Targeted base editors for treating SCN8a SNP-based pediatric epilepsy

Abstract

To address most recurrent pathogenic mutations associated with SCN8A-related epileptic encephalopathy, disclosed herein are SCN8A-targeting adenine or cytosine base editors designed to correct the following clinically relevant SCN8A gene variants: R1872W, R1872Q, R1617Q, R850Q, N1877S, and G1475R. By targeting these six recurrent genetic mutations, a personalized gene therapy solution for this type of pediatric epilepsy is provided.

Description

TARGETED BASE EDITORS FOR TREATING SCN8A SNP-BASEDPEDIATRIC EPILEPSYCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit of priority from U.S. Provisional Application No. 63 / 618,620, filed on January 8, 2024, which is incorporated by reference herein in its entirety.SEQUENCE LISTING

[0002] This application contains a computer readable Sequence Listing which has been submitted electronically in XML format with this application, and is incorporated herein by reference in its entirety. The Sequence Listing XML file submitted with this application was created on January 7, 2025; is named “UVA0004PCT.xml” and is 170,489 bytes in size. The Sequence Listing does not go beyond the disclosure in the application as filed.BACKGROUND

[0003] SCN8A is the gene that encodes Nav1.6, a sodium channel isoform heavily expressed in the brain and is essential for the initiation and propagation of action potentials in excitable cells1. It is highly expressed in both excitatory and inhibitory neurons, localized primarily at nodes of Ranvier and the axon initial segment (AIS)2,3. Over 500 individuals with mutations resulting in SCN8A developmental and epileptic encephalopathy (DEE) have been identified, with primarily de novo mutations that typically result in gain-of-function missense substitutions4. These mutations are associated with spontaneous seizures and sudden unexpected death in epilepsy (SUDEP) and a range of comorbidities, including movement disorders, developmental delay, and cognitive dysfunction5. Among these gain-of-function mutations, two single nucleotide polymorphisms (SNPs), R1617Q and R1872W, are recurrent in 20% of SCN8A DEE cases67.

[0004] The SCN8A protein encodes approximately 1,732 amino acids, with two amino acid single nucleotide polymorphisms (SNPs), R1617Q and R1872W, being the sites of mutation in 20% of EIEE13 (Early infantile epileptic encephalopathy). The genetic loci coding for Arg 1617 and Arg 1872 exhibit a high frequency of mutations as their genomic location is characterized as a CpG dinucleotide hotspot. R1617Q is located in a voltage-responsivetransmembrane segment (Fig. 1) and results in impaired neuronal voltage-dependence inactivation and a dramatically slower decay of the propagated current. The SNP R1872W is located in the cytoplasmic C-terminal domain (Fig. 1). This C-terminal portion contributes to stabilizing the inactivation of the Navi.6 channel which allows proper recovery during the return of a neuron to resting potential. The presence of either single nucleotide polymorphism within the SCN8a gene leads to heightened excitability in neurons harboring these mutations, explaining the overexcitation underlying seizures in affected patients. Clinical findings indicate a considerable portion of these patients are unresponsive to existing epileptic treatments, therefore underscoring the critical need for more personalized and comprehensive novel therapeutic strategies for this pediatric population. Half of caregiver respondents report trying and stopping 4 or more antiseizure medications, representing a high medication turnover and failure rate indicating a general patient and practitioner dissatisfaction with current therapies.

[0005] SCN8A early infantile epileptic encephalopathy (EIEE13) is a severe form of genetic epilepsy, originating from de novo mutations in the SCN8A gene that encodes the sodium channel Navi.6, a voltage-gated sodium channel transmembrane protein essential for initiation and propagation of the action potential in most excitable cells. The majority of these mutations are classified as gain-of-function. Infants carrying one of these SCN8A mutations experience extensive seizures, risk of SUDEP, and suffer from cognitive and motor impairments.

[0006] Presently, the treatment options for SCN8A epileptic encephalopathy are unable to address the underlying genetic defects driving the disease, and thus cannot fully mitigate symptoms or prevent mortality. Treatments that target genetic mutations, the root cause of SCHN8A epilepsy are needed and would be a major advance for SCN8A epileptic encephalopathy treatment.SUMMARY OF THE DISCLOSURE

[0007] By targeting the root cause of SCN8A epilepsy, which is a SCN8A gene with genetic mutations or a SCN8Agene with a single nucleotide polymorphism (SNP), we provide personalized gene therapy solutions for this form of pediatric epilepsy.

[0008] In one aspect, described herein is a SCN8A R1872W-targeting adenine base editor that comprises an adenine base editor; and a SCN8 A targeting protospacer guide selected from SEQ ID NOs 1-32, or a SCN8A targeting protospacer guide that is at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleic acid sequence selected from SEQ ID NOs: 1-32.

[0009] In some embodiments, the adenine base editor is SpRY-ABEmax HiFi, SpRY- ABEmax, SpRY-ABE8e HiFi, SpRY-ABE8e, eNme2-T. l and T.2-ABE8e, eNme2.C-ABE8e, ABEmax-NRCH, ABEmax-NG, ABE8e-NRCH, ABE8e-NG, ABE8e[TadAV106W]-NRCH, ABE8e[TadAV106W]-NG, or ABE8e[TadAV106W] and the SCN8A targeting protospacer guide is a human protospacer guide selected from SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, and 31.

[0010] In some embodiments, the adenine base editor is SpRY-ABEmax HiFi, SpRY- ABEmax, SpRY-ABE8e HiFi, SpRY-ABE8e, eNme2-T.l and T.2-ABE8e, eNme2.C-ABE8e, ABEmax-NRCH, ABEmax-NG, ABE8e-NRCH, ABE8e-NG, ABE8e[TadAV106W]-NRCH, ABE8e[TadAV106W]-NG, or ABE8e[TadAV106W] and the SCN8A targeting protospacer guide is a mouse protospacer guide selected from SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, and 32.

[0011] In one aspect, described herein is a SCN8A R1617Q-targeting adenine base editor that comprises an adenine base editor; and a SCN8 A targeting protospacer guide selected from SEQ ID NOs 33-66, or a SCN8A targeting protospacer guide that is at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 33-66.

[0012] In some embodiments, the adenine base editor is SpRY-ABEmax HiFi, SpRY- ABEmax, SpRY-ABE8e HiFi, SpRY-ABE8e, eNme2-T.l and T.2-ABE8e, eNme2.C-ABE8e, ABEmax-NRTH, ABEmax-NRCH, ABEmax-NG, ABEmax, ABE8e-NRTH, ABE8e-NRCH, ABE8e-NG, ABE8e[TadAV106W]-NRTH, ABE8e[TadAV106W]-NRCH,ABE8e[TadAV106W]-NG, ABE8e[TadAV106W], or ABE8e and the SCN8A targeting protospacer guide is a human protospacer guide selected from SEQ ID NOs: 33, 35, 37, 39, 41,43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65.

[0013] In some embodiments, the adenine base editor is SpRY-ABEmax HiFi, SpRY- ABEmax, SpRY-ABE8e HiFi, SpRY-ABE8e, eNme2-T.l and T.2-ABE8e, eNme2.C-ABE8e, ABEmax-NRTH, ABEmax-NRCH, ABEmax-NG, ABEmax, ABE8e-NRTH, ABE8e-NRCH, ABE8e-NG, ABE8e[TadAV106W]-NRTH, ABE8e[TadAV106W]-NRCH,ABE8e[TadAV106W]-NG, ABE8e[TadAV106W], or ABE8e and the SCN8A targeting protospacer guide is a mouse protospacer guide selected from SEQ ID NOs: 34, 36, 38, 40, 42,44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66.

[0014] In one aspect, described herein is a SCN8A G 1475 R- targeting adenine base editor that comprises an adenine base editor; and a SCN 8 A targeting protospacer guide selected from SEQ ID NOs 67-96, or a SCN8A targeting protospacer guide that is at least 85%, at least90%, at least 95%, at least 98% or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 67-96.

[0015] In some embodiments, the adenine base editor is SpRY-ABEmax HiFi, SpRY- ABEmax, SpRY-ABE8e HiFi, SpRY-ABE8e, eNme2.C-ABE8e, ABEmax-NRRH, ABEmax- NG, ABE8e[TadAV106W]-NRRH, ABE8e[TadAV106W]-NG, ABE8e-NRRH, or ABE8e-NG and the SCN8A targeting protospacer guide is a human protospacer guide selected from SEQ ID NOs: 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, and 95.

[0016] In some embodiments, the adenine base editor is SpRY-ABEmax HiFi, SpRY- ABEmax, SpRY-ABE8e HiFi, SpRY-ABE8e, eNme2.C-ABE8e, ABEmax-NRRH, ABEmax- NG, ABE8e[TadAV106W]-NRRH, ABE8e[TadAV106W]-NG, ABE8e-NRRH, or ABE8e-NG and the SCN8A targeting protospacer guide is a mouse protospacer guide selected from SEQ ID NOs: 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, and 96.

[0017] In one aspect, described herein is a SCN8A R850Q-targeting adenine base editor that comprises an adenine base editor; and a SCN8 A targeting protospacer guide selected from SEQ ID NOs 97-111, or a SCN8A targeting protospacer guide that is at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 97-111.

[0018] In some embodiments, the adenine base editor is SpRY-ABE8e, SpRY-ABE8e HiFi, SpRY-ABEmax, SpRY-ABEmax HiFi, eNme2.C-ABE8e, ABE8e-NG, ABE8e-NRCH, ABE8e[TadAV106W]-NG, ABEmax-NG, ABEmax-NRCH, ABE8e-NRRH, ABE8e[TadAV106W]-NRCH, ABE8e[TadAV106W]-NRRH, ABEmax-NRRH, ABE8e- iSpyMac, ABE8e-SpyMac, ABEmax-iSpyMac, ABEmax-SpyMac, ABE8e, ABE8e[TadAV106W], or ABEmax and the SCN8A targeting protospacer guide is a human protospacer guide selected from SEQ ID NOs: 97-111.

[0019] In some embodiments, the adenine base editor is SpRY-ABE8e, SpRY-ABE8e HiFi, SpRY-ABEmax, SpRY-ABEmax HiFi, eNme2.C-ABE8e, ABE8e-NG, ABE8e-NRCH, ABE8e[TadAV106W]-NG, ABEmax-NG, ABEmax-NRCH, ABE8e-NRRH, ABE8e[TadAV106W]-NRCH, ABE8e[TadAV106W]-NRRH, ABEmax-NRRH, ABE8e- iSpyMac, ABE8e-SpyMac, ABEmax-iSpyMac, ABEmax-SpyMac, ABE8e, ABE8e[TadAV106W], or ABEmax and the SCN8A targeting protospacer guide is a mouse protospacer guide selected from SEQ ID NOs: 97-111.

[0020] In one aspect, described herein is a SCN8A R1872Q-targeting adenine base editor that comprises an adenine base editor; and a SCN 8 A targeting protospacer guide selected from SEQ ID NOs 112-139, or a SCN8A targeting protospacer guide that is at least 85%, atleast 90%, at least 95%, at least 98% or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 112-139.

[0021] In some embodiments, the adenine base editor is SpRY-ABE8e, SpRY-ABE8e HiFi, SpRY-ABEmax, SpRY-ABEmax HiFi, eNme2.C-ABE8e, ABE8e-NRRH, ABE8e[TadAV106W]-NRRH, ABEmax-NRRH, ABE8e-iSpyMac, ABE8e-SpyMac, ABEmax-iSpyMac, ABEmax-SpyMac, ABE8e-NRTH, ABE8e[TadAV106W]-NRTH, ABEmax-NRTH, or xCas9 3.7-ABE and the SCN8A targeting protospacer guide is a human protospacer guide selected from SEQ ID NOs: 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, and 138.

[0022] In some embodiments, the adenine base editor is SpRY-ABE8e, SpRY-ABE8e HiFi, SpRY-ABEmax, SpRY-ABEmax HiFi, eNme2.C-ABE8e, ABE8e-NRRH, ABE8e[TadAV106W]-NRRH, ABEmax-NRRH, ABE8e-iSpyMac, ABE8e-SpyMac, ABEmax-iSpyMac, ABEmax-SpyMac, ABE8e-NRTH, ABE8e[TadAV106W]-NRTH, ABEmax-NRTH, or xCas9 3.7-ABE and the SCN8A targeting protospacer guide is a mouse protospacer guide selected from SEQ ID NOs: 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, and 139.

[0023] In one aspect, described herein is a SCN8A N1877S-targeting cytosine base editor comprising a cytosine base editor; and a SCN8A targeting protospacer guide selected from SEQ ID NOs 140-175, or a SCN8A targeting protospacer guide that is at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 140-175.

[0024] In some embodiments, the cytosine base editor is SpRY-BE4, SpRY-BE4max, SpRY-CBE6varients, eNme2-C-BE4, eNme2-C-CBE6varients, BE4-NRCH, BE4-NRRH, BE4max-NRCH, BE4max-NRRH, CBE6varients-NRCH, CBE6varients-NRRH, SpCas9 TadCBEd-V106W-NRCH, SpCas9 TadCBEd-V106W-NRRH, BE4-NG, BE4max-NG, CBE6varients-NG, iSpyMac-BE3, iSpyMacBE4, SpCas9 TadCBEd-V106W-NG, SpyMac- BE3, SpyMacBE4, or SpyMacCBE6varients and the SCN8A targeting protospacer guide is a human protospacer guide selected from SEQ ID NOs: 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, and 174.

[0025] In some embodiments, the cytosine base editor is SpRY-BE4, SpRY-BE4max, SpRY-CBE6varients, eNme2-C-BE4, eNme2-C-CBE6varients, BE4-NRCH, BE4-NRRH, BE4max-NRCH, BE4max-NRRH, CBE6varients-NRCH, CBE6varients-NRRH, SpCas9 TadCBEd-V106W-NRCH, SpCas9 TadCBEd-V106W-NRRH, BE4-NG, BE4max-NG, CBE6varients-NG, iSpyMac-BE3, iSpyMacBE4, SpCas9 TadCBEd-V106W-NG, SpyMac-BE3, SpyMacBE4, or SpyMacCBE6varients and the SCN8A targeting protospacer guide is a mouse protospacer guide selected from SEQ ID NOs: 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, and 175.

[0026] In another aspect, described herein is a vector that comprises a SCN8A R1872W-targeting adenine base editor, a SCN8A R1617Q-targeting adenine base editor, a SCN8A G1475R-targeting adenine base editor, a SCN8AR850Q-targeting adenine base editor, a SCN8A R1872Q-targeting adenine base editor, or a SCN8A N1877S-targeting cytosine base editor. In some embodiments, the vector is a retroviral vector, a lentiviral vector, a phage vector, an adenoviral vector, an adeno-associated virus (AAV) vector, or a herpes simplex vector. In some embodiments, the vector is delivered into a cell, a tissue or a subject with a delivery system comprising a lipid, a nanoparticle, a lipid nanoparticle, a liposome, an exosome, a microvesicle, or a gene-gun.

[0027] In another aspect, described herein is a method of modifying a SCN8A gene or a SCN8A gene with a single nucleotide polymorphism (SNP), or a cell that has incorporated the SCN8A gene or the SCN8A gene with a SNR In some embodiments, the method comprises contacting the SCN8A gene, a SCN8A gene with a SNP, or the cell with a base editor. In some embodiments, the base editor is a SCN8A R1872W-targeting adenine base editor, a SCN8A R1617Q-targeting adenine base editor, a SCN8A G1475R-targeting adenine base editor, a SCN8A R850Q-targeting adenine base editor, a SCN8A R1872Q-targeting cytosine base editor, or a SCN8A N1877S-targeting adenine base editor.

[0028] In another aspect, described herein is a method of treating a disease or disorder associated a SCN8A gene or a SCN8A gene with a single-nucleotide polymorphism (SNP) in a subject in need thereof. In some embodiments, the subject has been diagnosed with a neurodevelopmental disorder, wherein the neurodevelopmental disorder is selected from Early Infantile Epileptic Encephalopathy (EIEE), Dravet Syndrome, West Syndrome (Infantile Spasms), Lennox-Gastaut Syndrome, Ohtahara Syndrome and Pontocerebellar Hypoplasia. In some embodiments, the method comprises administering to the subject a base editor. In some embodiments, the administration comprises administering the subject a SCN8A R1872W- targeting adenine base editor, a SCN8A R1617Q-targeting adenine base editor, a SCN8A G1475R-targeting adenine base editor, a SCN8A R850Q-targeting adenine base editor, a SCN8A R1872Q-targeting adenine base editor, or a SCN8A N1877S-targeting cytosine base editor.BRIEF DESCRIPTION OF THE DRAWINGS

[0029] A better understanding of features and advantages of the present disclosure will be obtained by reference to the following detailed description, which sets forth illustrative embodiments of the disclosure, and the accompanying drawings.

[0030] Fig. 1. Schematic of the mutations in the voltage-gated sodium channel gene (SCN8A). The locations of the mutation in the channel protein are highlighted for all 6 variants: R1872W, R1872Q, R1617Q, R850Q, N1877S, and G1475R.

[0031] Fig. 2. Workflow for developing and validating the base editing construct targeting the R1872W loci. The lead construct was selected based on efficacy during in vitro screens and subsequently was packaged into an adeno-associated virus (AAV) system for in vivo delivery. In vivo analysis included immunohistochemical (IHC) imaging to assess protein expression, electrophysiology to measure neuronal function, next-generation sequencing (NGS) for barcode verification of edits, and behavioral studies (EEG monitoring and cognitive assessments) to examine the impact on neurological and behavioral phenotypes.

[0032] Fig. 3. Preliminary Construct Test. Sanger sequence analysis of Sanger sequencing analysis of R1872W position in mouse SCN8A shows ~30% conversion from A to G in the mice treated with our base editor containing a R1872W targeting protospacer vs. untreated mice. The arrow denotes the change in the base.

[0033] Figs. 4A-B. Scn8aW / + / EIIaCre Adjacent Litter Survival and Sequencing. FIG. 4A shows the survival of Scn8aW / + / EIIaCre mouse neonates injected with the base editor containing a R1872W targeting protospacer at P0 (outer line) vs uninjected Scn8aW / + / EIIaCre mouse neonates. All control mice succumbed to seizures on days 15 or 16. 3 treated mice lived past 21 days and one lived for 75 days. FIG. 4B. Sanger sequencing detected 15-33% G in all but one treated mouse (indicated by arrows) but no observable G reads in the control C+ / EIIA-Cre mice.

[0034] Fig. 5. R1872W Scn8aW / + / EIIaCre Next Generation Reads A to G (T to C) Conversion for ICV injected mice.

[0035] Fig. 6. R1872W Scn8aW / + / EIIaCre Next Generation Reads A to G (T to C) Conversion for mice freehand injected into each ventricle.

[0036] Fig. 7. Scn8aW / + / EMXlCre Adjacent Litter Survival for ICV injected mice. The graph shows survival of mice injected with the base editor containing a R1872W targeting protospacer at P0 (outer line) vs uninjected control mice. All control mice succumbed to seizures between days 21 and 31, but 75% of injected mice were still alive on day 60.

[0037] Fig. 8. Schematic representation of the adenine base editing process on the R1872W loci. Light base highlights the conversion of target adenine to inosine by the base editor deaminase domain to be converted to guanine by innate base excision and mismatch repair.

[0038] Figs. 9A-B. On-target adenine conversion efficiencies of various constructs. On-target adenine conversion efficiencies of various constructs are characterized by protospacer positions and PAM sequences, tested with different adenine base editor variants. HEK293 human cell screen (Fig. 9A) and CHO rodent cell screen (Fig. 9B) to assess crossspecies editing efficiency.

