Monoclonal antibody and use thereof

Abstract

Disclosed in the present invention are an antibody targeting BTNL2 or an antigen-binding fragment thereof and the use thereof. The antibody targeting BTNL2 or the antigen-binding fragment thereof specifically binds to BTNL2 (especially the IgC-like domain of the extracellular domain thereof). In addition, the present invention also relates to a nucleic acid or host cell containing such antibodies or the fragments thereof, and a method or use for the treatment and diagnosis by means of using the antibodies and fragments, in particular a method or use for restoring the function or activity of T cells, increasing immune responses and / or treating tumors.

Description

A monoclonal antibody and its application

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application is based on the Chinese patent application with application number 202410075900.6 and application date January 18, 2024, and claims the priority of the Chinese patent application. The entire content of the Chinese patent application is hereby introduced into this application as a reference. Technical Field

[0003] The present invention belongs to the field of antibodies, and specifically relates to an antibody or fragment thereof that specifically binds to BTNL2 (e.g., human BTNL2, particularly specifically binds to the extracellular domain of BTNL2, such as the extracellular domain of human BTNL2). In addition, the present invention also relates to nucleic acids or host cells comprising such antibodies or fragments thereof, as well as therapeutic and diagnostic methods or uses using these antibodies and fragments, in particular methods and uses for restoring T cell function or activity, increasing immune response, and / or treating tumors. Background Art

[0004] "BTNL2" stands for butyrophilin-like 2. Butyrophilin is a newly discovered T cell co-inhibitory / co-stimulatory molecule and a member of the immunoglobulin superfamily. It is structurally related to the B7 family and appears to have similar immunomodulatory functions. In humans, the butyrophilin family includes seven butyrophilins, five butyrophilin-like proteins, and a SKINT-like protein. The structural and functional similarities between butyrophilin and B7 family members suggest that it should be studied as a potential target for cancer immunotherapy.

[0005] Compared to other butryophilin family members, BTNL2 has a molecular structure more similar to the B7 family, with two extracellular IgV-like domains and two IgC-like domains, and lacks the B30.2 intracellular domain. Human and mouse BTNL2 are encoded by eight exons and share 64% sequence and structural similarity, suggesting that human and mouse BTNL2 may function through similar mechanisms (Nguyen, T. et al. (2006) BTNL2, a butryophilin-like molecule that functions to inhibit T cell activation. J. Immunol. 176:7354). The native sequence of BTNL2 can be found, for example, in the UniProt database, with references to Q9UIR0 (human BTNL2) and O70355 (mouse BTNL2), or in the GenBank database, with references to NM_001304561 and NP_001291490 (human BTNL2).

[0006] So far, relatively high BTNL2 mRNA expression levels have been found in at least the immune system, intestine, lung, spleen, stomach, and thymus of mice (Arnett HA et al., BTNL2, a Butyrophilin / B7-Like Molecule, Is a Negative Costimulatory Molecule Modulated in Intestinal Inflammation [J]. Journal of Immunology, 2007, 178(3): 1523-1533). BTNL2-Fc has also been found to inhibit CD4 +The proliferation and cytokine production in T cells, and regulates the differentiation of T cells into regulatory T cells Tregs (Cui C et al. In vivo administration of recombinant BTNL2-Fc fusion protein ameliorates graft-versus-host disease in mice. Cell Immunol. 2019 Jan; 335: 22-29.). In addition, BTNL2 genetic variation and truncated splicing variation are associated with autoimmune and inflammatory diseases. For example, changes in BTNL2 expression are known to be associated with sarcoidosis, rheumatoid arthritis, Kawasaki disease, inflammatory bowel disease, osteoarthritis, inclusion body myositis and lupus (Tian X et al. BTNL2-Ig Protein Attenuates Type 1 Diabetes in Non-Obese Diabetic (NOD) Mice [J]. Advanced Healthcare Materials, 2019, 8 (9): e1800987-e1800987). Other studies have found that BTNL2 is expressed in the tumor microenvironment and inhibits T cell activation and induces regulatory T cells. In addition, BTNL2 gene mutations are associated with a higher incidence of cancer, such as certain lung adenocarcinomas, marginal zone non-Hodgkin's B-cell lymphomas, prostate cancer, and uveal melanoma (M2 macrophages). In addition, high BTNL2 expression also shows a negative correlation with the patient's overall survival rate (Du, Y. et al. Cancer cell-expressed BTNL2 facilitates tumour immune escape via engagement with IL-17A-producing γδT cells. Nat Commun 13, 231 (2022).).

[0007] Multiple clues suggest that BTNL2 may be a novel target for the treatment of diseases associated with immune disorders. Attempts have been made in the field to use antibodies targeting murine BTNL2, alone or in combination, to treat, for example, murine tumors. However, there is still a need for new BTNL2 antibodies targeting this promising new target, particularly anti-human BTNL2 antibodies that are effective in treating human tumors. Summary of the Invention

[0008] The present invention discloses an antibody or antigen-binding fragment thereof targeting BTNL2 (such as human BTNL2) and applications thereof, in particular an antibody or antigen-binding fragment thereof that specifically binds to the extracellular domain of BTNL2 (such as the extracellular domain of human BTNL2).

[0009] The present invention therefore provides novel antibodies that bind to BTNL2 (eg, human BTNL2), and antigen-binding fragments thereof.

[0010] In some embodiments, the anti-BTNL2 antibodies or antigen-binding fragments thereof of the present invention specifically bind to the extracellular domain of human BTNL2. In some embodiments, the anti-BTNL2 antibodies or antigen-binding fragments thereof of the present invention specifically bind to the IgC-like domain of human BTNL2. In some embodiments, the BTNL2 antibodies or antigen-binding fragments thereof of the present invention specifically bind to amino acids 384-399 of BTNL2, such as the amino acid sequence set forth in SEQ ID NO:34.

[0011] In some embodiments, the anti-BTNL2 antibodies of the invention have one or more or all of the following properties:

[0012] (1) Binds to human BTNL2 with high affinity;

[0013] (2) binding to cells expressing human BTNL2;

[0014] (3) inhibiting the related activities of BTNL2;

[0015] (4) neutralize BTNL2's inhibition of T cell activation;

[0016] (5) Inhibit tumor growth, preferably without affecting body weight.

[0017] In some embodiments, the present invention provides an antibody or antigen-binding fragment thereof that binds to BTNL2, comprising three heavy chain variable region CDRs (HCDRs) of the heavy chain variable region as shown in SEQ ID NO: 1, 16, 20, 24 or 28, and / or three light chain CDRs (LCDRs) of the light chain variable region as shown in SEQ ID NO: 2, 17, 21, 25 or 29.

[0018] In some embodiments, the present invention provides nucleic acids encoding the antibodies or fragments thereof of the present invention, vectors comprising the nucleic acids, and host cells comprising the vectors.

[0019] In some embodiments, the present invention provides methods of making an antibody or fragment thereof of the present invention.

[0020] In some embodiments, the present invention provides immunoconjugates, pharmaceutical compositions and combination products comprising the antibodies of the present invention or fragments thereof.

[0021] The present invention also provides methods for preventing or treating BTNL2-related diseases, such as tumors or immune system diseases (such as autoimmune diseases or inflammation), in a subject using the antibodies of the present invention.

[0022] The present invention also relates to methods for detecting BTNL2 in a sample. In some embodiments, the present invention provides a kit, such as a detection kit, comprising the antibody or fragment thereof of the present invention.

[0023] In some embodiments, the present invention relates to the following embodiments:

[0024] 1. An antibody or antigen-binding fragment thereof that binds to human BTNL2, the antibody comprising

[0025] (i) three complementarity determining regions HCDR1, HCDR2, and HCDR3 contained in VH as shown in SEQ ID NO: 1, and three complementarity determining regions LCDR1, LCDR2, and LCDR3 contained in VL as shown in SEQ ID NO: 2;

[0026] (ii) three complementarity determining regions HCDR1, HCDR2, and HCDR3 contained in VH as shown in SEQ ID NO: 16, and three complementarity determining regions LCDR1, LCDR2, and LCDR3 contained in VL as shown in SEQ ID NO: 17;

[0027] (iii) three complementarity determining regions HCDR1, HCDR2, and HCDR3 contained in VH as shown in SEQ ID NO: 20, and three complementarity determining regions LCDR1, LCDR2, and LCDR3 contained in VL as shown in SEQ ID NO: 21;

[0028] (iv) the three complementarity determining regions HCDR1, HCDR2 and HCDR3 contained in the VH as shown in SEQ ID NO: 24, and the three complementarity determining regions LCDR1, LCDR2 and LCDR3 contained in the VL as shown in SEQ ID NO: 25; or

[0029] (v) three complementarity determining regions HCDR1, HCDR2, and HCDR3 contained in VH as shown in SEQ ID NO: 28, and three complementarity determining regions LCDR1, LCDR2, and LCDR3 contained in VL as shown in SEQ ID NO: 29;

[0030] Optionally, the HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 and LCDR3 use Kabat numbering.

[0031] 2. An antibody or antigen-binding fragment thereof that binds to BTNL2, the antibody comprising three complementarity determining regions (HCDRs) of a heavy chain variable region and three complementarity determining regions (LCDRs) of a light chain variable region, wherein HCDR1 comprises or consists of the amino acid sequence set forth in SEQ ID NO: 3, HCDR2 comprises or consists of the amino acid sequence set forth in SEQ ID NO: 4, HCDR3 comprises or consists of the amino acid sequence set forth in SEQ ID NO: 5, LCDR1 comprises or consists of the amino acid sequence set forth in SEQ ID NO: 6, LCDR2 comprises or consists of the amino acid sequence set forth in SEQ ID NO: 7, and LCDR3 comprises or consists of the amino acid sequence set forth in SEQ ID NO: 8.

[0032] 3. An antibody or antigen-binding fragment thereof that binds to BTNL2 according to embodiment 1 or 2, wherein the antibody comprises a heavy chain variable region, wherein the heavy chain variable region comprises, or consists of, an amino acid sequence that is at least 90% identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 1, 16, 20, 24, or 28; or comprises, or consists of an amino acid sequence selected from the group consisting of SEQ ID NO: 1, 16, 20, 24, or 28.

[0033] 4. An antibody or antigen-binding fragment thereof that binds to BTNL2 according to embodiment 1 or 2, wherein the antibody comprises a light chain variable region, wherein the light chain variable region comprises or consists of an amino acid sequence that is at least 90% identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 2, 17, 21, 25, or 29; or comprises or consists of an amino acid sequence selected from the group consisting of SEQ ID NO: 2, 17, 21, 25, or 29.

[0034] 5. The antibody or antigen-binding fragment thereof that binds to BTNL2 according to embodiment 1 or 2, wherein the antibody comprises the following heavy chain variable region VH and light chain variable region VL:

[0035] (i) a VH comprising, or consisting of, the amino acid sequence of SEQ ID NO: 1, or an amino acid sequence that is at least 90% identical thereto, and a VL comprising, or consisting of, the amino acid sequence of SEQ ID NO: 2, or an amino acid sequence that is at least 90% identical thereto;

[0036] (ii) a VH comprising, or consisting of, the amino acid sequence of SEQ ID NO: 16, or an amino acid sequence that is at least 90% identical thereto, and a VL comprising, or consisting of, the amino acid sequence of SEQ ID NO: 17, or an amino acid sequence that is at least 90% identical thereto;

[0037] (iii) a VH comprising, or consisting of, the amino acid sequence of SEQ ID NO: 20, or an amino acid sequence that is at least 90% identical thereto, and a VL comprising, or consisting of, the amino acid sequence of SEQ ID NO: 21, or an amino acid sequence that is at least 90% identical thereto;

[0038] (iv) a VH comprising, or consisting of, the amino acid sequence of SEQ ID NO: 24, or an amino acid sequence that is at least 90% identical thereto, and a VL comprising, or consisting of, the amino acid sequence of SEQ ID NO: 25, or an amino acid sequence that is at least 90% identical thereto; or

[0039] (v) a VH comprising, or consisting of, the amino acid sequence of SEQ ID NO: 28, or an amino acid sequence that is at least 90% identical thereto, and a VL comprising, or consisting of, the amino acid sequence of SEQ ID NO: 29, or an amino acid sequence that is at least 90% identical thereto.

[0040] 6. The antibody or antigen-binding fragment thereof that binds to BTNL2 according to any one of embodiments 1-5, further comprising a heavy chain constant region, for example, the antibody heavy chain constant region is the heavy chain constant region of IgG1, IgG2, IgG3 or IgG4, preferably the heavy chain constant region of human IgG1, IgG2, IgG3 or IgG4.

[0041] 7. The antibody or antigen-binding fragment thereof according to claim 6, wherein the heavy chain constant region comprises

[0042] (i) comprises or consists of an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to an amino acid sequence selected from SEQ ID NO: 11; or

[0043] (ii) comprises or consists of an amino acid sequence selected from SEQ ID NO: 11.

[0044] 8. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 7, comprising a light chain constant region, for example, the light chain constant region is a lambda or kappa light chain constant region, preferably a human lambda or kappa light chain constant region.

[0045] 9. The antibody or antigen-binding fragment thereof of claim 8, wherein the light chain constant region

[0046] (i) comprises or consists of an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO: 12; or

[0047] (ii) comprising or consisting of the amino acid sequence of SEQ ID NO: 12.

[0048] 10. The antibody or antigen-binding fragment thereof that binds to BTNL2 according to any one of embodiments 1-9, wherein the antibody comprises a heavy chain,

[0049] (i) comprises or consists of an amino acid sequence that is at least 85% identical to an amino acid sequence selected from SEQ ID NO: 9, 18, 22, 26 or 30; or

[0050] (ii) comprises or consists of an amino acid sequence selected from SEQ ID NO: 9, 18, 22, 26 or 30.

[0051] 11. The antibody or antigen-binding fragment thereof that binds to BTNL2 according to any one of embodiments 1-10, wherein the antibody comprises a light chain,

[0052] (i) comprises or consists of an amino acid sequence that is at least 85% identical to an amino acid sequence selected from SEQ ID NO: 10, 19, 23, 27 or 31; or

[0053] (ii) comprises or consists of an amino acid sequence selected from SEQ ID NO: 10, 19, 23, 27 or 31.

[0054] 12. The antibody or antigen-binding fragment thereof that binds to BTNL2 as described in any one of embodiments 1-11, wherein the antibody comprises a heavy chain and a light chain, wherein

[0055] (i) the heavy chain comprises or consists of the amino acid sequence of SEQ ID NO: 9; and the light chain comprises or consists of the amino acid sequence of SEQ ID NO: 10;

[0056] (ii) the heavy chain comprises or consists of the amino acid sequence of SEQ ID NO: 18; and the light chain comprises or consists of the amino acid sequence of SEQ ID NO: 19;

[0057] (iii) the heavy chain comprises or consists of the amino acid sequence of SEQ ID NO: 22; and the light chain comprises or consists of the amino acid sequence of SEQ ID NO: 23;

[0058] (iv) the heavy chain comprises or consists of the amino acid sequence of SEQ ID NO: 26; and the light chain comprises or consists of the amino acid sequence of SEQ ID NO: 27; or

[0059] (v) the heavy chain comprises or consists of the amino acid sequence of SEQ ID NO: 30; and the light chain comprises or consists of the amino acid sequence of SEQ ID NO: 31.

[0060] 13. The antibody or antigen-binding fragment thereof that binds to BTNL2 according to any one of embodiments 1-12, which has one or more of the following characteristics:

[0061] (1) Binds to human BTNL2 with high affinity;

[0062] (2) binding to cells expressing human BTNL2;

[0063] (3) inhibiting the related activities of BTNL2;

[0064] (4) neutralize BTNL2's inhibition of T cell activation;

[0065] (5) inhibit tumor growth;

[0066] (6) showing the same or similar binding affinity and / or specificity for BTNL2 as any of the antibodies listed in Embodiment 12;

[0067] (7) inhibiting the binding of any antibody listed in Embodiment 12 to BTNL2;

[0068] (8) binding to the same or overlapping epitope as any of the antibodies described in embodiment 12;

[0069] (9) competing with any of the antibodies described in Embodiment 12 for binding to BTNL2;

[0070] (10) having one or more biological properties of any antibody molecule listed in embodiment 12;

[0071] (11) Specifically binds to amino acids 384-399 of human BTNL2.

[0072] 14. The antibody or antigen-binding fragment thereof of embodiment 13, wherein:

[0073] (1) The antibody has the following equilibrium dissociation constant K D Binds to human BTNL2, the K D less than 10 nM, 9 nM, 8.5 nM, 8 nM, 7.5 nM, 7 nM, 6.9 nM or 6.8 nM;

[0074] (2) The relevant activity of inhibiting BTNL2 is to neutralize its inhibition of T cell activation (e.g., increased cytokine expression);

[0075] (3) Inhibition of one or more activities of BTNL2 results in one or more of the following: CD4 + T or CD8 + Increased T lymphocyte proliferation; increased cytokine expression and secretion; increased expression of activation antigens; increased tumor-infiltrating lymphocytes; or decreased immune evasion of cancer cells;

[0076] (4) inhibit tumor growth without affecting body weight; or

[0077] (5) Amino acids 384-399 of human BTNL2 are the amino acid sequence shown in SEQ ID NO: 34.

[0078] 15. The antibody or antigen-binding fragment thereof according to embodiment 14, wherein the cytokine is selected from one or more of interleukins (e.g., interleukin-2), interferon-γ, and tumor necrosis factor (e.g., tumor necrosis factor α).

[0079] 16. The antibody or antigen-binding fragment thereof of any one of embodiments 1-15, wherein the antibody is a monoclonal antibody.

[0080] 17. The antibody or antigen-binding fragment thereof according to any one of embodiments 1-16, wherein the antibody is a humanized antibody or a chimeric antibody.

