Methods of detecting leukemia stem cells

Abstract

Methods of detecting leukemia stem cells are provided herein. Further provided are methods of diagnosing and treating AML as well as minimal residual disease or medium- or high-risk AML.

Description

^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^METHODS OF DETECTING LEUKEMIA STEM CELLS GOVERNMENT SUPPORT

[0001] This invention was made with government support under R35 CA210057 awarded by the National Institutes of Health. The government has certain rights in the invention. RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Application No. 63 / 622,764 filed on January 19, 2024 which is incorporated by reference in their entirety herein. SEQUENCE LISTING

[0003] The instant application contains a Sequence Listing that has been submitted electronically in XML format and is incorporated by reference in its entirety. Said XML copy, created on January 16, 2025 is named “91016-419724 Sequence Listing” and is 12,288 bytes in size. FIELD

[0004] The present disclosure relates to methods of detecting leukemia stem cells, treating and diagnosing AML, as well as minimal residual disease, medium-risk (or intermediate-risk), and high- risk AML. BACKGROUND

[0005] Phosphatidylinositol 3-kinases (PI3Ks) are lipid kinase enzymes that regulate various cellular processes. Dysregulation of the PI3K pathway is common in human cancers, including 50% of de novo AML cases. There are three classes of PI3Ks (classes I, II, and III), the only class IB PI3K is PI3K^ (encoded by PIK3CG), and PI3K^ is preferentially restricted to leukocytes. Targeting PI3K isoforms has become an attractive therapeutic strategy in cancer. For example, IPI-549 is a selective PI3K^ inhibitor presently in clinical evaluation for solid malignancies to modulate the immunosuppressive tumor microenvironment. Further, combined inhibition of PI3K^ and PI3K^ has been identified as a potential therapy for Pten-null induced T cell acute lymphoblastic leukemia, and the PI3K signaling pathway is frequently hyperactivated in AML cells as well as associated with ^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^significant poorer overall survival. Simultaneous inhibition of PI3K^-AKT signaling also augments the anti-leukemic effects of selinexor, an XPO1 inhibitor. However, the functions and contributions of individual PI3K isoforms in AML are largely unexplored, and, although PI3K^ is involved in the function of multiple leukocyte populations and regulates the immune system, its role in leukemogenesis remains poorly understood. It has been difficult to successfully target the PI3K family members in cancer.

[0006] For example, duvelisib, a dual PI3K inhibitor targeting PI3K^ / ^ was evaluated in a small cohort of 6 AML patients with negligible therapeutic response observed (Flinn IW OBS, Kahl B, et al., Duvelisib, a novel oral dual inhibitor of PI3K-^,^, is clinically active in advanced hematologic malignancies. Blood. 2018;131(8):877-887). Duvelisib was approved by the FDA in 2018 to treat chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), and follicular lymphoma (FL) in the relapsed / refractory setting. The FDA approval was withdrawn for the FL indication in 2022 due to duvelisib’s insufficient clinical activity and an unfavorable safety profile in the FL population. Further, idelalisib, a selective PI3K^ inhibitor, and copanlisib, another dual PI3K^ / ^ targeting agent, were also both recently withdrawn for the treatment of FL, similarly due to risk- benefit concerns arising from additional clinical findings. All three discontinued inhibitors share high inhibitory potency against PI3K^ (duvelisib, IC50 = 2.5nM; idelalisib, IC50 = 2.5nM; copanlisib, IC50 = 0.7nM) but also toxicity concerns. Additionally, MK-2206, a pan-AKT inhibitor, has also displayed limited clinical activity against AML.

[0007] Acute myeloid leukemia (AML) is an aggressive hematological malignancy originating from transformed hematopoietic stem / progenitor cells. AML prognosis remains poor, due to resistance and relapse driven by leukemia stem cells (LSCs). Targeting LSCs will facilitate long-term remission and better patient outcomes. Thus, methods for detecting LSCs as well as diagnosing and effectively treating AML with a poor prognosis and reduced side effects are desirable. SUMMARY

[0008] Provided herein are methods of detecting leukemia stem cells (LSCs), comprising performing reverse transcriptase quantitative polymerase chain reaction (rt-qPCR) for a bone marrow or blood sample using PI3KCG primers, wherein the bone marrow or blood test sample reaches the amplification threshold by completing fewer amplification cycles than a bone marrow or blood control sample without LSCs. Provided herein are methods of detecting leukemia stem cells, comprising performing immunochemistry for a bone marrow or blood sample using an anti- phosphatidylinositol 3-kinase gamma (PI3K^), wherein the bone marrow or blood test sample binds ^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^more anti-PI3K^ than a bone marrow or blood control sample without LSCs.

[0009] Provided herein are methods of diagnosing acute myeloid leukemia (AML), comprising detecting leukemia stem cells using the methods disclosed herein, wherein the bone marrow is a human bone marrow sample from a subject with or at risk of having AML. Provided herein are methods of diagnosing medium-risk (or intermediate-risk) acute myeloid leukemia (AML), comprising detecting leukemia stem cells using the methods disclosed herein, wherein the bone marrow is a human bone marrow sample from a subject with or at risk of having AML. Provided herein are methods of diagnosing high-risk acute myeloid leukemia (AML), comprising detecting leukemia stem cells using the methods disclosed herein, wherein the bone marrow is a human bone marrow sample from a subject with or at risk of having AML. Provided herein are methods of diagnosing minimal residual disease (MRD), comprising detecting leukemia stem cells using the methods disclosed herein, wherein the bone marrow is a human bone marrow sample from a subject with or at risk of having MRD.

[0010] Provided herein are methods of treating acute myeloid leukemia (AML), comprising: detecting leukemia stem cells using the methods disclosed herein, wherein the bone marrow is a human bone marrow sample from a subject with or at risk of having AML; and administering a PI3K^ inhibitor. Provided herein are methods of treating medium-risk (or intermediate-risk) acute myeloid leukemia (AML), comprising: detecting leukemia stem cells using the methods disclosed herein, wherein the bone marrow is a human bone marrow sample from a subject with or at risk of having AML; and administering a PI3K^ inhibitor. Provided herein are methods of treating high-risk acute myeloid leukemia (AML), comprising: detecting leukemia stem cells using the methods disclosed herein, wherein the bone marrow is a human bone marrow sample from a subject with or at risk of having AML; and administering a PI3K^ inhibitor. Provided herein are methods of treating minimal residual disease (MRD), comprising: detecting leukemia stem cells using the methods disclosed herein, wherein the bone marrow is a human bone marrow sample from a subject with or at risk of having MRD; and administering a PI3K^ inhibitor.

