Extraction of genomic DNA from fixed cells
The described method effectively recovers high-quality genomic DNA from cross-linked cells by reverse cross-linking and high salt treatment, addressing the issues of low yield and fragmentation in existing methods, enabling efficient nucleic acid analysis.
Patent Information
- Application Number
- PCT/US2025/010783
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-01-08
- Filing Date
- 2025-01-08
- Publication Date
- 2025-07-17
AI Technical Summary
Existing methods for DNA extraction from cross-linked cells, such as those fixed with paraformaldehyde, result in low yields and fragmented DNA, making them unsuitable for nucleic acid analysis due to sequence artifacts and chemical modifications.
A method involving reverse cross-linking through heat treatment, followed by high salt treatment and isopropanol precipitation, with optional silica-based column purification, to recover high-quality, intact genomic DNA.
The method yields high molecular weight, PCR-amplifiable DNA with minimal fragmentation, suitable for downstream applications like NGS analysis, comparable to unfixed cells.
Smart Images

Figure 00000015_0000
Abstract
Description
[0001] EXTRACTION OF GENOMIC DNA FROM FIXED CELLS
[0002] SEQUENCE LISTING
[0003] This application contains a Sequence Listing which has been filed electronically in Extensible Markup Language (XML) format and is hereby incorporated by reference in its entirety. Said XML copy, created on January 8, 2025, is named 51814-002WO2_Sequence_Listing_1_8_25.XML and is 4,447 bytes in size.
[0004] CROSS-REFERENCE TO RELATED APPLICATIONS
[0005] This application claims benefit of U.S. Provisional Application No. 63 / 618,672, filed on January 8, 2024, which is incorporated herein by reference in their entirety.
[0006] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0007] This invention was made with government support under SR01 EY031036-04 awarded by the National Eye Institute. The government has certain rights in the invention.
[0008] BACKGROUND OF THE INVENTION
[0009] This invention relates to purification of nucleic acids.
[0010] Certain experimental designs require access both to intact cells and also to the DNA inside them. For example, transduction of cultured cells with integrating viral libraries, followed by fluorescence activated cell sorting (FACS), requires access to genomic DNA within the cells to evaluate the library contents of sorted fractions. Such experiments can benefit from cross-linking fixation, which allows for cell storage and manipulation with greater convenience and without degradation. Many fixation protocols require cells to be fixed using 1 -4% formaldehyde (PFA) for 10-20 minutes. However, using a crosslinking fixative such as paraformaldehyde (PFA), formaldehyde, neutral buffered formalin or other crosslinking fixatives creates challenges in downstream applications such as DNA isolation and PCR. The challenges primarily arise due to low yields, fragmentation of DNA (includes abasic sites, nicks), and presence of sequence artifacts or chemical modifications that frequently render them unsuitable for nucleic acid analysis (Do et al., Clin Chem, 2015. 61 (1 ): p. 64-71 , Hoffman et al., J Biol Chem, 2015. 290(44): p. 26404-11.1 , 2). Reverse crosslinking and sonication, which is included in protocols for chromatin immunoprecipitation (ChIP), can result in overheating, leading to irreversible damage and fragmentation of DNA ranging from 200 bp to 1 kb.
[0011] There is a need in the art for an efficient method of DNA extraction from cells that results in high yields and minimally fragmented DNA.
[0012] SUMMARY OF THE INVENTION
[0013] The invention, in general, features a method, including the steps of a) providing cross-linked fixed cells; b) reverse cross-linking the cells of step a); c) incubating in high salt solution; and d) precipitating deoxyribonucleic acid (DNA) from the cells.
[0014] In some embodiments, the cells of a) are fixed in paraformaldehyde (PFA), formaldehyde, glutaraldehyde, formalin, 10% neutral buffered formalin (NBF)), glyoxal, or acrolein.