[0081] 18. The antibody or antigen-binding fragment thereof of any one of embodiments 1-17, wherein the antigen-binding fragment is an antibody fragment selected from the group consisting of: Fab, Fab', Fab'-SH, Fv, a single-chain antibody such as scFv, a (Fab')2 fragment, a single-domain antibody, a diabody, or a linear antibody.

[0082] 19. The antibody or antigen-binding fragment thereof of embodiment 18, wherein the single-chain antibody is scFv.

[0083] 20. The antibody or antigen-binding fragment thereof according to any one of embodiments 1-19, wherein the antibody is a bispecific antibody or a multispecific antibody.

[0084] 21. An anti-BTNL2 antibody or antigen-binding fragment thereof that specifically binds to a BTNL2 epitope, wherein the BTNL2 epitope comprises amino acids 384-399 of BTNL2, wherein the amino acid numbering refers to the numbering of the human BTNL2 protein, for example, the numbering of the amino acid sequence set forth in SEQ ID NO: 15.

[0085] 22. The anti-BTNL2 antibody or antigen-binding fragment thereof according to claim 21, wherein the BTNL2 epitope comprises the amino acid sequence shown in SEQ ID NO: 34 and is located in the IgC domain of BTNL2, or the BTNL2 epitope consists of the amino acid sequence shown in SEQ ID NO: 34.

[0086] 23. An isolated nucleic acid encoding the anti-BTNL2 antibody or antigen-binding fragment thereof according to any one of embodiments 1 to 22.

[0087] 24. An expression vector comprising the nucleic acid of embodiment 23.

[0088] 25. The expression vector of embodiment 24, wherein the expression vector is a pcDNA vector, such as a pcDNA3.1 vector, or more preferably a pcDNA TM 3.4TOPO carrier.

[0089] 26. A host cell comprising the nucleic acid of embodiment 23 or the expression vector of embodiment 24 or 25.

[0090] 27. The host cell of embodiment 26, wherein the host cell is prokaryotic or eukaryotic.

[0091] 28. The host cell of embodiment 27, wherein the host cell is selected from Escherichia coli cells, yeast cells, mammalian cells or other cells suitable for preparing antibodies or antigen-binding fragments thereof.

[0092] 29. The host cell of embodiment 27, wherein the host cell is a 293 cell or a CHO cell.

[0093] 30. A method for preparing an anti-BTNL2 antibody or an antigen-binding fragment thereof, the method comprising culturing the host cell of any one of embodiments 26-29 under conditions suitable for expression of a nucleic acid encoding the anti-BTNL2 antibody or antigen-binding fragment thereof of any one of embodiments 1 to 22, optionally isolating the antibody or antigen-binding fragment thereof, and optionally the method further comprising recovering the anti-BTNL2 antibody or antigen-binding fragment thereof from the host cell.

[0094] 31. An immunoconjugate comprising the antibody or antigen-binding fragment thereof according to any one of embodiments 1 to 22 and other substances.

[0095] 32. The immunoconjugate of embodiment 31, wherein the other substance is a cytotoxic agent.

[0096] 33. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof according to any one of embodiments 1 to 22 or the immunoconjugate according to embodiment 31 or 32, and optionally a pharmaceutically acceptable excipient.

[0097] 34. A pharmaceutical combination comprising the antibody or antigen-binding fragment thereof according to any one of embodiments 1 to 22 or the immunoconjugate according to embodiment 31 or 32, and other therapeutic agents, and optionally pharmaceutically acceptable excipients.

[0098] 35. The pharmaceutical combination product of embodiment 34, wherein the other therapeutic agent is selected from a chemotherapeutic agent, other antibodies, a cytotoxic agent, a vaccine, a small molecule drug, an anti-infective agent or an immunomodulator.

[0099] 36. The drug combination product of embodiment 35, wherein the immunomodulator is an activator of a co-stimulatory molecule or an inhibitor of an immune checkpoint molecule.

[0100] 37. Use of an effective amount of an anti-BTNL2 antibody or antigen-binding fragment thereof according to any one of embodiments 1 to 22, or an immunoconjugate according to embodiment 31 or 32, or a pharmaceutical composition according to embodiment 33, or a pharmaceutical combination product according to any one of embodiments 34-36 in the preparation of a medicament for preventing or treating a tumor in a subject or individual.

[0101] 38. The use of embodiment 37, wherein the tumor is a solid tumor, such as a BTNL2-positive tumor.

[0102] 39. The use according to embodiment 37 or 38, wherein the tumor is cancer.

[0103] 40. The use of any one of embodiments 37-39, wherein the tumor is selected from melanoma, lung cancer, breast cancer, lymphoma, head / neck squamous cell carcinoma, liver cancer, renal cell carcinoma, bile duct cancer, gastric cancer, esophageal cancer, intestinal cancer, urinary tract cancer, bladder cancer, pancreatic cancer, neuroendocrine tumor, ovarian cancer, endometrial cancer, cervical cancer or prostate cancer.

[0104] 41. The use of any one of embodiments 37-40, further comprising administering one or more other therapies in combination to the subject.

[0105] 42. The use of embodiment 41, wherein the therapy comprises a treatment modality and / or other therapeutic agents.

[0106] 43. The use according to embodiment 42, wherein the other therapeutic agent is selected from a chemotherapeutic agent, other antibodies, cytotoxic agents, vaccines, small molecule drugs or immunomodulators, and / or the treatment modality comprises surgical treatment and / or radiotherapy.

[0107] 44. The use described in embodiment 43, wherein the immunomodulator is an activator of a co-stimulatory molecule or an inhibitor of an immune checkpoint molecule.

[0108] 45. A method for detecting BTNL2 in a sample, the method comprising

[0109] (a) contacting a sample with any anti-BTNL2 antibody or antigen-binding fragment thereof of any one of embodiments 1 to 22; and

[0110] (b) detecting formation of a complex between the anti-BTNL2 antibody or antigen-binding fragment thereof and BTNL2; optionally, the anti-BTNL2 antibody is detectably labeled.

[0111] 46. ​​A kit comprising the antibody or antigen-binding fragment thereof according to any one of embodiments 1 to 22.

[0112] 47. Use of the antibody or antigen-binding fragment thereof according to any one of embodiments 1 to 22 for the preparation of a kit for selecting a subject suitable for treatment with a BTNL2 antagonist or a pharmaceutical composition or pharmaceutical combination product comprising the same.

[0113] 48. The use according to embodiment 47, wherein the selection comprises

[0114] (1) detecting the level of BTNL2 in a biological sample from a subject using an anti-BTNL2 antibody or an antigen-binding fragment thereof; and

[0115] (2) The presence of BTNL2 protein indicates that the subject is likely to respond to a BTNL2 antagonist or a pharmaceutical composition or pharmaceutical combination product comprising the same.

[0116] 49. The use according to embodiment 47, wherein

[0117] (1) detecting the level of BTNL2 in a reference sample and a biological sample from a subject using an anti-BTNL2 antibody or an antigen-binding fragment thereof, or a composition or kit comprising the anti-BTNL2 antibody or an antigen-binding fragment thereof; and

[0118] (2) an upregulated expression level of BTNL2 protein compared to a reference sample indicates that the subject is more likely to respond to a BTNL2 antagonist or a pharmaceutical composition or pharmaceutical combination product comprising the same,

[0119] The reference sample is a control sample obtained from a healthy or non-diseased individual, or a healthy or non-diseased sample obtained from the subject.

[0120] 50. The use of embodiment 48 or 49, wherein the BTNL2 antagonist is selected from the antibody or antigen-binding fragment thereof of any one of embodiments 1 to 22 or the immunoconjugate of embodiment 31 or 32.

[0121] 51. The use of any one of embodiments 47-49, wherein the subject has a tumor.

[0122] 52. The use of any one of embodiments 51, wherein the tumor is a solid tumor.

[0123] 53. The use according to embodiment 51 or 52, wherein the tumor is cancer.

[0124] 54. The use of any one of embodiments 51-53, wherein the tumor is selected from melanoma, lung cancer, breast cancer, lymphoma, head / neck squamous cell carcinoma, liver cancer, renal cell carcinoma, bile duct cancer, gastric cancer, esophageal cancer, intestinal cancer, urinary tract cancer, bladder cancer, pancreatic cancer, neuroendocrine tumor, ovarian cancer, endometrial cancer, cervical cancer or prostate cancer.

[0125] 55. The use of any one of embodiments 48-54, wherein the biological sample from the subject is a sample or tumor cell from tumor tissue, and / or the reference sample is a sample or normal cell of normal tissue of the same tissue type from a healthy individual, or an adjacent normal tissue or adjacent non-cancerous or non-tumor tissue or adjacent cells or non-tumor cells of the patient.

[0126] 56. The kit of embodiment 46 or the use of any one of embodiments 47-55, wherein the antibody or antigen-binding fragment thereof is labeled.

[0127] 57. The use described in embodiment 56, wherein the label is selected from a fluorescent label, a chromophore label, an electron-dense label, a chemiluminescent label, a radioactive label, an enzyme or a ligand.

[0128] The present invention is further illustrated in the following drawings and specific embodiments. However, these drawings and specific embodiments should not be considered to limit the scope of the present invention, and changes that are readily apparent to those skilled in the art will be included within the spirit of the present invention and the protection scope of the appended claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0129] Figure 1 shows the neutralizing ability of anti-BTNL2 humanized antibodies detected using human PBMC cells under T cell activation conditions (anti-CD3, anti-CD28 antibodies). The leftmost horizontal line filled column shows the amount of IL-2 secreted by activated T cells; the unfilled and diagonal line filled columns respectively show the amount of IL-2 secreted by T cells after adding 5μg / mL human hBTNL2-ECD-His protein to the activated T cells and adding gradient concentrations of 0μg / mL, 5μg / mL, 10μg / mL, 15μg / mL, and 20μg / mL of humanized anti-human BTNL2 antibody 5B08-19-1-4. The results show that the anti-BTNL2 antibody significantly reversed the inhibitory effect of human BTNL2-ECD protein on T cells and had a good dose-dependent effect.

[0130] Figure 2 demonstrates the tumor inhibition ability of humanized anti-BTNL2 antibodies in mice. Figure 2a shows a line graph of the mean tumor volume over time in each group of mice after treatment with the three different antibody treatments indicated in the figure legend. Figures 2b-d detail the changes in tumor volume over time for five mice in each group. Figure 2e summarizes the tumor weights after sacrifice. Humanized anti-BTNL2 antibodies significantly inhibited A375 tumor growth in mice compared to an unrelated control antibody.

[0131] Figure 3 shows the effect of anti-BTNL2 humanized antibody treatment on immune cell infiltration in mouse tumors in the same experiment. Figures 3a, 3b, and 3c summarize the CD45 expression in tumor tissues of all mice in the hu IgG group and the 30 mg / kg anti-BTNL2 antibody group, respectively. + Total lymphocytes, CD8 + Cytotoxic T lymphocytes and CD4 + Percentage of helper T lymphocytes: Anti-BTNL2 antibodies significantly increased the number of immune cells infiltrating tumors, such as CD45-positive total lymphocytes and CD8-positive cytotoxic T lymphocytes, compared to control antibodies.

[0132] Figure 4 shows a line graph of the average body weight of each group of mice over time after treatment with the three different antibody treatments indicated in the legend. No significant decrease in body weight was observed in the anti-BTNL2 antibody and control antibody groups, indicating that the test antibodies were well tolerated.

[0133] Figure 5 shows the epitope and specificity of the anti-BTNL2 humanized antibody binding to the human BTNL2 antigen protein. Figure 5a shows the antibody-antigen binding epitope analyzed by hydrogen-deuterium exchange mass spectrometry. Figure 5b shows the epitope specificity of the antigen-antibody binding in an epitope validation ELISA. The mutant protein Fc-hBTNL2-δ(384-399), which lacks the key epitope, was unable to bind to the anti-BTNL2 humanized antibody 5B08-19-1-4.

[0134] FIG6 shows the effect of humanized anti-human BTNL2 antibody 5B08-19-1-4 on T lymphocyte killing of human lung cancer cell line H460 detected by FACS experiment. The bar graph in the figure shows the proportion of apoptotic cells detected at different tumor cell:T cell ratios;

[0135] FIG7 shows the effect of humanized anti-human BTNL2 antibody 5B08-19-1-4 on T lymphocyte killing of human liver cancer cell line HepG2 detected by FACS experiment. The bar graph in the figure shows the proportion of apoptotic cells detected at different tumor cell:T cell ratios.

[0136] Detailed Description of the Invention

[0137] Before describing the present invention in detail below, it should be understood that the present invention is not limited to the specific methodology, protocol and reagents described herein, as these may vary. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to limit the scope of the present invention, which will only be limited by the appended claims.

[0138] I. Definition

[0139] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0140] To interpret this specification, the following definitions will apply and, wherever appropriate, terms used in the singular may also include the plural, and vice versa.

[0141] The term "about" when used in conjunction with a numerical value is meant to encompass the numerical value within a range having a lower limit that is 5% less than the specified numerical value and an upper limit that is 5% greater than the specified numerical value.

[0142] As used herein, the term "and / or" means any one of the alternatives or two or more of the alternatives.

[0143] As used herein, the terms "comprising" or "including" are intended to include the recited elements, integers, or steps, but do not exclude any other elements, integers, or steps. In this document, when the terms "comprising" or "including" are used, unless otherwise indicated, combinations of the recited elements, integers, or steps are also encompassed. For example, when reference is made to an antibody variable region "comprising" a specific sequence, it is intended to encompass an antibody variable region consisting of that specific sequence.

[0144] The term "BTNL2 (butyrophilin-like protein 2)" is also known as butyrophilin-like protein-2 or BTL-II. In one embodiment, the BTNL2 of the present invention is from human (UNIPROT accession number Q9UIR0) or mouse (e.g., mouse, UNIPROT accession number O70355). In one embodiment, the human BTNL2 protein of the present invention comprises the amino acid sequence shown in SEQ ID NO: 15, or an amino acid sequence having at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity thereto, or consists of said sequence. In one embodiment, the human BTNL2 protein of the present invention comprises its extracellular domain. In some embodiments, the extracellular domain of the human BTNL2 protein of the present invention is from lysine 24 to serine 453 of the human BTNL2 protein. In some embodiments, the extracellular domain of the human BTNL2 protein of the present invention comprises the amino acid sequence shown in SEQ ID NO: 14, or an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical thereto, or consists of said sequence.

[0145] As used herein, the terms "anti-BTNL2 antibody," "anti-BTNL2," "BTNL2 antibody," or "antibody that binds to BTNL2" refer to an antibody that is capable of binding to (e.g., human) BTNL2 or a fragment thereof with sufficient affinity. In one embodiment, the anti-BTNL2 antibody binds to the extracellular domain of BTNL2.

[0146] The term "antibody fragment" includes a portion of an intact antibody. In a preferred embodiment, the antibody fragment is an antigen-binding fragment.

[0147] The term "antigen-binding fragment" is a portion or segment of an intact or complete antibody that has fewer amino acid residues than an intact or complete antibody and that is capable of binding to an antigen or competing with the intact antibody (i.e., the intact antibody from which the antigen-binding fragment is derived) for antigen binding. Antigen-binding fragments can be prepared by recombinant DNA technology, or by enzymatic or chemical cleavage of intact antibodies. Antigen-binding fragments include, but are not limited to, Fab, Fab', F(ab')2, Fv, single-chain antibodies such as scFv, diabodies, and single-domain antibodies (sdAbs). The Fab fragment is a monovalent fragment consisting of the VL, VH, CL, and CH1 domains. For example, Fab fragments can be obtained by digesting an intact antibody with papain. In addition, digesting an intact antibody with pepsin below the disulfide bonds in the hinge region produces F(ab')2, a dimer of Fab', a divalent antibody fragment. F(ab')2 can be reduced under neutral conditions by breaking the disulfide bonds in the hinge region, thereby converting the F(ab')2 dimer into a Fab' monomer. The Fab' monomer is essentially a Fab fragment with a hinge region (for a more detailed description of other antibody fragments, see: Fundamental Immunology, edited by W.E. Paul, Raven Press, NY (1993)). The Fv fragment consists of the VL and VH domains of a single antibody arm. In addition, although the two domains of the Fv fragment, VL and VH, are encoded by independent genes, recombinant methods can be used to connect them via a synthetic linker peptide that enables the two domains to be produced as a single protein chain, in which the VL and VH regions are paired to form a single-chain Fv (scFv). The antibody fragment can be obtained by chemical methods, recombinant DNA methods, or protease digestion.

[0148] As defined herein, the term "epitope" refers to the portion of an antigen that specifically interacts with an antibody molecule.

[0149] As defined herein, an "antibody that binds to the same or overlapping epitope as a reference antibody" is an antibody that blocks 50%, 60%, 70%, 80%, 90% or 95% or more of the binding of the reference antibody to its antigen in a competition assay, whereas conversely, the reference antibody blocks 50%, 60%, 70%, 80%, 90% or 95% or more of the binding of the antibody to its antigen in a competition assay.

[0150] As defined herein, an antibody that competes with a reference antibody for binding to its antigen is an antibody that blocks 50%, 60%, 70%, 80%, 90%, or 95% or more of the binding of the reference antibody to its antigen in a competition assay. Conversely, a reference antibody blocks 50%, 60%, 70%, 80%, 90%, or 95% or more of the binding of the antibody to its antigen in a competition assay. Numerous types of competitive binding assays can be used to determine whether one antibody competes with another, such as solid phase direct or indirect radioimmunoassays (RIAs), solid phase direct or indirect enzyme immunoassays (EIAs), sandwich competition assays, biointerferometry (e.g., Fortebio), or surface plasmon resonance (Biacore).

