Gene editing composition and use thereof

Targeted destruction of LPA genes through base editor fusion proteins and guide RNA compositions, solving the problem of reducing Lp(a) levels in the prior art, achieving efficient and safe Apo(a) protein knockdown, and reducing the risk of cardiovascular disease.

WO2025152584A1PCT designated stage expired Publication Date: 2025-07-24BASE THERAPEUTICS (SHANGHAI) CO LTD +1
View PDF 9 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/131498
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-01-15
Filing Date
2024-11-12
Publication Date
2025-07-24

AI Technical Summary

Technical Problem

The prior art is difficult to effectively and safely reduce the level of apolipoprotein (a) [Lp(a)] in plasma, traditional drugs are ineffective or at risk of off-target editing, and gene editing methods are complex and inconvenient.

Method used

The base editor fusion protein and guide RNA composition are used to reduce the Lp(a) level by targeting the disruption of the start codon or splicing site of the LPA gene.

Benefits of technology

Efficient editing of LPA genes in vitro and in vitro to achieve partial or complete knockdown of Apo(a) protein, high safety, no off-target effects, and safety of gene therapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2024131498-APPB-I100001
    Figure PCTCN2024131498-APPB-I100001
  • Figure PCTCN2024131498-APPB-I100002
    Figure PCTCN2024131498-APPB-I100002
  • Figure PCTCN2024131498-APPB-I100003
    Figure PCTCN2024131498-APPB-I100003
Patent Text Reader

Abstract

The present invention relates to the field of gene therapy drugs, and specifically relates to a gene editing composition and the use thereof. The gene editing composition comprises: 1) a base editor fusion protein, or a nucleic acid encoding the base editor fusion protein; and 2) a guide RNA, or a nucleic acid encoding the guide RNA, wherein the guide RNA comprises a spacer sequence fragment and a scaffold sequence fragment, and the nucleotide sequence encoding the spacer sequence fragment is as set forth in any one of SEQ ID NOs: 1-71. The gene editing composition can efficiently edit an LPA gene in vitro and in vivo, and can realize partial or complete knockout of Apo(a) protein in vivo. In addition, the gene editing composition can efficiently edit the LPA gene in vitro and in vivo without detectable off-target effects, thus demonstrating safety for gene therapy.
Need to check novelty before this filing date? Find Prior Art

Description

Gene editing compositions and uses thereof Technical Field

[0001] The present invention relates to the field of gene therapy drugs, and in particular to a gene editing composition and uses thereof. Background Art

[0002] Cardiovascular disease is the world's leading cause of death and a major burden of disease. It includes conditions such as hypercholesterolemia, coronary heart disease, hypertension, myocardial infarction, and stroke. Researchers have long sought to identify risk factors for cardiovascular disease and to identify methods to reduce patients' risk. In this regard, lipoprotein (a) [Lp(a)] has garnered widespread attention. Studies have long established that high levels of Lp(a) are an inherited and independent risk factor for cardiovascular disease. Mendelian randomization studies have consistently demonstrated a causal relationship between plasma Lp(a) concentrations and the risk of myocardial infarction, stroke, peripheral arterial disease, and cardiovascular death. The three components of Lp(a), namely low-density lipoprotein (LDL)-like particles, apolipoproteins [Apo(a)], and oxidized phospholipids (OxPL), are all indispensable factors in the pathogenesis of Lp(a). They mainly cause local pathological changes by promoting atherosclerosis, thrombosis, and inflammation, and then cause the occurrence of diseases (Kronenberg, F. (2016). Cardiovasc. Drugs Ther., 30(1):87-100). From the perspective of safety, individuals with low Lp(a) in the population will not suffer obvious health damage, so Lp(a) is a good target for cardiovascular intervention. Unlike LDL-C, there are currently no approved drugs to lower Lp(a). Traditional statins, lipid-lowering drugs, do not cause significant changes in Lp(a) levels. Some studies have even shown that statins can cause Lp(a) to increase. Currently, drugs that have been found to be effective in lowering Lp(a) include: niacin, PCSK9 inhibitors, estrogen, mipomersen, and lomitapide. However, considering the effectiveness of lowering Lp(a), economy, clinical adverse events, clinical operability and scalability, and cardiovascular benefits, these methods are not the best choice (Qi Chenlu et al., Advances in Clinical Medicine, 2022, 12(12), 11051-11056). Since elevated blood Lp(a) is mainly due to genetic variations in the LPA gene encoding Apo(a) (about 90%), the only way to prevent its harmful effects is to silence the LPA gene. Nucleic acid-based drugs, such as antisense oligonucleotides (ASOs) and small interfering RNA (siRNA), provide a strategy to lower Lp(a) levels by silencing the LPA gene, but they require multiple injections, which increases the inconvenience and cost of treatment for patients. Therefore, finding an effective treatment method that can stably or permanently lower Lp(a) levels is an urgent task.

[0003] Gene editing technology has the potential to precisely and permanently modify disease-causing genes in human patients. A single gene editing treatment can produce long-term effects, reducing the treatment burden on patients. Gene editing approaches targeting liver Lp(a), such as the targeted knockout of Apo(a) using the CRISPR-Cas9 nuclease system, have successfully reduced Lp(a) levels in animal models. While these studies demonstrate the potential of gene editing for regulating Apo(a) and Lp(a) levels, significant off-target editing has also been observed (Doerfler AM. et. al, Mol Ther Methods Clin Dev., 2022 Oct 13:27:337-351). Compared to the CRISPR-Cas9 nuclease system, base editors offer greater precision and safety. Using base editors, gene knockout can be achieved by disrupting the start codon or splice site of a protein-coding gene, or by introducing premature stop codons. The present invention aims to provide an innovative method and composition that utilizes base editing technology to efficiently and safely knock out Apo(a) to reduce the level of Lp(a) in plasma, thereby preventing or treating cardiovascular disease.

