Nicotinamide phosphoribosyltransferase mutant and use thereof

Abstract

Provided are a nicotinamide phosphoribosyltransferase mutant and the use thereof. By using a wild-type nicotinamide phosphoribosyltransferase as a parent, point mutation is performed on the amino acid at position 75 or the amino acid at position 83 of the wild-type nicotinamide phosphoribosyltransferase so as to obtain a mutant having a significantly improved activity compared with the wild type. In addition, a recombinant Saccharomyces cerevisiae for expressing the mutant is obtained. Compared with the wild type, the mutant can be used to significantly increase the NMN yield. The mutant obtained by means of performing mutation on the amino acid at position 75 has up to a 4.3-fold increase in NMN yield compared with the wild type, and the mutant obtained by means of performing mutation on the amino acid at position 83 has up to a 5.3-fold increase in NMN yield compared with the wild type.

Description

Nicotinamide phosphoribosyltransferase mutant and its application Technical Field

[0001] The present invention belongs to the field of genetic engineering technology and more specifically relates to a nicotinamide phosphoribosyltransferase mutant and its application. Background Art

[0002] Nicotinamide Mononucleotide (NMN) is a natural biologically active nucleotide belonging to V B NMN derivatives are highly food-safe and can be used to improve aging and metabolic diseases. However, the current production of NMN cannot meet the growing demand, and a method to increase NMN production is urgently needed.

[0003] At present, there are two main methods for synthesizing NMN: chemical synthesis and biosynthesis. Chemical synthesis has problems such as high energy consumption, harsh reaction conditions, and serious environmental pollution during the production process. Therefore, the biosynthesis method of NMN is more popular. The existing biosynthesis methods of NMN mainly use glucose and nicotinamide as substrates, using nicotinamide phosphoribosyltransferase for catalytic synthesis, or using recombinant bacteria expressing nicotinamide phosphoribosyltransferase for whole-cell catalysis; the former method of directly using enzymes for catalysis is not as advantageous as the latter method of using recombinant bacteria for whole-cell catalysis due to problems such as easy enzyme inactivation.

[0004] Nicotinamide phosphoribosyltransferase (Nampt) is a key enzyme in the biosynthesis of NMN, but the activity of the natural enzyme is not high, which limits the large-scale production of NMN. In order to increase the yield of NMN, technicians have tried to mutate nicotinamide phosphoribosyltransferase to improve the catalytic activity of the enzyme, thereby increasing the yield of NMN per unit time. Among the mutation schemes currently disclosed, there are more mutations in the 100-450 interval sites for the core region of nicotinamide phosphoribosyltransferase (the most mutations are in the 200-400 interval sites). However, research data show that the effects of mutants obtained by mutation at different sites are significantly different. The degree of improvement in the catalytic activity of most mutants currently disclosed is limited, and its catalytic activity is less than 1 times that of the wild type, and it cannot significantly increase the yield of NMN. Therefore, continuing to explore mutation sites and mutation methods is of great significance to the NMN industry.

[0005] Summary of the Invention

[0006] In view of the above-mentioned deficiencies in the prior art, the present invention provides a nicotinamide phosphoribosyltransferase mutant and its application.

[0007] The first object of the present invention is to provide a method for increasing the activity of nicotinamide phosphoribosyltransferase.

[0008] The second object of the present invention is to provide a nicotinamide phosphoribosyltransferase mutant.

[0009] The third object of the present invention is to provide a gene encoding the mutant.

[0010] The fourth object of the present invention is to provide a recombinant plasmid.

[0011] The fifth object of the present invention is to provide a recombinant bacterium.

[0012] A sixth object of the present invention is to provide use of the mutant, the gene, the recombinant plasmid or the recombinant bacteria in the biosynthesis of nicotinamide mononucleotide.

[0013] A seventh object of the present invention is to provide use of the mutant, the gene, the recombinant plasmid or the recombinant bacterium in preparing a product for biosynthesis of nicotinamide mononucleotide.

[0014] The eighth object of the present invention is to provide a method for high-yield nicotinamide mononucleotide.

[0015] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0016] The present invention uses the wild type of nicotinamide phosphoribosyltransferase (Nampt) as a parent, conducts semi-rational design of the enzyme, and obtains mutation sites and corresponding mutants that can improve the catalytic activity of nicotinamide phosphoribosyltransferase.