[0039] Fig. 10. Final construct test with split evolved editor. The selected construct (C2) was tested with the addition of a split intein structure and a V106W off-target reducing mutation in the TadA-8a domain. Testing in both HEK293 and CHO cells confirmed high on- target adenine conversion rates with reduced off-target activity, highlighting the effectiveness of the modified editing system in diverse cell types.

[0040] Fig. 11. Schematic representation of the AAV-ABE delivery system. The construct includes the Cbh promoter / terminator, U6 sgRNA cassette, and ABE8e TadA-8e V106W base editor with split intein N- and C-terminal Cas9. AAVs were delivered intracerebroventricularly at a 10:1 ratio of AAV-ABE to AAV-eGFP in neonatal (P2) mice.

[0041] Figs. 12A-B: Mutant survival changes after ABE treatment. Fig. 12A: Survival analysis of mutant Scn8aW / +;EIIaCre mice treated with NW2-ABE (light) compared to GFP controls (black). (n=12 treated mutants vs. n=13 Sham mutants; P<0.001 by Mantel- Cox.). Fig. 12B: Survival analysis of mutant Scn8aW / +;EMXl-Cre treated with NW2-ABE (light) compared to Sham GFP controls (black (n=24 treated mutants vs. n=25 Sham mutants; P<0.001 by Mantel-Cox.)

[0042] Figs. 13A-D: Immunohistochemistry of ABE expression in brain of (n=4) Scn8aW / +;EMXl-Cre mice. Fig. 13 A: Whole-brain confocal images (scale=lmm) demonstrating widespread AAV-PhP.eB-mediated transgene expression (eGFP, white) in Scn8aW / +;EMXl-Cre. Fig. 13B: Magnified confocal images (scale=100microns) showing AAV-PhP.eB-ABE (NW2 construct) expression within the cortex, confirming effective delivery and neuronal targeting in this region. Fig. 13C: Magnified confocal images (scale—lOOmicrons) showing AAV-PhP.eB-ABE (NW2 construct) expression within the hippocampus, confirming effective delivery and neuronal targeting in this region. Fig. 13D: Magnified confocal images (scale=100microns) showing AAV-PhP.eB (NW2 construct)expression within the dentate gyrus, confirming effective delivery and neuronal targeting in this region.

[0043] Figs 14A-B: Survival-associated seizure outcomes in Scn8aW / +;EMXl-Cre mice. Fig. 14A: EEG recording outcome of seizure frequency. Solid black bars represent mice that experienced seizure-related deaths and shaded bars indicate seizure incidence. A star represents an event of death by seizure caught in full behavioral physicality (tonic-clonic) on camera. Fig. 14B: Seizure incidence comparing EEG monitored GFP Sham (bottom 10 mice) and NW2-ABE treated (top 11 mice). Black dots correspond to seizure death within 65 days and white dots correspond to mice that survived over 100 days and had to be subsequently taken down.

[0044] Figs. 15A-B: Electrophysiological characterization of hyperexcitability in Scn8aW / +;EIIa-Cre neurons. Figs. 15 A: Representative action potential firing traces from patch-clamp recordings of SCN8aW+ / EIIacre mutant neurons expressing GFP, wild-type (WT) neurons, and Scn8aW / +;EIIa-Cre mutant neurons treated with ABE. Figs. 15B: Firing frequency-current (F-I) relationship for Scn8aW / +;EIIa-Cre neurons. GFP-expressing mutant neurons (light) (n=24 cells from 7 mice) compared to WT neurons (black) (n=26 cells from 5 mice) ABE-treated Scn8aW / +;EIIa-Cre neurons (gray) (n=25 cells from 9 mice) (P<0.001, Two-Way ANOVA).

[0045] Figs. 16A-B: Electrophysiological characterization of hyperexcitability in Scn8aW / +;EMXl-Cre neurons. Fig. 16A: Representative action potential firing traces from patch-clamp recordings of Scn8aW / +;EMXl-Cre GFP-expressing mutant neurons, WT neurons and ABE-treated Scn8aW / +;EMXl-Cre neurons. Fig. 16B: F-I relationship for Scn8aW / +;EMXl-Cre neurons (P<0.001, Two-Way ANOVA) from patch-clamp recordings of Scn8aW / +;EMXl-Cre GFP-expressing mutant neurons (light) (n=32 cells from 8 mice) compared to WT neurons (black) (n=39 cells from 9 mice) and ABE-treated W+ / EIIacre neurons (gray) (n=35 cells from 11 mice)

[0046] Figs. 17A-B: Effect on persistent sodium currents in Scn8aW / +;EMXl-Cre neurons. Fig. 17A: Representative traces of persistent sodium currents (INaP) recorded in Scn8aW / +;EMXl-Cre neurons. GFP-expressing mutant neurons (light) compared to WT neurons (black) and ABE-treated neurons (gray). Fig. 17B: Quantification of maximum persistent sodium current amplitudes (INaP). Mutant neurons expressing GFP (n=30 cells from 8 mice) compared to WT neurons (n=27 cells from 9 mice), P<0.0001, One-Way ANOVA).

[0047] Figs. 18A-B. Next-generation sequencing of on-target DNAediting. Fig. 18A:The percentage of adenine base editing (ABE)-mediated T-to-C conversion on the mutantScn8a R1872W allele in Scn8aW / +;EIIa-Cre mice at different survival time points. Black bars represent mice that experienced seizure-related death, and white bars indicate those euthanized at predetermined time points (taken down). Fig. 18B: The percentage of T-to-C conversion on the mutant R1872W allele in Scn8aW / +;EMXl-Cre NW2 treated mice at varying survival points, comparing non-EEG monitored (left) and EEG-monitored (right) mice. * denotes mice that experienced seizure death. # denotes mice experiencing seizures but no seizure induced death; mice were taken down, d- denotes day of DNA collection from mice (collected on day of death or take down), d- with no mark denotes mice with no seizures that were taken down on the allotted day.

[0048] Figs. 19A-B: On-target DNA editing revealed in RNA-sequencing of R1872W loci. Fig. 19A: Percentage of mutant allele conversion based on RNA-seq reads in W+ / EMX1-ABE mice. Comparisons are shown between long-surviving EEG (white bars) and non-EEG-monitored (black bars) ABE treated mutant mice. All mice were taken down on allotted time point for tissue extraction. Fig. 19B: RNA / DNAT to C conversion ratios of mice taken down at varying time points (days post birth).

[0049] Figs. 20A-C. Efficacy of adenine base editor (ABE) treatment in reducing behavioral abnormalities. Fig. 20A: Heatmaps show individual mouse data, darker shades represent higher time spent in open area. Fig. 20B: Representative tracks of movement during the open-field test are displayed for WT controls, GFP-treated, and ABE-treated W / +EMXlcre mice. (****p < 0.0001; **p < 0.01). Fig. 20C: Heatmaps represent individual mouse data, with darker shades indicating greater total distances traveled. (****p < 0.0001; ns: not significant).DETAILED DESCRIPTION

[0050] Epilepsy is a disease characterized by abnormal brain activity and a predisposition to generate epileptic seizures, leading to neurobiological, cognitive, psychological, social, and economic impacts for the patient. There are several known causes for epilepsy; one of them is the malfunction of ion channels, resulting from mutations. Voltagegated sodium channels (NaV) play an essential role in the generation and propagation of action potential, and malfunctions caused by mutations can induce irregular neuronal activity. That said, several genetic variations in NaV channels have been described and associated with epilepsy. These mutations can affect channel kinetics, modifying channel activation, inactivation, recovery from inactivation, and / or the current window.

[0051] SCN8A (Sodium Voltage-Gated Channel Alpha Subunit 8) is a protein coding gene. The SCN8A gene encodes the Navi.6 voltage-gated sodium channel, a key proteinresponsible for regulating neuronal excitability by facilitating the rapid influx of sodium ions during action potential generation and propagation. Navi.6 is predominantly expressed in the nodes of Ranvier of myelinated axons and the axon initial segments, where it supports high- frequency neuronal firing and efficient signal transmission. Structurally, Navi.6 consists of four homologous domains, each with six transmembrane segments, including voltage-sensing (S4) and ion-conducting (S5-S6) regions. This channel is crucial for amplifying electrical signals and maintaining neuronal communication in the central nervous system.

[0052] Mutations in the SCN8A gene are associated with various neurological disorders, most notably early infantile epileptic encephalopathy type 13 (EIEE13 or SCN8A DEE), characterized by severe, treatment-resistant seizures, developmental delays, and cognitive impairments. Other conditions linked to SCN8A mutations include autism spectrum disorders, ataxia, and intellectual disabilities. Due to its central role in neuronal function and its association with epilepsy, SCN8A is a promising target for therapeutic interventions, including sodium channel blockers and precision medicine approaches aimed at restoring normal channel activity.

[0053] To address these and the other most recurrent pathogenic mutations associated with SCN8A-related epileptic encephalopathy, we developed targeted constructs designed to correct the following clinically relevant variants: R1872W, R1872Q, R1617Q, R850Q, N1877S, and G1475R (Fig. 1). These 6 mutations collectively account for a majority proportion of the patient population that experience seizures, with over 200 documented cases in the United States alone demonstrating compatibility with the designed guide sequences. Notably, these genetic loci are located within CpG dinucleotide hotspots. The hotspots harboring these 6 mutation sites exhibit a distinct methylation signature, rendering them prone to spontaneous mutagenesis and contributing to their prominence in disease-associated variants. Leveraging this mechanistic insight, we have developed highly precise genome-editing constructs that target these 6 regions. This approach builds upon our validated in vitro and in vivo data, as demonstrated in the correction of the R1872W variant using adenine base editing technology. The data provided showcases the efficacy and specificity of one such construct in targeting R1872W in these CpG genomic regions, offering a promising, robust therapeutic strategy for correcting the other recurrent SCN8A mutations in similarly signatured areas.

[0054] We provide a treatment for SCN8A early infantile epileptic encephalopathy that uses a genomic editing technique known as base editing. The base editing technique is discussed in U.S. Patent Application Publication US2017 / 0121693, which is hereby incorporated by reference for its disclosure of the base editing technique. Base Editing enablesthe precise incorporation of single-nucleotide changes, or substitutions of a single DNA base pair, into the genome of living cells. We have employed adenine base editors (ABEs), which catalyze adenine (A) to guanine (G) base transversions through their adenosine deaminase domain as they accept an ammonia molecule from an adenine and donate a water molecule. This reaction initiates the innate mismatch repair system to substitute the modified target base with a guanine, restoring a pathogenic base to its wildtype counterpart. Furthermore, base editors circumvent the DNA double- stranded breaks and subsequent homologous and nonhomologous end joining repair induced by CRISPR-Cas9 approaches that lead to the introduction of detrimental byproducts such as indel stretches and activation of the innate immune response. In 2020, it was estimated that C > T base editors can precisely target at least 3196 point mutations (46% of all pathogenic T > C variants), and A > G editors - at least 6900 point mutations (34% of all pathogenic G> A variants). Since then, the evolution of base editors has continued by several groups, further expanding the ability of these editors to target genomic regions not accessible by earlier base editor constructs. Since the differing forms of EIEE13 consist of point mutations in various genomic loci of SCN8A, they, in theory, can all be treated by effecting a specific nucleotide change at that specific locus.

[0055] To elicit a phenotypic response from a genotypic alteration, mRNA turnover (and consequently, protein turnover) must occur. This is necessary as corrected DNA needs to be expressed, leading to the replacement of mutant proteins. This is the process that facilitates increased survival in rodent models of epilepsy and the restoration of a normal action potential. These turnover rates were determined in rodents, and it was found that prior to postnatal day 10 (P10) only Navi.2 channels (the prenatal sodium channel isoform) can be detected via immunocytochemistry or Western blot. Quantitative real-time PCR (qPCR) has also determined that during P2-P10 in rodents. Navi.6 RNA levels remained unchanged; then, during P10 and P19, there was an approximately 3-fold increase in Navi.6 transcript levels. These two observations support the conclusion that administering a base editor before day 10 in these mice afflicted with epilepsy causing mutations in their Navi.6 channels will provide time for the full turnover of the Navi.6 protein. This, in turn, will enable a greater accumulation of wildtype protein relative to the mutant variant, ultimately assisting in the restoration of pathogenic currents to more typical sodium currents. Additionally, the Navi.6 expression timeline in humans is elongated compared to rodent species with seizure onset within the first 18 months of life in the clinic, allowing this treatment to be translatable to the clinic. QPCR data has also demonstrated the time this change occurs by looking at the presence of exon 18a within the mRNA transcripts. In SCN8A, more than 90% of transcripts present in the maturehuman cortex contain splice-form exon 18A within SCN8A mRNA. In fetal developmental transcripts, however, exon 18N is either present instead or both exon 18N and 18A are excluded; the splicing inclusion of exon 18A takes place between 13 post-conceptual weeks and 6 months of age.

[0056] A knock-in mouse model has been established by Miriam Meisler at the University of Michigan, and gifted to our group. Known as Scn8aW / + / EIIaCre and Scn8aW / + / EMXlCre, these models are heterozygote lines in which the mice carry the patientspecific SCN8A mutation R1872W, one of the most recurring mutation loci in the SCN8A patient population. These mouse models together accurately replicate the disease phenotype observed in pediatric patients, displaying spontaneous seizures and premature death. These models allows us to assess the capability of a base editor to target and efficiently induce a transversion within the SCN8A gene.The following abbreviations are used in this disclosure.

[0057] AAV : Adenovirus Associated Vector

[0058] ABEs: Base Editors

[0059] EIEE : Early Infantile Epileptic Encephalopathy

[0060] ICV: Intracerebroventricular injection

[0061] NGS: Next Generation Sequencing

[0062] PAM: Protospacer Adjacent Motif

[0063] SUDEP: Sudden Unexpected Death in EpilepsyGENERAL DISCLOSURE

[0064] While various embodiments of the present disclosure are described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous modifications and changes to, and variations and substitutions of, the embodiments described herein will be apparent to those skilled in the art without departing from the disclosure. It is understood that various alternatives to the embodiments described herein can be employed in practicing the disclosure. It is also understood that every embodiment of the disclosure can optionally be combined with any one or more of the other embodiments described herein which are consistent with that embodiment.

[0065] Where a range of numerical values is recited, it is understood that the endpoints and each intervening integer value and each fraction thereof, as well as each subrange, between the recited endpoints (upper and lower limits) of that range are specificallydisclosed. The endpoints of all ranges are included within the range and are independently combinable. Where a value has an inherent limit, that inherent limit is specifically disclosed. Where a value is explicitly recited, it is understood that values which are about the same as the recited value are specifically disclosed.

[0066] It is also understood that, unless clearly indicated to the contrary, in any method described or claimed herein that includes more than one act or step, the order of the acts or steps of the method is not necessarily limited to the order in which the acts or steps of the method are recited, but the disclosure encompasses embodiments in which the order is so limited.

[0067] Presently, the treatment options for SCN8A epileptic encephalopathy are unable to address the underlying genetic defects driving the disease, and thus cannot fully mitigate symptoms or prevent mortality. Additionally, a substantial number of patients possess resistance to these treatments, further limiting their efficacy. By targeting the root cause, these 6 recurrent genetic mutations, we have created a personalized gene therapy solution for this form of pediatric epilepsy. Our research has represented a major breakthrough for SCN8A epileptic encephalopathy treatment, but it could also pave the way for wider applications of base editing technology in the treatment of other genetic diseases.

[0068] It is further understood that, in general, where an embodiment in the description or the claims is referred to as comprising one or more features, the disclosure also encompasses embodiments that consist of, or consist essentially of, such feature(s).

[0069] It is also understood that any embodiment of the disclosure, e.g., any embodiment or compound found within the prior art, can be explicitly excluded from the claims, regardless of whether or not the specific exclusion is recited in the specification.

[0070] In addition, it is understood that any functional language used in any claims shall not be construed as “means-plus-function” language under 35 U.S.C. §112(f), unless specifically expressed as such by use of the term “means for” or “step(s) for” in a claim.

[0071] It is further understood that the present disclosure encompasses analogs, derivatives, prodrugs, metabolites, salts, solvates, hydrates, clathrates and polymorphs of all the compounds / substances disclosed herein, as appropriate. The specific recitation of “analogs”, “derivatives”, “prodrugs”, “metabolites”, “salts”, “solvates”, “hydrates”, “clathrates” or “polymorphs” with respect to a compound / substance or a group of compounds / substances in certain instances of the disclosure shall not be interpreted as an intended omission of any of these forms in other instances of the disclosure where the compound / substance or the group of compounds / substances is mentioned or shown withoutrecitation of any of these forms, unless stated otherwise or the context clearly indicates otherwise.DEFINITIONS

[0072] Unless defined otherwise or clearly indicated otherwise by their use herein, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this application belongs.

[0073] As used herein and in the claims, the singular forms “a,” “an,” and “the” include the singular and the plural reference unless the context clearly indicates otherwise. Thus, for example, a reference to “an agent” includes a single agent and a plurality of such agents.

[0074] The term “mutation” refers to a substitution of a residue within a sequence, e.g., a nucleic acid or amino acid sequence, with another residue, or a deletion or insertion of one or more residues within a sequence. Mutations are typically described herein by identifying the original residue followed by the position of the residue within the sequence and by the identity of the newly substituted residue. Various methods for making the amino acid substitutions (mutations) provided herein are well known in the art.

[0075] The term “base editor” is described in U.S. Patent Application Publication US20170121693, which is hereby incorporated by reference for its disclosure of the base editing technique. By way of non-limiting example, the compatible base editors may comprise ABE8e, ABE8e[TadAV106W], ABE8e[TadAVI06W]-NG, ABE8e[TadAV106W]-NRCH, ABE8e[TadAV106W]-NRRH, ABE8e[TadAV106W]-NRTH, ABE8e-iSpyMac, ABE8e-NG, ABE8e-NRCH, ABE8e-NRRH, ABE8e-NRTH, ABE8e-SpyMac, ABEmax, ABEmax- iSpyMac, ABEmax-NRRH, ABEmax-NG, ABEmax-NRCH, ABEmax-NRRH, ABEmax- NRTH, ABEmax-SpyMac, BE4max-NG, BE4max-NRCH, BE4max-NRRH, BE4-NG, BE4- NRCH, BE4-NRRH, CBE6varients-NG, CBE6varients-NRCH, CBE6varients-NRRH, eNme2.C ABE8e, eNme2-C-BE4, eNme2-C-CBE6varients, eNme2-Tl and T.2-ABE8e, eNme2-T.l and T.2-ABE9, iSpyMac-BE3, iSpyMacBE4, SpCas9 TadCBEd-V106W-NG, SpCas9 TadCBEd-V106W-NRCH, SpCas9 TadCBEd-V106W-NRRH, SpRY-ABE8e, SpRY- ABE8e HiFi, SpRY-ABEmax, SpRY-ABEmax HiFi, SpRY-BE4, SpRY-BE4max, SpRY- CBE6varients, SpyMac-BE3, SpyMacBE4, SpyMacCBE6varients, xCas9 3.7-CBE, xCas9 3.7-ABE.

[0076] The term “CRISPR” or “Clustered Regularly Interspaced Short PalindromicRepeats”, refers to a segment of DNA found in the genomes of certain prokaryotic organisms, including some bacteria and archaea, that includes repeated short sequences of nucleotidesinterspersed at regular intervals between unique sequences of nucleotides derived from the DNA of a pathogen (e.g., virus) that had previously infected the organism and that functions to protect the organism against future infections by the same pathogen.