[0011] Provided herein are methods of treating medium-risk (or intermediate-risk) acute myeloid leukemia (AML), comprising administering a PI3K^ inhibitor to a patient or subject with medium- risk (or intermediate-risk) AML. Provided herein are methods of treating high-risk acute myeloid leukemia (AML), comprising administering a PI3K^ inhibitor to a patient or subject with high-risk AML. Provided herein are methods of treating minimal residual disease (MRD), comprising administering a PI3K^ inhibitor to a patient or subject with MRD. ^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^

[0012] Provided herein are compositions for use in treating acute myeloid leukemia (AML), comprising a PI3K^ inhibitor. Provided herein are pharmaceutical compositions for use in treating acute myeloid leukemia (AML), comprising PI3K^ inhibitor and a pharmaceutically acceptable carrier. Provided herein are uses of a PI3K^ inhibitor or pharmaceutical composition thereof for treating acute myeloid leukemia (AML), wherein the pharmaceutical composition comprises PI3K^ inhibitor and a pharmaceutically acceptable carrier. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] FIGS. 1A-1O show an example in which PI3K^ is highly expressed in LSCs and promotes AML development. (FIG. 1A) mRNA levels of Pik3cg in normal mouse bone marrow cells (Normal-BM), Lin–Sca-1+c-Kit+CD34+CD135- short-term HSCs (ST-HSCs), Lin–Sca-1+c- Kit+CD34-CD135- long-term HSCs (LT-HSCs), MLL-AF9+ leukemia cells (AML-BM), and Lin– CD127-Sca-1-c-Kit+CD34+CD16 / 32+ L-GMPs were measured by quantitative RT-PCR (n=3). (FIGS. 1B-1C) Representative flow cytometric analysis of leukemia cells (GFP+) in the peripheral blood (PB) 4 weeks after primary transplantation (FIG. 1B) and quantification data (FIG. 1C, n=5). (FIGS. 1D-1E) Lineage analysis with myeloid cell markers (Mac-1 / Gr-1) was conducted in WT and Pik3cg-KO PB leukemia cells 4 weeks after primary transplantation (FIG. 1D) and quantification data (FIG. 1E, n=5). (FIGS. 1F-1G) Representative images of the size of spleens and livers of recipients 4 weeks after primary transplantation (FIG. 1F) and quantification data (FIG. 1G, n=5). (FIG. 1H) The overall survival of the recipient mice transplanted with WT or Pik3cg-KO MLL- AF9+ leukemia cells upon primary transplantation (n=8). (FIG. 1I) Percentages of leukemia cells in the PB 4 weeks after secondary transplantation (n=5). (FIG. 1J) The percentages of Mac-1+Gr-1- and Mac-1+Gr-1+ cells in the PB leukemia cells 4 weeks after secondary transplantation (n=5). (FIGS. 1K-1L) Representative images of the size of spleens and livers of recipients 4 weeks after secondary transplantation (FIG. 1K) and quantification data (FIG. 1L, n=5). (FIG. 1M) The overall survival of the recipient mice upon secondary transplantation (n=10). (FIGS. 1N-1O) The frequencies of leukemia cells in the PB 4 weeks post-transplantation (FIG. 1N, n=5) and overall survival (FIG. 1O, n=5) were compared among the recipients transplanted with WT, Pik3cg- overexpressing WT, Pik3cg-KO, and Pik3cg-overexpressing KO AML cells. Data are represented as mean ± standard error of the mean. Student 2-tailed unpaired t test (FIGS. 1C and 1I), 1-way analysis of variance (ANOVA) with Tukey’s multiple comparison test (FIGS. 1A and 1N), 2-way ANOVA with Sidak’s multiple comparison test (FIGS. 1E, 1G, 1J, and 1L), and log-rank test ^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^(FIGS. 1H, 1M, and 1O) were used for the comparison of statistical significance. *, P <0.05; **, P <0.01; ***, P <0.001.

[0014] FIGS. 2A-2K show an example in which genetic ablation of Pik3cg in AML depletes LSCs. (FIG. 2A) Representative of flow cytometric analysis for WT and KO L-GMPs (Lin–CD127-Sca-1- c-Kit+CD34+CD16 / 32+) among the total live BM cells from recipients at 6 weeks after primary transplantation. (FIG. 2B) Quantification of the frequency of L-GMPs of the recipients in panel A (n=5). (FIG. 2C) Quantification of the frequency of L-GMPs among the total live BM cells from moribund mice upon secondary transplantation (n=5). (FIG. 2D) Representative images of colony formation of sorted WT and Pik3cg-KO BM L-GMPs during 1st and 2nd plating. Scar bar, 20^m. (FIGS. 2E-2F) Colony numbers (FIG. 2E) and derived total cell count (FIG. 2F) of sorted WT and Pik3cg-KO BM L-GMPs during the first and second plating were calculated (n=3). (FIG. 2G) Survival curve of recipient mice transplanted with 100 L-GMP cells from MLL-AF9+ WT or Pik3cg-KO BM cells after primary transplantation (n=10). (FIGS. 2H-2I) Limiting dilution assays for the frequency of the functional LSCs of WT and Pik3cg-KO BM cells. Different doses of GFP+ leukemia cells purified from primary recipients were transplanted into lethally irradiated recipients and the competitive repopulating units (CRUs) were determined using L-Calc software. (FIGS. 2J- 2K) Gene set enrichment analyses evaluating changes in leukemia initiation / maintenance and myeloid differentiation gene signatures in WT and Pik3cg-KO BM L-GMP cells at 4 weeks after primary transplantation. NES, normalized enrichment score; FDR q-val, false-discovery rate q-value. Data are represented as mean ± standard error of the mean. Student 2-tailed unpaired t test (FIGS. 2B, C, E, and 2F) and log-rank test (FIG. 2G) were used for the comparison of statistical significance. ***, P <0.001.