[0017] The present invention claims a method for increasing the activity of nicotinamide phosphoribosyltransferase, the method comprising: mutating the valine at position 75 of nicotinamide phosphoribosyltransferase to any amino acid except lysine;

[0018] Or the 83rd aspartic acid of nicotinamide phosphoribosyltransferase is mutated to leucine, lysine, cysteine, proline, isoleucine, histidine, methionine, glycine, tyrosine, valine, glutamic acid or asparagine.

[0019] Specifically, the NCBI reference sequence of the nicotinamide phosphoribosyltransferase of the present invention is WP_012788281.1.

[0020] Specifically, the mutating of the valine at position 75 of nicotinamide phosphoribosyltransferase into any amino acid except lysine refers to mutating it into any other natural amino acid except lysine.

[0021] The present invention also seeks to protect a nicotinamide phosphoribosyltransferase mutant, which is obtained by performing point mutation on a specific amino acid site of the reference sequence WP_012788281.1 using the above method.

[0022] As one embodiment, the mutant is constructed by designing corresponding site-directed mutagenesis primers and amplifying the mutant by reverse PCR. The gene sequence encoding the wild-type nicotinamide phosphoribosyltransferase is shown in SEQ ID NO. 1.

[0023] The present invention also claims protection for a gene encoding the mutant.

[0024] While the present invention does not provide the amino acid or gene sequences of each mutant, knowing the amino acid sequence of the parental amino acid sequence and the amino acid sequence after the mutation site can yield the amino acid sequence of the corresponding mutant, and thus the corresponding gene sequence. In addition to mutating the parental amino acid sequence, corresponding mutants can also be obtained through methods such as artificial synthesis based on the mutant sequence. Therefore, the present invention also seeks protection for the genes encoding the mutants. Using these genes, corresponding mutants can be obtained through recombinant expression.

[0025] The present invention also claims protection for a recombinant plasmid, which is used to express the mutant of the present invention.

[0026] Specifically, the recombinant plasmid contains the gene encoding the mutant of the present invention.

[0027] Optionally, the vector used to construct the plasmid is pRS306.

[0028] The present invention also seeks to protect a recombinant bacterium, which is capable of expressing the mutant of the present invention.

[0029] As one embodiment, the recombinant bacteria contains a recombinant plasmid for expressing the mutant of the present invention.

[0030] Optionally, when constructing recombinant bacteria, Escherichia coli or Saccharomyces cerevisiae can be selected as the starting strain.

[0031] The present invention also claims protection for the use of the mutant, the gene, the recombinant plasmid or the recombinant bacteria in the biosynthesis of nicotinamide mononucleotide.

[0032] The present invention also seeks to protect the use of the mutant, the gene, the recombinant plasmid or the recombinant bacteria in preparing a product for biosynthesis of nicotinamide mononucleotide.

[0033] The present invention also provides a method for high-yield nicotinamide mononucleotide, comprising: replacing the nicotinamide phosphoribosyltransferase used in producing nicotinamide mononucleotide with the nicotinamide phosphoribosyltransferase mutant of the present invention, or replacing the recombinant bacteria expressing nicotinamide phosphoribosyltransferase used in producing nicotinamide mononucleotide with the recombinant bacteria of the present invention.

[0034] As a specific embodiment, the method is: using glucose and nicotinamide as substrates, and utilizing the recombinant bacteria of the present invention to perform whole-cell catalysis.

[0035] Specifically, in the method, the concentration of the substrate glucose is 50-90 g / L, and the concentration of the substrate nicotinamide is 10-20 g / L.

[0036] Preferably, in the method, the concentration of the substrate glucose is 60-80 g / L, and the concentration of the substrate nicotinamide is 10-15 g / L.

[0037] More preferably, in the method, the concentration of the substrate glucose is 70 g / L, and the concentration of the substrate nicotinamide is 10-15 g / L. Under these substrate concentration conditions, the yield of NMN produced by whole-cell catalysis using the recombinant bacteria is relatively the highest.

[0038] Specifically, in the method, the OD of the recombinant bacteria 600 It is 28 to 32.

[0039] More specifically, in the method, the OD of the recombinant bacteria 600 is 30.

[0040] Specifically, the recombinant bacteria is a recombinant Saccharomyces cerevisiae capable of expressing the mutant of the present invention.