[0077] The term “Cas9” or “CRISPR-associated protein 9” is an endonuclease enzyme that plays a key role in the CRISPR immune system. Cas9 is guided by a RNA molecule, typically referred to as guide RNA (gRNA), which is complementary to a specific target DNA sequence. Cas9 uses the guide RNA to locate the matching DNA sequence within the target genome and induces a double-strand break at that precise location. The cell’s repair mechanisms then attempt to fix the break, which can be harnessed for purposes such as gene disruption, insertion of new genetic material, or correction of mutations.

[0078] The term “CRISPR RNA” , “sgRNA” or “crRNA” refers to a type of guide nucleic acid, wherein the nucleic acid is RNA comprising a first sequence that either a) hybridizes to a portion of a tracrRNA or b) is capable of being non-covalently bound by an effector protein; and a second sequence, often referred to herein as a spacer sequence, that hybridizes to a target sequence of a target nucleic acid. In some instances, the first sequence is referred to as a repeat sequence.

[0079] The term “protospacer” or “spacer” refers to a short segment of DNA that is present in the genome of a microorganism, such as bacteria, and is derived from a foreign genetic element, such as a virus or plasmid, which the organism has encountered previously. In the context of the CRISPR-Cas system, viral DNA inserted into a CRISPR locus that in type II adaptive immune systems was created from invading viral or plasmid DNA (called "protospacers"). Upon subsequent invasion, a CRISPR-associated nuclease such as Cas9 attaches to a tracrRNA-crRNA complex, which guides Cas9 to the invading protospacer sequence. The spacer sequence is partially or fully complementary to a target sequence found in a genomic DNA sequence, for example, a human genomic DNA sequence. For example, a spacer sequence can be partially or fully complementary to a nucleotide sequence in a gene having a disease-causing mutation. A spacer that is partially complementary to a target sequence can have, for example, one, two, or three mismatches with the target sequence.

[0080] The term “protospacer adjacent motif’ or “PAM” refers to a DNA sequence adjacent to a target sequence to which a complex comprising an effector and a RNA guide binds. In some embodiments, a PAM is required for enzyme activity. As used herein, the term “adjacent” includes instances in which a RNA guide of the complex specifically binds, interacts, or associates with a target sequence that is immediately adjacent to a PAM. In such instances, there are no nucleotides between the target sequence and the PAM. The term“adjacent” also includes instances in which there are a small number (e.g., 1, 2, 3, 4, or 5) of nucleotides between the target sequence, to which the targeting moiety binds, and the PAM. In some embodiments, a PAM is a 2-6-base pair DNA sequence immediately following the DNA sequence targeted by the Cas9 nuclease in the CRISPR bacterial adaptive immune system.

[0081] The term “effector” or “effector protein” refers to a protein, polypeptide, or peptide that non-covalently binds to a guide nucleic acid to form a complex that contacts a target nucleic acid, wherein at least a portion of the guide nucleic acid hybridizes to a target sequence of the target nucleic acid. A complex between an effector protein and a guide nucleic acid can include multiple effector proteins or a single effector protein.

[0082] The term “ribonucleotide protein complex” or “RNP” refers to a complex of one or more nucleic acids and one or more polypeptides described herein. While the term utilizes “ribonucleotides”, it is understood that the one or more nucleic acids may comprise deoxyribonucleotides (DNA), ribonucleotides (RNA), a combination thereof (e.g., RNA with a thymine base), biochemically or chemically modified nucleobases (e.g., one or more engineered modifications described herein), or combinations thereof.

[0083] The term “RNA guide” may be used interchangeably herein with the term “guide RNA” (gRNA). As used herein, the term “RNA guide” refers to any RNA molecule that facilitates the targeting of an effector described herein (e.g., SCN8A targeting adenine base editor) to a target sequence (e.g., a sequence of a SCN8A gene, a mutated SCN8A gene or SCN8A gene with single nucleotide polymorphisms). A RNA guide may be designed to include sequences that are complementary to a specific nucleic acid sequence (e.g., a sequence of a SCN8A gene, a mutated SCN8A gene or SCN8A gene with single nucleotide polymorphisms). A RNA guide may comprise a DNA targeting sequence (i.e., a spacer sequence) and a direct repeat (DR) sequence. Exemplary “RNA guides” include, but are not limited to, crRNAs, as well as crRNAs hybridized to or fused to either tracrRNAs and / or modulator RNAs. In some embodiments, a RNA guide includes both a crRNA and a tracrRNA, either fused into a single RNA molecule or as separate RNA molecules. In some embodiments, a RNA guide includes a crRNA and a modulator RNA, either fused into a single RNA molecule or as separate RNA molecules. In some embodiments, a RNA guide includes a crRNA, a tracrRNA, and a modulator RNA, either fused into a single RNA molecule or as separate RNA molecules.

[0084] The term “modulator RNA” as described herein refers to any RNA molecule that modulates (e.g., increases or decreases) an activity of a CRISPR effector or a nucleoprotein complex that includes a CRISPR effector. In some embodiments, a modulator RNA modulatesthe nuclease activity of the CRISPR effector or a nucleoprotein complex that includes a CRISPR effector.

[0085] The terms “trans-activating RNA”, “transactivating RNA” and “tracrRNA” refer to a transactivating or transactivated nucleic acid in a dual nucleic acid system that is capable of hybridizing, at least partially, to a crRNA to form a tracrRNA-crRNA duplex and of interacting with an effector protein to form a complex (e.g., a RNP complex).

[0086] The terms “target”, “target sequence” and “target nucleic acid” are used interchangeably and refer to a molecular target (e.g., a polynucleotide, a nucleic acid, a nucleic acid sequence) complementary to the entirety or a part of the protospacer or a protospacer guide disclosed herein, or a molecular target (e.g., a polynucleotide, a nucleic acid, a nucleic acid sequence), to which the protospacer or a protospacer guide specifically binds. In some embodiments, the “target” is selected as the nucleic acid for modification, binding, hybridization, or any other activity of or interaction with a nucleic acid, protein, polypeptide, or peptide described herein (e.g., protospacer or a protospacer guide). A target nucleic acid may comprise RNA, DNA, or a combination thereof. A target nucleic acid may be single-stranded (e.g., single- stranded RNA or single- stranded DNA) or double- stranded (e.g., double-stranded DNA).

[0087] The term “vector” refers to a nucleic acid-based molecular construct used to facilitate the delivery and / or expression of genetic material into host cells. Vectors are typically designed to carry a gene of interest or a functional nucleic acid sequence, such as a therapeutic gene, RNA molecule, or reporter gene. They include essential regulatory elements, such as promoters, enhancers, and terminators, to ensure appropriate expression in the target cells. Vectors may be classified into different types based on their origin and function, such as viral vectors (e.g., adenovirus-associated vectors, lentiviral vectors) and non-viral vectors (e.g., plasmids, lipid nanoparticles). Viral vectors are modified viruses designed to deliver genetic material into cells. In some embodiments, a vector is a retroviral vector, a lentiviral vector, a phage vector, an adenoviral vector, an adeno-associated virus (AAV) vector (e.g., AAV2, AAV5, AAV7m8, AAV8, AAV9, AAVrh8r, or AAVrhl 0), or a herpes simplex vector.

[0088] Polynucleotide and oligonucleotide are used interchangeably and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three-dimensional structure, and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: a gene or gene fragment, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branchedpolynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, primers and gRNAs. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component. A polynucleotide is composed of a specific sequence of four nucleotide bases: adenine (A); cytosine (C); guanine (G); thymine (T); and uracil (U) for thymine (T) when the polynucleotide is RNA. Thus, the term “nucleotide sequence” is the alphabetical representation of a polynucleotide molecule. The letters used in polynucleotide sequences described herein correspond to IUPAC notation. For example, the letter “N” in a nucleotide sequence represents a nucleotide which can be A, T, C, or G in a DNA sequence, or A, U, C, or G in a RNA sequence; the letter “R” in a nucleotide sequence represents a nucleotide which can be A or G; and the letter “H” in a nucleotide sequence represents a nucleotide other than G.

[0089] The term “genetic disease” refers to a disease, disorder, condition, or syndrome associated with or caused by one or more mutations in the DNA of an organism having the genetic disease.

[0090] The term “exemplary” as used herein means “serving as an example, instance or illustration”. Any embodiment or feature characterized herein as “exemplary” is not necessarily to be construed as preferred or advantageous over other embodiments or features.

[0091] The term “about” or “approximately” means an acceptable error for a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined. In certain embodiments, the term “about” or “approximately” means within one standard deviation. In some embodiments, when no particular margin of error (e.g., a standard deviation to a mean value given in a chart or table of data) is recited, the term “about” or “approximately” means that range which would encompass the recited value and the range which would be included by rounding up or down to the recited value as well, taking into account significant figures. In certain embodiments, the term “about” or “approximately” means within 10% or 5% of the specified value. Whenever the term “about” or “approximately” precedes the first numerical value in a series of two or more numerical values or in a series of two or more ranges of numerical values, the term “about” or “approximately” applies to each one of the numerical values in that series of numerical values or in that series of ranges of numerical values.

[0092] Whenever the term “at least” or “greater than” precedes the first numerical value in a series of two or more numerical values, the term “at least” or “greater than” applies to each one of the numerical values in that series of numerical values.

[0093] Whenever the term “no more than” or “less than” precedes the first numerical value in a series of two or more numerical values, the term “no more than” or “less than” applies to each one of the numerical values in that series of numerical values.

[0094] The term “substantially” is utilized herein to represent the inherent degree of uncertainty that can be attributed to any quantitative comparison, value, measurement, or other representation. The term “substantially” is also utilized herein to represent the degree by which a quantitative representation can vary from a stated reference without resulting in a change in the basic function of the subject matter at issue.

[0095] The terms "disease", "disorder", or "condition" are used interchangeably herein, referring to any alternation in state of the body or of some of the organs, interrupting or disturbing the performance of the functions and / or causing symptoms such as discomfort, dysfunction, distress, or even death to the person afflicted or those in contact with a person. A disease or disorder can also be related to a distemper, ailing, ailment, malady, disorder, sickness, illness, complaint, or affectation.

[0096] The term “in need thereof’ when used in the context of a therapeutic or prophylactic treatment, means having a disease, being diagnosed with a disease, or being in need of preventing a disease, e.g., for one at risk of developing the disease. Thus, a subject in need thereof can be a subject in need of treating or preventing a disease.

[0097] As used herein, the term "in combination" refers to the use of more than one prophylactic and / or therapeutic agent simultaneously or sequentially and in a manner such that their respective effects are additive or synergistic.

[0098] As used herein, the terms "treat," "treatment," "treating," or "amelioration" refer to therapeutic treatments, wherein the object is to reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of a disease, disorder, or syndrome related to a bacteria. The term "treating" includes reducing or alleviating at least one adverse effect or symptom of a disease, disorder, or syndrome. Treatment is generally "effective" if one or more symptoms or clinical markers are reduced. Alternatively, or in addition, treatment is "effective" if the progression of a disease, disorder, or syndrome is reduced or halted. That is, "treatment" includes not just the improvement of symptoms or markers, but also a cessation of, or at least slowing of, progress or worsening of symptoms compared to what would be expected in the absence of treatment. Beneficial or desired clinical results include, but are not limited to,alleviation of one or more symptom(s), diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, remission (whether partial or total), and / or decreased mortality. For example, treatment is considered effective if the condition is stabilized. The term "treatment" of a disease also includes providing relief from the symptoms or side-effects of the disease (including palliative treatment).L0099 J As used herein, the term "gene expression" includes both gene transcription, whereby DNA (or RNA in the case of some RNA-containing viruses) corresponding to a gene is transcribed to generate a RNA molecule and RNA translation, whereby a RNA molecule is translated to generate a protein encoded by the gene. As used herein, the term "protein expression" is used to refer both to gene expression comprising transcription of DNA (or RNA) to form a RNA molecule and subsequent processing and translation of the RNA molecule to form protein and to gene expression comprising translation of mRNA to form protein.

[0100] The term “medical conditions” (or “conditions” for brevity) includes diseases and disorders. The terms “diseases” and “disorders” are used interchangeably herein.

[0101] The term “subject” refers to an animal, including but not limited to a mammal, such as a primate (e.g., a human, a chimpanzee or a monkey), a rodent (e.g., a rat, a mouse, a guinea pig, a gerbil or a hamster), a lagomorph (e.g., a rabbit), a bovine (e.g., a cattle), a suid (e.g., a pig), a caprine (e.g., a sheep), an equine (e.g., a horse), a canine (e.g., a dog) or a feline (e.g., a cat). The terms “subject” and “patient” may be used interchangeably herein in reference to a subject / patient (e.g., a mammalian subject / patient such as a human subject / patient) having a medical condition.

[0102] As used herein, the term "administering," refers to the placement of an agent (e.g., a bacteriophage) as disclosed herein into a subject by a method or route that results in at least partial delivery of the agent at a desired site.

[0103] The phrase "and / or," as used herein in the specification and in the claims, should be understood to mean "either or both" of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with "and / or" should be construed in the same fashion, i.e., "one or more" of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the "and / or" clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to "A and / or B", when used in conjunction with open-ended language such as "comprising" can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only(optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.

[0104] As used herein in the specification and in the claims, "or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of’ or "exactly one of," or, when used in the claims, "consisting of," will refer to the inclusion of exactly one element of a number or list of elements. In general, the term "or" as used herein shall only be interpreted as indicating exclusive alternatives (i.e., "one or the other but not both") when preceded by terms of exclusivity, such as "either," "one of," "only one of," or "exactly one of. "

[0105] As used herein in the specification and in the claims, the phrase "at least one” in reference to a list of one or more elements, should be understood to mean at least one element selected from anyone or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase "at least one" refers, whether related or unrelated to those elements specifically identified. Thus, as a nonlimiting example, "at least one of A and B" (or, equivalently, "at least one of A or B” or, equivalently "at least one of A and / or B") can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.

[0106] As used in the specification and the claims, all transitional terms such as “comprising”, “containing”, “having”, “including”, “possessing”, “holding”, “carrying”, “bearing”, “composed of’, “characterized by” and the like are open-ended and inclusive, that is, mean including but not limited to and do not exclude additional, unrecited element(s) or method step(s). Only the transitional term “consisting of’ is closed, that is, excludes any additional, unrecited element or method step, and the transitional term “consisting essentially of” is semi-closed, that is, only allows inclusion of additional, unrecited element(s) or methodstep(s) that do not materially affect the basic and novel characteristic(s) of that particular embodiment.

[0107] The terms first, second, etc., as used herein are not meant to denote any particular ordering, but simply for convenience to denote a plurality of, for example, compositions. All methods described herein can be performed in a suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. Thus, in certain methods described herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited unless the context indicates otherwise.

[0108] Recitation of ranges of values is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. The endpoints of all ranges are included within the range and independently combinable.

[0109] The use of any and all examples, or exemplary language (e.g., “such as”), is intended merely to better illustrate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention as used herein.

[0110] The terms "decrease", "reduce", "reduction", "lower" or "lowering” or "inhibit" are all used herein generally to mean a decrease by a statistically significant amount. For example, "decrease", "reduce", "reduction", or "inhibit" means a decrease by at least 10% as compared to a reference level, for example a decrease by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%), or at least about 80%, or at least about 90% or up to and including a 100% decrease (e.g., absent level or non-detectable level as compared to a reference level), or any decrease between 10- 100%) as compared to a reference level. In the context of a marker or symptom, by these terms is meant a statistically significant decrease in such level. The decrease can be, for example, at least 10%, at least 20%, at least 30%, at least 40% or more, and is preferably down to a level accepted as within the range of normal for an individual without a given disease.

[0111] The term “polynucleotide”, “nucleic acid”, or “nucleic acid sequence” refers to a polymer composed of nucleotide units. Polynucleotides can contain naturally occurring nucleic acids (e.g., deoxyribonucleic acid [“DNA”] and ribonucleic acid [“RNA”]), or / and nucleic acid analogs. For example, the term “nucleic acid” or “polynucleotide” includes single-, double- or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine or pyrimidine bases, or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide base. Polynucleotides containing one or more nucleic acid or nucleotide analogs are sometimes called “aptamers”. Nucleic acid or nucleotide analogs include without limitation those which have a non-naturally occurring base / nucleobase, have a sugar or non-sugar moiety other than 2 ’-deoxyribose or ribose, or engage in linkages with other nucleotides other than the naturally occurring phosphodiester bond, or a combination thereof. Non-limiting examples of nucleic acid or nucleotide analogs include xeno(biotic) nucleic acids (XNAs) having a backbone other than the naturally occurring sugar-phosphate backbone present in DNA or RNA (e.g., bridged nucleic acids [BNAs], cyclohexene nucleic acids [CeNAs], 2’-deoxy-2’-fluoroarabino nucleic acids [FANAs], glycol nucleic acids [GNAs], 1,5-anhydrohexitol nucleic acids [HNAs], locked nucleic acids [LNAs], 2’-0-methyl ribonucleotides, morpholino nucleic acids [MNAs], peptide nucleic acids [PNAs], and threose nucleic acids [TNAs]), phosphoro thioates, phosphorodithioates, phosphorotriesters, phosphoramidates, boranophosphates, methylphosphonates, chiral-methyl phosphonates, and the like. DNA and RNA polynucleotides can be synthesized using a DNA or RNA polymerase or an automated DNA or RNA synthesizer. Polynucleotides containing nucleic acid analogs can be synthesized using, e.g., an engineered DNA or RNA polymerase that recognizes the nucleic acid analogs, a phosphorami di te strategy, or an automated peptide synthesizer in the case of PNAs. The term “nucleic acid molecule” typically refers to a larger polynucleotide. The term “oligonucleotide” typically refers to a shorter polynucleotide. In certain embodiments, an oligonucleotide contains no more than about 50 nucleotides. In some embodiments, when a polynucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes the corresponding, or the complementary, RNA sequence (i.e., A, U, G, C) in which “U” replaces “T”.

[0112] Conventional notation is used herein to describe polynucleotide sequences: the left-hand end of a single-stranded polynucleotide sequence is the 5’ end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5’ direction. The direction of 5 ’ to 3 ’ addition of nucleotides to a newly forming (daughter) DNA strand, or to a nascent RNA transcript, is referred to as the direction of replication or transcription, respectively. The DNA strand having a complementary, antiparallel sequence as a daughter DNA strand or a primary RNA transcript (the “coding strand”) is called the “template strand”. “Upstream” is toward the 5’ end of a RNA molecule, and “downstream” is toward its 3’ end.When considering double-stranded DNA, “upstream” is toward the 5’ end of the coding strand for the gene in question and “downstream” is toward the 3’ end of the coding strand, so the 3’ end of the template strand is upstream of the gene in question and the 5’ end of the template strand is downstream of the gene.

[0113] The term “primer” refers to a polynucleotide that is capable of specifically hybridizing to a designated polynucleotide template and providing a point of initiation for synthesis of a complementary polynucleotide. Such synthesis occurs when the polynucleotide primer is placed under conditions in which synthesis is induced, i.e., in the presence of nucleotides, a complementary polynucleotide template, and an agent for polymerization such as a DNA or RNA polymerase. A primer is typically single- stranded but may be doublestranded. Primers are typically deoxyribonucleic acids, but a wide variety of synthetic and naturally occurring primers are useful for many applications. A primer is complementary to the template to which it is designed to hybridize and serves as a site for the initiation of synthesis but need not reflect the exact sequence of the template. In such a case, specific hybridization of the primer to the template depends on the stringency of the hybridization conditions. A primer can be labeled with an agent that promotes isolation (e.g., biotin), separation (e.g., biotin) or detection (e.g., a fluorescent, chromogenic or radioactive moiety) of the coding strand in single-stranded form or the coding strand hybridized to the template strand.