[0015] FIGS. 3A-3P show an example in which PI3K^ regulates the pentose phosphate pathway of LSCs. (FIG. 3A) KEGG pathway analyses were performed with transcriptome data of WT and Pik3cg-KO BM L-GMP cells at 4 weeks after primary transplantation (n=3 mice / group). (FIG. 3B) Gene set enrichment analysis evaluating changes in the pentose phosphate pathway in WT and Pik3cg-KO BM L-GMP cells at 4 weeks after primary transplantation. (FIG. 3C) mRNA levels of G6pd, Pgd, Tkt, and Taldo1 were compared by quantitative RT-PCR between WT and KO L-GMPs at 4 weeks after primary transplantation (n=3). (FIG. 3D) Downregulated metabolic pathways in Pik3cg-KO L-GMP cells by metabolomics analysis at 4 weeks after primary transplantation. (FIGS. 3E-3F) The intensities of NADPH and NADP+ (FIG. 3E, n=6) and the ratio of NADPH / NADP+ (FIG. 3F, n=6) were evaluated in WT and KO BM L-GMP cells at 4 weeks after primary ^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^transplantation. (G) Flow cytometric analysis of ROS levels of WT and KO BM L-GMP cells at 4 weeks after primary transplantation (n=5). (FIG. 3H) Flow cytometric analysis of ROS levels in WT and KO BM L-GMP cells upon 1mM NAC treatment for 2 hours at 4 weeks after primary transplantation (n=3). (FIGS. 3I-3J) Colony numbers (FIG. 3I) and derived total cell count (FIG. 3J) of WT and Pik3cg-KO BM L-GMPs upon 1mM NAC treatment at 4 weeks after primary transplantation (n=3). (FIG. 3K) The protein levels of p-AKT (S473), p-AKT (T308), AKT, G6PD, PGD, and PI3K^ in WT and Pik3cg-KO BM L-GMP cells were measured by Western blot at 4 weeks after primary transplantation. (FIG. 3L) The changes of metabolites in the pentose phosphate pathway between WT and Pik3cg-KO BM L-GMP cells at 4 weeks after primary transplantation (n=6). (FIGS. 3M-3N) The frequencies of leukemia cells in the PB (FIG. 3M, n=5) 4 weeks post- transplantation and overall survival (FIG. 3N, n=5) were compared among the recipients transplanted with WT, Pgd-overexpressing WT, Pik3cg-KO, and Pgd-overexpressing KO AML cells. (FIGS. 3O-3P) The metabolite levels were measured in WT, Pgd-overexpressing WT, Pik3cg- KO, and Pgd-overexpressing KO L-GMP cells and normalized against WT+vector cells 4 weeks post-transplantation (n=5). Data are represented as mean ± standard error of the mean. Student 2- tailed unpaired t test (FIGS. 3C, 3F, 3G, and 3L), 1-way analysis of variance (ANOVA) with Tukey’s multiple comparison test (FIGS. 3H, 3I, 3J, 3M, and 3P), 2-way ANOVA with Sidak’s multiple comparison test (FIGS. 3E and 3O), and log-rank test (FIG. 3N) were used for the comparison of statistical significance. *, P <0.05; **, P <0.01; ***, P <0.001; n.s., not significant.

[0016] FIGS. 4A-4H show an example in which PI3K^ maintains the nucleotide metabolism of LSCs. (FIG. 4A) GO (biological process) analyses were performed with transcriptome data of WT and Pik3cg-KO BM L-GMP cells at 4 weeks after primary transplantation (n=3 mice / group). (FIGS. 4B-4C) Gene set enrichment analyses evaluating changes in purine metabolism (FIG. 4B) and pyrimidine metabolism (FIG. 4C) in WT and Pik3cg-KO BM L-GMP cells at 4 weeks after primary transplantation. (FIG. 4D) Pyrimidine and purine metabolite changes in WT and Pik3cg-KO BM L- GMP cells measured via metabolomics at 4 weeks after primary transplantation (n=6). (FIG. 4E) Nucleoside partial rescue of growth inhibition of Pik3cg-KO BM AML cells in liquid culture at 4 weeks after primary transplantation (n=3). (FIGS. 4F-4G) Colony numbers (FIG. 4F) and their derived cell counts (FIG. 4G) were determined 6 days after WT and Pik3cg-KO BM L-GMP cells were seeded in the methylcellulose medium containing nucleosides at 4 weeks after primary transplantation (n=3). (FIG. 4H) The metabolites in the nucleotide synthesis were measured in WT, Pgd-overexpressing WT, Pik3cg-KO, and Pgd-overexpressing KO L-GMP cells and normalized ^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^against WT+vector cells 4 weeks post-transplantation (n=5). Data are represented as mean ± standard error of the mean. Student 2-tailed unpaired t test (FIG. 4D) and 1-way analysis of variance (ANOVA) with Tukey’s multiple comparison test (FIGS. 4E-4G) were used for the comparison of statistical significance. *, P <0.05; **, P <0.01; ***, P <0.001.