[0151] As defined herein, an antibody that inhibits (e.g., competitively inhibits) the binding of a reference antibody to its antigen is an antibody that inhibits the binding of the reference antibody to its antigen by 50%, 60%, 70%, 80%, 90%, or 95% or more. Conversely, a reference antibody inhibits the binding of the antibody to its antigen by 50%, 60%, 70%, 80%, 90%, or 95% or more. The binding of an antibody to its antigen can be measured by affinity (e.g., equilibrium dissociation constant). Methods for determining affinity are known in the art.

[0152] An antibody that exhibits the same or similar binding affinity and / or specificity as a reference antibody is an antibody that has at least 50%, 60%, 70%, 80%, 90% or more than 95% of the binding affinity and / or specificity of the reference antibody. This can be determined by any method known in the art for determining binding affinity and / or specificity.

[0153] The term "variable region" or "variable domain" refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to an antigen. The variable regions of the heavy and light chains of natural antibodies generally have similar structures, with each domain comprising four conserved framework regions (FRs) and three complementarity determining regions.

[0154] As defined herein, "complementarity determining region" or "CDR region" or "CDR" is a region in an antibody variable domain that is highly variable in sequence and forms a structurally determined loop ("hypervariable loop") and / or contains antigen contact residues ("antigen contact points"). CDRs are primarily responsible for binding to antigenic epitopes. The CDRs of the heavy and light chains are typically referred to as CDR1, CDR2, and CDR3, and are numbered sequentially from the N-terminus. The CDRs located within the antibody heavy chain variable domain are referred to as HCDR1, HCDR2, and HCDR3, while the CDRs located within the antibody light chain variable domain are referred to as LCDR1, LCDR2, and LCDR3. In a given light chain variable region or heavy chain variable region amino acid sequence, the precise amino acid sequence boundaries of each CDR can be determined using any one or a combination of a number of well-known antibody CDR assignment systems, including, for example, Chothia based on the three-dimensional structure of antibodies and the topology of the CDR loops (Chothia et al. (1989) Nature 342:877-883, Al-Lazikani et al., "Standard conformations for the canonical structures of immunoglobulins", Journal of Molecular Biology, 273, 927-948 (1997)), Kabat based on antibody sequence variability (Kabat et al., Sequences of Proteins of Immunological Interest, 4th Edition, US Department of Health and Human Services, National Institutes of Health (1987)), AbM (University of Bath), Contact (University College London), International ImMunoGeneTics database (IMGT) (on the World Wide Web at imgt.cines.fr / ), and the North CDR definition based on affinity propagation clustering using a large number of crystal structures.

[0155] For example, according to different CDR definition schemes, the residues of each CDR are as follows.

[0156] The following are exemplary regions of CDRs defined using the Kabat, AbM, Chothia, Contact, and IMGT schemes.

[0157] Unless otherwise indicated, in the present invention, the term "CDR" or "CDR sequence" encompasses CDR sequences determined in any of the above ways. CDRs can also be determined based on having the same Kabat numbering position as a reference CDR sequence (e.g., any of the exemplary CDRs of the present invention). Unless otherwise indicated, in the present invention, when referring to residue positions in an antibody variable region (including heavy chain variable region residues and light chain variable region residues), it refers to the numbering position of the Kabat numbering system according to Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991).

[0158] In one embodiment, the HCDRs and LCDRs in the antibodies of the present invention are each determined according to the Kabat scheme.

[0159] A CDR can also be identified based on having the same Kabat numbering position as a reference CDR sequence (eg, any of the exemplary CDRs of the invention).

[0160] It should be noted that the boundaries of the CDRs of the variable regions of the same antibody obtained based on different assignment schemes may be different. That is, the CDR sequences of the variable regions of the same antibody defined under different assignment schemes may be different. Therefore, when referring to antibodies defined by specific CDR sequences defined in the present invention, the scope of the antibodies also covers antibodies whose variable region sequences contain the specific CDR sequences, but whose claimed CDR boundaries are different from the specific CDR boundaries defined in the present invention due to the application of different schemes (e.g., different assignment scheme rules or combinations).

[0161] Unless otherwise indicated, in the present invention, the term "CDR" or "CDR sequence" encompasses a CDR sequence determined in any one of the ways described herein or in any combination thereof.

[0162] The term "Fc domain" or "Fc region" is used herein to define the C-terminal region of an immunoglobulin heavy chain that contains at least a portion of the constant region. The term includes native sequence Fc regions and variant Fc regions. A native immunoglobulin "Fc domain" or "Fc region" comprises two or three constant domains, namely a CH2 domain, a CH3 domain, and an optional CH4 domain. For example, in a native antibody, the immunoglobulin Fc domain comprises the second and third constant domains (CH2 domain and CH3 domain) of the heavy chain derived from IgG, IgA, and IgD classes of antibodies; or the second, third, and fourth constant domains (CH2 domain, CH3 domain, and CH4 domain) of two heavy chains derived from IgM and IgE classes of antibodies. Unless otherwise indicated herein, the numbering of amino acid residues in the Fc region or heavy chain constant region is according to the EU numbering system (also called the EU index) as described in Kabat et al., Sequences of Proteins of Immunological Interes, 5th ed., Public Health Service, National Institutes of Health, Bethesda, MD, 1991. As used herein, the terms "Fc region," "Fc portion," and "Fc fragment" do not include the heavy chain variable region VH and light chain variable region VL, as well as the heavy chain constant region CH1 and light chain constant region CL of an immunoglobulin, but may include the hinge region at the N-terminus of the heavy chain constant region in some cases.

[0163] The term "IgG form antibody" refers to the IgG form to which the heavy chain constant region of the antibody belongs. For example, an IgG4 form antibody means that its heavy chain constant region is derived from IgG4, or an IgG1 form antibody means that its heavy chain constant region is derived from IgG1.

[0164] Examples of "effector functions" of immunoglobulins include: C1q binding and complement-dependent cytotoxicity (CDC), Fc receptor binding, antibody-dependent cell-mediated cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP), cytokine secretion, immune complex-mediated antigen uptake by antigen-presenting cells, downregulation of cell surface receptors (e.g., B-cell receptor), and B-cell activation.

[0165] The term "chimeric antibody" is an antibody molecule in which (a) the constant region or a portion thereof is changed, replaced or exchanged so that the antigen binding site is connected to a constant region of a different or altered class, effector function and / or species or a completely different molecule (e.g., enzyme, toxin, hormone, growth factor, drug) that imparts new properties to the chimeric antibody; or (b) the variable region or a portion thereof is changed, replaced or exchanged with a variable region having a different or altered antigenic specificity. For example, a mouse antibody can be modified by replacing its constant region with a constant region from a human immunoglobulin. Due to the replacement with a human constant region, the chimeric antibody can retain its specificity in recognizing the antigen while having reduced immunogenicity in humans as compared to the original mouse antibody.

[0166] A "humanized antibody" is an antibody that retains the antigen-specific reactivity of a non-human antibody (e.g., a mouse monoclonal antibody) while being less immunogenic when administered to humans as a therapeutic agent. This can be achieved, for example, by retaining the non-human antigen-binding site and replacing the remaining portions of the antibody with their human counterparts (i.e., replacing the constant region and portions of the variable region not involved in binding with the corresponding portions of a human antibody).

[0167] As used herein, the terms "anti," "binding," or "specific binding" mean that the binding is selective for the target or antigen and can be distinguished from unwanted or non-specific interactions. The ability of a binding site to bind to a specific target or antigen can be determined by flow cytometry or enzyme-linked immunosorbent assay (ELISA) or conventional binding assays known in the art, such as by radioimmunoassay (RIA) or thin-layer interferometry or MSD assays or surface plasmon resonance (SPR).

[0168] "Percent (%) identity" of an amino acid sequence refers to the percentage of amino acid residues in the candidate sequence that are identical to the amino acid residues in the specific amino acid sequence set forth in this specification, after aligning the candidate sequence with the specific amino acid sequence set forth in this specification and introducing gaps, if necessary, to achieve the maximum percentage identity, and not considering any conservative substitutions as part of the sequence identity. In some embodiments, the present invention contemplates variants of the antibody molecules of the present invention that have a substantial degree of identity, e.g., at least 80%, 85%, 90%, 95%, 97%, 98% or 99% or more, relative to the antibody molecules and sequences thereof specifically disclosed herein. The variants may comprise conservative changes or be conservatively modified variants.

[0169] The term "host cell" refers to a cell into which an exogenous polynucleotide has been introduced, including the progeny of such cells. Host cells include "transformants" and "transformed cells," which include primary transformed cells and progeny derived therefrom. Host cells are any type of cell system that can be used to produce the antibody molecules of the present invention, including eukaryotic cells, for example, mammalian cells (e.g., CHO or 293 cells), insect cells, yeast cells; and prokaryotic cells, for example, E. coli cells. Host cells include cultured cells, as well as cells within transgenic animals, transgenic plants, or cultured plant tissues or animal tissues.

[0170] The term "vector" when used herein refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is attached. The term includes vectors that are self-replicating nucleic acid structures as well as vectors that are incorporated into the genome of a host cell into which it has been introduced. The term "expression vector" refers to a vector comprising a recombinant polynucleotide comprising expression control sequences that are operatively linked to the nucleotide sequence to be expressed. The expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be provided by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, including cosmids, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) into which recombinant polynucleotides are incorporated.

[0171] The term "tumor" refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all precancerous and cancerous cells and tissues. The terms "cancer," "cancerous," and "tumor" are not mutually exclusive when referred to herein. The term "tumor" encompasses both solid tumors and hematologic tumors.

[0172] The term "anti-tumor" or "tumor inhibitory" or "tumor suppression" or "tumor inhibition" refers to a biological effect that can be demonstrated by various means including, but not limited to, for example, a decrease in tumor volume, a decrease in tumor cell number, a decrease in tumor cell proliferation, or a decrease in tumor cell survival.

[0173] The term "pharmaceutical composition" refers to a composition that is in form permitting the biological activity of the active ingredient contained therein to be effective, and that contains no additional ingredients that are unacceptably toxic to a subject to which the composition would be administered.

[0174] The term "treat," ...

[0175] The term "prevent" includes the inhibition of the development or progression of a disease or condition or symptoms of a particular disease or condition. In some embodiments, subjects with a family history of cancer are candidates for a preventative regimen. Generally, in the context of cancer, the term "prevent" refers to the administration of a drug before the development of signs or symptoms of cancer, particularly in a subject at risk for cancer.

[0176] The term "therapeutic agent" as used herein encompasses any substance effective in preventing or treating tumors, such as cancer, including chemotherapeutic agents, cytotoxic agents, other antibodies (such as immune checkpoint molecule antibodies), small molecule drugs, or immunomodulators (such as immunosuppressants or agonists).

[0177] The term "combination therapy" refers to the administration of two or more therapeutic agents or treatment modalities (e.g., radiotherapy or surgery) to treat diseases described herein. This administration includes co-administering these therapeutic agents in a substantially simultaneous manner, such as in a single capsule with a fixed ratio of active ingredients. Alternatively, this administration includes co-administration of each active ingredient in a variety of or separate containers (e.g., tablets, capsules, powders, and liquids). Powders and / or liquids can be reconstituted or diluted to the desired dose before administration. In addition, this administration also includes using each type of therapeutic agent in a sequential manner at approximately the same time or at different times. In either case, the therapeutic regimen will provide the beneficial effects of the drug combination in treating disorders or conditions described herein.

[0178] The term "pharmaceutical combination or pharmaceutical combination product" refers to a non-fixed combination product or a fixed combination product, including but not limited to a kit and a pharmaceutical composition. The term "non-fixed combination" means that the active ingredients (e.g., (i) an antibody of the invention, and (ii) other therapeutic agent) are administered to a patient as separate entities simultaneously, without specific time restrictions, or sequentially at the same or different time intervals, wherein such administration provides prophylactically or therapeutically effective levels of two or more active agents in the patient's body. The term "fixed combination" means that two or more active agents are administered to a patient simultaneously in the form of a single entity. Each component can be in a separate formulation, which can be the same or different.

[0179] The term "effective amount" refers to an amount or dosage of an antibody or fragment or composition or combination of the present invention that, after administration to a patient in a single or multiple doses, produces the desired effect in a patient in need of treatment or prevention. A "therapeutically effective amount" refers to an amount that is effective to achieve the desired therapeutic outcome at the required dosage and for the required period of time. Preferably, a therapeutically effective amount is one in which any toxic or deleterious effects of the antibody or antibody fragment or composition or combination are outweighed by the therapeutically beneficial effects. A "prophylactically effective amount" refers to an amount that is effective to achieve the desired prophylactic outcome at the required dosage and for the required period of time. Typically, because prophylactic doses are used in subjects before or at an earlier stage of the disease, the prophylactically effective amount will be less than the therapeutically effective amount.

[0180] The term "pharmaceutically acceptable excipient" refers to a diluent, adjuvant (eg, Freund's adjuvant (complete and incomplete)), vehicle, carrier, stabilizer, etc., which is administered together with the active substance.

[0181] "Subject / patient / individual sample" refers to a collection of cells or fluids obtained from a patient or subject. The source of the tissue or cell sample can be solid tissue, such as from fresh, frozen and / or preserved organ or tissue samples or biopsy samples or puncture samples; blood or any blood component; body fluids, such as tears, vitreous humor, cerebrospinal fluid, amniotic fluid (amniotic fluid), peritoneal fluid (ascites), or interstitial fluid; cells from any time during the subject's pregnancy or development. In some embodiments, the tissue sample is tumor tissue. The tissue sample may contain compounds that are not naturally mixed with tissue in nature, such as preservatives, anticoagulants, buffers, fixatives, nutrients, antibiotics, etc.

[0182] II. Antibodies

[0183] In some embodiments, the anti-BTNL2 antibodies or fragments thereof of the present invention bind to BTNL2 (e.g., human BTNL2 or its extracellular domain) with high affinity, for example, with an equilibrium dissociation constant (K D ) binds to BTNL2, the K D Less than about 10 nM, preferably, less than or equal to about 9 nM, 8.5 nM, 8 nM, 7.5 nM, 7 nM, 6.9 nM or 6.8 nM. In some embodiments, the anti-BTNL2 antibodies of the invention have a K of 6-9 nM, 6.5-8.5 nM, 6.5-7.5 nM, or 6.5-7 nM. D Binding to BTNL2. In some embodiments, BTNL2 is human BTNL2. In some embodiments, antibody binding affinity is determined using biointerferometry, such as surface plasmon resonance (Biacore) measurement.

[0184] In some embodiments, the anti-BTNL2 antibodies or fragments thereof of the present invention neutralize (or inhibit) the inhibitory effect of BTNL2 (eg, human BTNL2) on T cell activation. In some embodiments, the activity of T cell activation is selected from the increase of cytokine expression.

[0185] In some embodiments, the anti-BTNL2 antibodies or fragments thereof of the present invention inhibit one or more activities of BTNL2 (eg, human BTNL2) to cause one or more of the following: CD4 + T or CD8 + Increased T lymphocyte proliferation; increased expression and secretion of cytokines; increased expression of activation antigens; increased tumor-infiltrating lymphocytes; or decreased immune evasion of cancer cells.

[0186] In some embodiments, the cytokine is selected from one or more of interleukins (eg, interleukin 2), interferon-γ, and tumor necrosis factors (eg, tumor necrosis factor α).

[0187] In some embodiments, the antibodies or fragments thereof of the present invention (optionally in combination with treatment modalities and / or other therapeutic agents) can prevent or treat BTNL2-related diseases, such as tumors or immune system diseases. In some embodiments, the antibodies or fragments thereof of the present invention can inhibit tumor growth, preferably without affecting body weight.

[0188] In some embodiments, the present invention encompasses an anti-BTNL2 antibody or antigen-binding fragment thereof that specifically binds to a BTNL2 epitope, wherein the BTNL2 epitope comprises amino acids 384-399 of BTNL2, wherein the amino acid numbering is with reference to the numbering of the human BTNL2 protein, such as with reference to the amino acid sequence set forth in SEQ ID NO: 15. In one embodiment, the BTNL2 epitope comprises or consists of the amino acid sequence set forth in SEQ ID NO: 34. In one embodiment, the BTNL2 epitope is located within the IgC domain of BTNL2. In one embodiment, the BTNL2 epitope is located outside the IgV1 and IgV2 domains of BTNL2.

[0189] In one embodiment, the BTNL2 epitope of the present invention comprises the amino acid sequence shown in SEQ ID NO: 34 and is located in the IgC domain of BTNL2.

[0190] In some embodiments, the anti-BTNL2 antibodies or antigen-binding fragments thereof of the present invention comprise three complementarity determining regions (HCDRs) from the heavy chain variable region, HCDR1, HCDR2, and HCDR3.

[0191] In some embodiments, an anti-BTNL2 antibody or antigen-binding fragment thereof of the present invention comprises three complementarity determining regions (LCDRs) from the light chain variable region, LCDR1, LCDR2, and LCDR3.

[0192] In some embodiments, an anti-BTNL2 antibody or antigen-binding fragment thereof of the invention comprises three complementarity determining regions (HCDRs) from a heavy chain variable region and three complementarity determining regions (LCDRs) from a light chain variable region.

[0193] In some aspects, the anti-BTNL2 antibodies or antigen-binding fragments thereof of the present invention comprise a heavy chain variable region (VH). In some aspects, the anti-BTNL2 antibodies or antigen-binding fragments thereof of the present invention comprise a light chain variable region (VL). In some aspects, the anti-BTNL2 antibodies or antigen-binding fragments thereof of the present invention comprise a heavy chain variable region (VH) and a light chain variable region (VL). In some embodiments, the heavy chain variable region comprises three complementary determining regions (HCDRs) from the heavy chain variable region, HCDR1, HCDR2, and HCDR3. In some embodiments, the light chain variable region comprises three complementary determining regions (LCDRs) from the light chain variable region, LCDR1, LCDR2, and LCDR3.