[0114] The term “gene therapy” refers to a therapeutic technique that involves the modification, replacement, or introduction of genetic material into a patient’s cells to treat or prevent disease. Gene therapies utilize vectors, such as viral or non- viral delivery systems, to transport functional copies of genes, RNA molecules, or gene-editing components to target cells. Once delivered, the genetic material may integrate into the patient’s genome, produce therapeutic proteins, or repair existing DNA errors.

[0115] The term "contacting" refers to the act of making contact or bringing into immediate or close proximity, whether at the cellular or molecular level. This can involve initiating a physiological reaction, chemical reaction, or physical change, and may occur in various environments, such as in a solution, reaction mixture, or in vitro and in vivo conditions.

[0116] Reference throughout the specification to “some embodiments”, “an embodiment”, and so forth, means that a particular element described in connection with the embodiment is included in at least one embodiment described herein, and may or may not be present in other embodiments. In addition, it is to be understood that the described elements may be combined in any suitable manner in the various embodiments. A “combination thereof’is open and includes any combination comprising at least one of the listed components or properties optionally together with a like or equivalent component or property not listed.

[0117] “Pharmaceutical compositions” are compositions comprising at least one active agent, and at least one other substance, such as a carrier, excipient, or diluent. Pharmaceutical compositions meet the U.S. FDA’s GMP (good manufacturing practice) standards for human or non-human drugs.

[0118] The term “pharmaceutically acceptable” means that a substance (e.g., an active ingredient or an excipient) is generally safe, non-toxic and suitable for use in contact with the cells, tissues and organs of a subject without excessive irritation, allergic response, immunogenicity and other adverse reaction. A “pharmaceutically acceptable” excipient or carrier of a pharmaceutical composition is also compatible with the other ingredients of the composition.

[0119] “Pharmaceutically acceptable salts” include derivatives of the disclosed compounds in which the parent compound is modified by making inorganic and organic, nontoxic, acid or base addition salts thereof. The salts of the present compounds can be synthesized from a parent compound that contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting free acid forms of these compounds with a stoichiometric amount of the appropriate base (such as Na, Ca, Mg, or K hydroxide, carbonate, bicarbonate, or the like), or by reacting free base forms of these compounds with a stoichiometric amount of the appropriate acid. Such reactions are typically carried out in water or in an organic solvent, or in a mixture of the two. Generally, non-aqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred, where practicable. Salts of the present compounds further include solvates of the compounds and of the compound salts.

[0120] A “therapeutically effective amount” means an amount effective, when administered to a patient, to provide a therapeutic benefit such as an amelioration of at least a symptom of the disorder, decrease the frequency or severity of symptoms, or effect a change in a clinical marker for a disease or disorder, slowing the progression of a disease or disorder, halting the progression of a disease or disorder, or reversing the course of a disorder.

[0121] An adenovirus-associated vector (AAV) is a type of recombinant viral vector derived from adenoviruses that is engineered to deliver therapeutic genes to target cells. AAVs are typically non-pathogenic and rely on co-infection with a helper virus, such as an adenovirus, to facilitate their replication and packaging. These vectors are characterized by their ability to transduce a wide range of dividing and non-dividing cells, providing a versatile platform for gene therapy applications. AAV vectors are particularly advantageous due to their relativelylow immunogenicity, long-term gene expression in certain tissues, and ability to transduce various tissues, including the liver, muscle, and retina. The AAV genome consists of a single- stranded DNA molecule that can be engineered to carry and express foreign genes upon delivery into host cells.

[0122] The term “virus-like particle” (VLP) refers to a structure that in at least one attribute resembles a virus, but which has not been demonstrated to be infectious. A VLP may be a nonreplicating, noninfectious viral shell that contains a viral capsid but lacks all or part of the viral genome, in particular, the replicative components of the viral genome. VLPs are generally composed of one or more viral proteins, such as, but not limited to those proteins referred to as capsid, coat, shell, surface, and structural proteins.

[0123] A “transcription unit” refers to specific nucleic acid (e.g., DNA, RNA), nucleotide, polynucleotide, open reading frame (ORF), or framework region (FR) that play distinct roles in gene delivery, expression, or regulation of gene(s). Representative genetic "transcription unit" includes promoters, enhancers, polyadenylation (poly-A) signals, splicing sites, replication origins and selectable markers.

[0124] The engineered polynucleotide may further include regulatory elements to control expression of the engineered delivery vehicle. The term “regulatory element” refers to transcriptional and translational control sequences, such as promoters, enhancers, polyadenylation signals, terminators, protein degradation signals, and the like, that provide for and / or regulate transcription of a non-coding sequence (e.g., a guide nucleic acid) or a coding sequence (e.g., effector proteins, fusion proteins, and the like) and / or regulate translation of an encoded polypeptide. Such regulatory elements are described, for example, in Goeddel, Gene Expression Technology: Methods In Enzymology 185, Academic Press, San Diego, Calif. (1990).

[0125] Definitions of common terms in cell biology and molecular biology can be found in “The Merck Manual of Diagnosis and Therapy”, 19th Edition, published by Merck Research Laboratories, 2006 (ISBN 0-911910-19-0); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0- 632- 02182-9); Immunology by Wemer Luttmann, published by Elsevier, 2006. Definitions of common terms in molecular biology can also be found in Benjamin Lewin, Genes X, published by Jones & Bartlett Publishing, 2009 (ISBN- 10: 0763766321); Kendrew et al. (eds.), Molecular Biology and Biotechnology: A Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8) and Current Protocols in Protein Sciences 2009, Wiley Intersciences, Coligan et al., eds.

[0126] Unless otherwise stated, the present invention was performed using standard procedures, as described, for example in Sambrook et al., Molecular Cloning: A Laboratory Manual (3 ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2001); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (1995); Current Protocols in Protein Science (CPPS) (John E. Coligan, et. al., ed., John Wiley and Sons, Inc.), Current Protocols in Cell Biology (CPCB) (Juan S. Bonifacino et. al. ed., John Wiley and Sons, Inc.), and Culture of Animal Cells: A Manual of Basic Technique by R. Ian Freshney, Publisher: Wiley-Liss; 5th edition (2005), Animal Cell Culture Methods (Methods in Cell Biology, Vol. 57, Jennie P. Mather and David Barnes editors, Academic Press, 1st edition, 1998) which are all incorporated by reference herein in their entireties.

[0127] The R1872W mutation of SCN8A refers to the substitution of arginine (R) with tryptophan (W) at position 1872 of the SCN8A protein.

[0128] The R1617Q mutation of SCN8A refers to a substitution of arginine (R) with glutamine (Q) at position 1617 of the SCN8A protein.

[0129] The R850Q mutation of SCN8A refers to the substitution of arginine (R) with glutamine (Q) at position 850 of the SCN8 A protein.

[0130] The G1475R mutation of SCN8A refers to the substitution of glycine (G) with arginine (R) at position 1475 of the SCN8A protein.

[0131] The R1872Q mutation of SCN8A refers to the substitution of arginine (R) with glutamine (Q) at position 1872 of the SCN8A protein.

[0132] The N1877S mutation of SCN8A refers to the substitution of asparagine (N) with serine (S) at position 1877 of the SCN8A protein.

[0133] In some embodiments, a SCN8A-targeting adenine base editor is a SCN8A R1872W-targeting adenine base editor.

[0134] In some embodiments, a SCN8A-targeting adenine base editor is a SCN8A R1617Q-targeting adenine base editor.

[0135] In some embodiments, a SCN8A-targeting adenine base editor is a SCN8A R850Q-targeting adenine base editor.

[0136] In some embodiments, a SCN8A-targeting adenine base editor is a SCN8A G1475R-targeting adenine base editor.

[0137] In some embodiments, a SCN8A-targeting adenine base editor is a SCN8A R1872Q-targeting adenine base editor.

[0138] In some embodiments, a SCN8A-targeting adenine base editor is a SCN8A N1877S-targeting cytosine base editor.

[0139] In one aspect, described herein is a SCN8A R1872W-targeting adenine base editor that comprises an adenine base editor; and a SCN8 A targeting protospacer guide selected from SEQ ID NOs 1-32, or a SCN8A targeting protospacer guide that is at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleic acid sequence selected from SEQ ID NOs: 1-32.

[0140] In some embodiments, the adenine base editor is SpRY-AB Emax HiFi, SpRY- ABEmax, SpRY-ABE8e HiFi, SpRY-ABE8e, eNme2-T.l and T.2-ABE8e, eNme2.C-ABE8e, ABEmax-NRCH, ABEmax-NG, ABE8e-NRCH, ABE8e-NG, ABE8e[TadAV106W]-NG, or ABE8e[TadAV106W]-NRCH and the SCN8A targeting protospacer guide is a human protospacer guide selected from SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, and 31.

[0141] In some embodiments, the adenine base editor is SpRY-AB Emax HiFi, SpRY- ABEmax, SpRY-ABE8e HiFi, SpRY-ABE8e, eNme2-T.l and T.2-ABE9, eNme2.C-ABE8e, eNme2.C ABE8e, ABEmax-NRCH, ABEmax-NG, ABE8e-NRCH, ABE8e-NG, ABE8e[V106W]-NG, or ABE8e[TadAV106W]-NRCH and the SCN8A targeting protospacer guide is a mouse protospacer guide selected from SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, and 32.

[0142] In one aspect, described herein is a SCN8A R1617Q-targeting adenine base editor that comprises an adenine base editor; and a SCN8 A targeting protospacer guide selected from SEQ ID NOs 33-66, or a SCN8A targeting protospacer guide that is at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 33-66.

[0143] In some embodiments, the adenine base editor is SpRY-AB Emax HiFi, SpRY- ABEmax, SpRY-ABE8e HiFi, SpRY-ABE8e, eNme2-T. l and T.2-ABE8e, eNme2.C-ABE8e, ABEmax-NRTH, ABEmax-NRCH, ABEmax-NG, ABEmax, ABE8e-NRTH, ABE8e-NRCH, ABE8e-NG, ABE8e[TadAV106W]-NRTH, ABE8e[TadAV106W]-NRCH,ABE8e[TadAV106W]-NG, ABE8e[TadAV106W], or ABE8e and the SCN8A targeting protospacer guide is a human protospacer guide selected from SEQ ID NOs: 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65.

[0144] In some embodiments, the adenine base editor is SpRY-AB Emax HiFi, SpRY- ABEmax, SpRY-ABE8e HiFi, SpRY-ABE8e, eNme2-T.l and T.2-ABE8e, eNme2.C-ABE8e, ABEmax-NRTH, ABEmax-NRCH, ABEmax-NG, ABEmax, ABE8e-NRTH, ABE8e-NRCH, ABE8e-NG, ABE8e[TadAV106W]-NRTH, ABE8e[TadAV106W]-NRCH,ABE8e[TadAV106W]-NG, ABE8e[TadAV106W], or ABE8e and the SCN8A targetingprotospacer guide is a mouse protospacer guide selected from SEQ ID NOs: 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66.

[0145] In one aspect, described herein is a SCN8A G1475R-targeting adenine base editor that comprises an adenine base editor; and a SCN8A targeting protospacer guide selected from SEQ ID NOs 67-96, or a SCN8A targeting protospacer guide that is at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 67-96.

[0146] In some embodiments, the adenine base editor is SpRY-AB Emax HiFi, SpRY- ABEmax, SpRY-ABE8e HiFi, SpRY-ABE8e, eNme2.C-ABE8e, ABEmax-NRRH, ABEmax- NG, ABE8e[TadAV106W]-NRRH, ABE8e[TadAV106W]-NG, ABE8e-NRRH, or ABE8e-NG and the SCN8A targeting protospacer guide is a human protospacer guide selected from SEQ ID NOs: 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, and 95.

[0147] In some embodiments, the adenine base editor is SpRY-AB Emax HiFi, SpRY- ABEmax, SpRY-ABE8e HiFi, SpRY-ABE8e, eNme2.C-ABE8e, ABEmax-NRRH, ABEmax- NG, ABE8e[TadAV106W]-NRRH, ABE8e[TadAV106W]-NG, ABE8e-NRRH, or ABE8e-NG and the SCN8A targeting protospacer guide is a mouse protospacer guide selected from SEQ ID NOs: 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, and 96.

[0148] In one aspect, described herein is a SCN8A R850Q-targeting adenine base editor that comprises an adenine base editor; and a SCN8 A targeting protospacer guide selected from SEQ ID NOs 97-111, or a SCN8A targeting protospacer guide that is at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 97-111.

[0149] In some embodiments, the adenine base editor is SpRY-ABE8e, SpRY-ABE8e HiFi, SpRY-ABEmax, SpRY-ABEmax HiFi, eNme2.C-ABE8e, ABE8e-NG, ABE8e-NRCH, ABE8e[TadAV106W]-NG, ABEmax-NG, ABEmax-NRCH, ABE8e-NRRH, ABE8e[V106W]-NRCH, ABE8e[TadAV106W]-NRRH, ABEmax-NRRH, ABE8e-iSpyMac, ABE8e-SpyMac, ABEmax-iSpyMac, ABEmax-SpyMac, ABE8e, ABE8e[TadAV106W], or ABEmax and the SCN8A targeting protospacer guide is a human protospacer guide selected from SEQ ID NOs: 97-111.

[0150] In some embodiments, the adenine base editor is SpRY-ABE8e, SpRY-ABE8e HiFi, SpRY-ABEmax, SpRY-ABEmax HiFi, eNme2.C-ABE8e, ABE8e-NG, ABE8e-NRCH, ABE8e[TadAV106W]-NG, ABEmax-NG, ABEmax-NRCH, ABE8e-NRRH, ABE8e[TadAV106W]-NRCH, ABE8e[TadAV106W]-NRRH, ABEmax-NRRH, ABE8e- iSpyMac, ABE8e-SpyMac, ABEmax-iSpyMac, ABEmax-SpyMac, ABE8e,ABE8e[TadAV106W], or ABEmax and the SCN8A targeting protospacer guide is a mouse protospacer guide selected from SEQ ID NOs: 97-111.

[0151] In one aspect, described herein is a SCN8A R1872Q-targeting adenine base editor that comprises an adenine base editor; and a SCN8A targeting protospacer guide selected from SEQ ID NOs 112-139, or a SCN8A targeting protospacer guide that is at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 112-139.

[0152] In some embodiments, the adenine base editor is SpRY-ABE8e, SpRY-ABE8e HiFi, SpRY-ABEmax, SpRY-ABEmax HiFi, eNme2.C-ABE8e, ABE8e-NRRH, ABE8e[TadAV106W]-NRRH, ABEmax-NRRH, ABE8e-iSpyMac, ABE8e-SpyMac, ABEmax-iSpyMac, ABEmax-SpyMac, ABE8e-NRTH, ABE8e[TadAV106W]-NRTH, ABEmax-NRTH, or xCas9 3.7-ABE and the SCN8A targeting protospacer guide is a human protospacer guide selected from SEQ ID NOs: 112, 114, 116, 118, 120, 122, 124, 126, 128,130, 132, 134, 136, and 138.

[0153] In some embodiments, the adenine base editor is SpRY-ABE8e, SpRY-ABE8e HiFi, SpRY-ABEmax, SpRY-ABEmax HiFi, eNme2.C-ABE8e, ABE8e-NRRH, ABE8e[TadAV106W]-NRRH, ABEmax-NRRH, ABE8e-iSpyMac, ABE8e-SpyMac, ABEmax-iSpyMac, ABEmax-SpyMac, ABE8e-NRTH, ABE8e[TadAV106W]-NRTH, ABEmax-NRTH, or xCas9 3.7-ABE and the SCN8A targeting protospacer guide is a mouse protospacer guide selected from SEQ ID NOs: 113, 115, 117, 119, 121, 123, 125, 127, 129,131, 133, 135, 137, and 139.

[0154] In one aspect, described herein is a SCN8A N1877S-targeting cytosine base editor comprising a cytosine base editor; and a SCN8A targeting protospacer guide selected from SEQ ID NOs 140-175, or a SCN8A targeting protospacer guide that is at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 140-175.

[0155] In some embodiments, the cytosine base editor is SpRY-BE4, SpRY-BE4max, SpRY-CBE6varients, eNme2-C-BE4, eNme2-C-CBE6varients, BE4-NRCH, BE4-NRRH, BE4max-NRCH, BE4max-NRRH, CBE6varients-NRCH, CBE6varients-NRRH, SpCas9 TadCBEd-V106W-NRCH, SpCas9 TadCBEd-V106W-NRRH, BE4-NG, BE4max-NG, CBE6varients-NG, iSpyMac-BE3, iSpyMacBE4, SpCas9 TadCBEd-V106W-NG, SpyMac- BE3, SpyMacBE4, or SpyMacCBE6varients and the SCN8A targeting protospacer guide is a human protospacer guide selected from SEQ ID NOs: 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, and 174.

[0156] In some embodiments, the cytosine base editor is SpRY-BE4, SpRY-BE4max, SpRY-CBE6varients, eNme2-C-BE4, eNme2-C-CBE6varients, BE4-NRCH, BE4-NRRH, BE4max-NRCH, BE4max-NRRH, CBE6varients-NRCH, CBE6varients-NRRH, SpCas9 TadCBEd-V106W-NRCH, SpCas9 TadCBEd-V106W-NRRH, BE4-NG, BE4max-NG, CBE6varients-NG, iSpyMac-BE3, iSpyMacBE4, SpCas9 TadCBEd-V106W-NG, SpyMac- BE3, SpyMacBE4, or SpyMacCBE6varients and the SCN8A targeting protospacer guide is a mouse protospacer guide selected from SEQ ID NOs: 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, and 175.

[0157] In another aspect, described herein is a vector that comprises a SCN8A R1872W- targeting adenine base editor, a SCN8A R1617Q-targeting adenine base editor, a SCN8A G1475R-targeting adenine base editor, a SCN8AR850Q-targeting adenine base editor, a SCN8A R1872Q-targeting adenine base editor, or a SCN8A N1877S-targeting cytosine base editor. In some embodiments, the vector is a retroviral vector, a lentiviral vector, a phage vector, an adenoviral vector, an adeno-associated virus (AAV) vector, or a herpes simplex vector. In some embodiments, the vector is delivered into a cell, a tissue or a subject with a delivery system comprising a lipid, a nanoparticle, a lipid nanoparticle, a liposome, an exosome, a microvesicle, or a gene-gun.

[0158] In some embodiments, the nucleotide sequence of the protospacer guide is partially or fully complementary to a target mammalian genomic sequence.

[0159] In some embodiments, the target mammalian genomic sequence is a human genomic sequence.

[0160] In some embodiments, the target mammalian genomic sequence is a SCN8A genomic sequence.

[0161] In some embodiments, the target mammalian genomic sequence is upstream of a protospacer adjacent motif (PAM) sequence.

[0162] In some embodiments, the protospacer guide is a single guide RNA (sgRNA).

[0163] In some embodiments, a protospacer guide sequence is complementary to a target sequence. As used herein, the term “complementary” refers to the ability of nucleobases of a first nucleic acid molecule, such as a RNA guide, to base pair with nucleobases of a second nucleic acid molecule, such as a target sequence. Two complementary nucleic acid molecules are able to non-covalently bind under appropriate temperature and solution ionic strength conditions. In some embodiments, a protospacer guide sequence comprises 100% complementarity to a target sequence. In some embodiments, a protospacer guide sequence is complementary to a target sequence if the protospacer guide sequence comprises at least about80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementarity to the target sequence.