[0017] FIGS. 5A-5V show an example in which PI3K^ knockdown suppresses the growth of human AML cells. (FIG. 5A) In silico analysis of the expression of PIK3CG in human AML samples from the curated database (https: / / servers.binf.ku.dk / hemaexplorer / ). HSC_BM: bone marrow hematopoietic stem cell. (FIG. 5B) The relationship between the PIK3CG expression level and the overall survival in AML patients from the curated database (http: / / gepia.cancer-pku.cn). (FIG. 5C) Relative mRNA levels of PIK3CG were determined in the immunophenotypic Lin-CD34+CD38- CD90+CD45RA- cord blood HSCs, CD11B+ differentiated human leukemia cells (Dif-AMLs), and Lin-CD34+CD38-CD90-CD45RA+ LSCs (n=3). (FIG. 5D) PI3K^ protein levels in Scramble, sh- PIK3CG-#1, and sh-PIK3CG-#2 PDX cells were measured by Western blot. (FIGS. 5E-5F) CD45+ human AML cells in the bone marrow at 4 weeks post transplantation (FIG. 5E, n = 6) and the survival (FIG. 5F, n=6) of the recipients transplanted with PIK3CG-knockdown (sh-PIK3CG-#1 and sh-PIK3CG-#2) PDX #1 cells or control cells were shown. (FIGS. 5G-5H) CD45+ human AML cells in the bone marrow at 4 weeks post transplantation (FIG. 5G, n = 5) and the survival (FIG. 5H, n=5) of the recipients transplanted with PIK3CG-knockdown PDX #2 cells or control cells were shown. (FIGS. 5I-5J) CD45+ human AML cells in the bone marrow at 4 weeks post transplantation (FIG. 5I, n = 8) and the survival (FIG. 5J, n=8) of the recipients transplanted with PIK3CG-knockdown PDX #3 cells or control cells were shown. (FIG. 5K) Quantification of the frequency of Lin-CD34+CD38-CD90-CD45RA+ LSCs among the total live BM cells from moribund mice (PDX #1, n=5; PDX #2, n=6; PDX #3, n=6). (FIG. 5L) Flow cytometric analysis of ROS levels in BM LSCs from moribund mice (PDX #1, n=5; PDX #2, n=6; PDX #3, n=6). (FIG. 5M) Flow cytometric analysis of BM Annexin V+ apoptotic LSCs from moribund mice (PDX #1, n=5; PDX #2, n=6; PDX #3, n=6). (FIG. 5N) Flow cytometric analysis of mean fluorescence intensity (MFI) of CD11B in PDX cells from moribund mice (PDX #1, n=5; PDX #2, n=6; PDX #3, n=6). (FIGS. 5O-5Q) NADPH (FIG. 5O) and NADP+ (FIG. 5P) levels were measured in PIK3CG- knockdown CD34+ PDX cells and control cells and the ratio of NADPH / NADP+ (FIG. 5Q) was calculated 4 weeks post-transplantation (n=3). (FIG. 5R) The protein levels of p-AKT (S473), p- AKT (T308), AKT, G6PD, PGD, and nuclear NRF2 in PIK3CG-knockdown CD34+ PDX cells and control cells were measured by Western blot 4 weeks post-transplantation. (FIG. 5S) ChIP assays ^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^were analyzed with 293T cells transfected with PGD-promoter and NRF2 plasmid or empty vector. Input control and the amplification of the NRF2-binding sequence of PGD were determined. (FIG. 5T) PGD luciferase reporter and different doses of NRF2 were co-transfected into 293T cells, followed by the determination of luciferase activities (n=3). (FIGS. 5U-5V) The frequencies of leukemia cells in the PB (FIG. 5U, n=5) 4 weeks post-transplantation and overall survival (FIG. 5V, n=5) were compared among the recipients transplanted with WT, Nrf2-overexpressing WT, Pik3cg- KO, and Nrf2-overexpressing KO AML cells. Data are represented as mean ± standard error of the mean. 1-way analysis of variance (ANOVA) with Tukey’s multiple comparison test (FIGS. 5A, 5C, 5E, 5G, 5I, 5K, 5L, 5M, 5N, 5O, 5P, 5Q, 5T, and 5U) and log-rank test (FIGS. 5F, 5H, 5J, and 5V) were used for the comparison of statistical significance. *, P <0.05; **, P <0.01; ***, P <0.001.

[0018] FIGS. 6A-6V show an example in which pharmaceutical inhibition of PI3K^ suppresses the progression of AML. (FIG. 6A) Representative images of colony formation of mouse BM MLL- AF9+ AML cells upon 1^M IPI-549 treatment. Scar bar, 20^m. (FIGS. 6B-6C) Colony numbers (FIG. 6B) and derived total cell counts (FIG. 6C) of mouse BM AML cells upon 1^M IPI-549 treatment were calculated (n=3). (FIGS. 6D-6E) The frequencies of leukemia cells in the PB (FIG. 6D, n=6) and overall survival (FIG. 6E, n=6) were compared among the recipients transplanted with mouse MLL-AF9+ AML cells, followed by 15mg / kg IPI-549 treatment starting at 2 weeks post- transplantation. (FIGS. 6F-6G) The percentages of human CD45+ AML cells in the PB (FIG. 6F, n = 6) and the overall survival (FIG. 6G, n=6) were compared in the recipients transplanted with PDX #1 cells, followed by 15mg / kg IPI-549 treatment starting at 2 weeks post-transplantation. (FIGS. 6H-6I) The percentages of human CD45+ AML cells in the PB (FIG. 6H, n = 6) and the overall survival (FIG. 6I, n=6) were compared in the recipients transplanted with PDX #2 cells, followed by 15mg / kg IPI-549 treatment starting at 2 weeks post-transplantation. (FIGS. 6J-6K) The percentages of human CD45+ AML cells in the PB (FIG. 6J, n = 6) and the overall survival (FIG. 6K, n=6) were compared in the recipients transplanted with PDX #3 cells, followed by 15mg / kg IPI-549 treatment starting at 2 weeks post-transplantation. (FIGS. 6L-6S) Primary AML patient cells were treated with 5^M IPI-549. Cell number was calculated at the indicated time points (n=3). (FIGS. 6T-6U) Colony numbers (FIG. 6T) and derived total cell counts (FIG. 6U) of primary AML patient cells upon 5^M IPI-549 treatment were calculated (n=3). (FIG. 6V) Working model for the functions of PIK3CG in leukemogenesis (PI3K^i: PI3K^ inhibitor). Data are represented as mean ± standard error of the mean. Student 2-tailed unpaired t test (FIGS. 6B, 6C, 6D, 6F, 6H, 6J, 6L, 6M, 6N, 6O, 6P, 6Q, 6R, 6S, 6T, and 6U) and log-rank test (FIGS. 6E, 6G, 6I, and 6K) were used for ^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^the comparison of statistical significance. *, P <0.05; **, P <0.01; ***, P <0.001.