[0041] The present invention has the following beneficial effects:

[0042] The present invention discloses a nicotinamide phosphoribosyltransferase mutant and its application. The mutation scheme of the present invention is to perform a single-point mutation on the 75th amino acid or the 83rd amino acid within the 1st to 100th interval of the wild-type nicotinamide phosphoribosyltransferase to obtain a mutant with significantly improved activity compared to the wild-type. Based on the mutation scheme, the present invention also constructs a recombinant cerevisiae yeast capable of expressing the mutant. Compared with the wild-type, the mutant of the present invention can significantly increase the NMN production. Among them, the NMN production of the mutant obtained by mutating the amino acid at position 75 is up to 4.3 times higher than that of the wild-type, and the NMN production of the mutant obtained by mutating the amino acid at position 83 is up to 5.3 times higher than that of the wild-type. The present invention provides a theoretical basis for further improving the NMN production, which is conducive to the large-scale production of NMN and promotes the development of the NMN industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 is the colony PCR detection result after the recombinant expression plasmid pRS306-Cp-Nampt was transformed into Saccharomyces cerevisiae CEN.PK2-1C; Figure A is the colony PCR detection result; Figure B is the plasmid map of the recombinant expression plasmid pRS306-Cp-Nampt.

[0044] Figure 2 shows the colony PCR detection results after the recombinant expression plasmids with site-directed mutations and double mutations were transferred into Saccharomyces cerevisiae CEN.PK2-1C; Figure A shows the colony PCR detection results after the recombinant expression plasmids with site-directed mutations were transferred into Saccharomyces cerevisiae CEN.PK2-1C, where 1 corresponds to V75F, 2 corresponds to D83N, 3 corresponds to M139D, and 4 corresponds to L240W; Figure B shows the colony PCR detection results after the recombinant expression plasmids with double mutations (V75F-D83N) were transferred into Saccharomyces cerevisiae CEN.PK2-1C.

[0045] FIG3 shows the NMN production determination results of recombinant Saccharomyces cerevisiae expressing wild-type nicotinamide phosphoribosyltransferase and V75F, D83N, M139D, L240W, and V75F-D83N mutants.

[0046] FIG4 shows the results of NMN production determination of recombinant Saccharomyces cerevisiae expressing 19 mutants of amino acid 75 of nicotinamide phosphoribosyltransferase.

[0047] FIG5 shows the results of NMN production determination of recombinant Saccharomyces cerevisiae expressing 19 mutants of amino acid position 83 of nicotinamide phosphoribosyltransferase.

[0048] Figure 6 shows the NMN production determination results of recombinant Saccharomyces cerevisiae expressing nicotinamide phosphoribosyltransferase mutant D83N or V75F under different substrate concentrations; Figure A shows the NMN production determination results of recombinant Saccharomyces cerevisiae expressing nicotinamide phosphoribosyltransferase mutant D83N under different glucose concentrations; Figure B shows the NMN production determination results of recombinant Saccharomyces cerevisiae expressing nicotinamide phosphoribosyltransferase mutant D83N under different nicotinamide concentrations; Figure C shows the NMN production determination results of recombinant Saccharomyces cerevisiae expressing nicotinamide phosphoribosyltransferase mutant V75F under different glucose concentrations; Figure D shows the NMN production determination results of recombinant Saccharomyces cerevisiae expressing nicotinamide phosphoribosyltransferase mutant V75F under different nicotinamide concentrations. DETAILED DESCRIPTION

[0049] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0050] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.

[0051] Example 1 Construction of recombinant Saccharomyces cerevisiae expressing nicotinamide phosphoribosyltransferase and its mutants

[0052] The present invention uses wild-type nicotinamide phosphoribosyltransferase (WT) as a parent and conducts semi-rational enzyme design to identify mutation sites that may affect the catalytic activity of nicotinamide phosphoribosyltransferase. The NCBI reference sequence of the wild-type nicotinamide phosphoribosyltransferase is WP_012788281.1.

[0053] On this basis, the present invention mutates the 75th valine (V) of the wild-type nicotinamide phosphoribosyltransferase to phenylalanine (F), the 83rd aspartic acid (D) to asparagine (N), the 139th methionine (M) to aspartic acid (D), the 240th leucine (L) to tryptophan (W), the 75th valine (V) to phenylalanine (F), and the 83rd aspartic acid (D) to asparagine (N).