[0164] As used herein, the term “substantially complementary” refers to a polynucleotide (e.g., a protospacer guide) that has a certain level of complementarity to a target sequence. In some embodiments, the level of complementarity is such that the polynucleotide can hybridize to the target sequence with sufficient affinity to permit an effector polypeptide that is complexed with a compatible base editor to act (e.g., cleave) on the target sequence. In some embodiments, a protospacer guide sequence that is substantially complementary to a target sequence has less than 100% complementarity to the target sequence. In some embodiments, a protospacer guide sequence that is substantially complementary to a target sequence has at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementarity to the target sequence. In some embodiments, a protospacer guide that is substantially complementary to a target sequence has 100% complementarity to the target sequence.

[0165] In some embodiments, the SCN8A-targeting adenine or cytosine base editors disclosed herein are used as a gene therapy to transport functional copies of genes, RNA molecules, or gene-editing components to subjects, to modify, replace or introduce genetic materials into the subject’s cell to treat or prevent genetic disease, disorder, or syndrome.

[0166] In some embodiments, SCN8A-targeting adenine or cytosine base editor disclosed herein can be administered via any suitable route, which may depend on, e.g., the medical condition being treated and its location and the pharmacokinetics of the inhibitor. Potential routes of administration include without limitation oral, parenteral (including intradermal, subcutaneous, intramuscular, intravascular, intravenous, intra-arterial, intraperitoneal, intracavitary, intramedullary, intrathecal and topical), and topical (including dermal / epicutaneous, transdermal, mucosal, transmucosal, intranasal [e.g., by nasal spray or drop], ocular / intraocular [e.g., by eye drop], pulmonary [e.g., by oral or nasal inhalation], buccal, sublingual, rectal [e.g., by suppository], and vaginal [e.g., by suppository]).

[0167] In some embodiments, the SCN8A-targeting adenine or cytosine base editor disclosed herein is administered at an effective amount to a subject once. Repeated administration to a subject may be conducted at a regular interval (e.g., daily, every other day, twice per week, weekly, twice per month, monthly, every six months, once per year, or less or more frequently) as necessary to treat (e.g., improve or alleviate) one or more symptoms of a genetic disease, disorder, or condition in the subject.

[0168] Administration of the delivery vehicle to the subject may involve suitable carriers, excipients, and other agents within formulations that enhance transfer, delivery, tolerance, and similar factors. Numerous appropriate formulations are detailed in a standard reference for pharmaceutical chemists: Remington's Pharmaceutical Sciences (15th ed., Mack Publishing Company, Easton, Pa. (1975)), specifically in Chapter 87 by Seymour Blaug. Examples of such formulations include powders, pastes, ointments, jellies, waxes, oils, lipid- based vesicles (cationic or anionic) such as Lipofectin™, DNA conjugates, anhydrous absorption pastes, oil-in-water and water-in-oil emulsions, carbowax (polyethylene glycols of various molecular weights), semi-solid gels, and mixtures containing carbowax. Any of these formulations may be suitable for use in treatments and therapies under this invention, provided the active ingredient remains active within the formulation and is physiologically compatible and tolerable for the chosen administration route.

[0169] Carriers include excipients and diluents and must be of sufficiently high purity and sufficiently low toxicity to render them suitable for administration to the patient being treated. The carrier can be inert, or it can possess pharmaceutical benefits of its own. The amount of carrier employed in conjunction with the compound is sufficient to provide a practical quantity of material for administration per unit dose of the compound. Classes of carriers include, but are not limited to binders, buffering agents, coloring agents, diluents, disintegrants, emulsifiers, flavorants, glidents, lubricants, preservatives, stabilizers, surfactants, tableting agents, and wetting agents. Some carriers may be listed in more than one class, for example vegetable oil may be used as a lubricant in some formulations and a diluent in others. Exemplary pharmaceutically acceptable carriers include sugars, starches, celluloses, powdered tragacanth, malt, gelatin; talc, and vegetable oils. Optional active agents may be included in a pharmaceutical composition, which do not substantially interfere with the activity of the compound of the present invention.METHODS OF USE

[0170] In some embodiments, the present application provides a method of treating a disease or a condition associated with de novo mutations in the SCN8A gene that encodes the sodium channel Navi.6, a voltage-gated sodium channel transmembrane protein. The disease or condition is epilepsy, epilepsy syndromes, and / or epileptic seizure disorder, and wherein the method comprises administering to the mammal in need thereof a therapeutically effective amount of adenine base editors provided herein.

[0171] In one aspect, described herein is a method of modifying a SCN8A gene or a SCN8A gene with a single nucleotide polymorphism (SNP), or a cell that has incorporated the SCN8A gene or the SCN8A gene with a SNP. In some embodiments, the method comprises contacting the SCN8A gene, a SCN8A gene with a SNP, or the cell with a base editor. In some embodiments, the base editor is a SCN8A R1872W-targeting adenine base editor, a SCN8A R1617Q-targeting adenine base editor, a SCN8A G1475R-targeting adenine base editor, a SCN8A R850Q-targeting adenine base editor, a SCN8A R1872Q-targeting adenine base editor, or a SCN8A N1877S-targeting cytosine base editor. In some embodiments, the SCN8A gene with a SNP is associated with a R1872W mutation of SCN8A, a R1617Q mutation of SCN8A, a R850Q mutation of SCN8A, a G1475R mutation of SCN8A, a R1872Q mutation of SCN8A, a N1877S mutation of SCN8A, or a combination thereof. In some embodiments, modifying the SCN8A gene comprises inserting, deleting, or substituting one or more nucleotides in the SCN8A gene, or cleaving one or more genes in the SCN8A gene. In some embodiments, the cell is a prokaryotic or a eukaryotic cell. In some embodiments, the cell is a neuron cell. In some embodiments, the contacting is performed in vitro. In some embodiments, the contacting is performed in vivo.

[0172] In another aspect, described herein is a method of treating a disease or disorder associated a SCN8A gene or a SCN8A gene with a single-nucleotide polymorphism (SNP) in a subject in need thereof. In some embodiments, the subject has been diagnosed with a neurodevelopmental disorder, wherein the neurodevelopmental disorder is selected from Early Infantile Epileptic Encephalopathy (EIEE), Dravet Syndrome, West Syndrome (Infantile Spasms), Lennox-Gastaut Syndrome, Ohtahara Syndrome and Pontocerebellar Hypoplasia. In some embodiments, the method comprises administering to the subject a base editor. In some embodiments, the administration comprises administering the subject a SCN8A R1872W- targeting adenine base editor, a SCN8A R1617Q-targeting adenine base editor, a SCN8A G1475R-targeting adenine base editor, a SCN8A R850Q-targeting adenine base editor, a SCN8A R1872Q-targeting adenine base editor, or a SCN8A N1877S-targeting cytosine base editor.

[0173] In a further embodiment of the invention the epilepsy is Dravet syndrome, Lennox Gastaut syndrome, febrile infection related epilepsy syndrome (FIRES), Doose syndrome, Sturge Weber syndrome, CDKL5 mutation; Aicardi syndrome; bilateral polymicrogyria; Dupl5q; SNAP25; benign rolandic epilepsy; juvenile myoclonic epilepsy; infantile spasm (West syndrome); and Landau- Kleffner syndrome, refractory epilepsyjuvenile spasms, West syndrome, infantile spasms, refractory infantile spasms, tuberous sclerosiscomplex (TSC); neurogenetic storage disorder, neuronal ceroid lipofuscinoses (NCL), Batten disease, brain abnormality, atonic, idiopathic, absence seizure, partial seizure, simple partial seizure, or complex partial seizure.

[0174] In some embodiments, the epilepsy or epileptic seizure disorder is photosensitive epilepsy, self-induced syncope, intractable epilepsy, Angelman syndrome, benign rolandic epilepsy, CDKL5 disorder, childhood and juvenile absence epilepsy, Dravet syndrome, frontal lobe epilepsy, Glutl deficiency syndrome, hypothalamic hamartoma, infantile spasms / West's syndrome, juvenile myoclonic epilepsy, Landau-Kleffner syndrome, Lennox- Gastaut syndrome (LGS), epilepsy with myoclonic-absences, Ohtahara syndrome, Panayiotopoulos syndrome, PCDH 19 epilepsy, progressive myoclonic epilepsies, Rasmussen's syndrome, ring chromosome syndrome, reflex epilepsies, temporal lobe epilepsy, Lafera progressive myoclonus epilepsy, neurocutaneous syndromes, tuberous sclerosis complex, early infantile epileptic encephalopathy, early onset epileptic encephalopathy, SCN8A developmental and epileptic encephalopathy (SCN8A-DEE), focal onset seizure including adult focal onset seizure, generalized epilepsy with febrile seizures, Rett syndrome, multiple sclerosis, Alzheimer's disease, autism, ataxia, hypotonia, or paroxysmal dyskinesia.

[0175] In some embodiments, the epilepsy or epilepsy syndrome is a genetic epilepsy or a genetic epilepsy syndrome. In some embodiments, epilepsy or an epilepsy syndrome comprises epileptic encephalopathy, epileptic encephalopathy with SCN1A, SCN2A, SCN8A mutations, early infantile epileptic encephalopathy, Dravet syndrome, Dravet syndrome with SCN1A mutation, generalized epilepsy with febrile seizures, intractable childhood epilepsy with generalized tonic-clonic seizures, infantile spasms, benign familial neonatal-infantile seizures, SCN2A epileptic encephalopathy, focal epilepsy with SCN3A mutation, cryptogenic pediatric partial epilepsy with SCN3A mutation, SCN8A epileptic encephalopathy, sudden unexpected death in epilepsy, Rasmussen encephalitis, malignant migrating partial seizures of infancy, autosomal dominant nocturnal frontal lobe epilepsy, sudden expected death in epilepsy (SUDEP), KCNQ2 epileptic encephalopathy, or KCNT1 epileptic encephalopathy.

[0176] In some embodiments, the methods described herein further comprise identifying a subject having epilepsy or an epilepsy syndrome (e.g., epileptic encephalopathy, epileptic encephalopathy with SCN1A, SCN2A, SCN8A mutations, early infantile epileptic encephalopathy, Dravet syndrome, Dravet syndrome with SCN1A mutation, generalized Epilepsy with febrile seizures, intractable childhood epilepsy with generalized tonic-clonic seizures, infantile spasms, benign familial neonatal-infantile seizures, SCN2A epileptic encephalopathy, focal epilepsy with SCN3A mutation, cryptogenic pediatric partial epilepsywith SCN3 A mutation, SCN8A epileptic encephalopathy, sudden unexpected death in epilepsy, Rasmussen encephalitis, malignant migrating partial seizures of infancy, autosomal dominant nocturnal frontal lobe epilepsy, sudden expected death in epilepsy (SUDEP), KCNQ2 epileptic encephalopathy, or KCNT1 epileptic encephalopathy) prior to administration of an adenine base editor described herein.

[0177] In some embodiments, disclosed herein is a method of treating a subject who has a disease, disorder, or syndrome, which includes but is not limited to epilepsy, dravet syndrome, early infantile epileptic encephalopathy (EIEE), benign familial neonatal-infantile seizures (BFNIS), autism spectrum disorders (ASD), ataxia, peripheral neuropathies, brugada syndrome, congenital insensitivity to pain (CIP), primary erythromelalgia, sudden infant death syndrome (SIDS).

[0178] In some embodiments, the epilepsy or epileptic seizure disorder is selected from Dravet syndrome, infantile spasms / West's syndrome, temporal lobe epilepsy, Lennox- Gastaut syndrome (LGS), generalized epilepsy with febrile seizures, and early infantile epileptic encephalopathy.

[0179] In some embodiments, the epilepsy or epileptic seizure disorder is SCN8A developmental and epileptic encephalopathy (SCN8A-DEE) or adult focal onset seizure.

[0180] In some embodiments, the epilepsy or epileptic seizure disorder is SCN8A developmental and epileptic encephalopathy (SCN8A-DEE).

[0181] In some embodiments, the SCN8A-targeting adenine or cytosine base editor disclosed herein may be delivered to a subject together with a liposome. Suitable lipids for liposomal formulation include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, and the like.

[0182] In some embodiments, a delayed or sustained release of SCN8A-targeting adenine or / cytosine base editor can also be formulated as, e.g., a depot that can be implanted in or injected into a subject, e.g., intramuscularly, intracutaneously or subcutaneously. A depot formulation can be designed to deliver the nucleic acid over an extended period of time, e.g., over a period of at least about 1 week, 2 weeks, 3 weeks, 1 month or 3 months. For example, the nucleic acid can be formulated with a polymeric material (e.g., polyethylene glycol [PEG], polylactic acid [PLA] or poly glycolic acid [PGA], or a copolymer thereof [e.g., PLGA or PLA- PEG]), with a hydrophobic material (e.g., as an emulsion in an oil) and / or an ion-exchange resin, as a more lipophilic derivative (e.g., as an ester of or a salt with a fatty acid such as a C8- C20 fatty acid [e.g., decanoic acid]), or as a sparingly soluble derivative (e.g., a sparingly soluble salt).

[0183] In some embodiments, SCN8A-targeting adenine or cytosine base editor can also be contained or dispersed in a matrix material. The matrix material can comprise a polymer (e.g., ethylene-vinyl acetate) and controls the release of the compound by controlling dissolution and / or diffusion of the compound from, e.g., a reservoir, and can enhance the stability of the compound while contained in the reservoir. Such a release system can be designed as a sustained-release system, can be configured as, e.g., a transdermal or transmucosal patch, a microneedle transdermal patch, and can contain an excipient that can accelerate the compound’s release, such as a water-swellable material (e.g., a hydrogel) that aids in expelling the compound out of the reservoir.

[0184] Also disclosed herein are pharmaceutical formulations and medicaments comprising a SCN8A-targeting adenine or cytosine base editor the disclosure together with a pharmaceutically acceptable excipient. Suitable excipients include, but are not limited to, salts, diluents, (e.g., Tris-HCI, acetate, phosphate), preservatives e.g., Thimerosal, benzyl alcohol, parabens), binders, fillers, solubilizers, disintegrants, sorbents, solvents, pH modifying agents, antioxidants, antinfective agents, suspending agents, wetting agents, viscosity modifiers, tonicity agents, stabilizing agents, and other components and combinations thereof. Suitable pharmaceutically acceptable excipients can be selected from materials which are generally recognized as safe (GRAS), and may be administered to an individual without causing undesirable biological side effects or unwanted interactions. Suitable excipients and their formulations are described in Remington's Pharmaceutical Sciences, 16th ed. 1980, Mack Publishing Co. In addition, such compositions can be complexed with polyethylene glycol (PEG), metal ions, or incorporated into polymeric compounds such as polyacetic acid, polyglycolic acid, hydrogels, etc., or incorporated into liposomes, microemulsions, micelles, unilamellar or multilamellar vesicles, erythrocyte ghosts or spheroblasts. Suitable dosage forms for administration, e.g., parenteral administration, include solutions, suspensions, and emulsions.

[0185] In some embodiments, the formulation can be distributed or packaged in a liquid form, or alternatively, as a solid, obtained, for example by lyophilization of a suitable liquid formulation, which can be reconstituted with an appropriate carrier or diluent prior to administration. In some embodiments, the formulations can comprise SCN8A-targeting adenine or cytosine base editor in a pharmaceutically effective amount sufficient to edit a gene in a cell. The pharmaceutical compositions can be formulated for medical and / or veterinary use.

[0186] The disclosure further provides methods of using the SCN8A targeting adenine base editor, systems, and viral particles (including pluralities of particles) of the disclosure for altering cells.

[0187] In one aspect, a method of altering a cell comprises contacting a eukaryotic cell (e.g., a human cell) with a SCN8A-targeting adenine or cytosine base editor or pharmaceutical composition described herein.

[0188] Contacting a cell with a disclosed SCN8A-targeting adenine or cytosine base editor or pharmaceutical composition can be achieved by any method known in the art and can be performed in vivo, ex vivo, or in vitro. In some embodiments, the methods can include obtaining one or more cells from a subject prior to contacting the cell(s) with a herein disclosed nucleic acid, particle, system or pharmaceutical composition. In some embodiments, the methods can further comprise returning or implanting the contacted cell or a progeny thereof to the subject.

[0189] The disclosed SCN8A-targeting adenine or cytosine base editor can be delivered to a cell by any means known in the art, for example, by viral or non-viral delivery vehicles, electroporation or lipid nanoparticles.

[0190] A polynucleotide encoding SCN8A targeting adenine base editor, can be delivered to a cell (ex vivo or in vivo) by a lipid nanoparticle (LNP). LNPs can have, for example, a diameter of less than 1000 nm, 500 nm, 250 nm, 200 nm, 150 nm, 100 nm, 75 nm, 50 nm, or 25 nm. Alternatively, a nanoparticle can range in size from 1-1000 nm, 1-500 nm, 1- 250 nm, 25-200 nm, 25-100 nm, 35-75 nm, or 25-60 nm. LNPs can be made from cationic, anionic, neutral lipids, and combinations thereof. Neutral lipids, such as the fusogenic phospholipid DOPE or the membrane component cholesterol, can be included in LNPs as 'helper lipids' to enhance transfection activity and nanoparticle stability. LNPs can also be comprised of hydrophobic lipids, hydrophilic lipids, or both hydrophobic and hydrophilic lipids.

[0191] The disclosed SCN8A-targeting adenine or cytosine base editor can be delivered to a cell via an adeno-associated viral vector (e.g., of an AAV2, AAV5, AAV7m8, AAV8, AAV9, or AAVrh8r), or by another viral vector.

[0192] Other viral vectors include, but are not limited to lentivirus, adenovirus, alphavirus, enterovirus, pestivirus, baculovirus, herpesvirus, Epstein Barr virus, papovavirus, poxvirus, vaccinia virus, and herpes simplex virus. In some embodiments, a SCN8A-targeting adenine or cytosine base editor is formulated in a lipid nanoparticle, while a SCN8A-targeting adenine or cytosine base editor is delivered to a cell in an AAV or other viral vector. In someembodiments, one or more AAV vectors (e.g., one or more AAV2, AAV5, AAV7m8, AAV8, AAV9, AAVrh8r, or AAVrhl 0 serotype) are used to deliver SCN8A targeting adenine base editor. In some embodiments, a SCN8A-targeting adenine or cytosine base editor is delivered using separate vectors. In other embodiments, a SCN8A-targeting adenine or cytosine base editor is delivered using a single vector.GENERAL METHODSMaterials and Methods

[0193] Cell culture: Our laboratory, in collaboration with Brian Ruis at the UVA Genome Engineering Shared Resource (GESR) Core, established a cell line for the SCN8A gene containing the mutation R1872W. To achieve this, we introduced a 34-base-long doublestranded FRT sequence into the AVS1 AAV integration locus on chromosome 19 of HEK293 cells, which were obtained from the American Type Culture Collection (ATCC) with CRISPR- Cas9. For stable integration of plasmids, cells were cotransfected with pCAG-Flpe recombinase (Addgene Plasmid #13787) and a plasmid containing FLP sites and the R1872W mutation at an equimolar ratio. The first plasmid, designed by our team, contained two additional FRT sites flanking the entire mouse SCN8A sequence codon optimized by Dr. Jacy Wagnon. This plasmid was subjected to SDM to include the R1872W mutation as well as three silent mutations that were introduced in order for utilization of primers only targeting the mutant insert. This assisted in facilitating accurately targeted polymerase chain reaction (PCR) amplification within this multi-allele system. Consequently, this allowed for the insertion of a mouse-codon-optimized SCN8A sequence into the AVS1 locus, along with a Geneticin (G418) resistance cassette. The latter enabled antibiotic selection post-integration, thereby establishing a cell line conducive to the swift screening of-ma gRNA sequences. An additional Chinese Hamster Ovary (CHO) cell line containing the R1872W mutation was created via the same method with the exception of the CHO line being purchased from Invitrogen (Flp-In™-CHO Cell Line) already containing the FRT site needed for DNA recombination. Cells did not undergo antibiotic selection after base editor exposure and were cultured for 3 to 5 days before harvesting. All sgRNA sequences designed for this study are listed in the supplementary materials. Cells were maintained in Dulbecco’s Modified Eagle medium (DMEM; Life Technologies) supplemented with 10% fetal bovine serum (Gibco), 0.1 mM nonessential amino acids (NEAA, Life Technologies), Glutamax (GM, Life Technologies.