[0019] FIGS. 7A-7M show an example in which (FIG. 7A) PI3K^ protein levels in WT and Pik3cg-KO BM MLL-AF9+ AML cells were measured by Western blot. (FIG. 7B) Representative images of the Giemsa-Wright staining for WT and Pik3cg-KO AML cells in the PB 4 weeks after primary transplantation. Scale bar, 100^m. (FIG. 7C) Percentages of BM leukemia cells 5 weeks after primary transplantation (n=5). (FIG. 7D) The percentages of Mac-1+Gr-1- and Mac-1+Gr-1+ cells in BM leukemia cells 5 weeks after primary transplantation (n=5). (FIG. 7E) Histological hematoxylin / eosin staining of the livers and spleens of recipients 4 weeks after primary transplantation. Scale bar, 100^m. (FIG. 7F) Representative images of the Giemsa-Wright staining for WT and KO AML cells in the PB at 4 weeks after secondary transplantation. Scale bar, 100^m. (FIG. 7G) Percentages of leukemia cells in the BM 4 weeks after secondary transplantation (n=5). (FIG. 7H) The percentages of Mac-1+Gr-1- and Mac-1+Gr-1+ cells in BM leukemia cells 4 weeks after secondary transplantation (n=5). (FIG. 7I) Histological hematoxylin / eosin staining of the livers and spleens of recipients 4 weeks after secondary transplantation. Scale bar, 100^m. (FIG. 7J) PI3K^ protein levels in Scramble, sh-Pik3cg-#1, and sh-Pik3cg-#2 BM MLL-AF9+ AML cells were measured by Western blot. (FIGS. 7K-7L) The percentages of leukemia cells in the PB (FIG. 7K, n=6) 4 weeks post-transplantation and overall survival (FIG. 7L, n=6) of mice receiving Scramble, sh- Pik3cg-#1, and sh-Pik3cg-#2 BM MLL-AF9+ AML cells. (FIG. 7M) PI3K^ protein levels in BM cells of recipient mice transplanted with WT, Pik3cg-overexpressing WT, Pik3cg-KO, and Pik3cg-overexpressing KO AML cells were measured by Western blot. Data are represented as mean ± standard error of the mean. Student 2-tailed unpaired t test (FIGS. 7C and 7G), 2-way analysis of variance (ANOVA) with Sidak’s multiple comparison test (FIGS. 7D and 7H), 1-way ANOVA with Tukey’s multiple comparison test (FIG. 7K), and log-rank test (FIG. 7L) were used for the comparison of statistical significance. ***, P <0.001

[0020] FIGS. 8A-8U show an example in which (FIG. 8A) PI3K^ protein levels in scramble, sh- Pik3ca-#1, and sh-Pik3ca-#2 BM MLL-AF9+ AML cells were measured by Western blot. (FIGS. 8B-8C) The percentages of leukemia cells in the PB (FIG. 8B, n=5) and BM (FIG. 8C, n=5) of mice receiving Scramble, sh-Pik3ca-#1, and sh-Pik3ca-#2 BM MLL-AF9+ AML cells 4 weeks after primary transplantation. (FIGS. 8D-8E) The percentages of leukemia cells in the PB (FIG. 8D, n=5) and BM (FIG. 8E, n=5) of mice receiving Scramble, sh-Pik3ca-#1, and sh-Pik3ca-#2 BM MLL- AF9+ AML cells 4 weeks after secondary transplantation. (FIGS. 8F-8G) The overall survival of mice receiving Scramble, sh-Pik3ca-#1, and sh-Pik3ca-#2 MLL-AF9+ AML cells upon primary ^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^(FIG. 8F, n=5) and secondary (FIG. 8G, n=5) transplantation. (FIG. 8H) PI3K^ protein levels in WT and Pik3cb-KO BM MLL-AF9+ AML cells were measured by Western blot. (FIGS. 8I-8J) The percentages of leukemia cells in the PB (FIG. 8I, n=5) and BM (FIG. 8J, n=5) of mice receiving WT and Pik3cb-KO BM MLL-AF9+ AML cells 4 weeks after primary transplantation. (FIGS. 8K- 8L) The percentages of leukemia cells in the PB (FIG. 8K, n=5) and BM (FIG. 8L, n=5) of mice receiving WT and Pik3cb-KO BM MLL-AF9+ AML cells 4 weeks after secondary transplantation. (FIGS. 8M-8N) The overall survival of mice receiving WT and Pik3cb-KO MLL-AF9+ AML cells upon primary (FIG. 8M, n=5) and secondary (FIG. 8N, n=5) transplantation. (FIG. 8O) PI3K^ protein levels in WT and Pik3cd-KO BM MLL-AF9+ AML cells were measured by Western blot. (FIGS. 8P-8Q) The percentages of leukemia cells in the PB (P, n=5) and BM (FIG. 8Q, n=5) of mice receiving WT and Pik3cd-KO BM MLL-AF9+ AML cells 4 weeks after primary transplantation. (FIGS. 8R-8S) The percentages of leukemia cells in the PB (FIG. 8R, n=5) and BM (FIG. 8S, n=5) of mice receiving WT and Pik3cd-KO BM MLL-AF9+ AML cells 4 weeks after secondary transplantation. (FIGS. 8T-8U) The overall survival of mice receiving WT and Pik3cd- KO MLL-AF9+ AML cells upon primary (FIG. 8T, n=5) and secondary (FIG. 8U, n=5) transplantation. Data are represented as mean ± standard error of the mean. Student 2-tailed unpaired t test (FIGS. 8I, 8J, 8K, 8L, 8P, 8Q, 8R, and 8S), 1-way analysis of variance (ANOVA) with Tukey’s multiple comparison test (FIGS. 8B, 8C, 8D, and 8E), and log- rank test (FIGS. 8F, 8G, 8M, 8N, 8T, and 8U) were used for the comparison of statistical significance. n.s., not significant.

[0021] FIGS. 9A-9H show an example of (FIG. 9A) representative flow cytometric analysis of AML1- ETO9a+ leukemia cells (GFP+) in the PB in the eighth week upon primary transplantation. (FIG. 9B) Quantification of data in panel A (n=5). (FIG. 9C) The percentages of AML1-ETO9a+ leukemia cells in the BM in the tenth week upon primary transplantation (n=5). (FIG. 9D) The overall survival of mice receiving WT and Pik3cg-KO AML1-ETO9a+ leukemia cells (n=10) upon primary transplantation. (FIG. 9E) Representative flow cytometric analysis of AML1-ETO9a+ leukemia cells (GFP+) in the PB in the fourth week upon secondary transplantation. (FIG. 9F) Quantification of data in panel E (n=5). (FIG. 9G) The percentages of AML1-ETO9a+ leukemia cells in the BM in the sixth week upon secondary transplantation (n=5). (FIG. 9H) The overall survival of mice receiving WT and Pik3cg-KO AML1-ETO9a+ leukemia cells (n=10) upon secondary transplantation. Data are represented as mean ± standard error of the mean. Student 2- tailed unpaired t test (FIGS. 9B, 9C, 9F, and 9G) and log-rank test (FIGS. 9D and 9H) were used for the comparison of statistical significance. ***, P <0.001 ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^