[0004] Summary of the Invention

[0005] In view of the above-mentioned shortcomings of the prior art, the object of the present invention is to provide a gene editing composition and its use to solve the problems in the prior art.

[0006] To achieve the above objectives and other related objectives, the present invention provides a gene editing composition, comprising:

[0007] 1) a base editor fusion protein, or a nucleic acid encoding the base editor fusion protein;

[0008] 2) A guide RNA, or a nucleic acid encoding the guide RNA, wherein the guide RNA comprises a spacer sequence fragment and a scaffold sequence fragment, and the spacer sequence fragment encoding the spacer sequence fragment comprises A) a nucleic acid molecule having a nucleotide sequence as shown in any one or more of SEQ ID No.1-60, whose base editor fusion protein is a cytosine base editor fusion protein; B) a nucleic acid molecule having a nucleotide sequence as shown in any one or more of SEQ ID No.57-71, whose base editor fusion protein is an adenine base editor fusion protein;.

[0009] Preferably, the base editor fusion protein comprises a polypeptide having an amino acid sequence as shown in any one of SEQ ID No.74-76.

[0010] The present invention also provides an isolated nucleic acid molecule, which encodes the aforementioned guide RNA, the aforementioned base editor fusion protein, or simultaneously encodes the aforementioned guide RNA and the aforementioned base editor fusion protein.

[0011] The present invention also provides an expression vector comprising the aforementioned nucleic acid molecule and a plasmid backbone.

[0012] The present invention also provides a pharmaceutical composition comprising a delivery vector and the aforementioned gene editing composition, the aforementioned nucleic acid molecule or the aforementioned expression vector.

[0013] The present invention also provides use of the aforementioned gene editing composition, the aforementioned nucleic acid molecule, the aforementioned expression vector, or the aforementioned pharmaceutical composition in the preparation of any of the following products:

[0014] 1) Preparation of LPA-gene-modified cells and / or animals;

[0015] 2) for preparing cells and / or animals with apolipoprotein(a) and lipoprotein(a) knockout or knockdown;

[0016] 3) Used for preparing drugs for treating cardiovascular diseases.

[0017] As described above, the gene editing composition and its use of the present invention have the following beneficial effects:

[0018] The gene editing composition of the present invention can efficiently edit the LPA gene in vitro and in vivo, and can achieve partial or complete knockout of the Apo(a) protein in vivo and in vitro. Furthermore, the gene editing composition of the present invention can efficiently edit the LPA gene in vivo without any off-target effects, demonstrating the safety of gene therapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] FIG1 is a schematic diagram showing the effect of the gene editing composition of the present invention on editing the LPA gene in vivo.

[0020] Figure 2 is a schematic diagram showing the effect of the gene editing composition of the present invention on reducing apolipoprotein levels in vivo.

[0021] FIG3 is a schematic diagram showing the results of genome-wide off-target analysis after the gene editing composition of the present invention edits the LPA gene in vivo.

[0022] Figure 4 shows the base editor, gRNA and its original spacer sequence SEQ ID No. 1-35 corresponding to the composition of the present invention, and its base editing efficiency in HepG2.

[0023] Figure 5 shows the base editor, gRNA and its original spacer sequence SEQ ID No. 36-71 corresponding to the composition of the present invention, and its base editing efficiency in HepG2.

[0024] Figure 6 shows the base editing efficiency of 32 highly efficient target sgRNAs and their compositions of the present invention at potential off-target sites in cells.

[0025] Figure 7 shows the base editing efficiency of the gRNA (SG057, SG063 and SG067) of the present invention combined with the base editor in transgenic mice.

[0026] FIG8 shows the concentration of apolipoprotein in the plasma of transgenic mice before and after injection of the gene editing composition of the present invention.

[0027] [Corrected 23.12.2024 according to Rule 91] Figure 9 shows the in vitro editing efficiency of the LPA target gRNA (SG001-SG035) of the present invention combined with other base editors in HepG2.

[0028] [Corrected 23.12.2024 according to Rule 91] Figure 10 shows the in vitro editing efficiency of the LPA target gRNA (SG036-SG070) of the present invention combined with other base editors in HepG2.

[0029] [Corrected 23.12.2024 in accordance with Article 91] DETAILED DESCRIPTION

[0030] The present invention provides a gene editing composition, comprising:

[0031] 1) a base editor fusion protein, or a nucleic acid encoding the base editor fusion protein;

[0032] 2) A guide RNA, or a nucleic acid encoding the guide RNA, wherein the guide RNA comprises a spacer sequence fragment and a scaffold sequence fragment, and the spacer sequence fragment encoding the spacer sequence fragment comprises A) a nucleic acid molecule having a nucleotide sequence as shown in any one or more of SEQ ID No.1-60, whose base editor fusion protein is a cytosine base editor fusion protein; B) a nucleic acid molecule having a nucleotide sequence as shown in any one or more of SEQ ID No.57-71, whose base editor fusion protein is an adenine base editor fusion protein;.

[0033] In some embodiments, the base editor fusion protein comprises a programmable DNA binding domain fragment and a deaminase domain fragment. Specifically, the programmable DNA binding domain fragment is selected from the domain fragment of the Cas protein of the CRISPR / Cas system. More specifically, the programmable DNA binding domain fragment is a domain fragment of the Cas9 protein and its variants. Preferably, the Cas9 protein is selected from the SpCas9 protein and its variants or the SaCas9 protein and its variants.

[0034] In some embodiments, the gene editing combination can be a combination of a base editor fusion protein and a guide RNA; or a combination of a base editor fusion protein and a nucleic acid encoding the guide RNA; or a combination of a nucleic acid encoding the base editor fusion protein and a guide RNA; or a combination of a nucleic acid encoding the base editor fusion protein and a nucleic acid encoding the guide RNA. Furthermore, the Cas9 protein variant comprises a Cas9 nickase (nCas9) that unilaterally shears a double-stranded DNA strand or a Cas9 with lost nuclease activity (dCas9).