[0194] In some embodiments, the anti-BTNL2 antibodies or antigen-binding fragments thereof of the present invention further comprise an antibody heavy chain constant region. In some embodiments, the anti-BTNL2 antibodies or antigen-binding fragments thereof of the present invention further comprise an antibody light chain constant region. In some embodiments, the anti-BTNL2 antibodies or antigen-binding fragments thereof of the present invention further comprise a heavy chain constant region and a light chain constant region.

[0195] In some embodiments, the anti-BTNL2 antibodies or antigen-binding fragments thereof of the present invention comprise an antibody heavy chain (HC). In some embodiments, the anti-BTNL2 antibodies or antigen-binding fragments thereof of the present invention further comprise an antibody light chain (LC). In some embodiments, the anti-BTNL2 antibodies or antigen-binding fragments thereof of the present invention comprise a heavy chain and a light chain. In some embodiments, the anti-BTNL2 antibodies of the present invention comprise or consist of two heavy chains and two light chains.

[0196] In some embodiments, the antibody heavy chain of the present invention comprises or consists of an antibody heavy chain variable region and an antibody heavy chain constant region. In some embodiments, the antibody light chain of the present invention comprises or consists of an antibody light chain variable region and an antibody light chain constant region. In some embodiments, the heavy chain variable region of the present invention comprises or consists of an antibody light chain variable region and an antibody light chain constant region.

[0197] (i) comprises or consists of an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to an amino acid sequence selected from SEQ ID NO: 1, 16, 20, 24 or 28; or

[0198] (ii) comprises or consists of an amino acid sequence selected from SEQ ID NO: 1, 16, 20, 24 or 28; or

[0199] (iii) comprises or consists of an amino acid sequence having one or more (preferably no more than 10, more preferably no more than 5, 4, 3, 2, 1) amino acid changes (preferably amino acid substitutions, more preferably conservative amino acid substitutions) compared to an amino acid sequence selected from SEQ ID NO: 1, 16, 20, 24 or 28, preferably, the amino acid changes do not occur in the CDR regions.

[0200] In some embodiments, the light chain variable region of the present invention

[0201] (i) comprises or consists of an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to an amino acid sequence selected from SEQ ID NO: 2, 17, 21, 25 or 29; or

[0202] (ii) comprises or consists of an amino acid sequence selected from SEQ ID NO: 2, 17, 21, 25 or 29; or

[0203] (iii) comprises or consists of an amino acid sequence having one or more (preferably no more than 10, more preferably no more than 5, 4, 3, 2, 1) amino acid changes (preferably amino acid substitutions, more preferably conservative amino acid substitutions) compared to an amino acid sequence selected from SEQ ID NO: 2, 17, 21, 25 or 29, preferably, the amino acid changes do not occur in the CDR regions.

[0204] In some embodiments, the three complementarity determining regions (HCDRs) of the present invention, HCDR1, HCDR2, and HCDR3, from the heavy chain variable region are selected from

[0205] (i) three complementarity determining regions HCDR1, HCDR2 and HCDR3 contained in VH as shown in SEQ ID NO: 1,

[0206] (ii) three complementarity determining regions HCDR1, HCDR2 and HCDR3 contained in VH as shown in SEQ ID NO: 16,

[0207] (iii) three complementarity determining regions HCDR1, HCDR2 and HCDR3 contained in VH as shown in SEQ ID NO: 20,

[0208] (iv) three complementarity determining regions HCDR1, HCDR2 and HCDR3 contained in VH as shown in SEQ ID NO: 24, or

[0209] (v) three complementarity determining regions HCDR1, HCDR2 and HCDR3 contained in VH as shown in SEQ ID NO: 28, or

[0210] (vi) a sequence comprising at least one and no more than 5, 4, 3, 2 or 1 amino acid alteration (preferably an amino acid substitution, preferably a conservative substitution) in the three HCDR regions relative to the sequence of any one of (i) to (v),

[0211] Optionally, the CDRs are identified using Kabat numbering.

[0212] In some embodiments, the three complementarity determining regions (LCDRs) of the present invention, LCDR1, LCDR2, and LCDR3, from the light chain variable region are selected from

[0213] (i) three complementarity determining regions LCDR1, LCDR2 and LCDR3 contained in VL as shown in SEQ ID NO: 2,

[0214] (ii) three complementarity determining regions LCDR1, LCDR2 and LCDR3 contained in VL as shown in SEQ ID NO: 17,

[0215] (iii) three complementarity determining regions LCDR1, LCDR2 and LCDR3 contained in VL as shown in SEQ ID NO: 21,

[0216] (iv) three complementarity determining regions LCDR1, LCDR2 and LCDR3 contained in VL as shown in SEQ ID NO: 25,

[0217] (v) three complementarity determining regions LCDR1, LCDR2 and LCDR3 contained in VL as shown in SEQ ID NO: 29,

[0218] or

[0219] (iii) a sequence comprising at least one and no more than 5, 4, 3, 2 or 1 amino acid changes (preferably amino acid substitutions, preferably conservative substitutions) in the three LCDR regions relative to the sequence of any one of (i) to (v),

[0220] Optionally, the CDRs are identified using Kabat numbering.

[0221] In some embodiments, HCDR1 comprises or consists of the amino acid sequence of SEQ ID NO: 3, or HCDR1 comprises an amino acid sequence having one, two or three alterations (preferably amino acid substitutions, preferably conservative substitutions) compared to the amino acid sequence of SEQ ID NO: 3.

[0222] In some embodiments, HCDR2 comprises or consists of the amino acid sequence of SEQ ID NO: 4, or HCDR2 comprises an amino acid sequence having one, two or three alterations (preferably amino acid substitutions, preferably conservative substitutions) compared to the amino acid sequence of SEQ ID NO: 4.

[0223] In some embodiments, HCDR3 comprises or consists of the amino acid sequence of SEQ ID NO: 5, or HCDR3 comprises an amino acid sequence having one, two or three alterations (preferably amino acid substitutions, preferably conservative substitutions) compared to the amino acid sequence of SEQ ID NO: 5.

[0224] In some embodiments, LCDR1 comprises or consists of the amino acid sequence of SEQ ID NO: 6, or LCDR1 comprises an amino acid sequence having one, two or three changes (preferably amino acid substitutions, preferably conservative substitutions) compared to the amino acid sequence of SEQ ID NO: 6.

[0225] In some embodiments, LCDR2 comprises or consists of the amino acid sequence of SEQ ID NO: 7, or LCDR2 comprises an amino acid sequence having one, two or three changes (preferably amino acid substitutions, preferably conservative substitutions) compared to the amino acid sequence of SEQ ID NO: 7.

[0226] In some embodiments, LCDR3 comprises or consists of the amino acid sequence of SEQ ID NO: 8, or LCDR3 comprises an amino acid sequence having one, two or three changes (preferably amino acid substitutions, preferably conservative substitutions) compared to the amino acid sequence of SEQ ID NO: 8.

[0227] In some embodiments, the heavy chain constant region of the antibody of the present invention is from (human) IgG1, IgG2, IgG3 or IgG4, for example, the heavy chain constant region of (human) IgG1, IgG2, IgG3 or IgG4, for example, the heavy chain constant region of human IgG1. In some embodiments, the light chain constant region of the antibody of the present invention is a (human) lambda or kappa light chain constant region, for example, a (human) kappa light chain constant region.

[0228] In some embodiments, the heavy chain constant region of an antibody of the invention is

[0229] (i) comprising or consisting of an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO: 11;

[0230] (ii) comprises or consists of the amino acid sequence of SEQ ID NO: 11; or

[0231] (iii) comprises an amino acid sequence having one or more (preferably no more than 20 or 10, more preferably no more than 5, 4, 3, 2, or 1) amino acid changes (preferably amino acid substitutions, more preferably conservative amino acid substitutions) compared to the amino acid sequence of SEQ ID NO: 11, or consists of said amino acid sequence.

[0232] In some embodiments, the antibody light chain constant region of the invention is

[0233] (i) comprising or consisting of an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO: 12;

[0234] (ii) comprises or consists of the amino acid sequence of SEQ ID NO: 12; or

[0235] (iii) comprises an amino acid sequence having one or more (preferably no more than 20 or 10, more preferably no more than 5, 4, 3, 2, or 1) amino acid changes (preferably amino acid substitutions, more preferably conservative amino acid substitutions) compared to the amino acid sequence of SEQ ID NO: 12, or consists of said amino acid sequence.

[0236] In some embodiments of the present invention, the anti-BTNL2 antibody or antigen-binding fragment thereof comprises:

[0237] (i) three complementarity determining regions HCDR1, HCDR2, and HCDR3 contained in VH as shown in SEQ ID NO: 1, and three complementarity determining regions LCDR1, LCDR2, and LCDR3 contained in VL as shown in SEQ ID NO: 2;

[0238] (ii) three complementarity determining regions HCDR1, HCDR2, and HCDR3 contained in VH as shown in SEQ ID NO: 16, and three complementarity determining regions LCDR1, LCDR2, and LCDR3 contained in VL as shown in SEQ ID NO: 17;

[0239] (iii) three complementarity determining regions HCDR1, HCDR2, and HCDR3 contained in VH as shown in SEQ ID NO: 20, and three complementarity determining regions LCDR1, LCDR2, and LCDR3 contained in VL as shown in SEQ ID NO: 21;

[0240] (iv) the three complementarity determining regions HCDR1, HCDR2 and HCDR3 contained in the VH as shown in SEQ ID NO: 24, and the three complementarity determining regions LCDR1, LCDR2 and LCDR3 contained in the VL as shown in SEQ ID NO: 25; or

[0241] (v) three complementarity determining regions HCDR1, HCDR2, and HCDR3 contained in VH as shown in SEQ ID NO: 28, and three complementarity determining regions LCDR1, LCDR2, and LCDR3 contained in VL as shown in SEQ ID NO: 29;

[0242] Optionally, the HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 and LCDR3 are identified using Kabat numbering.

[0243] In some specific embodiments of the present invention, the anti-BTNL2 antibody or antigen-binding fragment thereof comprises HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 and LCDR3, wherein HCDR1 comprises or consists of the amino acid sequence of SEQ ID NO:3, HCDR2 comprises or consists of the amino acid sequence of SEQ ID NO:4, HCDR3 comprises or consists of the amino acid sequence of SEQ ID NO:5, LCDR1 comprises or consists of the amino acid sequence of SEQ ID NO:6, LCDR2 comprises or consists of the amino acid sequence of SEQ ID NO:7, and LCDR3 comprises or consists of the amino acid sequence of SEQ ID NO:8.

[0244] In some specific embodiments of the present invention, the anti-BTNL2 antibody or antigen-binding fragment thereof of the present invention comprises the following VH and VL:

[0245] (i) a VH comprising, or consisting of, an amino acid sequence as set forth in SEQ ID NO: 1, or an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical thereto, and a VL comprising, or consisting of, an amino acid sequence as set forth in SEQ ID NO: 2, or an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical thereto;

[0246] (ii) a VH comprising, or consisting of, an amino acid sequence as set forth in SEQ ID NO: 16, or an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical thereto, and a VL comprising, or consisting of, an amino acid sequence as set forth in SEQ ID NO: 17, or an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical thereto;

[0247] (iii) a VH comprising, or consisting of, an amino acid sequence as set forth in SEQ ID NO:20, or an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical thereto, and a VL comprising, or consisting of, an amino acid sequence as set forth in SEQ ID NO:21, or an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical thereto;

[0248] (iv) a VH comprising, or consisting of, an amino acid sequence as set forth in SEQ ID NO:24, or an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical thereto, and a VL comprising, or consisting of, an amino acid sequence as set forth in SEQ ID NO:25, or an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical thereto; or

[0249] (v) a VH comprising, or consisting of, the amino acid sequence of SEQ ID NO: 28, or an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical thereto, and a VL comprising, or consisting of, the amino acid sequence of SEQ ID NO: 29, or an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical thereto.

[0250] In some embodiments, the heavy chain of an anti-BTNL2 antibody of the invention

[0251] (i) comprising or consisting of an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to an amino acid sequence selected from SEQ ID NO: 9, 18, 22, 26 or 30;

[0252] (ii) comprises or consists of an amino acid sequence selected from SEQ ID NO: 9, 18, 22, 26 or 30; or

[0253] (iii) comprises an amino acid sequence having one or more (preferably no more than 20 or 10, more preferably no more than 5, 4, 3, 2, 1) amino acid changes (preferably amino acid substitutions, more preferably conservative amino acid substitutions) compared to an amino acid sequence selected from SEQ ID NO: 9, 18, 22, 26 or 30, or consists of said amino acid sequence, preferably, said amino acid changes do not occur in the CDR region of the heavy chain, more preferably, said amino acid changes do not occur in the heavy chain variable region.

[0254] In some embodiments, the light chain of an anti-BTNL2 antibody of the invention

[0255] (i) comprising or consisting of an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to an amino acid sequence selected from SEQ ID NO: 10, 19, 23, 27 or 31;

[0256] (ii) comprises or consists of an amino acid sequence selected from SEQ ID NO: 10, 19, 23, 27 or 31; or

[0257] (iii) comprises an amino acid sequence having one or more (preferably no more than 20 or 10, more preferably no more than 5, 4, 3, 2, 1) amino acid changes (preferably amino acid substitutions, more preferably conservative amino acid substitutions) compared to an amino acid sequence selected from SEQ ID NO: 10, 19, 23, 27 or 31, or consists of said amino acid sequence, preferably, said amino acid change does not occur in the CDR region of the light chain, more preferably, said amino acid change does not occur in the light chain variable region.

[0258] In a preferred embodiment, the present invention provides an anti-BTNL2 antibody or antigen-binding fragment thereof comprising a heavy chain and a light chain, wherein

[0259] (i) the heavy chain comprises or consists of the amino acid sequence of SEQ ID NO: 9; and the light chain comprises or consists of the amino acid sequence of SEQ ID NO: 10;

[0260] (ii) the heavy chain comprises or consists of the amino acid sequence of SEQ ID NO: 18; and the light chain comprises or consists of the amino acid sequence of SEQ ID NO: 19;

[0261] (iii) the heavy chain comprises or consists of the amino acid sequence of SEQ ID NO: 22; and the light chain comprises or consists of the amino acid sequence of SEQ ID NO: 23;

[0262] (iv) the heavy chain comprises or consists of the amino acid sequence of SEQ ID NO: 26; and the light chain comprises or consists of the amino acid sequence of SEQ ID NO: 27; or

[0263] (v) the heavy chain comprises or consists of the amino acid sequence of SEQ ID NO: 30; and the light chain comprises or consists of the amino acid sequence of SEQ ID NO: 31.

[0264] In one embodiment of the present invention, the amino acid changes described herein include amino acid substitutions, insertions or deletions. Preferably, the amino acid changes described herein are amino acid substitutions, preferably conservative substitutions.

[0265] In a preferred embodiment, the amino acid changes described herein occur in regions outside of the CDRs (e.g., in the FRs). More preferably, the amino acid changes described herein occur in regions outside of the heavy chain variable region and / or outside of the light chain variable region.

[0266] For polypeptide sequences, "conservative changes" include replacements, deletions or additions to the polypeptide sequence, but do not substantially change the desired functional activity of the polypeptide sequence. For example, conservative substitutions often result in a certain amino acid being replaced with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. The following lists 8 groups of amino acids containing mutually conservative replacements: 1) alanine (A), glycine (G); 2) aspartic acid (D), glutamic acid (E); 3) asparagine (N), glutamine (Q); 4) arginine (R), lysine (K); 5) isoleucine (I), leucine (L), methionine (M), valine (V); 6) phenylalanine (F), tyrosine (Y), tryptophan (W); 7) serine (S), threonine (T); and 8) cysteine ​​(C), methionine (M). In some embodiments, the term "conservative sequence change" is used to refer to amino acid modifications that do not significantly affect or change the target antigen binding characteristics of the antibody molecule or binding protein molecule of the present invention containing the amino acid sequence. For example, a conservatively modified variant retains at least 80%, 85%, 90%, 95%, 98%, 99% or more, such as 100-110% or more, binding affinity for the antigen of interest relative to the parent antibody or binding protein.

[0267] In certain embodiments, the substitution occurs in the CDR region of the antibody. Typically, the variant obtained has modifications (e.g., improvements) relative to the parent antibody in certain biological properties (e.g., increased affinity) and / or will have certain biological properties that are substantially retained by the parent antibody. An exemplary substitution variant is an affinity matured antibody.

[0268] In certain embodiments, one or more amino acid modifications can be introduced into the Fc region of an antibody provided herein to generate an Fc region variant, such as to enhance, for example, the affinity of the antibody or the effectiveness of treating a disease. The Fc region variant may include a human Fc region sequence (e.g., a human IgG1, IgG2, IgG3, or IgG4 Fc region) comprising an amino acid change (e.g., substitution) at one or more amino acid positions.

[0269] In certain embodiments, it may be desirable to generate cysteine ​​engineered antibodies, eg, "thioMAbs," in which one or more residues of an antibody are substituted with cysteine ​​residues.

[0270] In certain embodiments, the antibodies provided herein may be further modified to contain other non-proteinaceous moieties known in the art and readily available. Suitable moieties for antibody derivatization include, but are not limited to, water-soluble polymers. Non-limiting examples of water-soluble polymers include, but are not limited to, polyethylene glycol (PEG), ethylene glycol / propylene glycol copolymers, carboxymethyl cellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone, poly-1,3-dioxane, poly-1,3,6-trioxane, ethylene / maleic anhydride copolymers, polyamino acids (homopolymers or random copolymers), and dextran or poly (n-vinyl pyrrolidone) polyethylene glycol, propylene glycol homopolymers, polypropylene oxide / ethylene oxide copolymers, polyoxyethylated polyols (e.g., glycerol), polyvinyl alcohol, and mixtures thereof.