[0015] In some embodiments, reverse cross-linking of b) includes employing heat, a treatment with a low salt concentration, or an RNase or a combination thereof. In some embodiments, reverse cross-linking includes incubation with a low salt containing buffer at a temperature between 50-70°C (e.g., wherein the temperature is 60°C). In still other embodiments, reverse cross-linking includes incubating in a lysis buffer including a proteinase. And in yet other embodiments, reverse cross-linking includes incubating in a low salt containing buffer (e.g., a KCI buffer in the range of 10mM to 100 mM KCI). Still, in some embodiments, the salt is a non-sodium salt (e.g, ammonium acetate, potassium chloride, or lithium chloride).
[0016] In some embodiments, step c) includes incubating in 0.1 -2M final concentration of the salt solution. In some embodiments, the salt is sodium chloride (NaCI). And in some embodiments, the high salt solution has a 1.2M NaCI final concentration.
[0017] In some embodiments, step d) includes an alcohol precipitation to recover genomic DNA (e.g., by isopropanol precipitation).
[0018] In some embodiments, DNA obtained from step c) is further purified. For example, DNA purification includes using a silica-based column.
[0019] Importantly, reverse cross-linking does not include sonication or physical or enzymatic shearing of DNA or does not include chromatin immunoprecipitation or a combination thereof.
[0020] In some embodiments, recovered DNA is genomic DNA. Such genomic DNA precipitated in step d is of high molecular weight of at least 20 kilo base-pairs.
[0021] In some embodiments, the fixed cells are mammalian cells (e.g., cells in a suspension). In some embodiments, cells are provided on a support (e.g., a glass slide).
[0022] In some embodiments, the cells are fixed in a biological sample embedded in an embedding medium. In some embodiments, the embedding material has been removed.
[0023] In some embodiments, the biological sample is a tissue. In some embodiments, the biological sample is on a support (e.g., a glass slide). In any of the aforementioned embodiments, the cells or biological samples (e.g., a tissue sample) are human cells or human biological samples.
[0024] In any of the aforementioned embodiments, the cells or biological samples (e.g., a tissue sample) are mammalian cells (e.g., mouse, rat, guinea pig, hamster, dog, rabbit, monkey or cells or biological samples, cells, or tissues of a laboratory animal).
[0025] Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.
[0026] BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figures 1 A-1C show representative images of genomic DNA characterization extraction from a range (2-8%) of paraformaldehyde-fixed cells. Figure 1 A shows phase separation after the addition of isopropanol. Figure 1 B shows high molecular weight genomic DNA (1 pg) from cells fixed with different PFA concentrations, resolved on 1% agarose gel. Figure 1C shows a polymerase chain reaction (PCR) of the same DNA amplifying 1.2 kb rhodopsin transgene and ~10 kb beta-globin from 2%, 4%, and 8% PFA fixed cells (range of concentration tested).
[0028] DETAILED DESCRIPTION OF THE INVENTION
[0029] Cross-linking fixation of mammalian cells can facilitate cell-based assays like immunostaining and fluorescence-activated cell sorting (FACS). However, high-quality genomic DNA from fixed mammalian cells cannot generally be obtained using traditional DNA isolation protocols due cross-linked protein-DNA complexes and DNA fragmentation. As is described here, we have solved several issues relating to obtaining high-quality genomic DNA. Below we describe a highly efficient and reproducible protocol for DNA extraction from paraformaldehyde (PFA) fixed cultured cells. Our methodology involves, in part, reverse crosslinking through heat treatment, followed by high salt treatment, followed by isopropanol precipitation and purification to obtain DNA. The DNA yield and sequence integrity of the DNA obtained are similar to that of unfixed cells.
[0030] Our protocol extracts DNA from PFA fixed mammalian cells. The protocol describes reverse crosslinking using heat, treatment with a high salt concentration, RNase A treatment, followed by isopropanol precipitation, and further DNA purification using a silica-based column. This protocol yields significantly high-quality unfragmented DNA, which is PCR-amplifiable DNA, and gives better downstream results than without crosslinking reversal, especially for high throughput NGS analysis.