[0022] FIGS. 10A-10H show an example of (FIG. 10A) representative of flow cytometric analyses for WT and KO leukemia stem / progenitor populations (EGFP+Lin–Sca-1-c-Kit+) among the total live BM cells from recipients at 10 weeks after primary transplantation in the AML1-ETO9a+ AML model. (FIG. 10B) Quantification of data in panel A (n=5). (FIG. 10C) Representative of flow cytometric analyses for WT and KO leukemia stem / progenitor populations (EGFP+Lin–Sca-1-c- Kit+) among total live BM cells from the recipients at 6 weeks after secondary transplantation in the AML1-ETO9a+ AML model. (FIG. 10D) Quantification of data in panel C (n=5). (FIG. 10E) CFSE-labeled WT and Pik3cg-null primary Mac-1+c-Kit+ LSCs cells were transplanted and analyzed for the homed CFSE+ cells in the recipients’ BMs, livers, and spleens (n=5). (FIG. 10F) Representative flow cytometric analyses of cell cycle status of WT and Pik3cg-KO BM L-GMP cells using Ki- 67 / Hoechst 33342 staining at 6 weeks after primary transplantation. (FIG. 10G) Quantification of data in panel F (n=5). (FIG. 10H) The percentages of Annexin V+ apoptotic cells were evaluated in WT and Pik3cg-KO BM L-GMPs at 6 weeks after primary transplantation (n=5). Data are represented as mean ± standard error of the mean. Student 2-tailed unpaired t test (FIGS. 10B, 10D, 10E, and 10H) and 2-way ANOVA with Sidak’s multiple comparison test (FIG. 10G) were used for the comparison of statistical significance. **, P <0.01; ***, P <0.001; n.s., not significant.

[0023] FIGS. 11A-11L show an example of (FIGS. 11A-11B) representative flow cytometric analyses (FIG. 11A) and quantification data (FIG. 11B, n=5) of BM lineages (CD3 for T cells, B220 for B cells, and Mac-1+Gr-1+ for myeloid cells) from WT and Pik3cg-KO mice. (FIGS. 11C- 11D) Representative flow cytometric analyses (FIG. 11C) and quantification data (FIG. 11D, n=5) of common myeloid progenitors (CMPs), granulocyte macrophage progenitor (GMPs), and megakaryocyte erythrocyte progenitors (MEPs) from WT and Pik3cg-KO mice. CMPs: Lin-Sca-1-c- Kit+CD16 / 32-CD34+; GMPs: Lin-Sca-1-c-Kit+CD16 / 32+CD34+; MEPs: Lin-Sca-1-c- Kit+CD16 / 32-CD34-. (FIGS. 11E-11F) Representative flow cytometric analyses (FIG. 11E) and quantification data (FIG. 11F, n=5) of common lymphoid progenitors (CLPs) from WT and Pik3cg- KO mice. CLPs: Lin-Sca-1lowc-KitlowCD127+CD135+; (FIGS. 11G-11H) Representative flow cytometric analyses (FIG. 11G) and quantification data (FIG. 11H, n=5) of Lin-Sca-1+c-Kit+ cells (LSKs), multipotent progenitors (MPPs), short-term HSCs (ST-HSCs), and long-term HSCs (LT- HSCs) from WT and Pik3cg-KO mice. LSKs: Lin-Sca-1+c-Kit+; MPPs: Lin-Sca-1+c- Kit+CD135+CD34+; ST-HSCs: Lin-Sca-1+c-Kit+CD135-CD34+; LT- HSCs: Lin-Sca-1+c- Kit+CD135-CD34-. (FIGS. 11I-11L) The frequencies of WT and Pik3cg-KO donor cells were ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^evaluated 4, 8, 12, and 16 weeks after primary (FIG. 11I, n=5) and secondary (FIG. 11K, n=5) competitive BM transplantation. Multilineages of donor cells in the recipient mice transplanted with WT and Pik3cg-KO normal BM cells 16 weeks after primary (FIG. 11J, n=5) and secondary (FIG. 11L, n=5) transplantation. Data are represented as mean ± standard error of the mean. Student 2- tailed unpaired t test (FIGS. 11F, 11I, and 11K) and 2-way ANOVA with Sidak’s multiple comparison test (FIGS. 11B, 11D, 11H, 11J, and 11L) were used for the comparison of statistical significance. n.s., not significant.

[0024] FIGS. 12A-12R show an example in which (FIGS. 12A-12B) NADPH / NADP+ levels were determined in WT and Pik3cg-KO BM L-GMP cells by using a commercially available NADPH / NADP+ assay kit and the ratio was calculated at 4 weeks after primary transplantation (n=6). (FIGS. 12C-12D) NADPH / NADP+ levels were determined in WT and Pik3cg-KO BM Mac- 1+c-Kit- leukemia blasts by using a commercially available NADPH / NADP+ assay kit and the ratio was calculated at 4 weeks after primary transplantation (n=5). (FIG. 12E) Flow cytometry analysis of ROS levels in WT and KO BM Mac-1+c-Kit- leukemia blasts at 4 weeks after primary transplantation (n=5). (FIG. 12F) The changes of metabolites in the pentose phosphate pathway between WT and Pik3cg-KO normal BM GMP cells (n=3). (FIG. 12G) Flow cytometry analysis of ROS levels in WT and KO normal BM GMP cells (n=6). (FIGS. 12H-12K) Flow cytometry analyses of H2O2 (FIG. 12H), superoxide (FIG. 12I), hydroxyl radical (FIG. 12J), and nitric oxide (NO) (FIG. 12K) levels in WT and KO BM L-GMPs at 4 weeks after primary transplantation (n=3). (FIG. 12L) Flow cytometric analysis of H2O2 levels of WT and KO BM L- GMP cells upon 1mM NAC treatment for 2 hours at 4 weeks after primary transplantation (n=3). (FIG. 12M) Flow cytometric analysis of ROS levels in WT and KO BM L-GMP cells upon 100^M vitamin C treatment for 2 hours at 4 weeks after primary transplantation (n=3). (FIGS. 12N-12O) Colony numbers (FIG. 12N) and derived total cell count (FIG. 12O) of WT and Pik3cg-KO BM L-GMPs upon 100^M vitamin C treatment at 4 weeks after primary transplantation (n=3). (FIG. 12P) Flow cytometric analysis of ROS levels in WT and KO BM L-GMP cells upon 10^M vitamin E treatment for 2 hours at 4 weeks after primary transplantation (n=3). (FIGS. 12Q-12R) Colony numbers (FIG. 12Q) and derived total cell count (FIG. 12R) of WT and Pik3cg-KO BM L-GMPs upon 10^M vitamin E treatment at 4 weeks after primary transplantation (n=3). Data are represented as mean ± standard error of the mean. 2- way analysis of variance (ANOVA) with Sidak’s multiple comparison test (FIGS. 12A and 12C), Student 2-tailed unpaired t test (FIGS. 12B, 12D, 12E, 12F, 12G, 12H, 12I, 12J, and 12K), and 1-way ANOVA with Tukey’s multiple comparison test (FIGS. 12L-12R) ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^were used for the comparison of statistical significance. *, P <0.05; **, P <0.01; ***, P <0.001. n.s., not significant.