[0194] Cloning: Base editor plasmids were constructed by replacing deaminase andCas-protein domains of the p2T-CMV-ABE7.10-BlastR (Addgene #152989) plasmid by USERcloning (NEB). Individual sgRNAs were cloned into the SpCas9-hairpin U6 sgRNA expression plasmid (Addgene #71485) using BbsI plasmid digest and Gibson assembly (NEB). The sgRNA expression plasmid then was subjected to P2A-GFP insertion and subjected to site- directed mutagenesis to produce the varying photospacer sequences Genscript Inc.. Constructs were transformed into Top 10 chemically competent Escherichia coli (Thermo Fisher) grown on LB agar plates, and liquid cultures were grown in LB broth overnight at 37 °C with 100 pg / ml ampicillin. Individual colonies were validated by Sanger sequencing. Verified plasmids were prepared by maxiprep (Qiagen). AAV vectors were cloned by Genscript Inc. to insert the sgRNA sequence and C-terminal base editor half of ABE8e-NRCH (V106W) into v5 Cbh- AAV-ABE-NpuC+U6-sgRNA (Addgene #137177), and the N-terminal base editor half v5 Cbh-AAV-ABE-NpuN (Addgene #137178). Viral capsid preparations, packaging and purification was performed by Salk Institute’s Gene Transfer, Targeting and Therapeutics Viral Vector Core.

[0195] Base editor characterization library assay: For genome editing experiments and characterization of base editing constructs, mutation-integrated cells were seeded 1 day prior to be -70% confluent on the day of transfection and transfected with sgRNA and genome editing plasmids at a 1: 1 molar ratio in either cell line using Lipofectamine 3000 (ThermoFisher Scientific) in accordance with the manufacturer’s protocols in T25 flasks. We collected gDNA from cells 3 days after transfection and Genomic DNA was isolated using PurelinkDNA mini Kit (Invitrogen)

[0196] Mouse husbandry and genotyping: Scn8aW / + mice were generated as previously described and maintained through crosses with C57BL / 6I mice (Jax, #000664) to keep all experimental mice on a C57BL / 6J genetic background. Cell type-specific expression of R1872W was achieved using males heterozygous for the R1872W allele and C57BL / 6J females homozygous for either Ella-Cre (lax, #017320) or EMXl-Cre (lax# 005628) to generate mutant mice (Scn8aW / + / EIIaCre and Scn8aW / + / EMXlCre). Homozygous Cre females were used for breeding to ensure minimal germline recombination due to Cre. Because certain transgenic mice entail the insertion of Cre directly into the coding sequence for all experiments we used WT / W / + controls that contained the same allele encoding the Scn8a variant but lacked Cre activation and therefore only expressed wildtype Navi.6 from dual alleles.

[0197] Intracerebroventricular injections: Neonatal WT and mutant R1872W mice were given a single unilateral intracerebroventricular injection (ICV, 2 pL volume) of either 2.0E10 vg PhP.eB-CMV-GFP in PBS(Mg+2 &Ca+2 negative) or LIEU viral genomes (vg) ofthe 8NWC2 treatment in PBS(Mg+2 &Ca+2 negative) (5.5E10 vg of each dual AAV9-ABE vectors) along with 2.0E10 vg PhP.e-eGFP at postnatal day 1 using a 33-gauge needle attached to a 5 pL microvolume syringe. High-titer qualified AAV was obtained through the Gene Transfer, Targeting and Therapeutics Viral Vector Core at Salk Institute and stored at -80° until use. The injection solution was loaded through Hamilton plungers. 2 pl of injection mix was injected using a 3D printed pup immobilizer and a stereotactic arm for Hamilton syringe stabilization into each ventricle 24 hours after birth of pups.

[0198] Immunofluorescence imaging 8NWC2 in cortex, hippocampus, and dentate gyrus: Floating sections were fixed in 4% paraformaldehyde (PFA), washed in PBS 3 times for 5 minutes each, permeabilized with 0.1% Triton X-100 in PBS for 30 minutes, wash again and blocked with 2% bovine serum albumin (BSA) for 2 hours, and incubated with primary antibodies overnight at 4°C at a concentration of 1:1000. Sections were subsequently washed 3 times in PBS before secondary antibodies were applied for 2 hours at a concentration of 1 :500 in PBS containing 2% BSA at room temperature. Finally, the floating sections were washed 3 times with PBS and mounted in Prolong Gold antifade reagent with DAP1 on a microscope slide and covered with a cover glass.

[0199] Images were gathered using Zeiss Zen software on a LSM700 or LSM880. Overall cortical images were stitched following acquisition with a 20 x objective (Plan- Apochromat 20 x / 0.8) and z-stack images were gained by use of a 63 x objective (Plan- Apochromat 63 x / 1.4). Image brightness and contrast was adjusted for presentation and scale bars were added using FIJI software (Schindelin. J et al 2012).

[0200] Materials include Gibco DPBS (lOx), no calcium, no magnesium (14200- 075); Invitrogen Prolong Gold antifade reagent with DAPI (P36935); Fisher Superfrost Plus Microscope Slide (1255012); and Fisher Fisherfinest Premium Cover Glass 24x50-1 (125485M).

[0201] Primary antibodies include Abeam ab290 Rb pAb to GFP; Abeam abl83999 Rb mAb to GAD65 / 67 and Millipore MAB377 Ms x Neuronal Nuclei (NeuN).

[0202] Secondary antibodies (Alexa Fluor) include 488 goat anti-mouse IgG (H+L) Al 1029; 555 goat anti-rabbit IgG (H+L) A21429; and 594 goat anti-rabbit IgG (H+L) Al 1037.

[0203] Brain Slice Preparation for Electrophysiology: Preparation of acute brain slices for patch-clamp electrophysiology experiments was modified from standard protocols previously described.67,69,72 Mice were anesthetized with isoflurane and decapitated. The brains were rapidly removed and kept in chilled ACSF (0°C) containing (in mM): 125 NaCl,2.5 KC1, 1.25 NaH2PO4, 2 CaC12, 1 MgC12, 0.5 L-ascorbic acid, 10 glucose, 25 NaHCO3, and 2 Na-pyruvate. For electrophysiology experiments recording sodium currents, the slicing solution was modified to contain (in mM): 93 N-Methyl-D-glucamine (NMDG), 2.5 KC1, 1.25 NaH2PO4, 20 HEPES, 5 L-ascorbic acid (sodium salt), 2 thiourea, 3 sodium pyruvate, 0.5 CaC12, 10 MgSO4, 25 D-glucose, 12 N-acetyl-L-cysteine, 30 NaHCO3; pH adjusted to 7.2- 7.4 using HC1 (osmolarity 310 mOsm). Slices were continuously oxygenated with 95% 02 and 5% CO2 throughout the preparation. 300 pm coronal brain sections were prepared using a Leica Microsystems VT1200 vibratome. Slices were collected and placed in ACSF warmed to 37 °C for ~30 min and then kept at room temperature for up to 6 h.

[0204] Electrophysiology Recordings: Brain slices were placed in a chamber superfused (~2 ml / min) with continuously oxygenated recording solution warmed to 32 ± 1°C. Cortical layer IV / V PV interneurons were identified as red fluorescent cells using a Carl Zeiss Axioscope microscope. Whole-cell recordings were performed using a Multiclamp 700B amplifier with signals digitized by a Digidata 1322A digitizer. Currents were amplified, lowpass filtered at 2 kHz, and sampled at 100 kHz. Borosilicate electrodes were fabricated using a Brown-Flaming puller (model P1000, Sutter Instruments) to have pipette resistances between 3 and 5 mQ. All patch-clamp electrophysiology data were analyzed using custom MATLAB scripts and / or ClampFit 10.7.

[0205] Intrinsic Excitability Recordings: Current-clamp recordings of neuronal excitability were collected in ACSF solution identical to that used for preparation of brain slices. The internal solution contained the following (in mM): 120 K-gluconate, 10 NaCl, 2 MgC12, 0.5 K2EGTA, 10 HEPES, 4 Na2ATP, 0.3 NaGTP, pH 7.2 (osmolarity 290 mOsm). Intrinsic excitability was assessed using methods adapted from those previously described.69,72 Briefly, resting membrane potential was manually recorded from the neuron at rest. Current ramps from 0 to 400 pA over 4 s were used to calculate passive membrane and AP properties, including threshold, upstroke and downstroke velocity, which are the maximum and minimum slopes on the AP, respectively; amplitude, which was defined as the voltage range between AP peak and threshold; APD50, which is the duration of the AP at the midpoint between threshold and peak; input resistance, which was calculated using a -20 pA pulse in current-clamp recordings; and rheobase, which was defined as the maximum amount of depolarizing current that could be injected into neurons before eliciting an AP. AP frequencycurrent relationships were determined using Is current injections from -140 to 600 pA.

[0206] Persistent and Resurgent Sodium Current Recordings: The recording solution has been previously described91,92 and contained (in mM): 100 NaCl, 40 TEACI, 10 HEPES,3.5 KC1, 2 CaC12, 2 MgC12, 0.2 CdC12, 4 4- aminopyridine (4-AP), 25 D-glucose. Steady-state persistent sodium currents (INaP) were elicited using a voltage ramp (20 mV / s) from -80 to -20 mV. To record resurgent sodium currents (INaR), VIP interneurons were held at -100 mV, depolarized to 30 mV for 20 ms, then stepped to voltages between -100 mV and 0 mV for 40 ms. After collecting recordings at baseline, protocols were repeated in the presence of 1pm tetrodotoxin (TTX; Alomone Labs) to completely isolate INaP and INaR currents. TTX- subtracted traces were analyzed by extracting the current at each mV. The half-maximal voltage for activation of INaP was calculated as previously described.

[0207] In Vivo Seizure Monitoring: Custom electroencephalogram (EEG) headsets (PlasticsOne) were implanted in 5-week-old Scn8aW / +-PV mice and 6-8-week-old Scn8aD / + mice using standard surgical techniques. Anesthesia was induced with 5% and maintained with 0.5%-3% isoflurane. Adequacy of anesthesia was assessed by lack of toe-pinch reflex. A midline skin incision was made over the skull and connective tissue was removed. Burr holes were made at the lateral / anterior end of the left and right parietal bones to place EEG leads, and at the interparietal bone for ground electrodes. EEG leads were placed bilaterally in the somatosensory cortex and unilaterally placed in the occipital lobe. A headset was attached to the skull wi th dental acrylic (Jet Acrylic; Lang Dental). Mice received postoperative analgesia with ketoprofen (5 mg / kg, i.p.) and 0.9% saline (0.5 mL i.p.) and were allowed to recover a minimum of 2-4d before seizure-monitoring experiments.

[0208] Mice were then individually housed in custom-fabricated chambers and monitored for the duration of the experiment. The headsets were attached to a custom low- torque swivel cable, allowing mice to move freely in the chamber. EEG signals were amplified at 2000x and bandpass filtered between 0.3 and 100 Hz, with an analog amplifier (Neurodata model 12, Grass Instruments). Biosignals were digitized with a Powerlab 16 / 35 and recorded using LabChart 7 software at 1 kS / s. Video acquisition was performed by multiplexing four miniature night vision-enabled cameras and then digitizing the video feed with a Dazzle Video Capture Device and recording at 30 fps with LabChart 7 software in tandem with biosignals.

[0209] Behavioral assays: Open Field Test. All behavioral tests were conducted in behavioral testing rooms between 13:00 and 17:00 during the light phase of the light / dark cycle. Behavioral tests were performed in mice between the ages of 4 and 8 weeks.. Mice were tested in a random order. After the tests, the equipment was cleaned with 70% ethanol and super hypochlorous water to eliminate olfactory cues. The behavioral testing rooms were illuminated at 100-lux intensity.

[0210] Exploratory behavior, anxiety-like behavior, and general locomotor activity were examined using the open-field test. Each mouse was placed in the center of the apparatus consisting of a square area surrounded by white acrylic walls (45 45 - 40 cm). The total distance travelled (m) and time spent in the central area (s) were recorded. The central area was defined as the middle 20 x 20 cm area of the field. The test chamber was illuminated at 100 lx. Data was collected over a 5-min period. Data analysis was performed using the ANY-MAZE software.

[0211] Mouse genotyping and PCR amplification: Targeted Sanger Sequencing: Briefly, we isolated genomic DNA (gDNA) with the Invitrogen™PureLink™ Genomic DNA Mini Kit and used approximately 25mg of tissue and up to 10 ng of gDNA was used for individual locus editing experiments and 20 pg of gDNA for comprehensive context library samples. Sequencing libraries were amplified in three steps, first to amplify the mutated locus of interest to confirm editing of the mutant allele without healthy read noise from the wildtype allele of the heterozygote mice (A).

[0212] Primers: Forward Mutant 5’ -CATGTACATCGCCATTATTTTG-3’ (SEQ ID NO: 177); Primers: Forward Wildtype 5’-CATGTACATTGCCATCATCTTG-3’ (SEQ ID NO: 178); Primers: Reverse Mutant and Wildtype 5’-CTTTGTCACGCTGTCGTAAGAG-3’ (SEQ ID NO: 179); Primers: Sangar 5’-CTCGGTGGGTGCCTCCATTCTC-3’ (SEQ ID NO: 180)

[0213] The second to shorten the length of the amplicon from 700 bp to 150bp; and third to add full-length Illumina sequencing adapters (B).

[0214] Primers: NGS PREP Forward 5’-CAAGCCCAACACCATCGAG-3’ (SEQ ID NO: 181); Primers: NGS PREP Reverse 5’ -CTTTGGAAGGATTGGACGCC-3’ (SEQ ID NO: 182).

[0215] Next Generation Amplicon genomic DNA Sequencing: For the forward sequencing library preparation read: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’ (SEQ ID NO: 183); For the reverse sequencing read: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3’ (SEQ ID NO: 184)

[0216] All subsequent library preparations and Illumina 2x150 bp sequencing was performed by Azenta (‘Genewiz’’)). The pooled samples were sequenced using Alignment of fastq files and quantification of editing frequency for individual loci were performed using CRISPResso2 in batch mode. The editing frequency for each site was calculated as the ratio between the number of modified reads (i.e., containing nucleotide conversions or indels) and the total number of reads.

[0217] Whole-transcriptome RNA sequencing: Library preparation and sequencing were performed by Azenta “Genewiz”. Total RNA was harvested from cells in the hippocampus and cortex using the RNeasy Mini kit (Qiagen). FASTQs were generated by Azenta “Genewiz” in paired-end mode with default parameters to remove low-quality bases, adapter sequences, and unpaired sequences. Trimmed reads were aligned to the GENCODE mouse reference genome M31 (GRCm39) using IGV genome analysis browser and refined to canonical coding sequences using CCDS release 21.

[0218] Statistical Analysis: Analysis of electrophysiological data was performed blinded. All statistical comparisons were made using the appropriate test in GraphPad Prism 9. For membrane and AP properties, spontaneous firing frequency, peak sodium currents, half- maximal voltages, and IPSC frequency and amplitude, mouse genotypes were compared by one-way ANOVA followed by Dunnett's multiple comparisons test when the data were normally distributed with equal variances, by Brown-Forsythe ANOVA with Dunnett’s multiple comparisons test when the data were normally distributed with unequal variances, and by the nonparametric Kruskal- Wallis test followed by Dunn's multiple comparisons test when the data were not normally distributed. Data were assessed for normality using the Shapiro- Wilk test. Data were tested for outliers using the ROUT method to identify outliers. A two-way ANOVA followed by Tukey's test for multiple comparisons was used to compare groups in experiments in which repetitive measures were made from a single cell over various voltage commands or current injections. Data are presented as individual data points and / or mean ± SEM. Exact n and p-values are reported in figure legends.

[0219] Only the R1872W mutation has been modeled in mice out of the 6 most recurrent mutations. The mouse model of R1872W has been developed to displays spontaneous seizures and 100% penetrance of premature death, mirroring the clinical phenotype in pediatric patients. This variant is a Cre-Recombinase dependent variant. We have used two mouse models referred to as Scn8aW / +;EIIa-Cre (global expression of variant) and Scn8aW / +;EMXl - Cre (expression only in Hippocampus and cortex). We have used these two models to assess our base editing therapeutics in vivo. We provide pre-clinical data demonstrating that our approach to use base editing techniques works to correct the underlying SCN8A variant (R1872W) (Fig. 2). The data provided below, showcases the efficacy and specificity of these constructs in targeting methylated genomic regions, offering a promising robust therapeutic strategy for correcting the other recurrent SCN8A mutations in similarly signatured areas as only the R1872W mutation has been modeled in mice out of the 6 most recurrent mutations (see Guide Constructs section).EXAMPLESEXAMPLE 1. TARGETING R1872W MUTATED SCN8A IN MICE

[0220] We evaluated the ability of our synthetic spacers to target SCN8A and its pathogenic mutations in live systems using our lab's evolved editor, ABE8e [TadAV106W]- NRCH. ABE8e [TadAV106W]-NRCH has not been previously reported so its efficiency and abilities were unknown before our studies. We selected one of the four available protospacer guide sequences compatible with our evolved editor. We digested these plasmids and incorporated the base editing components into two AAV split intein backbones. The AAV split intein backbones have been described, e.g., by Liu, et al. in US 11,306,324, which is hereby incorporated by reference for its teachings regarding intein backbones. Subsequently, the reconstituted intein structures with our base editing components incorporated into AAV backbone plasmids were dispatched to the Salk Institute's Viral Vector Core for packaging into PhP.eB -evolved AAV viruses and in vivo application purification.