[0031] In general, a combination of a low salt lysis buffer and high salt intermediate step followed by precipitation was found to retain both DNA integrity and yield from fixed cells. Preferably, a 5M NaCI (sodium chloride) addition and incubation on ice for 10 minutes was found to further improve yield of genomic DNA.
[0032] Further using moderate temperatures ranging from 55-70°C and preferably 60°C preserves DNA integrity.
[0033] Fixed Biological Samples, Tissues, and Cells
[0034] In general, fixed cells are provided and used in the methods disclosed herein. Such cells having been fixed with, for example, an aldehyde, for example, with paraformaldehyde, formaldehyde, formalin, 10% neutral buffered formalin, or glutaraldehyde, glyoxal, acrolein or other known fixatives. Cell fixation methods are known in the art including, for example, cells having been fixed for 20 minutes at room temperature with 4% paraformaldehyde. Standard methods for fixing cells are described, for example, in Jamur et al., Methods Mol Biol, 2010. 588: p. 55-61 and Banerjee et al. Biotechniques, 2018. 65(2): p. 65- 69. As described below, isolating high quality DNA from fixed cells involves employing moderate temperature decrosslinking, a high salt intermediate step, and avoiding shearing the DNA.
[0035] Methods of recovering genomic DNA from a biological sample are also included. In some embodiments, a biological sample (such as a cell or tissue sample) is fixed and the fixed sample is processed, for example, by dehydrating, clearing, and / or embedding the fixed sample. The fixed (and optionally processed sample) is then used to recover genomic DNA as disclosed herein. If the tissue is embedded in a matrix, then such matrix is removed and dissolved in a separate step (e.g., by employing xylene to remove paraffin) according to standard methods.
[0036] Exemplary biological samples that can be used in the methods disclosed herein include, but are not limited to, whole organs or a portion thereof, organ sub-structures, tissue biopsies, punch biopsies, fine-needle aspirate biopsies, bone, archival tissues, or cells. In some examples, these biological samples are referred to as “tissues” or “tissue samples.” In cases where a sample is large, it can be cut into smaller pieces (such as pieces 1-3 mm thick or less), for ease of handling and improved fixative penetration and processing.
[0037] In some cases, biological samples, cells, tissues (e.g., embedded tissues) may be processed according to standard histological methods, for example, by adhering to a support such as a glass slide. Cells may, for example, be smeared on slides, fixed, and processed for recovery of DNA as described. Biological samples on glass slides may be gently shaken during processing.
[0038] In still further examples, DNA is extracted from the tissue samples (e.g., an embedded sample) or sections and utilized for analyses such as PCR, real-time PCR, quantitative real-time PCR, microarray analysis, sequencing (e.g., next generation sequencing), and Southern blotting. One of ordinary skill in the art can select these or other analytical methods suitable to the particular biological sample, cells, or tissue under examination and purpose (such as diagnosis of a particular disease or condition). High molecular weight genomic DNA recovered using the methods disclosed herein render such analyses more efficient.
[0039] Reverse crosslinking
[0040] Reverse crosslinking of fixed cells is achieved according to standard methods. Exemplary solutions employed at this step include salts for ionic strength (NaCI, KCI), salts for DNA stabilization or nuclease inhibition (MgCI2), a nuclease inhibitor (EDTA), a pH buffering agent (Tris-HCI), detergents (Nonidet P-40, Tween-20, Triton X-100, sodium dodecyl sulfate), and a protein blocking agent (gelatin, milk, serum, albumin).
[0041] In particular, an incubation with low salt containing buffer at temperature between 50-70°C, avoiding high temperatures such as 90-100°C, has been found to effectively reverse cross-links, which may be increased in the presence of proteinase K. In one example, reverse cross-linking of fixed cells is achieved, for example, by agitation at a temperature of 60°C in the presence of a low salt lysis buffer and Proteinase K.
[0042] In some other cases, the reverse crosslinking step involves utilizing a low salt buffer for cell lysis and reverse crosslinking at 60°C. An exemplary low salt buffer is the PDNB buffer described herein. Such low salt buffer concentrations range from 10mM to 100 mM of a salt. Preferably, KCI is employed, for example at 50 mM. Typically, at this step, a high concentration of salt is not preferred and is distinguished from adding an additional high salt step as described below.