[0025] FIGS. 13A-13L show an example in which (FIG. 13A) the protein levels of p-AKT (S473), p-AKT (T308), AKT, G6PD, PGD, ME1, ME2, IDH1, IDH2, MTHFD1, MTHFD2, and PI3K^ in WT and Pik3cg-KO BM bulk leukemia cells were measured by Western blot at 4 weeks after primary transplantation. (FIG. 13B) The protein levels of p-AKT1 (S473), AKT1, p-AKT2 (S474), and AKT2 levels in WT and Pik3cg-KO BM L-GMPs were measured by Western blot at 4 weeks after primary transplantation. (FIG. 13C) AKT1 and p-AKT1 (S473) protein levels in BM cells of recipient mice transplanted with WT, Akt1-overexpressing WT, Pik3cg-KO, and Akt1- overexpressing KO AML cells were measured by Western blot. (FIGS. 13D-13E) The frequencies of leukemia cells in the PB (FIG. 13D, n=5) 4 weeks post- transplantation and overall survival (FIG. 13E, n=5) were compared among the recipients transplanted with WT, Akt1-overexpressing WT, Pik3cg-KO, and Akt1-overexpressing KO AML cells. (FIG. 13F) AKT2 and p-AKT2 (S474) protein levels in BM cells of recipient mice transplanted with WT, Akt2-overexpressing WT, Pik3cg-KO, and Akt2-overexpressing KO AML cells were measured by Western blot. (FIGS. 13G- 13H) The frequencies of leukemia cells in the PB (G, n=5) 4 weeks post-transplantation and overall survival (FIG. 13H, n=5) were compared among the recipients transplanted with WT, Akt2- overexpressing WT, Pik3cg-KO, and Akt2-overexpressing KO AML cells. (FIG. 13I) AKT, p-AKT (S473), ^-catenin, and p-^-catenin (S552) protein levels in WT BM L-GMPs were measured by Western blot upon treatment with 200ng / ml Wnt3a alone or the 200ng / ml Wnt3a + 1^M IPI-549 combination. (FIG. 13J) mRNA levels of Pd-l1, Tim3, Cd24, Ctla4, Lag3, Tigit, Btla, Hvem, and Vsir in WT BM L-GMPs were measured by quantitative RT-PCR upon treatment with 200ng / ml Wnt3a alone or the 200ng / ml Wnt3a + 1^M IPI-549 combination (n=3). (FIG. 13K) Uniformly labeled 13C glucose (U-13C6) was used for the in vivo labeling in WT and KO BM L-GMPs, followed by the measurement of intermediate metabolites derived from PPP, glycolysis, and TCA cycle (n=3). (FIG. 13L) PGD protein levels in BM cells of recipient mice transplanted with WT, Pgd-overexpressing WT, Pik3cg-KO, and Pgd- overexpressing KO AML cells were measured by Western blot. Data are represented as mean ± standard error of the mean. 1-way analysis of variance (ANOVA) with Tukey’s multiple comparison test (FIGS. 13D, 13G, and 13J), Student 2-tailed unpaired t test (FIG. 13K), and log-rank test (FIGS. 13E and 13H) were used for the comparison of statistical significance. *, P <0.05; **, P <0.01; ***, P <0.001; n.s., not significant.

[0026] FIGS. 14A-14H show an example in which (FIG. 14A) pyrimidine and purine metabolite ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^changes in WT and Pik3cg-KO normal BM GMPs measured via metabolomics (n=3). (FIGS. 14B- 14C) Representative flow cytometric analyses of cell cycle status of WT and Pik3cg-KO BM L- GMP cells using in vivo EdU incorporation (FIG. 14B) at 6 weeks after primary transplantation and quantification of data in panel B (C, n=5). (FIGS. 14D-14E) WT and Pik3cg- KO AML cells were cultured in medium containing purines (FIG. 14D, n=3) or pyrimidines (FIG. 14E, n=3) for 6 days. The cell numbers were calculated at the indicated time points. (FIGS. 14F-14U) The metabolite changes in the nucleotide synthesis were compared in WT, Pgd- overexpressing WT, Pik3cg-KO, and Pgd-overexpressing KO L-GMP cells 4 weeks post-transplantation (n=5). Data are represented as mean ± standard error of the mean. Student 2-tailed unpaired t test (FIG. 14A), 2-way analysis of variance (ANOVA) with Sidak’s multiple comparison test (FIG. 14C), and 1-way ANOVA with Tukey’s multiple comparison test (FIGS. 14D-14U) were used for the comparison of statistical significance. *, P <0.05; **, P <0.01; ***, P <0.001; n.s., not significant.

