, such as 30 mg / L or more, such as 40 mg / L or more, such as 50 mg / L or more, such as 60 mg / L or more, such as 70 mg / L or more, such as 80 mg / L or more, such as 90 mg / L or more, such as 100 mg / L or more of the compound.92. A method of modifying a Streptomyces cell to increase the compound offormula (I) production in said Streptomyces cell, said method comprising thesteps of: i) providing a Streptomyces cell capable of synthesising the compound offormula (I), ii) introducing in said cell at least one mutation resulting in reducedbiosynthesis of one or more of: P7053PC00 i. azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; ii. nigericin, preferably wherein the cell has reduced activity of NigA(SEQ ID NO: 36) or a functional variant thereof having at least 60% identity thereto; and iii. pteridic acids, preferably wherein the cell has reduced activity ofPtaA (SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto iii) incubating said Streptomyces cell in a medium,iv) thereby obtaining said cell capable of producing the compound of formula(I) with an increased titre compared to a reference cell, which does notcomprise said at least one mutation resulting in reduced biosynthesis of one or more of azalomycin, nigericin and pteridic acids.93. The method according to item 92, wherein the Streptomyces cell, the at least onemutation, the reference cell, the compound and the increased titre are as definedin any of items 1-58.94. A method for production of the compound of formula (I), the methodcomprising providing the Streptomyces cell of any of the preceding items, andculturing said Streptomyces cell in a culture medium, preferably wherein thecompound of formula (I) is produced with a titre of 5 mg / L or more, such as 10mg / L or more, such as 20 mg / L or more, such as 30 mg / L or more, such as 40 mg / L or more, such as 50 mg / L or more, such as 60 mg / L or more, such as 70 mg / L or more, such as 80 mg / L or more, such as 90 mg / L or more, such as 100 mg / L or more.95. The method of item 94, further comprising the step of recovering the compoundfrom the culture medium.96. The method of any one of items 94-95, further comprising the step of purifyingthe compound from the culture medium.97. The compound of formula (I), P7053PC00 or a derivative thereof, such as an acceptable derivative thereof, such as a salt or solvate thereof; wherein, R4is independently selected from the group consisting of: hydrogen, hydroxy, alkyl and halogen; R1, R2and R3is selected from the group consisting of: hydrogen; oxo; hydroxy; and methoxy; R5is selected from the group consisting of hydrogen; alkyl; halogen; oxo; hydroxy; methoxy; and formula (II): obtainable by the method according to items 59-90.98. A nucleic acid construct for modifying a Streptomyces cell, comprising one ormore nucleic acids comprising at least one mutation resulting in reducedbiosynthesis of one of more of: P7053PC00 i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; and iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto, when said nucleic acids are introduced in said cell.99. The nucleic acid construct of item 98, said construct comprising at least one of:i) a polynucleotide encoding AzaA (SEQ ID NO: 31) or a functional variantthereof having at least 60% identity thereto, capable of reducing the biosynthesis of azalomycin, and / or ii) a polynucleotide encoding NigA (SEQ ID NO: 36) or a functional variantthereof having at least 60% identity thereto, capable of reducing the biosynthesis of nigericin, and / or iii) a polynucleotide encoding PtaA (SEQ ID NO: 26) or a functional variantthereof having at least 60% identity thereto, capable of reducing the biosynthesis of pteridic acids. wherein optionally the at least one polynucleotide is under the control of a promoter. 100. The nucleic acid construct according to items 98-99, wherein thenucleic acid construct comprises at least one polynucleotide for reducing the activity of: i) AzaA (SEQ ID NO: 31) or a functional variant thereof having at least60% identity thereto; and / or ii) NigA (SEQ ID NO: 36) or a functional variant thereof having at least60% identity thereto, and / or, wherein optionally the at least one polynucleotide is under the control of a promoter. P7053PC00101. The nucleic acid construct of items 98-100, wherein the nucleic acidconstruct comprises at least one polynucleotide for reducing the activity of: i) AzaA (SEQ ID NO: 31) or a functional variant thereof having at least60% identity thereto; and / or ii) PtaA (SEQ ID NO: 26) or a functional variant thereof having at least60% identity thereto; i. wherein optionally the at least one polynucleotide is under thecontrol of a promoter.102. The nucleic acid construct of items 98-101, wherein the nucleic acidconstruct comprises at least one polynucleotide for reducing the activity of: i) NigA (SEQ ID NO: 36) or a functional variant thereof having at least60% identity thereto, and / or, ii) PtaA (SEQ ID NO: 26) or a functional variant thereof having at least60% identity thereto; i. wherein optionally the at least one polynucleotide is under thecontrol of a promoter.