[0035] In some embodiments, the deaminase domain fragment is selected from a cytosine deaminase fragment or an adenine deaminase fragment. More specifically, the cytosine deaminase is selected from one or more of APOBEC1, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3E, APOBEC3F, APOBEC3G, APOBEC3H, AID, or pmCDA1; or the adenine deaminase is selected from ecTadA or a variant thereof.

[0036] In some embodiments, the base editor fusion protein is selected from CE-A3A in Example 1 of the patent specification with application number 202010163058.3. 1048-1063 The amino acid sequence of CE-SaABE8e-744 in patent application number 202310186267.3 is shown as SEQ ID No.76, or the amino acid sequence of CE-ABE8e is shown as SEQ ID No.74.

[0037] Furthermore, when the nucleotide sequence encoding the spacer sequence fragment in the guide RNA is as shown in any one of SEQ ID No. 1-60, the base editor fusion protein is CE-A3A in Example 1 of the patent specification with application number 202010163058.3 1048-1063; or, when the nucleotide sequence encoding the spacer sequence fragment in the guide RNA is as shown in any one of SEQ ID No.57-68, the base editor fusion protein is CE-ABE8e comprising an amino acid sequence as shown in SEQ ID No.74; or, when the nucleotide sequence encoding the spacer sequence fragment in the guide RNA is as shown in any one of SEQ ID No.69-71, the base editor fusion protein is CE-SaABE8e-744 in the patent application number 202310186267.3.

[0038] In some specific embodiments, the nucleotide sequence of the scaffold sequence fragment comprises a nucleic acid molecule shown in any one of SEQ ID No. 72-73.

[0039] In some embodiments, the guide RNA, if in RNA form, may comprise one or more modified bases, nucleosides, or nucleotides that can mitigate the degradation tendency of the RNA in cells.

[0040] The present invention also provides a base editor fusion protein, which comprises a polypeptide having an amino acid sequence as shown in SEQ ID No.74.

[0041] The present invention also provides an isolated nucleic acid molecule, which encodes the aforementioned gene editing composition guide RNA, base editor fusion protein, or simultaneously encodes the gene editing composition guide RNA and base editor fusion protein.

[0042] The present invention also provides an expression vector comprising the aforementioned nucleic acid molecule and a plasmid backbone.

[0043] In some embodiments, the plasmid backbone is a circular or linear DNA molecule that can autonomously replicate and express the inserted gene of interest within the cell. The backbone plasmid can contain regulatory sequences, such as promoters, replicons, enhancers, and transcriptional and translational start and stop codons. The plasmid backbone is typically linked to the gene of interest to form a complete expression vector capable of expressing a specific output in the cell.

[0044] In some specific embodiments, the plasmid backbone can be selected from any one or more of pAAV-CAG, pAAV-TRE, pAAV-EF1a, pAAV-GFAP, pAAV-Lgr5, pAAV-Sox2, pAAV-Syn or pAAV-CMV backbones.

[0045] The present invention also provides a cell, wherein the cell contains the aforementioned nucleic acid molecule or the aforementioned expression vector.

[0046] In some specific embodiments, the cell is selected from any one of animal cells (such as CHO, COS, N2A, human cervical cancer cells such as HELA or human embryonic kidney cells such as HEK293T), plant cells, bacterial cells (such as Escherichia coli, Streptomyces, Salmonella typhimurium), fungal cells (such as yeast), and insect cells (such as Sf9).

[0047] The present invention also provides a pharmaceutical composition comprising a delivery vector and the aforementioned gene editing composition, the aforementioned nucleic acid molecule or the aforementioned expression vector.

[0048] In some embodiments, the delivery vehicle is selected from one or more of polymer nanoparticles, liposomes, lipid nanoparticles, viral vectors, or extracellular vesicles.

[0049] In some embodiments, the pharmaceutical composition further comprises pharmaceutically acceptable excipients. The acceptable excipients may be sterile water or physiological saline, stabilizers, excipients, antioxidants (ascorbic acid), buffers (phosphoric acid, citric acid, other organic acids), preservatives, surfactants (PEG, Tween), chelating agents (EDTA), adhesives, and the like. Furthermore, the composition may also contain low molecular weight polypeptides; serum albumin, gelatin, or immunoglobulins; glycine, glutamine, asparagine, arginine, or lysine; polysaccharides or monosaccharides; mannitol or sorbitol. When preparing an aqueous solution for injection, such as physiological saline, an isotonic solution containing glucose or other auxiliary drugs, such as D-sorbitol, D-mannose, D-mannitol, or sodium chloride, appropriate solubilizers such as alcohols (ethanol), polyols (propylene glycol, PEG), and nonionic surfactants (Tween 80, HCO-50) may be used in combination.

[0050] The present invention also provides use of the aforementioned gene editing composition, the aforementioned nucleic acid molecule, the aforementioned expression vector, or the aforementioned pharmaceutical composition in the preparation of any of the following products:

[0051] 1) Preparation of LPA-gene-modified cells and / or animals;

[0052] 2) for preparing cells and / or animals with apolipoprotein(a) and lipoprotein(a) knockout or knockdown;

[0053] 3) Used for preparing drugs for treating cardiovascular diseases.

[0054] In some embodiments, the cardiovascular disease is selected from one or more of hypercholesterolemia, coronary heart disease, hypertension, myocardial infarction, stroke, peripheral vascular disease, or aortic atherosclerosis.

[0055] In some embodiments, the mammals include but are not limited to humans, non-human primates, and mice and rats into which human LPA genes have been exogenously transferred.