[0054] To facilitate the construction and acquisition of a mutant of nicotinamide phosphoribosyltransferase, the present invention codon-optimized the gene encoding nicotinamide phosphoribosyltransferase, and constructed a recombinant Saccharomyces cerevisiae expressing the wild-type nicotinamide phosphoribosyltransferase using the optimized gene sequence (shown in SEQ ID NO. 1). On this basis, a recombinant Saccharomyces cerevisiae expressing the above-mentioned nicotinamide phosphoribosyltransferase mutant was constructed.

[0055] The construction process of the recombinant Saccharomyces cerevisiae of the present invention is as follows:

[0056] 1. Entrust GENEWIZ (Suzhou GENEWIZ Biotechnology Co., Ltd.) to synthesize the optimized gene sequence (shown in SEQ ID NO. 1) and ligate it into the vector pRS306 to obtain recombinant expression plasmid 1 (pRS306-Cp-Nampt) and recombinant bacteria 1 (recombinant Escherichia coli expressing wild-type nicotinamide phosphoribosyltransferase);

[0057] 2. Introducing site-directed mutations and double mutations by inverse PCR; using recombinant expression plasmid 1 as a template, using site-directed mutagenesis primers designed for the mutations and a high-fidelity enzyme, performing inverse PCR amplification and performing electrophoresis detection;

[0058] 3. Recover the PCR amplification product using a gel recovery kit, digest the recovered PCR amplification product with Dpn I enzyme, and transform into competent E. coli cells after digestion. Select positive clones for colony PCR detection and sequencing, and retain the positive clones verified by sequencing to obtain recombinant strain 2, i.e., recombinant E. coli expressing the nicotinamide phosphoribosyltransferase mutant; wherein, the primers used in colony PCR are yz-1 and yz-2, and their nucleotide sequences are shown below:

[0059] yz-1:GCAATTAACCCTCACTAAAGGGAAC

[0060] yz-2:CAAGGCGATTAAGTTGGGTAACG

[0061] 4. Amplify the positive clones that have been tested correctly and extract the recombinant expression plasmid contained therein to obtain recombinant expression plasmid 2. Recombinant expression plasmid 2 is linearized with StuⅠ enzyme and then transformed into Saccharomyces cerevisiae (CEN.PK2-1C). Positive clones are selected for colony PCR detection and sequencing to obtain recombinant strain 3, which is a recombinant Saccharomyces cerevisiae expressing the nicotinamide phosphoribosyltransferase mutant.

[0062] The constructed recombinant expression plasmid 1 is subjected to step 4 to obtain a recombinant Saccharomyces cerevisiae expressing wild-type nicotinamide phosphoribosyltransferase (recombinant strain 4).

[0063] Specifically, the amino acid and base changes of the nicotinamide phosphoribosyltransferase mutant of the present invention are shown in Table 1; the site-directed mutagenesis primers designed for the mutation are shown in Table 2.

[0064] Table 1 Amino acid and base changes in nicotinamide phosphoribosyltransferase mutants

[0065] Table 2 Site-directed mutagenesis primers

[0066] The inverse PCR reaction system used was: 1 μL each of primers F / R, <1 ng of DNA template, 25 μL of Phanta high-fidelity enzyme, and ddH2O to make up to 50 μL. The inverse PCR reaction program was: 95°C denaturation for 3 min, 34 cycles of 95°C denaturation for 30 s, 55°C annealing for 30 s, and 72°C extension for 5 min, followed by 72°C extension for 5 min. The colony PCR reaction system used was: 1 μL each of primers yz1 / yz2, 1 μL of yeast genomic DNA, 10 μL of Premix Taq enzyme, and ddH2O to make up to 20 μL. The colony PCR reaction program was: 95°C denaturation for 10 min, 29 cycles of 95°C denaturation for 30 s, 55°C annealing for 30 s, and 72°C extension for 2 min, followed by 72°C extension for 5 min.