[0043] Addition of a high salt treatment step as described below after the reverse cross-linking typically improves reverse crosslinking and recovery of intact, high yield, high quality DNA. Additional sonication or enzymes or methods that shear the material are not preferred and are to be avoided.
[0044] High Salt Treatment
[0045] Our method further includes a high salt treatment step. Typically, this step involves incubating a reverse crosslinked lysate in a salt concentration having a 0.1 -2M final salt concentration. This is achieved by adding, for example, a 4-6M salt solution to the lysate, such as by the addition of 5M NaCI resulting in a final NaCI concentration of 1.2M. Exemplary salts employed at this step include sodium chloride, ammonium acetate, potassium chloride, and lithium chloride.
[0046] In one example, incubation of reverse-crosslinked cells is achieved by incubating with 5M NaCI (for example, for 10 minutes on ice) again with a final NaCI concentration of 1.2M. The addition of 5M NaCI to this final NaCI concentration was found to significantly contribute to the yield, purification, and stabilization of DNA.
[0047] Artifact removal
[0048] In some embodiments, if desired, a step is used to enzymatically remove damaged DNA (for example, deaminated cytosine residues) that would interfere with downstream processes, such as an incubation step with a glycosylase such as uracil N-glycosylase. Endonucleases and polymerases such as T4 Endonuclease V and T4 DNA Polymerase may also be used as needed.
[0049] RNA Nuclease Treatment
[0050] Addition of an RNA nuclease during the high salt incubation is also performed according to standard methods. In one example, RNAase A is added as is described here. A combination of RNases such as RNase A in combination with RNase T1 (RNase cocktail enzyme mix, Thermo) may also be used. Precipitation / Purification
[0051] DNA precipitation and purification is performed according to standard methods known in the art; for example, by using alcohol to act as a precipitating agent for nucleic acids. In one example, precipitation is achieved by adding an equal volume of isopropanol to the lysate of the aforementioned steps and incubating the mixture at room temperature for 10 minutes.
[0052] DNA may be purified further as needed. In one example, following incubation with isopropanol, phases separate, and the bottom layer is enriched with precipitated DNA and collected, while the top aqueous layer (organic phase) lacked detectable DNA. Furthermore, partially purified DNA may be exposed to an additional purification step on a column-contained matrix (e.g., a column with a silica- based binding matrix). This is a purification technique in which the DNA binds to the matrix (silica) with the help of chaotropic salts (guanidinium thiocyanate) in the buffer. Once the DNA is bound in the column, the column is washed with 70% ethanol and DNA is eluted using elution buffer (Tris-EDTA buffer, pH 8.0).
[0053] The following examples are provided to illustrate, not limit the invention.
[0054] EXAMPLE 1 - Genomic DNA extraction from paraformaldehyde-fixed mammalian cells
[0055] PROCEDURE
[0056] Fixing Cells
[0057] In this example, 293T cells were transduced with a rhodopsin (RHO) expression cassette under the control of the EF1a promoter. The cells were maintained in DMEM supplemented with 10% FBS. For DNA extraction, 1 million cells were collected, pelleted, and fixed in 2 mL of 4% paraformaldehyde for 20 minutes at room temperature. After a PBS wash, the cell pellets were either stored at -80°C (long-term storage) or processed immediately for DNA extraction.
[0058] Processing is performed as follows.
[0059] Do not vortex the contents in any of the steps below unless specified. Our protocol eliminates the use of phenol-chloroform and avoids harsh treatments such as sonication, physical shearing, or enzymatic shearing of DNA during the process.
[0060] 1. If frozen, thaw cell pellet vials on ice.
[0061] 2. Cell pellets were dislodged by flicking the tube or by brief vortexing. Once dislodged, the pellet was resuspended in 200 pL Quick-extract buffer supplemented with 3.75 pL Proteinase K, per million cells. Scale the reaction, as needed, proportionally to the volume of lysis buffer for the steps below. As an alternative to Quick-extract buffer, this protocol can be performed using PDNB buffer. For complete lysis of 1 million cells, add 300 pL of PDNB buffer and 5.6 pL of Proteinase K to the sample.