[0271] In some embodiments, the anti-BTNL2 antibodies or antigen-binding fragments thereof of the present invention further include antibodies or antigen-binding fragments having one or more of the following properties:

[0272] (i) exhibiting the same or similar binding affinity and / or specificity for BTNL2 as the antibodies of the present invention;

[0273] (ii) inhibiting (e.g., competitively inhibiting) the binding of an antibody of the invention to BTNL2;

[0274] (iii) binds to the same or overlapping epitope as an antibody of the invention, e.g., a BTNL2 epitope of the invention, e.g., a BTNL2 epitope comprising SEQ ID NO: 34;

[0275] (iv) competing with the antibodies of the present invention for binding to BTNL2;

[0276] (v) possess one or more biological properties of an antibody of the invention.

[0277] In some embodiments, the anti-BTNL2 antibody of the present invention is an antibody in the form of IgG1 or an antibody in the form of IgG2 or an antibody in the form of IgG3 or an antibody in the form of IgG4.

[0278] In some embodiments, the anti-BTNL2 antibody is a monoclonal antibody.

[0279] In some embodiments, the anti-BTNL2 antibody is a humanized antibody. Humanization can be achieved by replacing one or more amino acid residues in the heavy chain variable region and light chain variable region of a non-human natural antibody, especially the framework region sequence, with residues at corresponding positions in the variable region (e.g., VH or VL template) of a conventional human antibody. Methods for humanizing antibodies are well known in the art. Generally, humanizing substitutions are performed in a manner that maintains the favorable binding properties of the antibody. Tests for determining the biological properties of humanized antibodies, such as binding affinity, are well known in the art to determine and select suitable humanized residue mutations or mutation combinations.

[0280] In some embodiments, the human germline sequence suitable for use as a VH template is IGHV3-73, IGHV3-15, IGHV3-30, or IGHV3-23. In some embodiments, the human germline sequence suitable for use as a VL template is IGKV1-9, IGKV1-39, IGKV3-20, or IGKV3-11. In some embodiments, the VH humanized template is IGHV3-73, and the VL humanized template is IGKV1-9; the VH humanized template is IGHV3-15, and the VL humanized template is IGKV1-39; the VH humanized template is IGHV3-30, and the VL humanized template is IGKV3-20; or the VH humanized template is IGHV3-23, and the VL humanized template is IGKV3-11.

[0281] In some embodiments, the anti-BTNL2 antibody is a chimeric antibody.

[0282] In some embodiments, the anti-BTNL2 antibodies of the invention are full-length antibodies.

[0283] In one embodiment, the anti-BTNL2 antibodies of the present invention also encompass antibody fragments thereof, preferably antigen-binding fragments, preferably antibody fragments selected from the group consisting of: Fab, Fab', Fab'-SH, Fv, single-chain antibodies (e.g., scFv), (Fab')2, single-domain antibodies such as VHH, dAb (domain antibody) or linear antibodies.

[0284] In certain embodiments, the anti-BTNL2 antibody molecule is in the form of a bispecific or multispecific antibody molecule.In some embodiments, the anti-BTNL2 antibody of the invention is a bispecific antibody or a multispecific antibody.

[0285] III. Nucleic acids of the present invention and host cells containing the same

[0286] In one aspect, the present invention provides nucleic acids encoding any of the above anti-BTNL2 antibodies or fragments thereof. In one embodiment, a vector comprising the nucleic acid is provided. In one embodiment, the vector is an expression vector. In one embodiment, a host cell comprising the nucleic acid or the vector is provided. In one embodiment, the host cell is eukaryotic. In another embodiment, the host cell is selected from yeast cells, mammalian cells (e.g., CHO cells or 293 cells), or other cells suitable for preparing antibodies or antigen-binding fragments thereof. In another embodiment, the host cell is prokaryotic.

[0287] In one aspect, the present invention provides a nucleic acid encoding any of the anti-BTNL2 antibodies or fragments thereof described herein. The nucleic acid may comprise a nucleic acid encoding an amino acid sequence of the light chain variable region and / or the heavy chain variable region of the antibody, or a nucleic acid encoding an amino acid sequence of the light chain and / or the heavy chain of the antibody.

[0288] For example, the nucleic acids of the present invention include nucleic acids encoding an amino acid sequence selected from any one of SEQ ID NOs: 1, 2, 9, 10, or 16-31, or nucleic acids encoding an amino acid sequence selected from any one of SEQ ID NOs: 1, 2, 9, 10, or 16-31 that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical.

[0289] As will be appreciated by those skilled in the art, because of codon degeneracy, each antibody or polypeptide amino acid sequence can be encoded by a variety of nucleic acid sequences. Nucleic acid sequences encoding molecules of the present invention can be produced by methods well known in the art, for example, by de novo solid phase DNA synthesis, or by PCR amplification.

[0290] In one aspect, the present invention provides nucleic acids encoding any of the above antibodies or any antibody chains. When expressed from a suitable expression vector, the polypeptide encoded by the nucleic acid can exhibit the ability to bind to BTNL2 (e.g., human BTNL2, e.g., the extracellular domain of human BTNL2). In one embodiment, the nucleic acids encoding each chain of an antibody of the present invention can be in the same vector or in different vectors. In another embodiment, the nucleic acids encoding each chain of an antibody of the present invention can be introduced into the same or different host cells for expression. Therefore, in some embodiments, the method for producing an antibody of the present invention comprises the steps of culturing a host cell containing the nucleic acids encoding each chain under conditions suitable for expressing each chain of the molecule to produce the antibody of the present invention.

[0291] In one embodiment, one or more vectors comprising the nucleic acid are provided. In one embodiment, the vector is an expression vector, such as a eukaryotic expression vector. Vectors include, but are not limited to, viruses, plasmids, cosmids, lambda phages, or yeast artificial chromosomes (YACs). In some embodiments, the vector is a pcDNA vector. In some embodiments, the vector is pcDNA3.1. In some embodiments, the vector is pcDNA TM 3.4TOPO.

[0292] In one embodiment, a host cell comprising the nucleic acid or vector is provided. Suitable host cells for cloning or expressing nucleic acids or vectors encoding antibodies include prokaryotic or eukaryotic cells. In one embodiment, the host cell is eukaryotic. In another embodiment, the host cell is selected from yeast cells, mammalian cells such as Chinese hamster ovary celI (e.g., CHO cells (e.g., CHO-S, such as ExpiCHO-S) or 293 cells (e.g., 293F or HEK293 cells)) or other cells suitable for preparing antibodies or their fragments. In one embodiment, the host cell is prokaryotic, for example, bacteria, such as Escherichia coli.

[0293] For example, eukaryotic microorganisms such as filamentous fungi or yeast are suitable cloning or expression hosts for antibody-encoding vectors. For example, fungal and yeast strains whose glycosylation pathways have been "humanized" result in the production of antibodies with partially or fully human glycosylation patterns. Host cells suitable for expressing glycosylated antibodies are also derived from multicellular organisms (invertebrates and vertebrates). Vertebrate cells can also be used as hosts. For example, mammalian cell lines modified to be suitable for suspension growth can be used. Other examples of useful mammalian host cell lines are monkey kidney CV1 lines (COS-7) transformed with SV40; human embryonic kidney lines (HEK293, 293F or 293T cells), etc. Other useful mammalian host cell lines include Chinese hamster ovary (CHO) cells, including DHFR-CHO cells, CHO-S cells, ExpiCHO, etc.; and myeloma cell lines such as Y0, NS0 and Sp2 / 0. Mammalian host cell lines suitable for producing antibodies are known in the art.

[0294] IV. Production and Purification of Antibody Molecules of the Invention

[0295] In one embodiment, the present invention provides a method for preparing an anti-BTNL2 antibody or fragment thereof (preferably an antigen-binding fragment), wherein the method comprises culturing a host cell comprising a nucleic acid encoding the antibody or fragment thereof (preferably an antigen-binding fragment) under conditions suitable for expression of the nucleic acid, and optionally isolating the antibody or fragment thereof (preferably an antigen-binding fragment). In a certain embodiment, the method further comprises recovering the anti-BTNL2 antibody or fragment thereof (preferably an antigen-binding fragment) from the host cell.

[0296] The polynucleotide encoding the polypeptide chain of the antibody of the present invention can be inserted into one or more vectors for further cloning and / or expression in a host cell. Methods well known to those skilled in the art can be used to construct expression vectors. Once an expression vector comprising one or more nucleic acid molecules of the present invention has been prepared for expression, the expression vector can be transfected or introduced into a suitable host cell. A variety of techniques can be used to achieve this purpose, for example, protoplast fusion, calcium phosphate precipitation, electroporation, retroviral transduction, viral transfection, gene gun, liposome-based transfection or other conventional techniques.

[0297] Antibodies prepared as described herein can be purified by known techniques such as high performance liquid chromatography, ion exchange chromatography, gel electrophoresis, affinity chromatography, size exclusion chromatography, etc. The actual conditions used to purify a particular protein will also depend on factors such as net charge, hydrophobicity, hydrophilicity, etc., and these will be apparent to those skilled in the art.

[0298] The purity of the antibody molecules of the present invention can be determined by any of a number of well-known analytical methods, including size exclusion chromatography, gel electrophoresis, high performance liquid chromatography, and the like.

[0299] V. Assay

[0300] The anti-BTNL2 antibodies provided herein can be identified, screened, or characterized for their physical / chemical properties and / or biological activities by various assays known in the art.

[0301] In one aspect, the antibodies of the invention are tested for their antigen binding activity, for example, by known methods such as ELISA, Western blot, etc. Binding to BTNL2 can be determined using methods known in the art, exemplary methods are disclosed herein. In some embodiments, radioimmunoassay (RIA) or biofilm thin layer interferometry (BLI) or electrochemiluminescence (ECL) or surface plasmon resonance (SPR) or flow cytometry (FACS) is used for measurement.

[0302] On the other hand, competition assays can be used to identify antibodies that compete with any of the anti-BTNL2 antibodies disclosed herein for binding to BTNL2. In certain embodiments, such competing antibodies bind to an epitope (e.g., a linear or conformational epitope) that is identical to or overlaps with an epitope bound by any of the anti-BTNL2 antibodies disclosed herein.

[0303] On the other hand, potential epitopes of the antigen can be determined using hydrogen deuterium exchange mass spectrometry, and / or antigen-antibody binding epitope specificity can be verified by ELISA experiments of antigen-antibody binding, for example as described in Example 6. Antibodies or antigen-binding fragments thereof that bind to the identified epitope are also provided.

[0304] The present invention also provides assays for identifying anti-BTNL2 antibodies with biological activity. Biological activity can include, for example, binding to BTNL2 (e.g., binding to human BTNL2), neutralizing BTNL2's inhibition of T cell activation, etc., for example, by the methods of Examples 3 or 4. Antibodies having such biological activity in vivo and / or in vitro are also provided.

[0305] The present invention also provides a method for identifying the inhibitory activity or structural safety of an antibody molecule against tumors. The method may be known in the art, such as performing a tumor inhibition experiment on a mouse tumor model, such as the method shown in Example 5.

[0306] In certain embodiments, the antibodies of the invention are tested for such biological activities.

[0307] Cells for use in any of the above in vitro assays include cell lines that naturally express BTNL2 or are engineered to express BTNL2. Such cells also include cell lines that express BTNL2 and cell lines that are transfected with DNA encoding BTNL2 but do not normally express BTNL2.

[0308] It will be appreciated that any of the above assays can be performed using the immunoconjugates of the invention in place of or in addition to anti-BTNL2 antibodies.

[0309] It will be appreciated that any of the above assays can be performed using anti-BTNL2 antibodies and additional active agents.

[0310] VI. Immunoconjugates

[0311] In some embodiments, the present invention provides an immunoconjugate comprising any anti-BTNL2 antibody or antigen-binding fragment thereof provided herein. Preferably, the immunoconjugate comprises one or more other therapeutic agents (eg, cytotoxins or small molecule compounds) or a label.

[0312] In some embodiments, the immunoconjugate is an antibody drug conjugate (ADC).

[0313] VII. Pharmaceutical Compositions and Pharmaceutical Formulations

[0314] In some embodiments, the present invention provides a composition, a medicament or a formulation comprising any anti-BTNL2 antibody or fragment thereof (preferably an antigen-binding fragment thereof) or an encoding nucleic acid or an immunoconjugate thereof described herein, preferably a pharmaceutical composition.

[0315] The composition, medicine or preparation of the present invention may further comprise suitable pharmaceutically acceptable excipients, such as pharmaceutically acceptable carriers and pharmaceutically acceptable excipients known in the art, including buffers.

[0316] As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, isotonic and absorption delaying agents, and the like that are physiologically compatible.

[0317] For the use of pharmaceutically acceptable excipients and their uses, see also "Handbook of Pharmaceutical Excipients", 8th edition, RC Rowe, PJ Eskey and S C Owen, Pharmaceutical Press, London, Chicago.

[0318] The compositions, medicaments or preparations of the present invention can be in various forms. These forms include, for example, liquid, semisolid and solid dosage forms, such as liquid solutions (e.g., injections or eye drops), powders or suspensions, liposomes and suppositories. The preferred form depends on the intended mode of administration and therapeutic use.

[0319] Pharmaceutical formulations comprising the antibodies or antigen-binding fragments thereof or immunoconjugates described herein can be prepared by mixing the antibodies or antigen-binding fragments thereof or immunoconjugates thereof of the invention having the desired degree of purity with one or more optional pharmaceutically acceptable excipients, optionally in the form of a lyophilized formulation or an aqueous solution.

[0320] The pharmaceutical composition or formulation of the present invention may also contain more than one active ingredient, as required for the specific indication being treated, preferably those with complementary activities that do not adversely affect each other, for example, the active ingredients are other therapeutic agents, such as chemotherapeutic agents, cytokines, cytotoxic agents, vaccines, other antibodies, small molecule drugs or immunomodulators, etc. The active ingredients are suitably combined in amounts effective for the intended use.

[0321] Sustained-release preparations can be prepared. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, eg, films, or microcapsules.

[0322] In some embodiments, the pharmaceutical composition, medicament or formulation is for use in therapy, such as for preventing or treating a BTNL2-related disease, such as a tumor or an immune system disease (such as an autoimmune disease or inflammation).

[0323] VIII. Pharmaceutical Combinations and Kits

[0324] In some embodiments, the present invention also provides a pharmaceutical combination or pharmaceutical combination product comprising an anti-BTNL2 antibody or fragment thereof (preferably an antigen-binding fragment) of the present invention, or an immunoconjugate thereof, or a composition, formulation, or drug thereof, and one or more other therapeutic agents (e.g., chemotherapeutic agents, cytokines, cytotoxic agents, other antibodies, small molecule drugs, or immunomodulators, etc.).

[0325] Another object of the present invention is to provide a kit comprising the pharmaceutical combination or pharmaceutical combination product of the present invention, preferably in the form of a pharmaceutical dosage unit, whereby dosage units can be provided according to a dosing regimen or a drug administration interval.

[0326] In one embodiment, the kit of parts of the present invention comprises in the same package:

[0327] - a first container containing a pharmaceutical composition, a medicament or a formulation comprising an anti-BTNL2 antibody or a fragment thereof or an immunoconjugate thereof;

[0328] - A second container containing a pharmaceutical composition or medicament or formulation comprising an additional therapeutic agent.

[0329] In some embodiments, the combination product is for use in therapy, eg, for preventing or treating a BTNL2-related disease, such as a tumor or an immune system disease (eg, an autoimmune disease or inflammation).

[0330] IX. Use and Method

[0331] In one aspect, the present invention provides a method for preventing or treating a disease in a subject, comprising administering to the subject an antibody or antigen-binding fragment thereof of the present invention, or an immunoconjugate, composition, medicament, formulation, combination product, or kit comprising the same.

[0332] In some embodiments, the disease is a BTNL2-associated disease. In some embodiments, the disease is associated with abnormal expression or abnormal activity of BTNL2.

[0333] In some embodiments, the disease is, for example, a tumor, such as cancer. The cancer may be in the early, middle, or late stages or may be metastatic. In some embodiments, the tumor may be a solid tumor or a hematological tumor or a metastatic lesion thereof. In some embodiments, the tumor is a malignant tumor. In some embodiments, the cancer includes, but is not limited to, melanoma, lung cancer, breast cancer, lymphoma, head / neck squamous cell carcinoma, liver cancer, renal cell carcinoma, bile duct cancer, gastric cancer, esophageal cancer, intestinal cancer, urinary tract cancer, bladder cancer, pancreatic cancer, neuroendocrine tumors, ovarian cancer, endometrial cancer, cervical cancer, or prostate cancer.

[0334] In some embodiments, the tumor, eg, cancer, would benefit from inhibition of BTNL2.

[0335] In some embodiments, the tumor, e.g., cancer, is a tumor, e.g., cancer, characterized as having protein expression of BTNL2, or having elevated protein levels and / or nucleic acid levels of BTNL2, or having elevated BTNL2 activity, e.g., having protein expression of BTNL2, or having elevated protein levels and / or nucleic acid levels and / or activity of BTNL2 in tumor tissue or tumor cells of the tumor, e.g., cancer (e.g., compared to a reference sample, e.g., compared to normal tissue or normal cells of the same tissue type of a healthy individual, or compared to adjacent normal tissue or adjacent non-cancerous or non-tumor tissue or adjacent cells or non-tumor cells of the patient).

[0336] In some embodiments, the patient's tumor is BTNL2 positive, e.g., it comprises tumor cells that express BTNL2. In some embodiments, the patient's tumor comprises tumor cells that express BTNL2. In some specific embodiments, the tumor, e.g., cancer, is a cancer in which cancer cells or tumor cells have BTNL2 protein on their cell surface, or a cancer in which cancer cells or tumor cells have upregulated levels of BTNL2 on their cell surface compared to non-cancerous cells of the same tissue type.