[0056] In some embodiments, the base mutation is a C·G to T·A mutation; or, the base mutation is an A·T to G·C mutation. Specifically, when the deaminase domain fragment in the gene editing composition is a cytosine deaminase fragment, the base mutation is a C·G to T·A mutation; or, when the deaminase domain fragment in the gene editing composition is an adenine deaminase fragment, the base mutation is an A·T to G·C mutation.

[0057] Furthermore, the base mutation is a loss-of-function mutation or a non-coding mutation. Specifically, the loss-of-function mutation is the introduction of a premature stop codon or a mutation in an intronic splice site in the LPA gene, which results in the production of a truncated or non-functional Apo(a) protein; or the non-coding mutation is the mutation of the start codon ATG in the LPA gene, which results in the elimination of LPA gene expression.

[0058] Furthermore, the aforementioned premature termination codon is TAA, TAG, TGA or TGA. For example, the premature stop codon is converted from CAA to TAA via deamination of the first C on the coding chain; the premature stop codon is converted from CAG to TAG via deamination of the first C on the coding chain; the premature stop codon is converted from CGA to TGA via deamination of the first C on the coding chain; the premature stop codon is converted from TGG to TGA via deamination of the third C on the complementary chain; the start codon mutation is converted from ATG to ATA via deamination of the third C on the complementary chain; the start codon mutation is converted from ATG to ACG via deamination of the second A on the complementary chain; the start codon mutation is converted from ATG to GTG via deamination of the first A on the coding chain; the intron splice site mutation is converted from CA to TA or TC to TT by deamination of C on the complementary chain; the intron splice site mutation is converted from CA to CG by deamination of A on the complementary chain; the intron splice site mutation is converted from AG to GG by deamination of A on the coding chain.

[0059] In some embodiments, the number of base mutations in the LPA gene is 1-20. More specifically, the number of base mutations is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0060] The present invention also provides a method for preventing and / or treating a disease, comprising administering a therapeutically effective amount of the aforementioned gene editing composition, the aforementioned nucleic acid molecule, the aforementioned expression vector or the aforementioned pharmaceutical composition to a subject in need; the disease is selected from one or more of the following: hypercholesterolemia, coronary heart disease, hypertension, myocardial infarction, stroke, peripheral vascular disease or aortic atherosclerosis.

[0061] In the present invention, the aforementioned gene editing composition, the aforementioned nucleic acid molecule, the aforementioned expression vector or the aforementioned pharmaceutical composition may also be used in combination with other drugs.

[0062] In the composition or use provided by the present invention, the aforementioned gene editing composition, the aforementioned nucleic acid molecule, the aforementioned expression vector or the aforementioned pharmaceutical composition is a single active ingredient or is combined with other active ingredients to form a combined preparation. The other active ingredients can be various other drugs that can be used to treat hypercholesterolemia, coronary heart disease, hypertension, myocardial infarction, stroke, peripheral vascular disease or aortic atherosclerosis. The content of the active ingredient in the composition is generally a safe and effective amount, and the safe and effective amount should be adjustable for those skilled in the art. For example, the dosage of the active ingredient generally depends on the patient's weight, the type of application, the condition and severity of the disease. For example, the dosage of the aforementioned gene editing composition, the aforementioned nucleic acid molecule, the aforementioned expression vector or the aforementioned pharmaceutical composition as an active ingredient can generally be 1-1000 mg / kg / day, 20-200 mg / kg / day, 1-3 mg / kg / day, 3-5 mg / kg / day y, 5~10mg / kg / day, 10~20mg / kg / day, 20~30mg / kg / day, 30~40mg / kg / day, 40~60mg / kg / day, 60~80mg / kg / day, 80~100 mg / kg / day, 100~150mg / kg / day, 150~200mg / kg / day, 200~300mg / kg / day, 300~500mg / kg / day, or 500~1000mg / kg / day.

[0063] In the present invention, the term "expression vector" refers to a nucleic acid delivery vehicle capable of expressing a protein from a nucleic acid molecule encoding a protein. An expression vector can be introduced into a host cell via transformation, transduction, or transfection, so that the genetic material elements it carries are expressed in the host cell. Expression vectors are well known to those skilled in the art and include, but are not limited to, plasmids; phagemids; cosmids; artificial chromosomes, such as yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), or P1-derived artificial chromosomes (PACs); bacteriophages such as lambda phage or M13 phage, and animal viruses. An expression vector may contain a variety of expression control elements, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Furthermore, an expression vector may also contain a replication initiation site. An expression vector may contain a nucleic acid of the present invention for introduction into a cell for expression. An expression vector may contain expression control elements, such as a promoter, terminator, and / or enhancer, operably linked to the nucleic acid.

[0064] In the present invention, the dosage form of the pharmaceutical composition is selected from the group consisting of: injection, sterile powder for injection, tablet, pill, capsule, lozenge, elixir, powder, granule, syrup, solution, tincture, aerosol, powder spray, or suppository. Those skilled in the art can select a suitable formulation according to the mode of administration. For example, formulations suitable for oral administration may include, but are not limited to, pills, tablets, chewable tablets, capsules, granules, solution, drops, syrup, aerosol, or powder spray.

[0065] In the methods and uses of the present invention, when the active ingredient is used in combination with other therapeutic agents, the active ingredient is co-administered with the other therapeutic agent. "Co-administered" means administered simultaneously in the same formulation or in two different formulations via the same or different routes, or administered sequentially via the same or different routes. "Sequential" administration means that there is a time difference of seconds, minutes, hours, or days between the administration of two or more different compounds.

[0066] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those familiar to those skilled in the art. Furthermore, any methods and materials similar or equivalent to those described herein can be applied to the methods of the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0067] As used herein, “include”, “comprising” and the like should be understood as having an inclusive meaning, rather than an exclusive or exhaustive meaning, that is, the meaning of “including but not limited to”.