Claims

P7053PC00 Claims 1. A Streptomyces cell, preferably a Streptomyces iranensis cell, capable ofproducing the compound of formula (I),or a derivative thereof, such as an acceptable derivative thereof, such as a salt or solvate thereof; wherein, R4 is independently selected from the group consisting of: hydrogen, hydroxy, alkyl and halogen; R1, R2 and R3 is selected from the group consisting of: hydrogen; oxo; hydroxy; and methoxy; R5 is selected from the group consisting of hydrogen; alkyl; halogen; oxo; hydroxy; methoxy; and formula (II):(II), said cell having at least one mutation resulting in reduced biosynthesis of one or more of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto;P7053PC00 ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; and iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto.

2. The Streptomyces cell of any of claim 1, wherein the cell produces thecompound with an increased titre compared to a reference cell which does notcomprise said at least one mutation resulting in reduced biosynthesis of one or more of azalomycin, nigericin and pteridic acids.

3. The Streptomyces cell of any of the preceding claims, wherein the productionof the compound in said Streptomyces cell is increased compared to acorresponding reference cell by at least 1.5-fold, such as at least 1.8-fold, such as at least 2-fold, such as at least 3-fold, such as at least 4-fold, such as at least 4.5-fold, such as at least 5-fold, such as at least 6-fold, such as at least 7- fold, such as at least 7.3-fold, such as at least 8-fold, such as at least 9-fold, such as at least 10-fold.

4. The Streptomyces cell of any of the preceding claims, wherein the productionof the compound is increased compared to a reference cell by at least 7.3-fold.

5. The Streptomyces cell of any of the preceding claims, wherein said at least onemutation is one mutation, two mutations or three mutations resulting in reducedbiosynthesis of: i) azalomycin, wherein the cell has reduced activity of AzaA (SEQ ID NO:31) or a functional variant thereof having at least 60% identity thereto; ii) nigericin, wherein the cell has reduced activity of NigA (SEQ ID NO: 36)or a functional variant thereof having at least 60% identity thereto; or iii) pteridic acids, wherein the cell has reduced activity of PtaA (SEQ ID NO:26) or a functional variant thereof having at least 60% identity thereto.

6. The Streptomyces cell of any of the preceding claims, wherein the nucleicacids encoding PtaA (SEQ ID NO: 25); AzaA (SEQ ID NO: 30); or NigA (SEQP7053PC00 ID NO: 35), or a homologue thereof having at least 70% identity thereto, comprise a premature STOP codon.

7. The Streptomyces cell of any of the preceding claims, wherein the cellcomprises a constitutive promoter, upstream of the nucleic acid encoding SplA (SEQ ID NO: 41) or of a homologue thereof having at least 70% identitythereto.

8. The Streptomyces cell of any of the preceding claims, wherein the cellcomprises a constitutive promoter, such as KasOp constitutive promoter of SEQ ID NO: 40, upstream of the nucleic acid encoding SplA (SEQ ID NO: 42) or of a homologue thereof having at least 70% identity thereto.