[0067] Specifically, the process of transforming E. coli competent cells is:

[0068] (1) Add 10 μL of the product to be transformed into one tube of competent cells and place on ice for 30 min;

[0069] (2) Heat shock in a 42°C water bath for 90 seconds, followed by an ice bath for 2 minutes;

[0070] (3) Add 800 μL of 37°C LB medium (liquid) to each tube and incubate at 37°C on a shaker at 220 rpm for 1 h;

[0071] (4) Centrifuge at 8000 rpm for 1 min, discard the supernatant, and spread the resuspended bacteria on a Kan-resistant LB plate. Incubate at 37°C in a culture medium until a single colony grows.

[0072] The process of transforming Saccharomyces cerevisiae is:

[0073] (1) Pick a single colony of Saccharomyces cerevisiae and culture it in 2 mL YPD overnight, then transfer it to 48 mL YPD and culture it until OD 600 =1.3~1.5;

[0074] (2) Take 1 mL of bacterial solution from three 1.5 mL EP tubes and centrifuge at 13,000 rpm at 4°C for 5 min.

[0075] (3) Discard the supernatant, resuspend in 1 mL of pre-cooled sterile water, and centrifuge at 13,000 rpm for 5 min at 4°C.

[0076] (4) Resuspend and wash with 200 μL of pre-cooled sterile water, combine three tubes into one, and centrifuge at 13,000 rpm at 4°C for 5 min;

[0077] (5) Resuspend and wash with 200 μL of pre-cooled 0.1 M LiAc, and centrifuge at 13,000 rpm for 1 min at 4°C;

[0078] (6) Resuspend in 100 μL of pre-chilled 0.1 M LiAc to obtain Saccharomyces cerevisiae competent cells and store on ice;

[0079] (7) Boil water, boil salmon extract for 5 minutes, and chill for 5 minutes;

[0080] (8) Centrifuge the competent cells at 13,000 rpm at 4°C for 1 min and discard the supernatant;

[0081] (9) Add 36 μL 1 M LiAc to resuspend, 240 μL PEG, 10 μL salmon sperm, and 2000 ng of DNA to be transformed, and shake for 10 s;

[0082] (10) 30°C metal bath for 30 min, 42°C metal bath for 25 min, centrifugation at 13,000 rpm for 1 min;

[0083] (11) Discard the supernatant, add 600 μL of sterile water, resuspend, spread on SD uracil-deficient (SD-Ura) plates, and culture in a 30°C incubator until single colonies grow.

[0084] The results of colony PCR after the recombinant expression plasmid pRS306-Cp-Nampt was transformed into Saccharomyces cerevisiae CEN.PK2-1C are shown in Figure 1 ; Figure 1 A shows the colony PCR results; Figure 1 B shows the plasmid map of the recombinant expression plasmid pRS306-Cp-Nampt. As shown in Figure 1 , the present invention successfully constructed a recombinant Saccharomyces cerevisiae expressing wild-type nicotinamide phosphoribosyltransferase.

[0085] The results of colony PCR detection after the site-directed mutagenesis and double-mutation recombinant expression plasmids were transferred into Saccharomyces cerevisiae CEN.PK2-1C are shown in Figure 2. Figure 2A shows the results of colony PCR detection after the site-directed mutagenesis recombinant expression plasmid was transferred into Saccharomyces cerevisiae CEN.PK2-1C. In the figure, 1 corresponds to the mutation V75F, 2 corresponds to the mutation D83N, 3 corresponds to the mutation M139D, and 4 corresponds to the mutation L240W. Figure 2B shows the results of colony PCR detection after the double-mutation (V75F-D83N) recombinant expression plasmid was transferred into Saccharomyces cerevisiae CEN.PK2-1C. As shown in Figure 2, the present invention successfully constructed recombinant Saccharomyces cerevisiae expressing the nicotinamide phosphoribosyltransferase V75F, D83N, M139D, L240W, and V75F-D83N mutants.

[0086] Example 2 Catalytic synthesis of nicotinamide mononucleotide by recombinant whole-cell yeast Saccharomyces cerevisiae

[0087] The correctly sequenced recombinant Saccharomyces cerevisiae expressing the wild type and V75F, D83N, M139D, L240W and V75F-D83N mutants of nicotinamide phosphoribosyltransferase were inoculated into 10 mL of YPD liquid medium and cultured at 30°C and 220 rpm for 15 h; then 4% of the culture solution was transferred to 50 mL of fermentation medium and cultured for 60 h; then, the cells were collected by centrifugation at 4°C and 8000 rpm for 5 min.