[0068] As used herein, "therapeutically effective amount" generally refers to an amount that, after an appropriate administration period, can achieve the effect of treating the diseases listed above.

[0069] As used herein, the terms "therapeutic" and "prophylactic" should be understood in their broadest sense. The term "therapeutic" does not necessarily imply that a mammal undergoes treatment until full recovery. Similarly, "prophylactic" does not necessarily mean that a subject will not ultimately contract a disease condition. Thus, treatment and prevention include alleviating the symptoms of a particular condition or preventing or reducing the risk of a particular condition developing. The term "prevention" can be understood to mean reducing the severity of an episode of a particular condition. Treatment can also include reducing the severity of an existing condition or the frequency of acute episodes.

[0070] As used herein, the subject or individual for therapeutic or prophylactic treatment is preferably a mammal, such as, but not limited to, a human, a primate, livestock (e.g., sheep, cattle, horses, donkeys, pigs), a pet (e.g., a dog, a cat), a laboratory animal (e.g., a mouse, rabbit, rat, guinea pig, hamster), or a captive wild animal (e.g., a fox, a deer). The subject is preferably a primate. The subject is most preferably a human.

[0071] As used herein, the terms "nucleic acid molecule" and "nucleic acid component" are used interchangeably and refer to compounds having a core base and an acidic portion, such as a polymer of nucleosides, nucleotides, or nucleotides. In some embodiments, "nucleic acid" refers to a single nucleic acid residue (e.g., nucleotides and / or nucleosides). In some embodiments, "nucleic acid molecule" refers to an oligonucleotide chain comprising three or more nucleotide residues. As used herein, the terms "nucleic acid molecule" and "polynucleotide" are used interchangeably to refer to a polymer of nucleotides (e.g., a string of at least three nucleotides). In some embodiments, "nucleic acid" includes RNA and single-stranded and / or double-stranded DNA. Nucleic acids can be naturally occurring or non-naturally occurring molecules.

[0072] As used herein, the term "expression" refers to the process by which a polynucleotide is transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell. The expression level of a gene can be determined by measuring the amount of mRNA or protein in a cell or tissue sample.

[0073] The terms "protein", "peptide" and "polypeptide" are used interchangeably and in their broadest sense to refer to compounds of two or more subunits of amino acids, amino acid analogs or peptide mimetics. The subunits can be linked by peptide bonds. In another aspect, the subunits can be linked by other bonds, for example, esters, ethers, etc. A protein or peptide must contain at least two amino acids, and there is no limit on the maximum number of amino acids that make up a protein or peptide sequence. Proteins and peptides are known to have a C-terminus and an N-terminus, wherein the C-terminus refers to the end to which there is an unbound carboxyl group on the terminal amino acid and the N-terminus refers to the end to which there is an unbound amino group on the terminal amino acid. The term "amino acid" as used herein refers to natural and / or non-natural or synthetic amino acids, including glycine, as well as D and L optical isomers, amino acid analogs and peptide mimetics. The term "fusion" in the context of a protein or polypeptide refers to the connection between the ends of two or more proteins or polypeptides (or their domains) to form a fusion protein.

[0074] The following describes the embodiments of the present invention through specific examples. Those skilled in the art will readily understand the other advantages and benefits of the present invention from the disclosure herein. The present invention may also be implemented or applied through various other specific embodiments, and the details in this specification may be modified or altered based on different viewpoints and applications without departing from the spirit of the present invention.

[0075] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing specific specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0076] When the embodiments provide numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the understanding of the prior art by those skilled in the art and the description of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention may also be used to implement the present invention.

[0077] Example 1 Design of LPA gene target gRNA

[0078] The target gene modified using the compositions and methods disclosed herein is the LPA gene (also known as AK38, APOA, and LP), which encodes apolipoprotein a [apo(a)]. The human LPA gene is located on human chromosome 6q25.3-q26 at position NC_000006.12 (160531482..160664275, complement). The LPA gene is present only in the genomes of humans and other primates.

[0079] The base editor used in this embodiment is CE-A3A in Example 1 of Patent 202010163058.3 1048-1063 (The amino acid sequence is shown in SEQ ID No. 75.) This editor can recognize the 20-nt protospacer sequence preceding the PAM site with the NGG sequence (NGG PAM) on DNA and edit the cytosine (C) within its editing window (approximately positions 3-11 on the protospacer sequence) to thymine (T), i.e., C>T. All protospacer sequences on the human LPA gene that can be introduced into a stop codon, disrupt the start codon, or disrupt the splice site by ceBE-A3A (or a BE variant containing a Cas nuclease that can use the NGG PAM) are recognized (for example, see Figures 4 and 5, SEQ ID NOs: 1-60).

[0080] Two adenosine base editors were used in this embodiment, including ABE and SaABE. Among them, ABE generally refers to an adenosine base editor whose DNA binding domain of the base editor protein is derived from SpCas9 or its variants, while SaABE refers to an adenosine base editor whose DNA binding domain of the base editor protein is derived from SaCas9 or its variants. The ABE used in this embodiment is a base editor named CE-ABE8e with an amino acid sequence shown in SEQ ID NO: 74. The gRNA carried by the CE-ABE8e editor can recognize a 20-nt original spacer sequence with NGG PAM on DNA and edit adenine (A) within its editing window (approximately positions 3-15 on the original spacer sequence) to guanine (G), that is, A>G. All original spacer sequences that can be destroyed by CE-ABE8e (or an ABE variant containing a Cas nuclease that can use NGG PAM) to destroy the start codon or splice site are recognized (for example, see Figures 4 and 5, SEQ ID NOs: 57-68).