[0062] Note: The procedure was either done in a 1.5 mL or 2 mL Eppendorf tube. PDNB buffer contains 50 mM KCI, 10 mM Tris-HCI (pH 8.3), 2.5 mM MgCI2, 0.1 mg / ml gelatin, 0.45% (v / v) Nonidet P40, and 0.45% (v / v) Tween 20. Reverse Crosslinking Using Moderate Heat
[0063] 3. The tubes were allowed to incubate overnight (typically -8-12 hours) in a thermomixer set at 60°C at 600 r.p.m.
[0064] High Salt Concentration Treatment
[0065] 4. After overnight incubation, spin down all the evaporated contents and add 50 pL of 5M NaCI. Mix thoroughly by inverting the tube 50 times (avoid vortexing). Briefly centrifuge to collect the contents at the bottom of the tube.
[0066] 5. Incubate the samples on ice for 10 minutes.
[0067] Nuclease Treatment
[0068] 6. Add 3.5 pL of RNAase A and mix thoroughly by inverting the tube 50 times and incubate on the samples for 10 minutes at room temperature.
[0069] 7. After incubation, centrifuge at 12,000 r.p.m. (16,000 g) for 10 minutes. This step should pellet any undissolved material in the sample and prevent carry-over to downstream steps.
[0070] Precipitation
[0071] 8. Using a p200 or p1000 pipette, carefully transfer the supernatant to a fresh 1.5 ml_ tube and add equal volume of room temperature isopropanol . Note: Do not use ice-cold isopropanol, as this may increase the likelihood of salt precipitation.
[0072] 9. Immediately, mix thoroughly by inverting the tube 20 times. Briefly centrifuge to remove liquid from the tube walls.
[0073] 10. Incubate the tubes for 10 minutes at room temperature and allow the phases to settle (see Figure 1 A). In the settled phases (top and bottom), the bottom phase contains the DNA.
[0074] 11. Following incubation, carefully aspirate the top phase, leaving a trace of the top layer. After removing this layer -300 pL of the bottom phase should remain in the tube.
[0075] 12. Add an equal volume of MONARCH DNA binding buffer (supplied with the kit) and mix thoroughly by inverting the tube 50 times. Briefly centrifuge to collect the contents at the bottom of the tube.
[0076] Purification
[0077] 13. Load the contents into the MONARCH column (silica based) fitted with the collection tube, following the manufacturer’s instructions. For larger extraction volumes, use multiple Monarch columns. Spin for 1 minute at 12,000 r.p.m at room temperature and discard flowthrough.
[0078] 14. Add 500 pL Monarch DNA Wash buffer into the column and centrifuge for 1 minute at 12,000 r.p.m at room temperature and discard the flowthrough.
[0079] 15. To remove traces of ethanol, centrifuge for columns at 12,000 r.p.m for 2 minutes.
[0080] 16. Replace the collection tube with a clean 1.5 ml microfuge tube. Add 20-30 uL prewarmed elution buffer onto the middle of the column and incubate at room temperature for 2 minutes. 17. Centrifuge at 12,000 r.p.m. for 1 minute to elute the DNA. Perform a second elution if necessary, as this may slightly increase the DNA yield.
[0081] Materials and Reagents
[0082] 1. Cell culture reagents per lab protocol. For example: 293T cells (ATCC, Cat no.CRL- 3216), Dulbecco's modified Eagle's medium (DMEM) (Gibco, Cat no.11995073), Fetal bovine serum (FBS) (Cytiva, Cat no.SH30071.03), DPBS (Ca2+ / Mg2+ free) (Gibco, Cat no.14190144), Trypsin 0.25% (Gibco, Cat no.25200056).