[0221] Dual-AAV9-mediated delivery of the ABE8e [TadAV106W]-NRCH and a green fluorescent protein AAV (GFP) were injected into SCN8aW+ / EIIA-Cre neonates. We conducted a preliminary study with an ICV dosage consistent with clinically approved FDA levels of AAV viral genomes / kilogram mouse of the AAV editor system into a SCN8A R1872W mouse pup at P2. Survival was increased from 14 days for a non-injected littermate pup to 55 days survival for the base editor treated mouse. Furthermore, Sanger sequencing analysis conducted by Eurofins Genomic Incorporated revealed an approximately 30% transversion rate from A to G (CCA to CCG) in cortical and hippocampal tissue in the base editor treated mouse while in non-injected litter controls there were no observable reads of G detected (FIG. 3). A total of 2xl012vg / kg of the dual PhP.eB-ABE vectors, along with a IxlO11vg / kg PhP.eB-Cbh- eGFP vector were delivered to mice on P0 via ICV CNS injection.EXAMPLE 2. SURVIVAL OF MOUSE PUPS WITH R1872W SCN8A MUTATION FOLLOWING INJECTION WITH BASE EDITOR CONTAINING R1872W PROTOSPACER

[0222] We injected a larger number of SCN8aW+ / EIIA-Cre neonates mouse neonates at the same ICV dosage to discern the abilities of this editor to repeatedly target the R1872W mutation. A litter of 7 SCN8aW+ / EIIA-Cre neonates pups at P0 were injected with the same ICV dosage used in Example 1 and compared to a separate cohort of C+ / EIIA-Cre control litter. The pups injected with the base editors had increased survival compared to that of the control mice. Notably, three mice reached the weaning stage (>P21), a survival time not observed innon-injected control litters (FIG. 4A). One mouse weaned from this injected group lived for 75 days. Sanger sequencing conducted by Eurofins Genomics detected no observable G reads in the control SCN8aW+ / EIIA-Cre neonates mice (Fig. 4B). Editing of SCN8A in AAV-injected mice was confirmed by Next Generation Illumina MySeq deep-read amplicon sequencing conducted by Azenta Life Sciences and control mice sequenced reads were combined and averaged in order to compare with injected mice NGS data (Fig. 5.)L0223] One mouse from the injected litter, which succumbed on day 16 (a time typically associated with dropout in control survival curves), showed an insignificant number of reads for the "G" in the SNP loci to be detected by Sanger sequencing (Fig. 4B). NGS revealed that the mice that died of a seizure on days 15 and 16 had less than 10% A to G editing, a number insufficient for rescue. This observation, along with the other time variations among the pups that received the base editor construct, is likely a result of the time needed for AAV viruses to attain their peak expression levels. Typically, around half of AAV gene expression is anticipated within 10 days following in vivo infection, with maximum expression at 3 weeks. Protein expression levels can also fluctuate depending on factors such as the specific protein being expressed, the type of promoter used, and the cell type involved. If the virus was not able to properly enter the ventricles or express the base editors in sufficient numbers by the time Navi.6 protein expression increases in magnitude after PIO, there may not be enough wildtype protein translated from the corrected SNP in time to allow mice to live significantly past the dropout for a noninjected SCN8aW+ / EIIA-Cre neonate litter of mice.EXAMPLE 3. TREATMENT OF MICE BY INJECTION INTO EACH VENTRICLE

[0224] To control for total viral delivery load to the ventricles, viral delivery was modified to parallel the delivery completed in base editing treatment of A7SMA mice that live a similar survival curve compared to the SCN8aW+ / EIIA-Cre neonate mice with a dropoff time of 12-20 days. A small cohort of 4 mice were subjected to a freehand injection into each ventricle on two consecutive days: P0 and Pl. The remaining three mice of the litter were kept as littermate controls. One injected mouse was unable to be harvested and sequenced due to cerebral sample loss. The remaining three experimental mice injected with the dual-AAV and GFP viruses were processed for subsequent Sanger and NGS sequencing which revealed more confirmation of our group’s ability to accurately target this SNP in vivo. (Fig. 6) EXAMPLE 4. SURVIVAL OF MICE WITH CRE RECOMBINASE ACTIVATED R1872W MUTATION

[0225] In order to further understand the limitations of the SCN8aW+ / EIIA-Cre neonates model and allow full visualization of viral expression time, editing activity, and timeto express the corrected protein, we utilized an additional R1872W model gifted to us, SCN8aW+ / EMXl-Cre neonates, another heterozygous expression model of the R1872W allele activated by Cre Recombinase. This model is a conditional mutation expressed, not ubiquitously as the EIIA-Cre model is, but rather conditionally in the cortex and hippocampal areas. The model begins to exhibit seizures around post-wean day 21 and the survival curve is complete at day 31. This timeline allows more time for base editing to take place. SCN8aW+ / EMXl-Cre pups at PO were injected with the same 1CV dosage of dual- AAV and GFP viruses as used in the preliminary study and first SCN8aW+ / EIIa-Cre study. They were compared to an SCN8aW+ / EMXl-Cre control litter. Notably, all injected AAV- ABE mice had increased survival compared to the control group with 75% of injected mice still alive on day 60 as of 11 / 6 / 23 (Fig. 7). One of two samples at this time have been processed for sequencing which reveals 8+7% A to G editing of the target in samples from the cortex and hippocampus.EXAMPLE 4. ABE TREATMENT TARGETS R1872W Loci IN VITRO

[0226] Construction and in vitro verification of SCN8A adenine base editor SCN8A is encoded on the positive strand and due to the mutation of CGG (Arginine) to TGG (Tryptophan), the positive strand is not accessible to either cytosine or adenine base editors as C to T transversions are not within their capabilities. Instead, we chose to target the negative strand complementary sequence which contains CCG mutated to CCA (Fig. 8). This adenine to guanine conversion is accessible and so, an adenine base editor (ABE) was employed to facilitate our base transversion. Additionally, a canonical NGG PAM which ABE8e (popular high efficiency ABE variant) recognizes is not present near the R1872W loci in a utilizable position for guide RNA constructs so base editors with fluid PAM sequences were explored for a cell screen to determine efficacy of constructs. We identified and designed guide RNA photo spacers that can use different ABE deaminases constructs with varying PAM recognition abilities to revert the SNP R1872W. We chose to pair these into testable constructs based on reported PAM preferences (‘predicted % PAM efficiency’) and constructs with high predictive accuracy from both BE-HIVE, CRISPOR, and CRISPR RGEN tools. All recurrent mutations had their designated sgRNA constructs designed in the fashion with the same restraints. These RNA constructs, each designed to target different adenine positions and their associated PAM sequences, were initially evaluated in HEK293 cells engineered to harbor a mouse-codon- optimized SCN8A gene with the patient-specific R1872W mutation.

[0227] Base editing of the SNP R1872W in HEK293 cells was highly efficient without requirement for antibiotic selection or flow cytometry sorting of transfected cells. Theediting efficiencies observed were approximately 37% A-to-G conversion by construct CIO, 33% by C8, 22% by C12, 18% by C7, 17% by C2, 16% by Cl, and 15% by C6 (Fig. 9A). Constructs Cl 1, C12, C4, and C3 exhibited over 2% off-target adenine activity within the guide RNA window, disqualifying them from further studies. Constructs C5, C9, and C13-C15 did not produce any detectable editing in the absence of cellular selection. The most efficient constructs, demonstrating no off-target window activity, were then evaluated in CHO cells engineered to harbor a mouse-codon-optimized SCN 8A gene with the patient-derived R 1872W mutation. Base editing in CHO cells also yielded high efficiencies without requiring cell selection, achieving approximately 36% A-to-G conversion by C8, 30% by C2, 21% by C6, 16% by CIO and Cl, and 5% by C7 (Fig. 9B). We selected construct C2 for in vivo analysis, as the ABE8e base editor has demonstrated enhanced control over off-target editing and improved fidelity. This is achieved by significantly reducing both DNA and transcriptome-wide RNA off-target effects especially when the V106W mutation is introduced in the TadA domain. The TadA-8e V106W domain is particularly advantageous in gene editing scenarios where minimizing off-target activity is crucial, such as with the R1872W mutation, where the presence of multiple adenines in the target sequence poses a heightened risk in a sensitive pediatric population.

[0228] However, while the V106W mutation has been evaluated in ABE8e, it has not been tested in ABE8e-NRCH. To address this, we performed site-directed mutagenesis (SDM) on the TadA-8e domain to introduce the V106W mutation. The construct was then divided into N-terminal and C-terminal pAAV backbones, incorporating NpuN and NpuC intein proteins to form construct C2v2 (Fig. 11). To ensure that these modifications did not compromise the construct’s activity, we conducted tests in HEK293 and CHO-FRT-R1872W cell lines, comparing the results to those from C2 transfected cells lacking these modifications. We found no significant loss in editing of the R1872W loci when C2v2 V106W split intein construct was compared to C2 in HEK293 and CHO cell lines (Fig. 10).EXAMPLE 5. ABE TREATMENT AMELIORATES EPILEPSY IN VIVO

[0229] To test in vivo conversion of the R1872W allele, we employed two mouse models: Scn8aW / +;EIIa-Cre, which confers global heterozygous expression of the R1872W locus, and Scn8aW / +;EMXl-Cre, which restricts heterozygous expression to forebrain excitatory neurons. We designed an adeno-associated virus (AAV) delivery strategy, referred to as NW2, to package the split ABE8e [TadAV106W)-NRCH base editor along with the C2 sgRNA. For packaging, we selected the AAVPHP.eB capsid, an engineered variant of AAV9,due to its enhanced ability to penetrate the blood-brain barrier (enables future studies to be explored with non-ICV injection methods) without altering neuronal tropism or the number of neurons targeted. In the cortex and hippocampus, AAV9 and PhP.eB exhibited no significant difference of neuronal tropism or physical quantity of neurons targeted in mice when injected intracerebroventricularly (ICV). Both serotypes have been shown to almost exclusively target neurons and ICV results in efficient transduction of neurons compared to other cells at levels of over 80%. Given these characteristics, we utilized PhP.eB to deliver the NW2 strategy to both Scn8aW / +;EIIa-Cre and Scn8aW / +;EMXl-Cre neonates at P2 via ICV injection. We ICV injected neonates of both genotypes with total of 1.1E11 viral genomes (vg) of the NW2 treatment (5.5E10 vg of each dual AAV9-ABE vectors) along with 2.0E10 vg PhPe-eGFP (Fig. 11). Mutant mice were injected with 2.0E10 vg PhPe-eGFP to serve as a viral transduction control treatment Sham (placebo). This dose is comparable to high therapeutic doses used for P0 ICV AAV administration of base editors for rescue Hutchinson-Gilford progeria syndrome as well as Niemann-Pick disease in mice.

[0230] Peak expression of AAV s, and therefore editing activity, occurs around 2 to 3 weeks and global expression of the R1872W SCN8A variant (Scn8aW / +;EIIa-Cre) leads to premature death at P14, typically after a single seizure. Despite the incongruent timeline of base editing-mediated rescue, NW2 increased the lifespan of treated animals from an average of 14.5 days (median 15 days, maximum 18 days) to a median over date of wean (20 days) and a maximum 283 days, with 2 mice taken down for sequencing at P163 and P263 (Mantel-Cox (p<0.0001) (Fig. 12A). We also evaluated NW2 in Scn8aW / +;EMXl-Cre mice. These mice express the variant in cortical regions and the hippocampus and seizure onset occurs around P20 and median survival is 46 days. NW2 increased the lifespan of Scn8aW / +;EMXl-Cre with maximum significance from a mutant un-treated median 26 days survival, maximum 65 days to a median above 250 days for NW2 treated mutants(Mantel-Cox (p<0.0001) (Fig. 12B). Of note, 5 Scn8aW / +;EMXl-Cre mice were euthanized for sequencing at P345 and another 7 after P150.

[0231] We then conducted confocal imaging of mice treated with the full triple- AAV construct across widespread brain regions, enabling detailed examination of neuronal architecture. The serotype expression highlighted in white colocalizes with distinct brain areas integral to seizure propagation and network hyperexcitability (Figs. 13A-D). There is observable robust eGFP expression across the entire brain, emphasizing the widespread transduction efficiency of NW2 treatment in both cortical (Fig. 13B) and subcortical regions (Figs. 13C and D). Figs. 13A-D reveal targeting of hyperconnected pyramidal neurons withextended apical dendrites and dense labeling of somas and dendritic arbors. These depicted areas are critical nodes in cortical hyperexcitability, often implicated in seizure initiation and propagation. This overall distribution underscores the utility of this AAV serotype for delivery while investigating broad-scale neuronal networks implicated in epilepsy.

[0232] To interpret the mechanism by which the NW2 treatment mitigates premature mortality, the Scn8aW / +; EMXl-Cre strain was employed for electroencephalogram (EEG) analysis (Figs. 14A-B). NW2 treated mice (n=ll) and control littermate treated PhP.e-eGFP (GFP sham) mice (n=10) were monitored for seizure activity until 55 days post birth or death. 10 / 11 mice treated with NW2 survived the EEG time length while 8 / 10 control treated ABE NW2 mice experienced SUDEP before P40. The remaining 2 control treated ABE NW2 mice died before P65. One mouse treated with NW2, died at P26 for unknown reasons. Sequencing revealed 14.4% editing in the hippocampus and cortex but monitoring videos indicated surgical complications and general poor health. Notably, 9 / 11 NW2 treated mice lived past P55.EXAMPLE 6. SCN8A ABE ATTENUATES NEURONAL HYPEREXCITABILITY

[0233] A hallmark of seizures is increased neuronal excitability and previous studies have confirmed neuronal hyperexcitability in Scn8aW / +;EIIa-Cre mice. We used electrophysiology techniques to assess whether NW2 treatment could rescue the increased neuronal excitability (Figs. 15A-B). Control C57 / B6 mice expressing no mutant transcripts and Scn8aW / +;EIIa-Cre mice were injected with either the sham PhP.eB-eGFP, or the NW2 treatment. Recordings from GFP+ labeled neurons showed that NW2 treatment attenuated hyperexcitability' in Scn8aW / +;EIIa-Cre mice to levels that were no longer significantly different from Wildtype (WT) control mice; conversely, sham GFP treated Scn8aW / +;EIIaCre mice had increased neuronal excitability (Figs. 15A-B). Overall network excitability has decreased due to NW2 treatment.

[0234] Congruent electrophysiological studies were performed on Scn8aW / +; EMXl-Cre mice. Scn8aW / +;EMXl-Cre treated with the sham exhibited significant hyperexcitability compared to both the WT mice and Scn8aW / +;EMXl-Cre NW2-treated mice over current injection steps beginning at 280 pA (Figs. 16A-B). Again, there was no significant difference in neuronal excitability between WT mice and Scn8aW / +;EMXl-Cre NW2-treated mice at any injection step. Again, overall network excitability and predisposition to seizure initiation and propagation has decreased due to treatment of NW2 in both mouse strains.

[0235] Persistent Na currents (INaP) are thought to be major contributors to the generation of high frequency AP firing and are increased in R1872W loci harboring mice. Toexamine the effect of the NW2 treatment on the magnitude of INaP currents we measured channel activity in the presence and absence of NW2 treatment in GFP+ neurons of Scn8aW / +;EMXl-Cre mice. Treatment of NW2 significantly reduced the peak of the INaP current from a mean of -250.5 mV to -137mV (Figs.l7A-B). There was an average reduction in persistent current from 71% of peak current to 3% (0% peak current is seen in wildtype controls) with NW2 treatment. This conclusion also indicates NW2 can counter the hyperactivity of the mutant channel by mutant to wildtype conversion of bases.

[0236] We used Next-Generation targeted amplicon sequencing (NGS) to assess the extent of correction of R1872W. We dissected hippocampal and cortical regions of Scn8aW / +;EIIaCre mice treated with NW2. We observed an approximate 20% reversion of mutant reads T / A to C / G wildtype conversion in all cells in the hippocampus and cortex (Fig. 18 A). All neurons in these regions with activated tryptophan alleles are reduced from approximately 46% (calculated 7.5% failure of Ella-Cre) to 30% and wildtype arginine transcripts increased from approximately 54% expression to 70%. We also assessed the extent of correction of R1872W in Scn8aW / +;EMXl-Cre mice since in vivo base editing impacts protein levels by 3-4 weeks post-administration. We assessed base editing in hippocampal and cortical regions of NW2-treated Scn8aW / +;EMXl-Cre mice and observed 20% average reversion of mutant reads T / A to C / G wildtype conversion in mice living over 50 days of age (Fig. 18B). Mice d40*, d44*, and d26* were excluded as they are outliers of editing and likely did not receive the full treatment in the proper ventricular area to spread to essential regions for seizure circuitry (Figs. 13A-D). Total attendance of activated mutant tryptophan in EMX1- Cre expressing neurons decreased from an average of 41% of total NGS deep sequenced reads to 28% and were converted to the wildtype, healthy-counterpart, arginine. NW2 treatment of the R1872W SNP effectively converts the mutant tryptophan allele TGG to its wildtype arginine CGG counterpart thereby inducing increasing levels of healthy wildtype transcript. We found no significant bystander editing near the on-target adenine (A3 and A13) after NW2 treatment in DNA sequencing results. The editing of healthy heterozygote allele in all mutant mice was undetectable and primers used for this test listed in methods.

[0237] RNA on-target efficacy was evaluated to confirm RNA transcript changes resulting from DNA editing which revealed high on-target editing with NW2 (Figs. 19A-B). Insignificant off-target editing (> 1 %) was observed for 25 potential off- target loci with no more than three mis-match nucleotides with the target sequence predicted by Cas-OFFinder, COSMID and ntBLAST. RNA sequencing also confirmed no significant bystander editing near the on-target adenine (A3 and A13). There was an observed ~1.5-2x higher RNA editingcompared to DNA editing for a neuron-specific gene, following delivery of AAV vector PhP.eB which preferentially transfects neurons, highlights key aspects of cell-type-specific editing dynamics. Neurons are the primary site of the observance of editing result in RNA transcripts due to the gene's expression pattern being primarily in neurons CNS. Non- neuronal cells have the gene but exhibit transcriptional inactivity with the exception of astrocytes and Schwann cells. These findings underscore the importance of transcriptional state, vector specificity, and cellular context in determining editing efficiency and outcomes.

[0238] At all analyzed time points beyond 150 days post- AAV delivery, DNA editing consistently lagged behind RNA editing, with the RNA-to-DNA editing ratio remaining stable over time. This trend was observed in tissues collected from mice euthanized at 150, 160, 180, 200, and 345 days (Figs 19A-B). The editing ratios of RNA:DNA does not converge to one as a function of time indicating the ratio>l is due to expressional variations of DNA between neurons and other cell types in the brain and not the base editing treatment acting on RNA directly. No off-target mutations were detectably induced at the 200 immediate sites of sequence-homology to the on-target sgRNA sequence site in five NW2 treated mice.

[0239] Clinical findings have indicated a high prevalence of neurodevelopmental comorbidities and autism in patients with SCN8A DEE with about half of affected individuals having severe intellectual disabilities. In SCN8A DEE, an increase in the frequency or severity of seizures that appears over a patient's life is often associated with ataxia, neurodevelopmental regression, cognitive impairment, behavioral and psychiatric issues, as well as neurological damage to development. To determine if mice with R1872W expression exhibit parallel behavior discrepancies, we conducted an open field test to measure anxiety in mice, an associated symptom of autism in patients with SCN8A DEE.

[0240] By measuring the thigmotaxis of mice (tendency to stay close to walls) as well as locomotive activity, we were able to discern that after a week of seizure onset, Scn8aW / +; EMXl-Cre mice exhibit significant differences compared to WT healthy mice in terms of percentage of time spent in open areas of the field as well as locomotive activity which indicate an anxiety phenotype in these mutant mice as well as movement discrepancies. This reduced movement is likely reflective of an underlying motor disorder, consistent with what has been reported for certain genetic mutations that affect neuronal excitability. It is plausible that the reduced locomotion observed is exacerbated by an increased incidence of seizures in the mutant untreated mice. Seizures can lead to bouts of immobility, decreased exploratory behavior, and generalized motor dysfunction. The combination of movement disorders and seizure activity can result in the overall lower locomotion observed in the open field test. Furthermore, thereduced time spent in the center of the arena indicates an additional anxiety-like phenotype, which may also be worsened by seizure-related neurological disruptions as recurrent seizures accumulate. Anxiety and seizures often co-occur in neurological disorders, potentially compounding the observed behavioral deficits. The improved locomotion and exploratory behavior in the treated mice likely reflects the result of the reduction, or even complete cessation, of seizure activity. By lowering seizure incidence, NW2 not only addresses the primary motor deficits but also reduces the secondary effects of seizures on mobility and anxiety. This treatment could therefore potentially mitigate comorbidity effects of SCN8A EE that are worsened by increasing seizure incidence.EXAMPLE 7. GUIDE CONSTRUCTS FOR CHOICE TARGETING OF 6 RECURRENT SCN8A VARIANTS

[0241] With our clear success targeting and treating R1872W loci in SCN8A mutant mice, we are able to demonstrate the other 5 listed recurrent mutations in similar genomic GC and methylation states in SCN8A are targetable in the same fashion. The guide designs for R1872W and the other 5 recurrent mutations being created with the same constraints and qualifications from BE-HIVE, CRISPOR, and CRISPR RGEN tools.