[0081] The SaABE used in this embodiment is CE-SaABE8e-744 (whose amino acid sequence is shown in SEQ ID No. 76), disclosed in the existing patent 202310186267.3. The gRNA carried by CE-SaABE8e-744 can recognize a 22-nt protospacer sequence with an NNGRRT PAM on DNA and edit the adenine (A) within its editing window (approximately positions 3-16 on the protospacer sequence) to guanine (G), i.e., A>G. All protospacer sequences whose splice sites can be destroyed by CE-SaABE8e-744 (or SaABE variants containing Cas nucleases that can use NNGRRT PAM) are recognized (for example, see Figure 5, SEQ ID NOs: 69-71).

[0082] To perform base editing of the LPA target, approximately 100-nt guide RNAs (gRNAs) were synthesized that matched the protospacer sequences in Figures 4 and 5 and had a scaffold sequence (SEQ ID NO: 72 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU or SEQ ID NO: 73 GUUUUAGUACUCUGUAAUGAAAAUUACAGAAUCUACUAAAACAAGGCAAAAUGCCGUGUUUAUCUCGUCAACUUGUUGGCGAGAUUU) attached to their 3' ends. Each synthesized gRNA was specifically chemically modified to reduce nuclease degradation.

[0083] Example 2 In vitro base editing evaluation of target gRNA

[0084] To verify the ability of each gRNA to affect targeted base editing, three base editors CE-A3A were synthesized by in vitro transcription in the experiment. 1048-1063 , CE-ABE8e, CE-SaABE8e-744 mRNA, and the corresponding 71 sgRNAs (SG001-SG071) in Example 1 were co-delivered to the human liver cancer cell line HepG2 to evaluate the base editing efficiency. In order to deliver the base editing components, the synthesized gRNA and the mRNA of the corresponding base editor were co-encapsulated into lipid nanoparticles (Lipid Nanoparticle, LNP) in a weight ratio of 1: 1 to obtain a nucleic acid nanoliposome (mRNA / gRNA_LNP) solution with a concentration of 0.3 mg RNA / mL. The LNP used in this embodiment experiment comes from the LNP in application number 202310557830.3.

[0085] Human hepatoma cell line HepG2 was cultured in DMEM medium containing 10% FBS at a density of 3.0×10 cells per well. 5 Cells were seeded at a density of 100 μg / well in a 24-well plate (Thermo, Cat. No. 142485) and cultured at 5% CO2 and 37°C for 24 hours before transfection. Cells were ready for transfection when the confluence reached 80%. The cells were transfected with 3.5 μL of the prepared mRNA / gRNA-LNP at a concentration of 3.5 μL / well. The next morning, fresh culture medium was replaced. 45 hours after transfection, the cell pellet was collected by centrifugation, and DNA was extracted as a template for LPA gene identification. PCR was used to amplify an approximately 500-bp gene fragment in the target region, with the annealing temperature set at 58°C. The PCR products were Sanger sequenced using the corresponding upstream amplification primers, and the potential base editing within the gRNA-associated LPA gene protospacer region was analyzed using the EditR website (Kluesner M, et al. The CRISPR Journal 2018 1:3, 239-250.). The statistical data for the A>G or C>T editing efficiency of the target base at each target site are shown in Figures 4 and 5.

[0086] As shown in Figures 4 and 5, in the original spacer sequence, lowercase nucleotides (a, g, c and t) represent 2'-deoxyribonucleotides: adenine, guanine, cytosine and uracil, respectively; CBE represents a cytosine base editor, ABE represents an adenosine base editor, and SaABE represents an ABE with NNGRRT as the PAM sequence.

[0087] As can be seen from Figures 4 and 5, the LPA gene target base editing efficiency achieved by 71 gRNAs and their base editors at the target site is between 29% and 99%.

[0088] To evaluate the off-target editing events caused by target gRNA in cells, we selected 37 gRNAs with target editing efficiencies greater than 60% (as shown in Figure 6) for gRNA-dependent DNA off-target editing analysis. Candidate off-target sites were obtained using an online website, and the top three with the fewest mismatched bases were selected as candidate off-target sites. Using the DNA obtained after HepG2 editing with the corresponding gRNA as a template, a 500bp gene fragment near the candidate off-target site was amplified and analyzed by first-generation sequencing. As can be seen from Figure 6 , 13 of the gRNAs tested underwent off-target editing at the candidate off-target sites, while no off-target editing was detected for the other 24 gRNAs, namely SG001, SG004, SG007, SG008, SG013, SG021, SG027, SG037, SG038, SG040, SG045, SG047, SG049, SG052, SG054, SG056, SG057, SG058, SG063, SG066, SG067, SG068, SG069, and SG071.

[0089] Among the gRNAs with no detectable off-target effects, the three with the highest base editing efficiencies at the LPA gene target site were SG057, SG063, and SG067. These three gRNAs, guided by CE-ABE8e, achieved A>G editing at the LPA gene target site, with base editing efficiencies of 98%, 95%, and 99%, respectively. Base editing at all three targets disrupted the splice site of the LPA gene, resulting in aberrant transcripts and ultimately affecting protein translation.

[0090] Example 3 In vivo base editing of the LPA gene

[0091] Since the LPA gene is only present in the genomes of humans and ancient world monkeys (such as crab-eating macaques), rodents (such as mice and rats) lack the LPA gene and therefore do not produce apo(a) protein. To this end, human LPA transgenic mice (C57BL / 6JGpt-Tg(hLPA)17 / Gpt) were purchased from GemPharmatech as a model for evaluating in vivo base editing and apo(a) knockdown. At the same time, LNP was used as a delivery vehicle for the base editing system.