[0083] 2. Paraformaldehyde (Electron microscopy sciences, Cat no.15710)
[0084] 3. Genomic DNA purification kit (NEB, PCR and DNA cleanup kit, Monarch Cat no.T1030S)
[0085] 4. Quick extract buffer (Lucigen, Cat no.QE09050) or PBND buffer: 50 mM KCI, 10 mM Tris- HCI (pH 8.3), 2.5 mM MgCI2, 0.1 mg / ml gelatin, 0.45% (v / v) Nonidet P40, 0.45% (v / v) Tween 20
[0086] 5. 5M Sodium Chloride (Thermo, Cat no. AM9760G)
[0087] 6. Proteinase K (Thermo Cat no. EO0491)
[0088] 7. DNAse and RNAse free tubes (1.5 ml_ or 2 ml_ tubes)
[0089] Primers used for PCR : ATTCTCCTTGGAATTTGCCCTT (Forward)(SEQ ID NO:1), Reverse CATAGCGTAAAAGGAGCAACA (SEQ ID NO:2) for the 1.25 kb RHO (for transgene amplification) and 10 kb P-globin gene (endogenous) (Forward) GACACAAGGGCTACTGGTTGCCGATTTTTATTG (SEQ ID NO:3) and (Reverse) GAACTGCAGTCACCAAATGAGCTATATCCTGAG (SEQ ID NO:4).
[0090] Equipment
[0091] 1. Benchtop centrifuge (Eppendorf, speed up to 12,000 r.p.m.)
[0092] 2. Thermomixer (Eppendorf)
[0093] 3. Nanodrop (ThermoFisher)
[0094] 4. PCR machine (Bio-Rad)
[0095] 5. Gel documentation system (Bio-Rad)
[0096] RESULTS
[0097] Representative images of genomic DNA extracted from 2-4% paraformaldehyde-fixed cells are shown in Figures 1A-1C. Phase separation after the addition of isopropanol is shown in Fig. 1A. Genomic DNA (1 pg) from cells fixed with different PFA concentrations, resolved on 1% agarose gel is shown in Fig. 1b. PCR of the same DNA (shown in 1 B) amplifying 1.2 kb rhodopsin transgene and ~10 kb beta-globin from 2%, 4% and 8% PFA fixed cells (range of concentration tested) is shown in Fig. 1 C. Next, the amplicons from figure 1 B were subjected to next generation sequencing (NGS) to determine the intactness of the DNA sequence of the recovered DNA. Compared to the known original DNA sequence, the fixed DNA showed a very low sequence error rate, nearly equivalent to unfixed DNA, even without adding DNA modifying enzymes such as uracil N-glycosylase:
[0098] Median error rate per 1000 base pairs:
[0099] Unfixed 0.36 4% paraformaldehyde 0.92
[0100] 8% paraformaldehyde 0.80
[0101] EXAMPLE 2 - Comparison with unfixed cells
[0102] A comparison between the DNA extraction method as described in Example 1 to the yield and quality obtained from unfixed cells using a New England Biolabs MONARCH Nucleic Acid Purification Kit demonstrated comparable yields. This is notable because unfixed cells provide a maximum yield, and exposing them to crosslinking then reverse-crosslinking with similar yields demonstrates a high recovery rate even with a range of fixation strengths (2-8% paraformaldehyde).
[0103] EXAMPLE 3 - Extraction from fixed cells
[0104] The robustness of the methods described herein were further demonstrated by extracting high-quality DNA (greater than 20 kb having little or no degradation) from 20,000 fixed cells, demonstrating the robustness of our method with low input cells (HEK293T cells, Human embryonic kidney cell line, ATCC CRL-3216).
[0105] EXAMPLE 4- Extraction of genomic DNA from cells embedded In a tissue
[0106] Murine retinas were subjected to the following fixation conditions for 20 minutes, and then exposed to the methods in Example 1.
[0107] The following DNA yields were obtained:
[0108] Fixative DNA yield total (in micrograms)
[0109] Unfixed 18.3
[0110] 4% paraformaldehyde 5.85, 12.7
[0111] 10% neutral buffered formalin 1.59, 5.23
[0112] The values separated by commas are replicates (N=2). The unfixed yield result is N=1.