[0337] BTNL2 expression or upregulated expression can be determined in a diagnostic or prognostic assay by assessing increased levels of BTNL2 present in cells (e.g., by immunohistochemistry; IHC). Alternatively or additionally, the level of nucleic acid encoding BTNL2 in cells can be measured, for example, by fluorescence in situ hybridization (FISH), southern blot, or polymerase chain reaction (PCR) techniques, such as real-time quantitative PCR (RT-PCR). BTNL2 expression can also be studied by measuring shed antigen (e.g., extracellular domain or soluble protein of BTNL2) in biological fluids such as serum. In addition to the above assays, various in vivo assays are also available. For example, cells in a patient can be exposed to an anti-BTNL2 antibody or antigen-binding fragment thereof (e.g., an antibody or antigen-binding fragment thereof described herein), the antibody optionally being labeled with a detectable label (e.g., a radioisotope), and the binding of the antibody to the patient's cells can be assessed, for example, by external scanning for radioactivity or by analyzing a biopsy taken from a patient previously exposed to the antibody.

[0338] In some embodiments, the subject has been identified as likely to respond to a BTNL2 antagonist. The presence or level of BTNL2 in the biological sample of interest can indicate whether the subject from which the biological sample was derived is likely to respond to the BTNL2 antagonist. In some embodiments, the test sample is derived from cancer cells or tissues, or tumor-infiltrating immune cells. In certain embodiments, the presence or upregulated level of BTNL2 in the test biological sample indicates the likelihood of a response.

[0339] The term "BTNL2 antagonist" refers to an agent capable of antagonizing BTNL2 expression or activity, such as an anti-BTNL2 antibody or antigen-binding fragment thereof or an immunoconjugate thereof, such as an anti-BTNL2 antibody or antigen-binding fragment thereof described herein, or an immunoconjugate comprising the same.

[0340] As used herein, the term "upregulated" refers to an overall increase in the protein level or activity of BTNL2 in a test sample by no less than 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% or more compared to the protein level or activity of BTNL2 in a reference sample detected using the same antibody. The reference sample can be a control sample obtained from a healthy or non-diseased individual, or a healthy or non-diseased sample obtained from the same individual from which the test sample is obtained. For example, the reference sample can be a non-diseased sample adjacent to or near the test sample (e.g., a tumor).

[0341] The antibodies or antigen-binding fragments thereof of the present invention (as well as immunoconjugates, compositions, pharmaceutical compositions, preparations, combination products, kits, etc. comprising the same) can be administered by any suitable method, including parenteral administration, intrapulmonary administration and intranasal administration, and, if local treatment requires, intralesional administration. Parenteral injection or infusion includes intramuscular, intravenous, intraarterial, intraperitoneal or subcutaneous injection or infusion. Depending on whether the medication is short-term or long-term to a certain extent, any suitable route can be used, such as by injection, such as intravenous or subcutaneous injection. Various medication schedules are contemplated herein, including, but not limited to, single administration or multiple administrations at multiple time points, push administration, and pulse infusion.

[0342] For the prevention or treatment of disease, the appropriate dosage of the antibodies or antigen-binding fragments thereof (and immunoconjugates, compositions, pharmaceutical compositions, formulations, combination products, kits, etc. comprising the same) of the invention (when used alone or in combination with one or more other therapeutic agents) will depend on the type of disease to be treated, the type of antibody, the severity and course of the disease, whether the administration is for preventive or therapeutic purposes, previous treatments, the patient's clinical history and response to the antibody, and the discretion of the attending physician. The antibody is suitably administered to the patient as a single treatment or over a series of treatments.

[0343] In other aspects, the present invention provides use of an antibody or antigen-binding fragment thereof, or an immunoconjugate or composition or combination product comprising the same, of the present invention in the production or preparation of a medicament for use as described herein, e.g., for preventing or treating the relevant diseases or conditions mentioned herein.

[0344] In other aspects, the present invention provides use of the antibodies or antigen-binding fragments thereof of the present invention, or immunoconjugates or compositions or combination products comprising the same, for the uses described herein, such as for preventing or treating the relevant diseases or disorders mentioned herein.

[0345] In other aspects, the present invention provides an antibody or antigen-binding fragment thereof of the present invention, or an immunoconjugate or composition or combination product comprising the same, for use in therapy, such as for the uses described herein, such as for preventing or treating the relevant diseases or disorders mentioned herein.

[0346] In some embodiments, the BTNL2 antibody or antigen-binding fragment thereof (as well as immunoconjugates, compositions, pharmaceutical compositions, formulations, etc. comprising the same) can also be administered in combination with one or more other therapies, such as treatment modalities and / or other therapeutic agents, for the uses described herein, e.g., for preventing and / or treating the relevant diseases or conditions mentioned herein.

[0347] In some embodiments, the treatment modality is, for example, surgery or radiotherapy. In some embodiments, the treatment modality includes surgery, radiotherapy (e.g., external beam radiation therapy, which involves three-dimensional conformal radiation therapy in which the irradiation area is designed), local irradiation (e.g., irradiation directed to a preselected target or organ), or focused irradiation), etc.

[0348] In some embodiments, the other therapeutic agent is, for example, a chemotherapeutic agent, a cytokine, a cytotoxic agent, other antibodies, a small molecule drug, or an immunomodulator (eg, an immunosuppressant or agonist). Exemplary immunomodulators include immunosuppressants or anti-inflammatory agents.

[0349] The term "cytotoxic agent" as used herein refers to a substance that inhibits or prevents the function of cells and / or causes cell death or destruction.

[0350] "Chemotherapeutic agents" include chemical compounds useful in treating cancer or immune system disorders.

[0351] The term "small molecule drug" refers to low molecular weight organic compounds that are capable of regulating biological processes. "Small molecules" are defined as molecules with a molecular weight of less than 10 kD, typically less than 2 kD, and preferably less than 10 kD. Small molecules include, but are not limited to, inorganic molecules, organic molecules, organic molecules containing inorganic components, molecules containing radioactive atoms, synthetic molecules, peptide mimetics, and antibody mimics. As therapeutic agents, small molecules can be more cell-permeable, less susceptible to degradation, and less prone to eliciting an immune response than macromolecules.

[0352] As used herein, the term "immunomodulator" refers to a natural or synthetic agent or drug that inhibits or modulates an immune response. The immune response can be a humoral response or a cellular response. Immunomodulators include immunosuppressants. In some embodiments, the immunomodulators of the present invention include immune checkpoint inhibitors or immune checkpoint agonists.

[0353] In some embodiments, the antibody combinations described herein can be administered separately, e.g., as separate antibodies, or linked (e.g., as a bispecific or trispecific antibody molecule).

[0354] Such combination therapies encompass combined administration (e.g., two or more therapeutic agents contained in the same formulation or separate formulations), and separate administration, in which case administration of the antibodies of the invention can occur before, concurrently with, and / or after administration of the other therapeutic agents and / or agents.

[0355] The subject can be a mammal, e.g., a primate, preferably a higher primate, e.g., a human (e.g., an individual suffering from or at risk of suffering from a disease described herein). In one embodiment, the subject suffers from or is at risk of suffering from a disease described herein (e.g., cancer). In some embodiments, the subject receives or has received other treatments, e.g., chemotherapy and / or radiation therapy.

[0356] IX. Methods, Kits, and Compositions for Diagnosis and Detection

[0357] In certain embodiments, any of the anti-BTNL2 antibodies or antigen-binding fragments thereof provided herein can be used to detect the presence of BTNL2 (particularly human BTNL2) in a biological sample.

[0358] When the term "detection" is used herein, it includes quantitative or qualitative detection, and exemplary detection methods can be related to immunohistochemistry, immunocytochemistry, flow cytometry (e.g., FACS), magnetic beads of antibody molecule complexes, ELISA assays, PCR-technology (e.g., RT-PCR). In certain embodiments, biological samples are other liquid samples of blood, serum or biological origin. In certain embodiments, biological samples include cells or tissues. In some embodiments, biological samples are from tumors or immune system diseases (e.g., autoimmune diseases or inflammation) related lesions. In some embodiments, biological samples are tumor cells or tumor tissues.

[0359] In one embodiment, an anti-BTNL2 antibody or antigen-binding fragment thereof is provided for use in a method of diagnosis or detection.

[0360] In one embodiment, a composition or kit for use in a diagnostic or detection method is provided, comprising an anti-BTNL2 antibody or antigen-binding fragment thereof as provided herein. In some embodiments, the composition or kit is used to select or diagnose a subject or disease suitable for treatment with a BTNL2 antagonist (e.g., an anti-BTNL2 antibody or antigen-binding fragment thereof or immunoconjugate thereof) or a pharmaceutical composition or pharmaceutical combination product comprising the same. In some embodiments, the present invention provides a use of an anti-BTNL2 antibody or antigen-binding fragment thereof for preparing a composition or kit for selecting or diagnosing a subject or disease suitable for treatment with a BTNL2 antagonist (e.g., an anti-BTNL2 antibody or antigen-binding fragment thereof or immunoconjugate thereof, such as an anti-BTNL2 antibody or antigen-binding fragment thereof described herein, or an immunoconjugate comprising the same) or a composition or drug or formulation or combination product or kit comprising the same.

[0361] In another aspect, methods for detecting the presence of BTNL2 in a biological sample are provided. In certain embodiments, the method comprises detecting the presence of BTNL2 protein in the biological sample. In certain embodiments, BTNL2 is human BTNL2. In certain embodiments, the method comprises contacting the biological sample with an anti-BTNL2 antibody or antigen-binding fragment thereof as described herein under conditions that allow binding of the anti-BTNL2 antibody or antigen-binding fragment thereof to BTNL2, and detecting whether a complex forms between the anti-BTNL2 antibody or antigen-binding fragment thereof and BTNL2. The formation of a complex indicates the presence of BTNL2. The method can be an in vitro or in vivo method.

[0362] In one embodiment, an anti-BTNL2 antibody or antigen-binding fragment thereof is used to select or diagnose a subject or disease suitable for treatment with a BTNL2 antagonist (e.g., an anti-BTNL2 antibody or antigen-binding fragment thereof or immunoconjugate thereof, e.g., an anti-BTNL2 antibody or antigen-binding fragment thereof described herein, or an immunoconjugate comprising the same), or a composition or medicament or formulation or combination product or kit comprising the same, e.g., wherein BTNL2 is a biomarker for selecting the disease or subject.

[0363] In some embodiments, a method of selecting or diagnosing a subject or disease suitable for treatment with a BTNL2 antagonist (e.g., an anti-BTNL2 antibody or antigen-binding fragment thereof, or an immunoconjugate thereof, such as an anti-BTNL2 antibody or antigen-binding fragment thereof described herein, or an immunoconjugate comprising the same) or a composition or medicament or formulation or combination product or kit comprising the same is provided, the method comprising:

[0364] (1) detecting the level of BTNL2 in a biological sample from a subject using an anti-BTNL2 antibody or an antigen-binding fragment thereof, or a composition or kit comprising the anti-BTNL2 antibody or an antigen-binding fragment thereof; and

[0365] (2) the presence of BTNL2 protein indicates that the subject is likely to respond to a BTNL2 antagonist (e.g., an anti-BTNL2 antibody or antigen-binding fragment thereof or immunoconjugate thereof, such as an anti-BTNL2 antibody or antigen-binding fragment thereof described herein, or an immunoconjugate comprising the same) or a composition or drug or formulation or combination product or kit comprising the same; or the disease is likely to be treated with a BTNL2 antagonist (e.g., an anti-BTNL2 antibody or antigen-binding fragment thereof or immunoconjugate thereof, such as an anti-BTNL2 antibody or antigen-binding fragment thereof described herein, or an immunoconjugate comprising the same) or a composition or drug or formulation or combination product or kit comprising the same; or

[0366] (1′) detecting the level of BTNL2 in a reference sample and a biological sample from a subject using an anti-BTNL2 antibody or an antigen-binding fragment thereof, or a composition or a kit comprising the anti-BTNL2 antibody or an antigen-binding fragment thereof; and

[0367] (2') Upregulated expression levels of BTNL2 protein compared to a reference sample indicate that the subject is more susceptible to responding to a BTNL2 antagonist (e.g., an anti-BTNL2 antibody or an antigen-binding fragment thereof or an immunoconjugate thereof, such as an anti-BTNL2 antibody or an antigen-binding fragment thereof described herein, or an immunoconjugate comprising the same) or a composition, drug, formulation, combination product, or kit comprising the same; or that the disease is more susceptible to being treated with a BTNL2 antagonist (e.g., an anti-BTNL2 antibody or an antigen-binding fragment thereof or an immunoconjugate thereof, such as an anti-BTNL2 antibody or an antigen-binding fragment thereof described herein, or an immunoconjugate comprising the same) or a composition, drug, formulation, combination product, or kit comprising the same.

[0368] The term "upregulated" refers to an overall increase in the level of BTNL2 protein in the test sample, for example, by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% or more, compared to the level of BTNL2 protein in a reference sample detected using the same antibody. The reference sample can be a control sample obtained from a healthy or non-diseased individual, or a healthy or non-diseased sample obtained from the same individual from which the test sample is obtained. For example, the reference sample can be a non-diseased sample adjacent to or near the test sample.

[0369] In some embodiments, the subject suffers from a disease or condition of interest as described herein. In some embodiments, the subject suffers from a tumor, such as cancer. The cancer may be in the early, mid, or late stages or may be metastatic. In some embodiments, the cancer may be a solid tumor or a hematologic tumor. In some embodiments, the cancer includes, but is not limited to, melanoma, lung cancer, breast cancer, lymphoma, head / neck squamous cell carcinoma, liver cancer, renal cell carcinoma, bile duct cancer, gastric cancer, esophageal cancer, intestinal cancer, urinary tract cancer, bladder cancer, pancreatic cancer, neuroendocrine tumors, ovarian cancer, endometrial cancer, cervical cancer, or prostate cancer.

[0370] In some embodiments, the biological sample is a sample or tumor cell from tumor tissue. In some embodiments, the reference sample is a sample or normal cell of normal tissue of the same tissue type from a healthy individual, or adjacent normal tissue or adjacent non-cancerous or non-tumor tissue or cell or adjacent normal cell or non-tumor cell of the patient.

[0371] In certain embodiments, labeled anti-BTNL2 antibodies or antigen-binding fragments thereof are provided. Labels include, but are not limited to, directly detectable labels or moieties (e.g., fluorescent labels, chromophore labels, electron-dense labels, chemiluminescent labels, and radioactive labels), as well as moieties that are indirectly detected, such as enzymes or ligands, e.g., via an enzymatic reaction or molecular interaction.

[0372] In some embodiments provided herein, the sample is obtained before treatment with a BTNL2 antagonist (e.g., an anti-BTNL2 antibody or antigen-binding fragment thereof, or an immunoconjugate thereof, such as an anti-BTNL2 antibody or antigen-binding fragment thereof described herein, or an immunoconjugate comprising the same), or a composition or medicament or formulation or combination product or kit comprising the same. In some embodiments, the sample is obtained before treatment with other therapies. In some embodiments, the sample is obtained during treatment with other therapies, or after treatment with other therapies.

[0373] The present invention therefore relates to a method for treating a disease that is amenable to treatment with a BTNL2 antagonist (e.g., an anti-BTNL2 antibody or antigen-binding fragment thereof, or an immunoconjugate thereof, such as an anti-BTNL2 antibody or antigen-binding fragment thereof described herein, or an immunoconjugate comprising the same), or a composition or medicament or formulation or combination product or kit comprising the same, the method comprising

[0374] (1) using the anti-BTNL2 antibodies or antigen-binding fragments thereof described herein, or compositions or kits comprising the same, to select or diagnose subjects or diseases suitable for treatment with a BTNL2 antagonist (e.g., an anti-BTNL2 antibody or antigen-binding fragment thereof, or an immunoconjugate thereof, such as an anti-BTNL2 antibody or antigen-binding fragment thereof described herein, or an immunoconjugate comprising the same), or a composition or drug or formulation or combination product or kit comprising the same;

[0375] (2) administering a BTNL2 antagonist (e.g., an anti-BTNL2 antibody or an antigen-binding fragment thereof, or an immunoconjugate thereof, such as an anti-BTNL2 antibody or an antigen-binding fragment thereof described herein, or an immunoconjugate comprising the same) or a composition or drug or formulation or combination product or kit comprising the same to the subject or the subject suffering from the disease.

[0376] In some embodiments, BTNL2 is detected prior to treatment, eg, prior to initiation of treatment or prior to a treatment after a treatment interval. Example

[0377] Example 1. Preparation of recombinant protein antigen

[0378] Construct and synthesize cloning primer pairs, the sequences are as follows:

[0379] His-BTNL2-F:CAAATGGGTCGCGGATCCGAATTCATGGTGGATTTTCCAGGCTAC

[0380] (SEQ ID NO:32), and

[0381] His-BTNL2-R: CTCGAGTGCGGCCGCAAGCTTGCTATGAGAGAGAAAAAGTTGCG (SEQ ID NO: 33).

[0382] A DNA fragment encoding the coding sequence of the extracellular domain (ECD) of human BTNL2 (lysine 24 to serine 453) fused to the coding sequence of a histidine tag 6×His was obtained by PCR and cloned into the expression vector pET-28a (Novagen). The resulting construct was then transformed into BL21 competent cells (Beijing Biomed Gene Technology Co., Ltd., BC202-01). After induction of expression, the protein was purified using an NTA column (Beijing Kangrun Chengye Biotechnology Co., Ltd., G106-100) to obtain the hBTNL2-ECD-His protein.

[0383] Example 2. Preparation of mouse anti-human BTNL2 monoclonal antibody

[0384] 2.1 Immunity

[0385] Five 6-8 week old female Balb / c mice were purchased from Beijing Weitonglihua Laboratory Animal Technology Co., Ltd. and used for antigen immunization to produce antibodies.