[0092] Following the method described in Example 1, a 0.3 mg / mL mRNA / gRNA-LNP solution was prepared, containing a 1:1 weight ratio of CE-ABE8e mRNA and LPA gene-targeting gRNAs (SG057, SG063, and SG067). Human LPA transgenic mice were administered LNPs at a total RNA dose of 3 mg / kg (3 mg per kg of mouse). Transgenic mice were randomly assigned to three experimental groups (3 mice per group) and a control group of mice. One week before tail vein injection, 100 μL of blood was collected from all transgenic mice and centrifuged at 2000 g for 10 minutes at 4°C. The upper plasma layer was collected as a pre-injection sample and frozen at -20°C. Mice were weighed at 6 weeks of age, and the six different LNP solutions were injected into the tail vein of the corresponding experimental group at a dose of 3 mg / kg (3 mg total RNA per kg). Control mice were injected with 200 μL of 1× PBS solution. Seven days after injection, mice were euthanized by carbon dioxide inhalation. 300 μL of blood was collected and centrifuged to extract the upper plasma sample for post-injection storage at -20°C. Whole liver tissue was also collected and minced. First, a genomic DNA extraction kit (Tiangen, Cat. No. DP304) was used according to the manufacturer's instructions to lyse the collected liver tissue and extract genomic DNA. Sanger sequencing was then used to assess base editing at each target site (see Figures 7 and 1).

[0093] As shown in Figures 7 and 1, the average base editing efficiency of the three groups of LNPs at their corresponding LPA targets ranged from 76.8% to 83.9%, among which the base editing efficiency guided by the gRNA (SG057) corresponding to LNP1 was the highest, with an average of 83.9% (N=3).

[0094] To select the most effective gRNA for therapeutic use, a key evaluation criterion is the magnitude of the reduction in apo(a) protein following base editing. Apo(a) protein ELISA was performed on plasma samples before and after injection using an ELISA kit specifically recognizing human LPA (Abcam, Catalog No. ab212165) according to the manufacturer's instructions. Based on the ELISA results, the pre- and post-injection apo(a) protein concentrations (Figure 8) and the percentage reduction in protein concentration after injection were calculated and evaluated (Figure 8 and Figure 2).

[0095] As shown in Figure 8, the three LNP reagents tested in this example all achieved high apo(a) protein knockout in transgenic mice by base editing. Among them, gRNAs SG057 and SG067 guided CE-ABE8e (corresponding to LNP1 and LNP3) to achieve complete knockout of apo(a) protein in vivo, that is, the plasma apo(a) level of some mice decreased by 100% after drug injection.

[0096] Example 4 gRNA-mediated genome-wide off-target editing

[0097] Another criterion to evaluate when selecting gRNAs for therapeutic use is the frequency of off-target editing across the genome. To evaluate off-target editing mediated by mRNA / gRNA LNPs, this study used whole-genome sequencing to identify off-target editing events mediated by LNPs in the human liver cancer cell line HepG2 at the genome-wide level.

[0098] Human hepatoma cell line HepG2 was cultured in DMEM medium containing 10% FBS at a rate of 1×10 cells per well. 6 The cells were seeded at a density of 100 cells / well in a 6-well plate (Thermo, Cat. No. 140685) and cultured at 5% CO2 and 37°C for 18-24 hours before transfection. Transfection was performed when the cell confluence was about 80%, and fresh culture medium was replaced two hours before transfection. The LNP1 solution (concentration of 0.3 mg / mL) prepared in the previous implementation case 3 was transfected into the cells at 10uL / well. The next morning, fresh culture medium was replaced. 45 hours after transfection, the cells were trypsinized and collected to extract genomic DNA. Subsequently, whole genome sequencing was performed on the genomic DNA samples of LNP1-transfected and non-transfected cells to analyze base editing events, and the results are shown in Figure 3.

[0099] As shown in Figure 3, in LNP-transfected cells, except for base editing at the location of the LPA protospacer sequence, no off-target editing was observed in the entire genome.

[0100] Example 5 Evaluation of the editing effect of other base editors at the target gRNA

[0101] This implementation case is intended to demonstrate how three commonly used base editors in the field can be used to edit 71 targets we designed to achieve LPA gene knockout, thereby demonstrating the universality of these targets.

[0102] In this example, we selected three widely used representative base editors, namely AncBE4max, ABEmax, and SaABEmax, for in vitro editing verification of the LPA gene target. Among them, AncBE4max is a cytosine base editor that can achieve C>T editing on the NGG PAM target, ABEmax is an adenosine base editor that can achieve A>G editing on the NGG PAM target, and SaABEmax is an adenosine base editor that can achieve A>G editing on the NNGRRTPAM target. The mRNA of the base editor was prepared by in vitro transcription and co-delivered with the sgRNA corresponding to the target in Example 1 to human HepG2 to evaluate the base editing efficiency (as shown in Figures 9, 10, and 11).

[0103] As shown in Figures 9, 10 and 11, in the original spacer sequence, lowercase nucleotides (a, g, c and t) represent 2'-deoxyribonucleotides: adenine, guanine, cytosine and uracil, respectively, and uppercase nucleotides represent the start codon (Star codon), splice site (Splice site) and codon on the exon (exon) of the LPA gene destroyed by base editing (which becomes a stop codon after editing), while bold letters (C or A) indicate the target editing base; N / A indicates that there is no data for off-target editing verification of the target site.