[0088] Yeast fermentation medium: contains glucose 70 g / L, peptone 20 g / L, yeast extract 10 g / L, KH2PO4 4 g / L, K2HPO4 2 g / L, MgSO4·7H2O 0.5 g / L, and NaCl 0.5 g / L.

[0089] The collected cells were used to synthesize nicotinamide mononucleotide by whole-cell catalysis. The reaction system used was: Glucose (glucose) 70g / L, Nam (nicotinamide) 15g / L, cell OD 600 is 30; the reaction conditions used are: 220 rpm, 30°C; samples were taken after 3 h, 6 h and 9 h of reaction, respectively, and the samples were added with glass beads and crushed with a high-pressure homogenizer for 60 s, 30 s, 70 frequencies, and 10 times to detect the production of NMN; recombinant cerevisiae transformed with pRS306-Cp-Nampt, that is, recombinant cerevisiae expressing wild-type nicotinamide phosphoribosyltransferase, was used as a control.

[0090] The detection of NMN production is carried out using a chemical method, namely the product NMN derivative reaction method. The specific process is as follows: take 69 μL of crushed sample into a centrifuge tube, add 27.7 μL of 2mol / L KOH into the centrifuge tube, then add 27.7 μL of 20% acetophenone, vortex briefly to mix, and place in ice for a full ice bath for 2 minutes; add 125 μL of 88% formic acid, centrifuge briefly at low speed, and react in a constant temperature shaker at 37°C for 10 minutes; measure fluorescence: aspirate 240 μL of liquid in the centrifuge tube into the measurement well of a black 96-well plate, and use a Tecan multi-function microplate reader to measure fluorescence under excitation light of 382 nm and emission light of 445 nm; substitute the measured fluorescence value into the standard curve to obtain the concentration of NMN.

[0091] The results of NMN production determination of recombinant Saccharomyces cerevisiae expressing wild-type nicotinamide phosphoribosyltransferase and V75F, D83N, M139D, L240W and V75F-D83N mutants are shown in Figure 3. As can be seen from Figure 3, when the whole-cell catalytic reaction was 3 hours, the NMN production of the recombinant Saccharomyces cerevisiae expressing the single mutation D83N was 553.4 mg / L. After 6 hours of reaction, the NMN production of the recombinant Saccharomyces cerevisiae expressing the single mutation V75F was 463.2 mg / L, and the NMN production of the recombinant Saccharomyces cerevisiae expressing the wild-type Nampt was 88 mg / L. By comparison, the single mutation D83N significantly increased the activity of the wild-type Nampt, and its NMN production increased by 5.3 times compared to the wild type. The single mutation V75F also significantly increased the activity of the wild-type Nampt, causing its NMN production under the same conditions to increase by 4.3 times compared to the wild type.

[0092] Example 3 Saturation Mutation of Nicotinamide Phosphoribosyltransferase V75 and D83 Sites

[0093] To study the effects of other mutations at amino acids 75 and 83 of nicotinamide phosphoribosyltransferase on enzyme activity, the present invention used the amino acid sequence of the wild-type nicotinamide phosphoribosyltransferase as a parent, and performed saturation mutations at amino acids 75 and 83, respectively. The method for constructing mutants corresponding to the saturation mutations was the same as in Example 1. Corresponding mutation primers were designed for the desired mutations, and the mutated sequences were obtained by inverse PCR amplification.

[0094] Referring to the method described in Example 1, the present invention successfully constructed recombinant Saccharomyces cerevisiae with 18 other mutations at amino acids 75 and 83 of nicotinamide phosphoribosyltransferase. Based on the obtained recombinant Saccharomyces cerevisiae, whole-cell catalysis and NMN production were measured using the method described in Example 2.

[0095] The results of NMN production assays of recombinant Saccharomyces cerevisiae expressing 19 mutants at amino acid position 75 of nicotinamide phosphoribosyltransferase are shown in Figure 4. As shown in Figure 4, except for a slight decrease in NMN production compared to the wild type after valine at position 75 was mutated to lysine, the NMN production of the remaining mutants was higher than that of the wild type.