[0242] A lower-case letter within the sequences denotes the targeted variant within the guide photospacers. Any sequence with a lower case (g) at the 5’ most end of the guide indicated a purposeful mismatch to aid in U6 promoter translation.

[0243] Our research team has devised protospacer RNA guide constructs aimed at targeting mammalian (e.g., human) R1872W with a U6 promoter that functions ubiquitously in mammalian cells (TABLE 1). These protospacers direct the editors to the site (1872) where the correction is required. These guides are versatile for use both in vivo and in vitro within mouse tissue, and we have adapted them to contain human-optimized codons for use in human tissue as well (TABLE 1). These guide constructs are tailored to work with different base editors developed by Dr. David Liu and his team at the Broad Institute. Furthermore, our team has developed an editor through site-directed mutagenesis, labeled as ABE8e[TadAV106W]- NRCH.

[0244] In addition, we have also created guide constructs designed for base editors evolved by the Liu Group (e.g., eNme2-T.l and T.2-ABE8, eNme2.C-ABE8e, SpRY-ABE8e, SpRY-ABEmax, SpRY-ABEmax HiFi, SpRY-ABE8e HiFi, NG-ABE8e, ABEmax-NRCH, and ABE8e-NRCH), as well as our group’s evolved editor, ABE8e[TadAV106W]-NRCH, to target the R1617Q mutation in both mouse and human tissues (TABLE 2). Using phage-assisted evolution (PACE and PANCE), the Lui lab identified new variants of SpCas9 that can recognize non-NGG PAM sequences when attached to a deaminase complex. One such unpublished variant for plasmid use: ABE8e-NRCH was used by our lab for site directed mutagenesis to generate a V106W mutation within the TadA-8e deaminase domain. Cas9-independent off- target editing increases with the use of ABE8e over ABE7.10, an older deaminase, but can be corrected by introducing the V106W substitution into TadA-8e. This can reduce the affinity of TadA-8e for both DNA and RNA, thereby increasing its dependence on Cas9 for substrate engagement and can increase base editor specificity to only the target SNP (Richter, M.F., et al., (2020) Nat. Biotechnol., 38: 883-891).

[0245] Our research team has devised protospacer RNA guide constructs aimed at targeting mammalian (e.g., human) G1475R loci in SCN8A (TABLE 3).

[0246] Our research team has devised protospacer RNA guide constructs aimed at targeting mammalian (e.g., human) R850Q loci in SCN8A (TABLE 4).[02471 Our research team has devised protospacer RNA guide constructs aimed at targeting mammalian (e.g., human) R1872Q loci in SCN8A (TABLE 5).[02481 Our research team has devised protospacer RNA guide constructs aimed at targeting mammalian (e.g., human) N1877S loci in SCN8A (TABLE 6).

[0249] Sequence for the ABE8e[TadAV106W]-NRCH base editor is provided: Tctgaggtggagttttcccacgagtactggatgagacatgccctgaccctggccaagagggcacgggatgagagggaggtgc ctgtgggagccgtgctggtgctgaacaatagagtgatcggcgagggctggaacagagccatcggcctgcacgacccaacagc ccatgccgaaattatggccctgagacagggcggcctggtcatgcagaactacagactgattgacgccaccctgtacgtgacatt cgagccttgcgtgatgtgcgccggcgccatgatccactctaggatcggccgcgtggtgtttggctggaggaactcaaaaagag gcgccgcaggctccctgatgaacgtgctgaactaccccggcatgaatcaccgcgtcgaaattaccgagggaatcctggcagat gaatgtgccgccctgctgtgcgatttctatcggatgcctagacaggtgttcaatgctcagaagaaggcccagagctccatcaactc cggaggatctagcggaggctcctctggctctgagacacctggcacaagcgagagcgcaacacctgaaagcagcgggggcag cagcggggggtcagacaagaagtacagcatcggcctgaccatcggcaccaactctgtgggctgggccgtgatcaccgacga gtacaaggtgcccagcaagaaattcaaggtgctgggcaacaccgaccggcacagcatcaagaagaacctgatcggagccctg ctgttcgacagcggcgaaacagccgaggccacccggctgaagagaaccgccagaagaagatacaccagacggaagaaccg gatctgctatctgcaagagatcttcagcaacgagatggccaaggtggacgacagcttcttccacagactggaagagtccttcctg gtggaagaggataagaagcacgagcggcaccccatcttcggcaacatcgtggacgaggtggcctaccacgagaagtacccc accatctaccacctgagaaagaaactggtggac (SEQ ID NO: 176)REFERENCES1. 005628 - EMX1[IRES ere] , EMXl-Cre Strain Details, https: / / www.jax.org / strain / 005628.2. Chatteijee, P. et al. A Cas9 with PAM recognition for adenine dinucleotides. Nat Commun 11, 2474 (2020).3. Bouzroud, W., Tazzite, A., Boussakri, I., Gazzaz, B. & Dehbi, H. A novel SCN8A variant of unknown significance in pediatric epilepsy: a case report. J Int Med Res 51, 3000605231187931 (2023).4. Schaller, K. L., Krzemien, D. M., Yarowsky, P. J., Krueger, B. K. & Caldwell, J. H. A novel, abundant sodium channel expressed in neurons and glia. The Journal of Neuroscience 15, 3231 (1995).5. Stoica, L., Ahmed, S. S., Gao, G. & Esteves, M. S. AAV-mediated gene transfer to the mouse CNS. Current protocols in microbiology 0 14, Unitl4D.5 (2013).6. About SCN8A - SCN8A Alliance, https: / / scn8aalliance.org / what-is-scn8a / .7. Ryu, S.-M. et al. Adenine base editing in mouse embryos and an adult mouse model of Duchenne muscular dystrophy. Nat Biotechnol 36, 536-539 (2018).

Claims

What Is Claimed Is:

1. A SCN8A R1872W-targeting adenine base editor comprising an adenine base editor; and a SCN8A targeting protospacer guide, wherein the SCN8A targeting protospacer guide is selected from SEQ ID NOs 1-32, or is a SCN8A targeting protospacer guide that is at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to a nucleic acid sequence selected from SEQ ID NOs: 1-32.

2. The base editor of claim 1, wherein the adenine base editor is SpRY-ABEmax HiFi, SpRY-ABEmax, SpRY-ABE8e HiFi, SpRY-ABE8e, eNme2-T.l and T.2-ABE8e, , eNme2.C ABE8e, ABEmax-NRCH, ABEmax-NG, ABE8e-NRCH, ABE8e-NG, ABE8e[TadAV106W]-NG, or ABE8e[TadAV106W]-NRCH and the SCN8A targeting protospacer guide is a human protospacer guide selected from SEQ ID NOs: 1, 3, 5, 7,9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, and 31.

3. The base editor of claim 1, wherein the adenine base editor is SpRY-ABEmax HiFi, SpRY-ABEmax, SpRY-ABE8e HiFi, SpRY-ABE8e, eNme2-T.l and T.2-ABE9, , eNme2.C ABE8e, ABEmax-NRCH, ABEmax-NG, ABE8e-NRCH, ABE8e-NG, ABE8e[TadAV106W]-NRCH, or ABE8e[V106W]-NG, and the SCN8A targeting protospacer guide is a mouse protospacer guide selected from SEQ ID NOs: 2, 4, 6, 8,10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, and 32.

4. A SCN8A R1617Q-targeting adenine base editor comprising an adenine base editor; and a SCN8A targeting protospacer guide, wherein the SCN8A targeting protospacer guide is selected from SEQ ID NOs 33-66, or a SCN8A targeting protospacer guide that is at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to a nucleic acid sequence of any one of SEQ ID NOs: 33-66.

5. The base editor of claim 4, wherein the adenine base editor is SpRY-ABEmax HiFi, SpRY-ABEmax, SpRY-ABE8e HiFi, SpRY-ABE8e, eNme2-T.l and T.2-ABE8e, eNme2.C-ABE8e, ABEmax-NRTH, ABEmax-NRCH, ABEmax-NG, ABEmax, ABE8e-NRTH, ABE8e-NRCH, ABE8e-NG, ABE8e[TadAV106W]-NRTH, ABE8e[TadAV106W]-NRCH, ABE8e[TadAV106W]-NG, ABE8e[TadAV106W], or ABE8e and the SCN8A targeting protospacer guide is a human protospacer guide selected from SEQ ID NOs: 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65.

6. The base editor of claim 4, wherein the adenine base editor is SpRY-ABEmax HiFi, SpRY-ABEmax, SpRY-ABE8e HiFi, SpRY-ABE8e, eNme2-T.l and T.2-ABE8e, eNme2.C-ABE8e, ABEmax-NRTH, ABEmax-NRCH, ABEmax-NG, ABEmax,ABE8e-NRTH, ABE8e-NRCH, ABE8e-NG, ABE8e[V106W]-NRTH, ABE8e[TadAV106W]-NRCH, ABE8e[TadAV106W]-NG, ABE8e[TadAV106W], or ABE8e and the SCN8A targeting protospacer guide is a mouse protospacer guide selected from SEQ ID NOs: 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66.

7. A SCN8A G1475R-targeting adenine base editor comprising an adenine base editor; and a SCN8A targeting protospacer guide, wherein the SCN8A targeting protospacer guide is selected from SEQ ID NOs 67-96, or a SCN8A targeting protospacer guide that is at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to a nucleic acid sequence of any one of SEQ ID NOs: 67-96.

8. The base editor of claim 7, wherein the adenine base editor is SpRY-ABEmax HiFi, SpRY-ABEmax, SpRY-ABE8e HiFi, SpRY-ABE8e, eNme2.C-ABE8e, ABEmax- NRRH, ABEmax-NG, ABE8e[TadAV106W]-NRRH, ABE8e[TadAV106W]-NG, ABE8e-NRRH, or ABE8e-NG and the SCN8A targeting protospacer guide is a human protospacer guide selected from SEQ ID NOs: 67, 69, 71, 73, 75, 77, 79, 81, 83, 85,87, 89, 91, 93, and 95.

9. The base editor of claim 7, wherein the adenine base editor is SpRY-ABEmax HiFi, SpRY-ABEmax, SpRY-ABE8e HiFi, SpRY-ABE8e, eNme2.C-ABE8e, ABEmax- NRRH, ABEmax-NG, ABE8e[TadAV106W]-NRRH, ABE8e[TadAV106W]-NG, ABE8e-NRRH, or ABE8e-NG and the SCN8A targeting protospacer guide is a mouse protospacer guide selected from SEQ ID NOs: 68, 70, 72, 74, 76, 78, 80, 82, 84, 86,88, 90, 92, 94, and 96.

10. A SCN8A R850Q-targeting adenine base editor comprising an adenine base editor; and a SCN8A targeting protospacer guide, wherein the SCN8A targeting protospacer guide is selected from SEQ ID NOs 97-111, or a SCN8A targeting protospacer guide that is at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to a nucleic acid sequence of any one of SEQ ID NOs: 97-111.

11. The base editor of claim 10, wherein the adenine base editor is SpRY-ABE8e, SpRY- ABE8e HiFi, SpRY-ABEmax, SpRY-ABEmax HiFi, eNme2.C-ABE8e, ABE8e-NG, ABE8e-NRCH, ABE8e[TadAV106W]-NG, ABEmax-NG, ABEmax-NRCH, ABE8e- NRRH, ABE8e[TadAV106W]-NRCH, ABE8e[TadAV106W]-NRRH, ABEmax- NRRH, ABE8e-iSpyMac, ABE8e-SpyMac, ABEmax-iSpyMac, ABEmax-SpyMac, ABE8e, ABE8e[TadAV106W], or AB Emax and the SCN8A targeting protospacer guide is a human protospacer guide selected from SEQ ID NOs: 97-111.

12. The base editor of claim 10, wherein the adenine base editor is SpRY-ABE8e, SpRY- ABE8e HiFi, SpRY-AB Emax, SpRY-ABEmax HiFi, eNme2.C-ABE8e, ABE8e-NG, ABE8e-NRCH, ABE8e[TadAV106W]-NG, ABEmax-NG, ABEmax-NRCH, ABE8e- NRRH, ABE8e[TadAV106W]-NRCH, ABE8e[V106W]-NRRH, ABEmax-NRRH, ABE8e-iSpyMac, ABE8e-SpyMac, ABEmax-iSpyMac, ABEmax-SpyMac, ABE8e, ABE8e[TadAV 106W], or ABEmax and the SCN8A targeting protospacer guide is a mouse protospacer guide selected from SEQ ID NOs: 97-111.

13. A SCN8A R1872Q-targeting adenine base editor comprising an adenine base editor; and a SCN8A targeting protospacer guide, wherein the SCN8A targeting protospacer guide is selected from SEQ ID NOs 112-139, or a SCN8A targeting protospacer guide that is at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 112-139.

14. The base editor of claim 13, wherein the adenine base editor is SpRY-ABE8e, SpRY- ABE8e HiFi, SpRY-ABEmax, SpRY-ABEmax HiFi, eNme2.C-ABE8e, ABE8e- NRRH, ABE8e[TadAV106W]-NRRH, ABEmax-NRRH, ABE8e-iSpyMac, ABE8e- SpyMac, ABEmax-iSpyMac, ABEmax-SpyMac, ABE8e-NRTH, ABE8e[TAdAV106W]-NRTH, ABEmax-NRTH, or xCas9 3.7-ABE and the SCN8A targeting protospacer guide is a human protospacer guide selected from SEQ ID NOs:112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, and 138.

15. The base editor of claim 13, wherein the adenine base editor is SpRY-ABE8e, SpRY- ABE8e HiFi, SpRY-ABEmax, SpRY-ABEmax HiFi, eNme2.C-ABE8e, ABE8e- NRRH, ABE8e[TadAV106W]-NRRH, ABEmax-NRRH, ABE8e-iSpyMac, ABE8e- SpyMac, ABEmax-iSpyMac, ABEmax-SpyMac, ABE8e-NRTH, ABE8e[TadAV106W]-NRTH, ABEmax-NRTH, or xCas9 3.7-ABE and the SCN8A targeting protospacer guide is a mouse protospacer guide selected from SEQ ID NOs:113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, and 139.

16. A SCN8A N1877S-targeting cytosine base editor comprising an adenine base editor; and a SCN8A targeting protospacer guide, wherein the SCN8A targeting protospacer guide is selected from SEQ ID NOs 140-175, or a SCN8A targeting protospacer guide that is at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to a nucleic acid sequence of any one of SEQ ID NOs: 140-175.

17. The base editor of claim 16, wherein the cytosine base editor is SpRY-BE4, SpRY-BE4max, SpRY-CBE6varients, eNme2.C-BE4, eNme2.C-CBE6varients, BE4-NRCH,BE4-NRRH, BE4max-NRCH, BE4max-NRRH, CBE6varients-NRCH,CBE6varients-NRRH, SpCas9 TadCBEd-V106W-NRCH, SpCas9 TadCBEd-V106W- NRRH, BE4-NG, BE4max-NG, CBE6varients-NG, iSpyMac-BE3, iSpyMacBE4, SpCas9 TadCBEd-V106W-NG, SpyMac-BE3, SpyMacBE4, or SpyMacCBE6varients and the SCN8A targeting protospacer guide is a human protospacer guide selected from SEQ ID NOs: 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164,166, 168, 170, 172, and 174.

18. The base editor of claim 16, wherein the cytosine base editor is SpRY-BE4, SpRY- BE4max, SpRY-CBE6varients, eNme2.C-BE4, eNme2-C-CBE6varients, BE4-NRCH, BE4-NRRH, BE4max-NRCH, BE4max-NRRH, CBE6varients-NRCH, CBE6varients-NRRH, SpCas9 TadCBEd-V106W-NRCH, SpCas9 TadCBEd-V106W- NRRH, BE4-NG, BE4max-NG, CBE6varients-NG, iSpyMac-BE3, iSpyMacBE4, SpCas9 TadCBEd-V106W-NG, SpyMac-BE3, SpyMacBE4, or SpyMacCBE6varients and the SCN8A targeting protospacer guide is a mouse protospacer guide selected from SEQ ID NOs: 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165,167, 169, 171, 173, and 175.

19. A vector comprising the SCN8A R1872W-targeting adenine base editor of claim 1, the SCN8A R1617Q-targeting adenine base editor of claim 4, the SCN8A G1475R- targeting adenine base editor of claim 7, the SCN8A R850Q-targeting adenine base editor of claim 10, the SCN8A R1872Q-targeting adenine base editor of claim 13, or the SCN8A N1877S-targeting cytosine base editor of claim 16; wherein the vector is a retroviral vector, a lentiviral vector, a phage vector, an adenoviral vector, an adeno- associated virus (AAV) vector, or a herpes simplex vector.

20. The vector of claim 19, additionally comprising a delivery system for delivering the vector into a cell, a tissue, or a subject wherein the delivery system comprises a lipid, a nanoparticle, a lipid nanoparticle, a liposome, an exosome, a microvesicle, or a gene-gun.

21. A method of modifying a SCN8A gene or a SCN8A gene with a single nucleotide polymorphism (SNP), or a cell that has incorporated the SCN8A gene or the SCN8A gene with a SNP, comprising contacting the SCN8A gene, a SCN8A gene with a SNP, or the cell with the base editor of any one of claims 1-18, or the vector of any one of claims 19 and 20.

22. The method of claim 21, wherein the method comprises modifying the SCN8A gene with a SNP; wherein the SCN8A gene with a SNP is associated with a R1872W mutation of SCN8A, a R1617Q mutation of SCN8A, a R850Q mutation of SCN8A, aG1475R mutation of SCN8A, a R1872Q mutation of SCN8A, a N1877S mutation of SCN8A, or a combination thereof; wherein modifying the SCN8A gene comprises inserting, deleting, or substituting one or more nucleotides in the SCN8A gene, or cleaving one or more genes in the SCN8A gene.

23. The method of claim 21, wherein the cell is a prokaryotic or a eukaryotic cell.

24. The method of claim 21, wherein the cell is a neuron cell.

25. The method of claim 21, wherein the contacting is performed in vitro.

26. The method of claim 21, wherein the contacting is performed in vivo.

27. A method of treating a disease or disorder associated a SCN8A gene or a SCN8A gene with a single-nucleotide polymorphism (SNP) in a subject in need thereof comprising administering to the subject the base editor of any one of claims 1-20, or the vector of any one of claims 19 and 20.

28. The method of claim 27, wherein the subject has been diagnosed with a neurodevelopmental disorder selected from Early Infantile Epileptic Encephalopathy (EIEE), Dravet Syndrome, West Syndrome (Infantile Spasms), Lennox-Gastaut Syndrome, Ohtahara Syndrome and Pontocerebellar Hypoplasia.

29. The method of claim 27, wherein the administration comprises administering the subject the SCN8A R1872W-targeting adenine base editor of claim 1, the SCN8A R1617Q-targeting adenine base editor of claim 4, the SCN8A G1475R-targeting adenine base editor of claim 7, the SCN8A R850Q-targeting adenine base editor of claim 10, the SCN8A R1872Q-targeting adenine base editor of claim 13, or the SCN8A N1877S-targeting cytosine base editor of claim 16.

Images