[0104] [Corrected 23.12.2024 according to Rule 91] In order to deliver the base editing components, the synthesized gRNA and the mRNA of the corresponding base editor were co-encapsulated into LNPs at a weight ratio of 1:1 to obtain a nucleic acid nanoliposome (mRNA / gRNA_LNP) solution with a concentration of 0.3 mg RNA / mL, and HepG2 cells were transfected at 3.5 uL / well. Cells were collected 48 hours after transfection, and genomic DNA was extracted for LPA gene identification. A fragment of approximately 500 bp in the region where the target site was located was amplified by PCR and Sanger sequencing was performed. The editing efficiency of the target base A>G or C>T at each target site was analyzed on the EditR website as shown in Figures 9 and 10. The results show that the base editing efficiency of SG001-SG060 combined with AncBE4max at the LPA gene target site is between 19% and 81%, the base editing efficiency of SG057-SG068 combined with ABEmax at the LPA gene target site is between 34% and 72%, and the base editing efficiency of SG069-SG071 combined with SaABEmax at the LPA gene target site is between 46% and 55%. It can be seen that the three base editors can achieve effective target base editing at the corresponding target sites, which shows that the 71 target sgRNAs provided in this application can also be combined with other commonly used base editors to achieve LPA gene knockout.

[0105] [Corrected 23 December 2024, in accordance with Rule 91] Furthermore, potential off-target editing sites for the 37 sgRNAs validated in Example 2 were also evaluated. Using the DNA obtained after HepG2 editing as a template, a 500-bp gene fragment near the potential off-target site was amplified. Next-generation sequencing was used to identify and analyze the off-target editing efficiency. The results are shown in Figures 9 and 10.

[0106] [Corrected 23.12.2024 according to Rule 91] The results show that even when different base editors were used, off-target editing occurred only in 13 gRNAs identified in Implementation Case 2, with an off-target editing efficiency between 16% and 64%, while no off-target editing was observed in the other 24 gRNAs tested (as shown in Figures 9 and 10).

[0107] The above examples are intended to illustrate the embodiments disclosed herein and are not to be construed as limiting the present invention. In addition, the various modifications listed herein and variations of the methods in the invention will be apparent to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications apparent to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention.

Claims

1. A gene editing composition, characterized in that, The gene editing composition comprises: 1) a base editor fusion protein, or a nucleic acid encoding the base editor fusion protein; 2) a guide RNA, or a nucleic acid encoding the guide RNA, wherein the guide RNA comprises a spacer sequence fragment and a scaffold sequence fragment, and the nucleic acid encoding the spacer sequence fragment comprises A) a nucleic acid molecule having a nucleotide sequence shown in any one or more of SEQ ID No. 1-60, and its base editor fusion protein is a cytosine base editor fusion protein; B) a nucleic acid molecule having a nucleotide sequence shown in any one or more of SEQ ID No. 57-71, and its base editor fusion protein is an adenine base editor fusion protein.

2. The gene editing composition according to claim 1, wherein The base editor fusion protein comprises a programmable DNA binding domain fragment and a deaminase domain fragment.

3. The gene editing composition according to claim 2, wherein The programmable DNA binding domain fragment is selected from the domain fragments of Cas proteins of the CRISPR / Cas system.

4. The gene editing composition according to claim 3, wherein The programmable DNA binding domain fragment is a domain fragment of Cas9 protein and its variants.

5. The gene editing composition according to claim 2, wherein The deaminase domain fragment is selected from a cytosine deaminase fragment or an adenine deaminase fragment.

6. The gene editing composition according to claim 5, wherein The cytosine deaminase is selected from one or more of APOBEC1, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3E, APOBEC3F, APOBEC3G, APOBEC3H, AID or pmCDA1; or, the adenine deaminase is selected from ecTadA or its variants.

7. The gene editing composition according to claim 1, wherein The base editor fusion protein is selected from one or more of CE-A3A1048-1063, CE-SaABE8e-744 or a base editor fusion protein having an amino acid sequence shown in SEQ ID No.

74.

8. The gene editing composition according to claim 1, wherein The scaffold sequence fragment comprises a nucleic acid molecule having a nucleotide sequence shown in any one of SEQ ID No. 72-73.

9. The gene editing composition according to claim 1, wherein The gene editing composition can disrupt the start codon of the LPA gene, or induce the generation of a premature stop codon in the LPA gene, or disrupt the alternative splicing site of the LPA gene.

10. An isolated nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the guide RNA, the base editor fusion protein in the gene editing composition according to any one of claims 1-9, or simultaneously encodes the guide RNA and the base editor fusion protein in the gene editing composition according to any one of claims 1-9.

11. An expression vector, characterized in that, The expression vector comprises the nucleic acid molecule according to claim 10 and a plasmid backbone.

12. A cell, characterized in that, The cell contains the nucleic acid molecule according to claim 10 or the expression vector according to claim 11.

13. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises a delivery vector, and further comprises the gene editing composition according to any one of claims 1-9, the nucleic acid molecule according to claim 10 or the expression vector according to claim 11.

14. The pharmaceutical composition according to claim 13, wherein The delivery vector is selected from one or more of polymeric nanoparticles, liposomes, lipid nanoparticles, viroid-like particles, viral vectors or extracellular vesicles.

15. Use of the gene editing composition according to any one of claims 1-9, the nucleic acid molecule according to claim 10, the expression vector according to claim 11, or the pharmaceutical composition according to any one of claims 13-14 in the preparation of any of the following products: 1) For the preparation of LPA gene-modified cells and / or animals; 2) For the preparation of cells and / or animals with apolipoprotein(a) and lipoprotein(a) knocked out or knocked down; 3) For the preparation of a drug for treating cardiovascular diseases.

16. The use according to claim 15, characterized in that, The cardiovascular diseases are selected from one or more of hypercholesterolemia, coronary heart disease, hypertension, myocardial infarction, stroke, peripheral vascular disease, or aortic atherosclerosis.

Citation Information

Patent Citations

  • Compositions and methods for delivering a nucleobase editing system

    CN112969790A

  • Compositions and methods for treating glycogen storage disease type 1a

    CN114026237A

  • Adenosine deaminase base editors and methods of using same to modify a nucleobase in a target sequence

    CN114072496A

  • Base editing system and use method thereof

    CN114945670A

  • Gene editing method and application

    CN115820728A