[0096] The results of NMN production determination of recombinant Saccharomyces cerevisiae expressing 19 mutants of amino acid 83 of nicotinamide phosphoribosyltransferase are shown in Figure 5. As shown in Figure 5, mutating aspartic acid at position 83 to leucine (L), lysine (K), cysteine ​​(C), proline (P), isoleucine (I), histidine (H), methionine (M), glycine (G), tyrosine (Y), valine (V), glutamic acid (E) or asparagine (N) can increase its NMN production.

[0097] Example 4 Optimization of substrate concentration in whole-cell catalytic reaction system

[0098] Based on the whole-cell catalytic reaction system described in Example 2, the present invention uses recombinant Saccharomyces cerevisiae expressing nicotinamide phosphoribosyltransferase mutants D83N or V75F as test strains to optimize the concentrations of substrates glucose and nicotinamide. A single-factor experiment was conducted with glucose concentrations of 50 / 70 / 90 g / L and nicotinamide concentrations of 10 / 15 / 20 g / L. The bacterial OD 600 The whole-cell catalysis was carried out according to the method described in Example 2, and the NMN production was measured after 3 hours of reaction.

[0099] The results of NMN production measurements in recombinant Saccharomyces cerevisiae expressing the nicotinamide phosphoribosyltransferase mutants D83N or V75F under different substrate concentrations are shown in Figure 6. Figure 6A shows the NMN production measurements under different glucose concentrations; Figure 6B shows the NMN production measurements under different nicotinamide concentrations; Figure 6C shows the NMN production measurements in recombinant Saccharomyces cerevisiae expressing the nicotinamide phosphoribosyltransferase mutant V75F under different glucose concentrations; and Figure 6D shows the NMN production measurements in recombinant Saccharomyces cerevisiae expressing the nicotinamide phosphoribosyltransferase mutant V75F under different nicotinamide concentrations. As shown in Figure 6, for recombinant Saccharomyces cerevisiae expressing the nicotinamide phosphoribosyltransferase mutant D83N, the optimal glucose concentration is 70 g / L, at which point the NMN production is 524.8 mg / L; and the optimal nicotinamide concentration is 15 g / L, at which point the NMN production is 529.8 mg / L. For recombinant Saccharomyces cerevisiae expressing the nicotinamide phosphoribosyltransferase mutant V75F, the optimal concentration of glucose is 70 g / L, at which time the NMN production is 442.3 mg / L; the optimal concentration of nicotinamide is 10 g / L, at which time the NMN production is 427.7 mg / L.

[0100] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A method for enhancing the activity of nicotinamide phosphoribosyltransferase, characterized in that, Mutate the valine at position 75 of nicotinamide phosphoribosyltransferase to any amino acid other than lysine; or mutate the aspartic acid at position 83 of nicotinamide phosphoribosyltransferase to leucine, lysine, cysteine, proline, isoleucine, histidine, methionine, glycine, tyrosine, valine, glutamic acid or asparagine.

2. A nicotinamide phosphoribosyltransferase mutant, characterized in that, The mutant is obtained by the method described in claim 1.

3. A gene encoding the mutant described in claim 2.

4. A recombinant plasmid, characterized in that, Containing the gene described in claim 3.

5. A recombinant bacterium, characterized in that, Expressing the mutant described in claim 2.

6. Use of the mutant described in claim 2, the gene described in claim 3, the recombinant plasmid described in claim 4 or the recombinant bacterium described in claim 5 in the biosynthesis of nicotinamide mononucleotide.

7. Use of the mutant described in claim 2, the gene described in claim 3, the recombinant plasmid described in claim 4 or the recombinant bacterium described in claim 5 in the preparation of a product for the biosynthesis of nicotinamide mononucleotide.

8. A method for high-yield production of nicotinamide mononucleotide, characterized in that, Replace the nicotinamide phosphoribosyltransferase used in the production of nicotinamide mononucleotide with the nicotinamide phosphoribosyltransferase mutant described in claim 2, or replace the recombinant bacterium expressing nicotinamide phosphoribosyltransferase used in the production of nicotinamide mononucleotide with the recombinant bacterium described in claim 5.

9. The method according to claim 8, wherein In the method, the concentration of the substrate glucose is 50 - 90 g / L, and the concentration of the substrate nicotinamide is 10 - 20 g / L.

10. The method according to claim 9, wherein In the method described above, the OD of the recombinant bacterium 600 is 28 to 32.

Images