[0386] Mice were immunized subcutaneously with 100 μg of recombinant hBTNL2-ECD-His protein per mouse at the back. Each mouse was immunized three times, with monthly intervals, using Freund's complete adjuvant (Sigma, F5881) for the first immunization and incomplete Freund's adjuvant (Sigma, F5506) for the subsequent two immunizations. Three days before cell fusion, each mouse received an intraperitoneal booster injection of 100 μg of unadjuvanted hBTNL2-ECD-His protein.

[0387] 2.2 Cell fusion

[0388] Mouse myeloma cell line SP2 / 0 (Wuhan Punosai Life Science Co., Ltd., CL-0217) was fused with spleen cells from immunized Balb / c mice at a ratio of 1:6. The cells were then placed in a 96-well cell culture plate and screened with complete medium containing HAT (Sigma, H0262) (Beijing Zhongke Maichen Technology Co., Ltd., CM10040). The medium was replaced by half once a week, and clones were visible after 2 weeks.

[0389] 2.3 Hybridoma supernatant screening

[0390] Hybridoma cell culture supernatants were screened using an enzyme-linked immunosorbent assay (ELISA) technique: 96-well clear flat-bottom polystyrene microplates (Corning, CLS 9018) were coated with recombinant hBTNL2-His protein. After blocking, the hybridoma cell culture supernatant obtained in the previous step was added. Then, horseradish peroxidase (HRP)-conjugated anti-mouse secondary antibody (Jackson Immuno Research, 115-035-003) was added. Clones whose supernatants reacted positively with hBTNL2-ECD-His protein but negatively with control His protein were selected, indicating that they secreted mouse anti-human BTNL2 antibodies. These clones were cultured in complete medium containing HT (Sigma, H0137) and subcloned.

[0391] 2.4 Subcloning

[0392] For each selected hybridoma cell line, cells were counted and diluted to 1 cell / 200 μL in complete culture medium containing HT, plated in 96-well cell culture plates, and cultured at 37°C. After single clones were formed, hybridoma subclones whose supernatants reacted positively with the hBTNL2-ECD-His protein were screened again by ELISA.

[0393] 2.5 Flow cytometry detection of antibody binding to cell surface BTNL2

[0394] By using human embryonic kidney HEK293T cells (System Biosciences) expressing hBTNL2-Flag, positive hybridoma strains were screened by FACS using a BD FACSAria II. Cells were stained with hybridoma supernatant samples and then subjected to secondary antibody binding using goat anti-mouse IgG (Thermo, A11029) linked to FITC. Cell lines transfected with the corresponding empty vector plasmids were used as negative controls (negative controls also included blank supernatant, addition of secondary antibodies alone, etc., with no false positive results, data not shown). Flow cytometry was followed by analysis using FlowJo software, and hybridoma cell lines that were positive for both FACS and ELISA were selected for final analysis.

[0395] 2.6 Subtype Testing

[0396] The positive hybridoma cells were screened using a commercially available mouse monoclonal antibody subtype identification kit (Proteintech, PK20002-480T) to determine the light and heavy chain subtypes of the anti-human BTNL2 antibody they secreted. A hybridoma cell line, designated 5B08-19, secreting anti-human BTNL2 monoclonal antibodies was identified, with the heavy chain subtype identified as IgG1 and the light chain subtype as κ.

[0397] The antibody sequences are summarized in Table 3.

[0398] Table 3: Summary of Antibody Sequences

[0399] Example 3. Preparation of humanized anti-human BTNL2 monoclonal antibody

[0400] 3.1 Antibody Sequencing and Humanization

[0401] The cDNA coding sequence of the antibody secreted by the 5B08-19 hybridoma cell line obtained in Example 2 was determined and translated into an amino acid sequence. The human germline immunoglobulin sequences with the highest sequence identity to the light and heavy chains of the 5B08-19 antibody were selected as templates (see Table 4) for CDR transplantation, and the CDR regions were modeled based on homology. The amino acids that differed between the mouse antibody and the human template were reverse mutated to determine the final humanized antibody sequence, and the variable region was fused with the constant region of human IgG1κ.

[0402] Table 4: Human germline sequence numbers used as templates in different humanization schemes

[0403] 3.2 Construction and expression of humanized antibodies

[0404] Based on the light and heavy chain amino acid sequences determined in the previous step, reverse translation was performed using codons favored by Chinese hamster ovary carcinoma CHO cells (ECACC, 85051005). This resulted in the identification of the cDNA sequence encoding the humanized anti-BTNL2 antibody. After synthesis, the cDNA was inserted into the pcDNA3.4-TOPO vector (Invitrogen, A14697) and transfected into CHO cells via electroporation for expression. Following expression, the CHO cell culture supernatant was harvested and the antibody protein was isolated and purified using Protein A affinity chromatography (Nanomicron Technology, NMab™ Pro Protein A, 17010-150100). Purity and other quality control tests were performed and the protein was quantified.

[0405] 3.3 Biacore analysis to measure the binding kinetics of antibodies to human BTNL2

[0406] 100 nM hBTNL2-ECD-His protein was coupled to a surface plasmon resonance (SPR) Biacore detection chip (cytiva, protein A chip, catalog number: 29127556). Mouse or humanized anti-BTNL2 antibody was passed through the BIAcore T200 at a concentration of 2 μg / mL and a flow rate of 30 μL / min. The association rate constant k was detected and recorded. a , dissociation rate constant k d , through K D =k d / k a Calculate the dissociation constant K D , some affinity data are summarized in Table 1 below.

[0407] Table 1: Antibody affinity data.

[0408] The results showed that the anti-BTNL2 antibodies, before and after humanization, bound to hBTNL2-ECD-His with comparable affinity, as detected using surface plasmon resonance.

[0409] Example 4. Identification of the in vitro neutralizing ability of humanized anti-BTNL2 antibodies

[0410] Neutralizing anti-human BTNL2 antibodies were identified using a PBMC-derived human T cell activation assay. T cell activator anti-CD3 antibody (Biolegend, 317326) and anti-CD28 antibody (Biolegend, 302943) were coated onto high-affinity 96-well cell culture plates (Corning, 3590) at a final concentration of 1 μg / ml and incubated at 4°C overnight. After washing once with pH 7.2-7.4 PBS, hBTNL2-ECD-His protein was coated onto the corresponding wells at a final concentration of 5 μg / ml and incubated at room temperature for 2 hours. After washing once with PBS, anti-human BTNL2 antibody was diluted to a gradient of 0 μg / ml, 10 μg / ml, 20 μg / ml, and 40 μg / ml, added to the corresponding wells, and incubated at room temperature for 2 hours. After incubation, the plates were washed once with PBS, and then human PBMC (1×10 5 The cells were cultured at 37°C for 48 h, and the PBMC culture supernatant was collected. The secretion level of human interleukin-2 (IL-2, Thermo, 88-7025-76) was detected by ELISA to characterize the degree of T cell activation.

[0411] The results are shown in Figure 1. Taking the humanized anti-BTNL2 antibody 5B08-19-1-4 as an example, the addition of hBTNL2-ECD-His protein inhibited the activation of T cells by anti-CD3 / CD28 antibodies to a certain extent, while the humanized antibody prepared by the present invention effectively neutralized the suppressed state of T cells, which was reflected in the upregulation of IL-2 expression, and the neutralizing effect of the antibody showed good dose dependence.

[0412] Example 5. Inhibitory effect of humanized anti-BTNL2 antibody 5B08-19-1-4 on tumor growth in vivo

[0413] The anti-tumor efficacy of humanized anti-BTNL2 antibodies was evaluated by establishing an in vivo tumor model of melanoma cells A375 (Wuhan Pronocell Life Science Co., Ltd., CL-0014) in mice with humanized immune systems.

[0414] A375 cells were cultured at 5 × 10 6 The cells / 0.1 mL / mouse were inoculated subcutaneously on the right flank of female 6-8 week old huPBMC-NOG-dKO mice (immunocompromised NOG mice with PBMC xenografts, purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd.). The tumors were grown to an average volume of approximately 100 ± 50 mm. 3 At the time of the experiment, 15 mice with moderate tumor volume were selected and divided into 3 groups according to tumor volume, namely the control hu IgG group (InVivoMab human IgG1, BIOXCELL, BE0297) and two dose groups of anti-BTNL2 antibody 5B08-19-1-4 at 15 mg / kg and 30 mg / kg. The administration route was tail vein injection, and the antibody was injected once every three days for a total of 6 injections. After the end of the administration, the mice were observed for another three days. The tumor volume and mouse body weight were measured twice a week during the experiment. The tumor volume formula V (mm 3 )=0.5×length (mm)×width (mm)×width (mm), and the relative tumor inhibition rate was calculated according to the following formula: TGI=[1-(T i -T0) / (V i -V0)]×100%

[0415] (T i : mean tumor volume of the treatment group on the i-th day of administration, T0: mean tumor volume of the treatment group on the 0th day of administration; V i : the mean tumor volume of the control group on the i-th day of administration, V0: the mean tumor volume of the control group on the 0th day of administration)

[0416] At the end of the experiment, the mice were euthanized, the tumors were removed, weighed and recorded, and the human CD45 infiltrates in the tumors of each group were detected by flow cytometry.+ Total lymphocytes, CD8 + and CD4 + T lymphocyte (Biolegend, 304012; 344706; 357406) ratio.

[0417] Results: At the end of the experiment, the average tumor volume of the control hu IgG group was 967.23 mm 3 Compared with the control group, the tumor volume of the anti-BTNL2 antibody 5B08-19-1-4 experimental group was significantly reduced (the average tumor volume was 498.66 mm 3 、312.62mm 3 The tumor volume data of all mice are summarized in Figure 2a; the tumor volume data of each mouse in each group are shown in Figures 2b-d). At the same time, the tumor weight was significantly reduced (see Figure 2e), that is, the antibody showed a significant anti-tumor effect, with tumor inhibition rates of 53.11% and 74.56%, respectively (see Table 2), both above 50%. In addition, compared with the control group, the tumor-infiltrating human CD45 + The proportion of total lymphocytes increased, CD8 + The proportion of cytotoxic T lymphocytes increased, CD4 + There was no significant difference in the proportion of helper T lymphocytes (see Figure 3a-c). During the experiment, the body weight of the experimental animals in each group did not decrease significantly (see Figure 4), indicating that the tested antibodies were well tolerated.

[0418] Table 2: Antibody treatment effects

[0419] Example 6. Determination of Antibody Binding Epitope

[0420] By analyzing the antigen-antibody spatial epitope by hydrogen deuterium exchange mass spectrometry (HDX-MS) (see, for example, Masson GR…, Zheng J, et al. Recommendations for performing, interpreting and reporting hydrogen deuterium exchange mass spectrometry (HDX-MS) experiments. Nat Methods. 2019 Jul; 16(7): 595-602; Zheng J et al. Protein dynamics and conformational changes explored by Hydrogen / deuterium exchange Mass spectrometry. Current Opinion of Structure Biology. 2019; 52: 1-9; or Zheng J, et al. HDX-MS reveals dysregulated checkpoints that compromise discrimination against self RNA during RIG-I mediated autoimmunity. Nature communications. 2018; 9(1): 5366), it was found that the potential epitope region for the interaction between antibody 5B08-19-1-4 and BTNL2 antigen is: DGWFPQPHVPWRDMEG (SEQ ID NO:34), i.e., amino acids 384-399 of BTNL2. Furthermore, an ELISA experiment was performed using different truncated and mutant proteins of the BTNL2 antigen to bind to the antibody to verify the antigen-antibody binding epitope specificity. The steps are as follows:

[0421] The antigens were dissolved in ELISA Coating Buffer (Thermo Fisher, CB01100) at a concentration of 20 ng / mL. Six groups were used: the full-length extracellular antigen hBTNL2-ECD-Fc (SEQ ID NO: 35) with the Fc region linked to the C-terminus; truncated antigen proteins with the Fc region linked to the C-terminus: hBTNL2-IgV1-Fc (containing only IgV1, SEQ ID NO: 36); hBTNL2-δIgV1-Fc (lacking the IgV1 domain, SEQ ID NO: 37); hBTNL2-IgV2-Fc (containing only IgV2, SEQ ID NO: 38); hBTNL2-δIgV2-Fc (lacking the IgV2 domain, SEQ ID NO: 39); and the antigen-binding epitope mutant protein hBTNL2-δ(384-399)-Fc (lacking the 384-399 sequence, SEQ ID NO: 40) with the Fc region linked to the C-terminus. The antigen protein was serially diluted to concentrations of 10, 5, 2.5, 1.25, 0.625, 0.3125, and 0.15625 ng / mL. 100 μL of the diluted antigen protein was coated onto a high-affinity 96-well plate at each well and incubated overnight at 4°C. The supernatant was discarded, and the plate was washed three times with 0.05% PBST and patted dry. Antibody 5B08-19-1-4 was prepared at 0.5 μg / mL and coated onto a 96-well plate at each well. The plate was incubated at 37°C for 1 hour. The supernatant was discarded, and the plate was washed three times with 0.05% PBST and patted dry. The secondary antibody MLC (Goat anti-Human Kappa Light Chain Secondary Antibody, HRP, A18853, Invitrogen) was prepared at a 5000-fold dilution and coated onto a 96-well plate at each well at each well. The plate was incubated at room temperature for 1 hour. Discard the supernatant, wash the plate six times with 0.05% PBST, and pat dry. Add TMB colorimetric solution and incubate at room temperature in the dark for 10 min. Stop the color development with 2 M sulfuric acid and measure absorbance at 450 nm. Plot the correlation between the OD value recorded for each group and the concentration.

[0422] As shown in Figure 5, the extracellular full-length protein hBTNL2-ECD-Fc, the truncated protein hBTNL2 lacking the IgV1 domain hBTNL2-δIgV1-Fc, and the truncated protein hBTNL2 lacking the IgV2 domain hBTNL2-δIgV2-Fc have good binding affinity to the 5B08-19-1-4 antibody, indicating that the binding of the 5B08-19-1-4 antibody to hBTNL2 is independent of the IgV1 and IgV2 domains; the mutant protein hBTNL2-δ(384-399)-Fc lacking the 384-399 domain of hBTNL2 has no affinity to the 5B08-19-1-4 antibody, indicating that amino acids 384-399 of BTNL2 are the key epitope for the binding of the 5B08-19-1-4 antibody to BTNL2.

[0423] Example 7. FACS assay to detect the effect of humanized anti-human BTNL2 antibody on T lymphocytes killing tumor cell lines

[0424] 1. FACS assay to detect the effect of humanized anti-human BTNL2 antibody 5B08-19-1-4 on T lymphocyte killing of human lung cancer cell line H460:

[0425] High-affinity 96-well plates (Corning, 3590) were coated with 2 μg / mL anti-CD3 antibody (Biolegend, 100340) and 1 μg / mL anti-CD28 antibody (Biolegend, 102116) at 4°C overnight at 100 μL per well. Mouse spleen CD8+ T cells were isolated using a kit (Miltenyi Biotec, 130-104-075). Antibody 5B08-19-1-4 was added to 2×10-4-containing plates at a density of 2×10 5 / mL, H460 cells (ATCC, HTB-177) were incubated at 37°C for 30 minutes. The cells were seeded into wells pre-coated with T cell activator at H460:T cell ratios of 1:1, 1:2, and 1:10. The cells were cultured at 37°C for 18 hours. The proportion of apoptotic cells was determined by flow cytometry using the FITC Annexin V Apoptosis Detection Kit (BD Pharmingen, 556547). The results are shown in Figure 6.

[0426] Figure 6 shows that the apoptotic rate of H460 tumor cells gradually increases with the increase in T cell counts. Adding the 5B10-19-1-4 antibody at concentrations of 10 μg / mL and 20 μg / mL significantly enhanced the apoptotic rate of tumor cells at various T cell ratios. This suggests that blocking BTNL2 with the 5B10-19-1-4 antibody can enhance the killing ability of T cells against the lung cancer cell line H460.

[0427] 2. FACS assay to detect the effect of humanized anti-human BTNL2 antibody 5B08-19-1-4 on T lymphocytes killing human hepatocellular carcinoma cell line HepG2:

[0428] High-affinity 96-well plates (Corning, 3590) were coated with 2 μg / mL anti-CD3 antibody (Biolegend, 100340) and 1 μg / mL anti-CD28 antibody (Biolegend, 102116) at 4°C overnight at 100 μL per well. Mouse spleen CD8+ T cells were isolated using a kit (Miltenyi Biotec, 130-104-075). Antibody 5B08-19-1-4 was added to 2×10-4-containing plates at a density of 2×10 5 / mL, HepG2 cells (ATCC, HB-8065) ​​in a volume of 100 μL were incubated at 37°C for 30 min; the cells were seeded into well plates pre-coated with T cell activators at a HepG2:T cell ratio of 1:1, 1:2, and 1:10; the cells were cultured at 37°C for 18 h; and the proportion of apoptotic cells was detected by flow cytometry using the FITC Annexin V Apoptosis Detection Kit (BD Pharmingen, 556547).

[0429] The results are shown in Figure 7, which shows that the apoptotic rate of HepG2 tumor cells gradually increased with the increase in T cell counts. Adding the 5B10-19-1-4 antibody at concentrations of 10 μg / mL and 20 μg / mL significantly enhanced the apoptotic rate of tumor cells at various T cell ratios. This suggests that blocking BTNL2 with the 5B10-19-1-4 antibody can enhance the killing ability of T cells against the HepG2 liver cancer cell line.