9. The Streptomyces cell of any of the preceding claims, wherein the cell iscapable of producing a titre of 5 mg / L or more of the compound, such as 10 mg / L or more, such as 20 mg / L or more, such as 30 mg / L or more, such as 40 mg / L or more, such as 50 mg / L or more, such as 60 mg / L or more, such as 70 mg / L or more, such as 80 mg / L or more, such as 90 mg / L or more, such as 100 mg / L or more of the compound.

10. The Streptomyces cell of any of the preceding claims, wherein the compoundhas formula (III):(II)P7053PC00 or is a salt or solvate thereof.

11. A method of increasing the production of the compound of formula (I),or a derivative thereof, such as an acceptable derivative thereof, such as a salt or solvate thereof; wherein, R4 is independently selected from the group consisting of: hydrogen, hydroxy, alkyl and halogen; R1, R2 and R3 is selected from the group consisting of: hydrogen; oxo; hydroxy; and methoxy; R5 is selected from the group consisting of hydrogen; alkyl; halogen; oxo; hydroxy; methoxy; and formula (II):(II), in a Streptomyces cell, preferably an S. iranensis cell, the method comprising introducing in said cell at least one mutation resulting in reduced biosynthesis of one or more of:P7053PC00 i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; and iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto, preferably, wherein the cell, the compound and the at least one mutation are as defined in any one of claims 1-10, preferably wherein the compound is asdefined in claim 10.

12. The method of claim 11, wherein the mutation results in reduced biosynthesisof one or more of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; and iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto.

13. The method of any of claims 11-12, wherein the cell produces an increasedtiter of the compound versus a reference cell, which does not comprise said at least one mutation resulting in reduced biosynthesis of one or more of azalomycin, nigericin and pteridic acids.

14. A method of modifying a Streptomyces cell to increase the compoundproduction in said Streptomyces cell, said method comprising the steps of:P7053PC00or a derivative thereof, such as an acceptable derivative thereof, such as a salt or solvate thereof; wherein, R4is independently selected from the group consisting of: hydrogen, hydroxy, alkyl and halogen; R1, R2and R3is selected from the group consisting of: hydrogen; oxo; hydroxy; and methoxy; R5is selected from the group consisting of hydrogen; alkyl; halogen; oxo; hydroxy; methoxy; and formula (II):(II), i) introducing in said cell at least one mutation resulting in reducedbiosynthesis of one or more of: i. azalomycin, preferably wherein the cell has reduced activity ofAzaA (SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto;P7053PC00 ii. nigericin, preferably wherein the cell has reduced activity of NigA(SEQ ID NO: 36) or a functional variant thereof having at least 60% identity thereto; and iii. pteridic acids, preferably wherein the cell has reduced activity ofPtaA (SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto ii) incubating said Streptomyces cell in a medium,thereby obtaining said cell capable of producing the compound with anincreased titre compared to a reference cell, which does not comprise said at least one mutation resulting in reduced biosynthesis of one or more of azalomycin, nigericin and pteridic acids.

15. A nucleic acid construct for modifying a Streptomyces cell, comprising one ormore nucleic acids comprising at least one mutation resulting in reduced biosynthesis of one of more of: i) azalomycin, preferably wherein the cell has reduced activity of AzaA(SEQ ID NO: 31) or a functional variant thereof having at least 60% identity thereto; ii) nigericin, preferably wherein the cell has reduced activity of NigA (SEQID NO: 36) or a functional variant thereof having at least 60% identity thereto; and iii) pteridic acids, preferably wherein the cell has reduced activity of PtaA(SEQ ID NO: 26) or a functional variant thereof having at least 60% identity thereto, when said nucleic acids are introduced in said cell.

Citation Information

Patent Citations

  • Spirolactone as a novel antimicrobial lead

    WO2024003331A1

  • Method for improving production of streptomyces polyketide compounds

    WO2020233506A1

Cited By

  • Streptomyces albidoflavus and application thereof

    CN122381969A