[0113] EXAMPLE 5 - Comparison between using a high salt step versus omitting a high salt step
[0114] Below are results showing differences in genomic DNA recovery when using a high salt incubation as described above.
[0115] Genomic DNA yield for 1 million cells treated with 4% paraformaldehyde for 20 minutes:
[0116] - omitting high salt step 420, 400, 440 ng (replicate values)
[0117] - including high salt step 3,640 ng
[0118] Inclusion of a high salt treatment following reverse crosslinking was found to significantly increase yield of genomic DNA.
[0119] OTHER EMBODIMENTS
[0120] While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure come within known or customary practice within the art to which the invention pertains and may be applied to the essential features hereinbefore set forth.
[0121] All publications, patents, and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference in its entirety.
[0122] Other embodiments are within the following claims. What is claimed is:
Claims
AMENDED CLAIMS received by the International Bureau on 03 April 2025 (03.04.2025)CLAIMS1 . A method, comprising the steps of a) providing cross-linked fixed cells; b) reverse cross-linking the cells of step a); c) incubating in high salt solution; and d) precipitating deoxyribonucleic acid (DNA) from the cells.
2. The method of claim 1 , wherein the cells of a) are fixed in paraformaldehyde, formaldehyde, glutaraldehyde, formalin, 10% neutral buffered formalin, glyoxal, or acrolein.
3. The method of claim 1 , wherein reverse cross-linking comprises employing heat, a treatment with a low salt concentration, or an RNAse or a combination thereof.
4. The method of claim 3, wherein reverse cross-linking comprises incubation with a low salt containing buffer at a temperature between 50-70°C.
5. The method of claim 4, wherein the temperature is 60°C.
6. The method of claim 1 , wherein reverse cross-linking comprises incubating in a lysis buffer including a proteinase.
7. The method of claim 1 , wherein reverse cross-linking comprises incubating in a low salt containing buffer.
8. The method of claim 7, wherein the salt is a non-sodium salt.
9. The method of claim 1 , wherein step c) comprises incubating in 0.1 -2M final concentration of the salt solution.
10. The method of claim 9, wherein the salt is sodium chloride (NaCI).11 . The method of claim 10, wherein the high salt solution is 1 .2M NaCI final concentration.
12. The method of claim 1 , wherein step d) comprises isopropanol precipitation.
13. The method of claim 1 , wherein DNA obtained from step c) is further purified.
14. The method of claim 13, wherein purification comprises using a silica-based column.
15. The method of claim 1 , wherein reverse cross-linking does not include sonication or physical or enzymatic shearing of DNA or does not include chromatin immunoprecipitation or a combination thereof.
16. The method of claim 1 , wherein DNA is genomic DNA.
17. The method of claim 1 , wherein the precipitated DNA of step d is of high molecular weight of at least 20 kilo base-pairs.
18. The method of claim 1 , wherein the fixed cells are mammalian cells.
19. The method of claim 18, wherein the cells are in a suspension.
20. The method of claim 18, wherein the cells are on a support.21 . The method of claim 1 , wherein the cells are fixed in a biological sample embedded in an embedding medium.
22. The method of claim 21 , wherein the embedding material has been removed.
23. The method of claim 21 , wherein the biological sample is a tissue.
24. The method of claim 21 , wherein the biological sample is on a support.
25. The method of any of the aforementioned claims, wherein the cells or biological samples are human cells or human biological samples.
26. The method of any of the aforementioned claims, wherein the cells or biological samples are mammalian cells.
27. The method of claim 25, wherein the cells or biological samples are mouse, rat, guinea pig, hamster, dog, rabbit, monkey or cells or biological samples of a laboratory animal.
Citation Information
Patent Citations
Methods and compositions for the removal of aldehyde adducts and crosslinks from biomolecules
US20170283860A1
Methods for studying nucleic acids
US20180237951A1
Chemical platform assisted proximity capture (cap-c)
US20210317506A1