[0430] Table 5: Sequence Listing

Claims

1. An antibody or antigen-binding fragment thereof that binds to human BTNL2, said antibody comprising (i) three complementarity-determining regions HCDR1, HCDR2, and HCDR3 contained in VH as shown in SEQ ID NO:1, and three complementarity-determining regions LCDR1, LCDR2, and LCDR3 contained in VL as shown in SEQ ID NO:2; (ii) three complementarity-determining regions HCDR1, HCDR2, and HCDR3 contained in VH as shown in SEQ ID NO:16, and three complementarity-determining regions LCDR1, LCDR2, and LCDR3 contained in VL as shown in SEQ ID NO:17; (iii) three complementarity-determining regions HCDR1, HCDR2, and HCDR3 contained in VH as shown in SEQ ID NO:20, and three complementarity-determining regions LCDR1, LCDR2, and LCDR3 contained in VL as shown in SEQ ID NO:21; (iv) three complementarity-determining regions HCDR1, HCDR2, and HCDR3 contained in VH as shown in SEQ ID NO:24, and three complementarity-determining regions LCDR1, LCDR2, and LCDR3 contained in VL as shown in SEQ ID NO:25; or (v) three complementarity-determining regions HCDR1, HCDR2, and HCDR3 contained in VH as shown in SEQ ID NO:28, and three complementarity-determining regions LCDR1, LCDR2, and LCDR3 contained in VL as shown in SEQ ID NO:29; Optionally, wherein said HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 are numbered according to the Kabat numbering system.

2. An antibody or antigen-binding fragment thereof that binds to BTNL2, said antibody comprising three complementarity-determining regions HCDR of the heavy-chain variable region and three complementarity-determining regions LCDR of the light-chain variable region, wherein HCDR1 comprises or consists of the amino acid sequence shown in SEQ ID NO:3, HCDR2 comprises or consists of the amino acid sequence shown in SEQ ID NO:4, HCDR3 comprises or consists of the amino acid sequence shown in SEQ ID NO:5, LCDR1 comprises or consists of the amino acid sequence shown in SEQ ID NO:6, LCDR2 comprises or consists of the amino acid sequence shown in SEQ ID NO:7, and LCDR3 comprises or consists of the amino acid sequence shown in SEQ ID NO:

8.

3. The antibody or antigen-binding fragment thereof that binds to BTNL2 according to claim 1 or 2, said antibody comprising a heavy-chain variable region, wherein said heavy-chain variable region comprises an amino acid sequence having at least 90% identity to the amino acid sequence selected from SEQ ID NO:1, 16, 20, 24, or 28, or consists of said sequence; or comprises the amino acid sequence selected from SEQ ID NO:1, 16, 20, 24, or 28, or consists of said sequence.

4. The antibody or antigen-binding fragment thereof that binds to BTNL2 according to claim 1 or 2, wherein the antibody comprises a light chain variable region, and the light chain variable region comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2, 17, 21, 25 or 29, or consists of said sequence; or comprises the amino acid sequence shown in SEQ ID NO: 2, 17, 21, 25 or 29, or consists of said sequence.

5. The antibody or antigen-binding fragment thereof that binds to BTNL2 according to claim 1 or 2, wherein the antibody comprises a heavy chain variable region VH and a light chain variable region VL as follows (i) VH comprising the amino acid sequence shown in SEQ ID NO: 1 or an amino acid sequence having at least 90% identity thereto or consisting of said amino acid sequence, and VL comprising the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity thereto or consisting of said amino acid sequence; (ii) VH comprising the amino acid sequence shown in SEQ ID NO: 16 or an amino acid sequence having at least 90% identity thereto or consisting of said amino acid sequence, and VL comprising the amino acid sequence shown in SEQ ID NO: 17 or an amino acid sequence having at least 90% identity thereto or consisting of said amino acid sequence; (iii) VH comprising the amino acid sequence shown in SEQ ID NO: 20 or an amino acid sequence having at least 90% identity thereto or consisting of said amino acid sequence, and VL comprising the amino acid sequence shown in SEQ ID NO: 21 or an amino acid sequence having at least 90% identity thereto or consisting of said amino acid sequence; (iv) VH comprising the amino acid sequence shown in SEQ ID NO: 24 or an amino acid sequence having at least 90% identity thereto or consisting of said amino acid sequence, and VL comprising the amino acid sequence shown in SEQ ID NO: 25 or an amino acid sequence having at least 90% identity thereto or consisting of said amino acid sequence; or (v) VH comprising the amino acid sequence shown in SEQ ID NO: 28 or an amino acid sequence having at least 90% identity thereto or consisting of said amino acid sequence, and VL comprising the amino acid sequence shown in SEQ ID NO: 29 or an amino acid sequence having at least 90% identity thereto or consisting of said amino acid sequence.

6. The antibody or antigen-binding fragment thereof that binds to BTNL2 according to any one of claims 1-5, which further comprises a heavy chain constant region. For example, the heavy chain constant region of the antibody is the heavy chain constant region of IgG1, IgG2, IgG3 or IgG4, preferably the heavy chain constant region of human IgG1, IgG2, IgG3 or IgG4.

7. The antibody or antigen-binding fragment thereof of claim 6, wherein the heavy chain constant region comprises (i) comprises an amino acid sequence having at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to an amino acid sequence selected from SEQ ID NO:11 or consists of said amino acid sequence; or (ii) comprises an amino acid sequence selected from SEQ ID NO:11 or consists of said amino acid sequence.

8. The antibody or antigen-binding fragment thereof of any one of claims 1-7, which comprises a light chain constant region, such as said light chain constant region is a lambda or kappa light chain constant region, preferably a human lambda or kappa light chain constant region.

9. The antibody or antigen-binding fragment thereof of claim 8, wherein the light chain constant region (i) comprises an amino acid sequence having at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence of SEQ ID NO:12 or consists of said amino acid sequence; or (ii) comprises the amino acid sequence of SEQ ID NO:12 or consists of said amino acid sequence.

10. The antibody or antigen-binding fragment thereof that binds to BTNL2 according to any one of claims 1-9, said antibody comprising a heavy chain, which (i) comprises an amino acid sequence having at least 85% identity to an amino acid sequence selected from SEQ ID NO:9, 18, 22, 26 or 30 or consists thereof; or (ii) comprises an amino acid sequence selected from SEQ ID NO:9, 18, 22, 26 or 30 or consists thereof.

11. The antibody or antigen-binding fragment thereof that binds to BTNL2 according to any one of claims 1-10, said antibody comprising a light chain, which (i) comprises an amino acid sequence having at least 85% identity to an amino acid sequence selected from SEQ ID NO:10, 19, 23, 27 or 31 or consists thereof; or (ii) comprises an amino acid sequence selected from SEQ ID NO:10, 19, 23, 27 or 31 or consists thereof.

12. The antibody or antigen-binding fragment thereof that binds to BTNL2 according to any one of claims 1-11, said antibody comprising a heavy chain and a light chain, wherein (i) the heavy chain comprises the amino acid sequence of SEQ ID NO:9 or consists thereof; and the light chain comprises the amino acid sequence of SEQ ID NO:10 or consists thereof; (ii) the heavy chain comprises the amino acid sequence of SEQ ID NO:18 or consists thereof; and the light chain comprises the amino acid sequence of SEQ ID NO:19 or consists thereof; (iii) the heavy chain comprises the amino acid sequence of SEQ ID NO:22 or consists thereof; and the light chain comprises the amino acid sequence of SEQ ID NO:23 or consists thereof; (iv) the heavy chain comprises the amino acid sequence of SEQ ID NO:26 or consists thereof; and the light chain comprises the amino acid sequence of SEQ ID NO:27 or consists thereof; or (v) The heavy chain comprises or consists of the amino acid sequence of SEQ ID NO: 30; and the light chain comprises or consists of the amino acid sequence of SEQ ID NO:

31.

13. The antibody or antigen-binding fragment thereof that binds to BTNL2 according to any one of claims 1-12, which has one or more of the following characteristics: (1) Binds to human BTNL2 with high affinity; (2) Binds to cells expressing human BTNL2; (3) Inhibits the related activity of BTNL2; (4) Neutralizes the inhibition of T cell activation by BTNL2; (5) Inhibits tumor growth; (6) Displays the same or similar binding affinity and / or specificity for BTNL2 as any of the antibodies listed in claim 12; (7) Inhibits the binding of any of the antibodies listed in claim 12 to BTNL2; (8) Binds to the same or overlapping epitopes as any of the antibodies shown in claim 12; (9) Competitively binds to BTNL2 with any of the antibodies shown in claim 12; (10) Has one or more biological characteristics of any of the antibody molecules listed in claim 12; (11) Specifically binds to amino acids 384-399 of human BTNL2.

14. The antibody or antigen-binding fragment thereof according to claim 13, wherein: (1) The antibody binds to human BTNL2 with an equilibrium dissociation constant K D such that the K D is less than 10 nM, 9 nM, 8.5 nM, 8 nM, 7.5 nM, 7 nM, 6.9 nM or 6.8 nM; (2) Inhibiting the related activity of BTNL2 is to neutralize its inhibition of T cell activation (such as increased cytokine expression); (3) Inhibiting one or more activities of BTNL2 results in one or more of the following: CD4 + T or CD8 + increased proliferation of T lymphocytes; increased expression and secretion of cytokines; increased expression of activation antigens; increased tumor-infiltrating lymphocytes; or reduced immune evasion of cancer cells; (4) Inhibits tumor growth without affecting body weight; or (5) Amino acids 384-399 of human BTNL2 have the amino acid sequence as shown in SEQ ID NO:

34.

15. The antibody or antigen-binding fragment thereof according to claim 14, wherein the cytokine is selected from one or more of interleukin (such as interleukin 2), interferon-γ, tumor necrosis factor (such as tumor necrosis factor α).

16. The antibody or antigen-binding fragment thereof according to any one of claims 1-15, wherein the antibody is a monoclonal antibody.

17. The antibody or antigen-binding fragment thereof according to any one of claims 1-16, wherein the antibody is a humanized antibody or a chimeric antibody.

18. The antibody or antigen-binding fragment thereof according to any one of claims 1-17, wherein the antigen-binding fragment is an antibody fragment selected from the following: Fab, Fab’, Fab’-SH, Fv, single-chain antibody such as scFv, (Fab’)2 fragment, single-domain antibody, bispecific antibody or linear antibody.

19. The antibody or antigen-binding fragment thereof according to claim 18, wherein the single-chain antibody is scFv.

20. The antibody or antigen-binding fragment thereof according to any one of claims 1-19, wherein the antibody is a bispecific antibody or a multispecific antibody.

21. An anti-BTNL2 antibody or antigen-binding fragment thereof that specifically binds to a BTNL2 epitope, wherein the BTNL2 epitope comprises amino acids 384-399 of BTNL2, and the amino acid numbering refers to the numbering of the human BTNL2 protein, for example, the numbering of the amino acid sequence shown in SEQ ID NO:

15.

22. The anti-BTNL2 antibody or antigen-binding fragment thereof according to claim 21, wherein the BTNL2 epitope comprises the amino acid sequence shown in SEQ ID NO:34 and is located in the IgC domain of BTNL2, or the BTNL2 epitope consists of the amino acid sequence shown in SEQ ID NO:

34.

23. An isolated nucleic acid encoding the anti-BTNL2 antibody or antigen-binding fragment thereof according to any one of claims 1 to 22.

24. An expression vector comprising the nucleic acid according to claim 23.

25. The expression vector of claim 24, wherein the expression vector is a pcDNA vector, such as a pcDNA3.1 vector, and more preferably a pcDNA TM 3.4TOPO vector.

26. A host cell comprising the nucleic acid according to claim 23 or the expression vector according to claim 24 or 25.

27. The host cell according to claim 26, wherein the host cell is prokaryotic or eukaryotic.

28. The host cell according to claim 27, wherein the host cell is selected from Escherichia coli cells, yeast cells, mammalian cells or other cells suitable for preparing an antibody or antigen-binding fragment thereof.

29. The host cell according to claim 27, wherein the host cell is a 293 cell or a CHO cell.

30. A method for preparing an anti-BTNL2 antibody or antigen-binding fragment thereof, the method comprising culturing the host cell according to any one of claims 26-29 under conditions suitable for expressing the nucleic acid encoding the anti-BTNL2 antibody or antigen-binding fragment thereof according to any one of claims 1 to 22, optionally isolating the antibody or antigen-binding fragment thereof, and optionally the method further comprises recovering the anti-BTNL2 antibody or antigen-binding fragment thereof from the host cell.

31. An immunoconjugate comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 22 and another substance.

32. The immunoconjugate according to claim 31, wherein the other substance is a cytotoxic agent.

33. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 22 or the immunoconjugate according to claim 31 or 32, and optionally a pharmaceutically acceptable excipient.

34. A pharmaceutical combination product comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 22 or the immunoconjugate according to claim 31 or 32, and another therapeutic agent, and optionally a pharmaceutically acceptable excipient.

35. The pharmaceutical combination product according to claim 34, wherein the other therapeutic agent is selected from chemotherapeutic agents, other antibodies, cytotoxic agents, vaccines, small molecule drugs, anti-infective active agents or immunomodulators.

36. The pharmaceutical combination product according to claim 35, wherein the immunomodulator is an activator of a costimulatory molecule or an inhibitor of an immune checkpoint molecule.

37. Use of an effective amount of the anti-BTNL2 antibody or antigen-binding fragment thereof according to any one of claims 1 to 22, or the immunoconjugate according to claim 31 or 32, or the pharmaceutical composition according to claim 33 or the pharmaceutical combination product according to any one of claims 34-36 in the preparation of a drug for preventing or treating a tumor in a subject or an individual in a subject.

38. The use according to claim 37, wherein the tumor is a solid tumor, such as a BTNL2-positive tumor.

39. Use according to claim 37 or 38, wherein the tumor is cancer.

40. Use according to any one of claims 37 - 39, wherein the tumor is selected from melanoma, lung cancer, breast cancer, lymphoma, head / neck squamous cell carcinoma, liver cancer, renal cell carcinoma, cholangiocarcinoma, gastric cancer, esophageal cancer, intestinal cancer, urinary tract cancer, bladder cancer, pancreatic cancer, neuroendocrine tumor, ovarian cancer, endometrial cancer, cervical cancer or prostate cancer.

41. Use according to any one of claims 37 - 40, which further comprises co - administering to the subject one or more other therapies.

42. Use according to claim 41, wherein the therapy comprises a treatment modality and / or other therapeutic agents.

43. Use according to claim 42, wherein the other therapeutic agents are selected from chemotherapeutic agents, other antibodies, cytotoxic agents, vaccines, small molecule drugs or immunomodulators, and / or the treatment modality comprises surgical treatment and / or radiotherapy.

44. Use according to claim 43, wherein the immunomodulator is an activator of co - stimulatory molecules or an inhibitor of immune checkpoint molecules.

45. A method for detecting BTNL2 in a sample, the method comprising (a) contacting the sample with any anti - BTNL2 antibody or antigen - binding fragment thereof according to any one of claims 1 to 22; and (b) detecting the formation of a complex between the anti - BTNL2 antibody or antigen - binding fragment thereof and BTNL2; optionally, the anti - BTNL2 antibody is detectably labeled.

46. A kit comprising an antibody or antigen - binding fragment thereof according to any one of claims 1 to 22.

47. Use of an antibody or antigen - binding fragment thereof according to any one of claims 1 to 22 for preparing a kit for selecting a subject suitable for treatment with a BTNL2 antagonist or a pharmaceutical composition or pharmaceutical combination product comprising the same.

48. Use according to claim 47, wherein the selection comprises (1) detecting the level of BTNL2 in a biological sample from a subject with an anti - BTNL2 antibody or antigen - binding fragment thereof; and (2) the presence of BTNL2 protein indicates that the subject may respond to a BTNL2 antagonist or a pharmaceutical composition or pharmaceutical combination product comprising the same.

49. Use according to claim 47, wherein (1) detecting the levels of BTNL2 in a reference sample and a biological sample from a subject with an anti - BTNL2 antibody or antigen - binding fragment thereof, or a composition or kit comprising the anti - BTNL2 antibody or antigen - binding fragment thereof; and (2) an up - regulated expression level of BTNL2 protein compared to the reference sample indicates that the subject is more likely to respond to a BTNL2 antagonist or a pharmaceutical composition or pharmaceutical combination product comprising the same, wherein the reference sample is a control sample obtained from a healthy or non - diseased individual, or a healthy or non - diseased sample obtained from the subject.

50. Use according to claim 48 or 49, wherein the BTNL2 antagonist is selected from an antibody or antigen - binding fragment thereof according to any one of claims 1 to 22 or an immunoconjugate according to claim 31 or 32. Use according to any one of claims 47 - 49, wherein the subject has a tumor.

52. Use according to any one of claim 51, wherein the tumor is a solid tumor.

53. Use according to claim 51 or 52, wherein the tumor is cancer.

54. Use according to any one of claims 51 - 53, wherein the tumor is selected from melanoma, lung cancer, breast cancer, lymphoma, head / neck squamous cell carcinoma, liver cancer, renal cell carcinoma, cholangiocarcinoma, gastric cancer, esophageal cancer, intestinal cancer, urinary tract cancer, bladder cancer, pancreatic cancer, neuroendocrine tumor, ovarian cancer, endometrial cancer, cervical cancer or prostate cancer.

55. Use according to any one of claims 48 - 54, wherein the biological sample from the subject is a sample from tumor tissue or tumor cells, and / or the reference sample is a sample of normal tissue or normal cells of the same tissue type from a healthy individual, or normal tissue or non - cancerous or non - tumorous tissue or adjacent cells or non - tumor cells adjacent to the patient.

56. The kit according to claim 46 or the use according to any one of claims 47 - 55, wherein the antibody or its antigen - binding fragment is labeled.

57. Use according to claim 56, wherein the label is selected from a fluorescent label, a chromophore label, an electron - dense label, a chemiluminescent label, a radioactive label, an enzyme or a ligand.

Images