[0027] FIGS. 15A-15T show an example in which (FIG. 15A) PI3K^ protein levels in scramble, sh- PIK3CG-#1, and sh-PIK3CG-#2 human AML cell lines (THP-1, MV4-11, and U937) were measured by Western blot. (FIGS. 15B-15D) The numbers of THP-1, MV4-11, and U937 cells were calculated after infection with shRNAs targeting PIK3CG (sh-PIK3CG-#1 and -#2) or scrambled shRNA (n=3). (FIG. 15E) Representative flow cytometric analysis of THP-1 cells (human CD45+) in the BM from mice receiving PIK3CG-knockdown cells and control cells 4 weeks post- transplantation. (FIG. 15F) The percentages of THP-1 cells in BM, spleen, liver, and PB from mice receiving PIK3CG-knockdown cells and control cells at 4 weeks after transplantation (n=5). (FIG. 15G) The overall survival was examined in the recipients transplanted with PIK3CG-knockdown cells and control THP-1 cells (n=5). (FIG. 15H) Representative flow cytometric analysis of MV4-11 cells (human CD45+) in the BM from mice receiving PIK3CG-knockdown cells and control cells 4 weeks post- transplantation. (FIG. 15I) The percentages of MV4-11 cells in BM, spleen, liver, and PB from mice receiving PIK3CG-knockdown cells and control cells at 4 weeks after transplantation (n=5). (FIG. 15J) The overall survival was examined in the recipients transplanted with PIK3CG- knockdown cells and control MV4-11 cells (n=5). (FIGS. 15K-M) NADPH (FIG. 15K) and NADP+ (FIG. 15L) levels were measured in PIK3CG-knockdown human cell lines (THP-1, MV4- 11, and U937) and control cells and the ratio of NADPH / NADP+ (FIG. 15M) was calculated (n=3). (FIG. 15N) The protein levels of p-AKT (S473), p-AKT (T308), AKT, G6PD, and PGD in PIK3CG-knockdown (sh-PIK3CG-#1 and -#2) human cell lines (THP-1, MV4-11, and U937) and control cells were measured by Western blot. (FIGS. 15O-15P) Colony numbers (FIG. 15O) and ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^derived total cell counts (FIG. 15P) of Lin-CD34+CD38-CD90- CD45RA+ LSCs during the first and second plating were calculated (n=3). (FIG. 15Q) The protein levels of cytoplasmic AKT, p- AKT, PGD and nuclear NRF2 in CD34+ PDX cells treated with 5^M MK-2206 or vehicle for 24 hours were assessed by Western blot. (FIG. 15R) Nuclear NRF2 protein levels in BM cells of recipient mice transplanted with WT, Nrf2- overexpressing WT, Pik3cg-KO, and Nrf2- overexpressing KO AML cells were measured by Western blot. (FIG. 15S) mRNA levels of Pgd, Tkt, and Taldo1 in BM L-GMPs from mice transplanted with WT, Nrf2-overexpressing WT, Pik3cg-KO, and Nrf2- overexpressing KO AML cells were measured by quantitative RT-PCR 4 weeks post-transplantation (n=3). (T) The metabolites in the nucleotide synthesis were measured in WT, Nrf2-overexpressing WT, Pik3cg-KO, and Nrf2-overexpressing KO L-GMP cells and normalized against WT+vector cells 4 weeks post-transplantation (n=3). Data are represented as mean ± standard error of the mean. 1-way analysis of variance (ANOVA) with Tukey’s multiple comparison test (FIGS. 15B, C, D, F, I, K, L, M, O, P, and S) and log-rank test (FIGS. 15G and J) were used for the comparison of statistical significance. *, P <0.05; **, P <0.01; ***, P <0.001.

[0028] FIGS. 16A-16O show an example in which (FIGS. 16A-16C) THP-1(FIG. 16A), MV4- 11(FIG. 16B), and U937 (FIG. 16C) were treated with 5^M IPI-549. Cell number was calculated at the indicated time points (n=3). (FIG. 16D) The protein levels of cytoplasmic AKT, p-AKT, PGD and nuclear NRF2 in human AML cell lines treated with 5^M IPI-549 or vehicle in vitro for 12 hours were assessed by Western blot. (FIGS. 16E-16G) NADPH (FIG. 16E) and NADP+ (FIG. 16F) levels were measured in human AML cell lines treated with 5^M IPI-549 or vehicle in vitro for 12 hours and the ratio of NADPH / NADP+ (FIG. 16G) was calculated (n=3). (FIG. 16H) Flow cytometric analysis of ROS levels in human AML cell lines upon 5^M IPI-549 treatment in vitro for 12 hours (n=3). (FIGS. 16I-16K) NADPH (FIG. 16I) and NADP+ (FIG. 16J) levels were measured in mouse BM MLL-AF9+ AML cells treated with 1^M IPI-549 or vehicle in vitro for 12 hours and the ratio of NADPH / NADP+ (FIG. 16K) was calculated (n=6). (FIG. 16L) Flow cytometric analysis of ROS levels in mouse BM MLL-AF9+ AML cells upon in vitro 1^M IPI-549 treatment for 12 hours (n=3). (FIG. 16M) Flow cytometric analysis of ROS levels in BM AML cells from mice transplanted with WT and Pgd-overexpressing WT upon in vitro 1^M IPI-549 treatment for 12 hours (n=3). (FIGS. 16N-16O) Colony numbers (FIG. 16N) and derived total cell counts (FIG. 16O) of BM AML cells from mice transplanted with WT and Pgd-overexpressing WT AML cells upon 1^M IPI-549 treatment were calculated (n=3). Data are represented as mean ± standard error of the mean. Student 2-tailed unpaired t test (FIGS. 16A, 16B, 16C, 16E, 16F, 16G, 16H, 16I, ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^16J, 16K, and 16L) and 1- way analysis of variance (ANOVA) with Tukey’s multiple comparison test (FIGS. 16M-16O) were used for the comparison of statistical significance. *, P <0.05; **, P <0.01; ***, P <0.001; n.s., not significant.

[0029] FIGS. 17A-17V show an example in which (FIGS. 17A-17B) the frequencies of leukemia cells in the BM at 4 weeks post transplantation (FIG. 17A, n=5) and overall survival (FIG. 17B, n=8) were compared among the recipients transplanted with mouse MLL-AF9+ AML cells, followed by 15mg / kg IPI-549 treatment starting 24 hours post-transplantation. (FIGS. 17C-17D) The percentages of human CD45+ AML cells in the BM at 4 weeks post transplantation (FIG. 17C) (n = 5) and the overall survival (FIG. 17D, n=5) were compared in the recipients transplanted with PDX #1 cells, followed by 15mg / kg IPI-549 treatment starting 24 hours post- transplantation. (FIGS. 17E-17F) The percentages of human CD45+ AML cells in the BM at 4 weeks post transplantation (FIG. 17E) (n = 6) and the overall survival (FIG. 17F, n=6) were compared in the recipients transplanted with PDX #2 cells, followed by 15mg / kg IPI-549 treatment starting 24 hours post-transplantation. (FIGS. 17G-17H) The percentages of human CD45+ AML cells in the BM at 4 weeks post transplantation (FIG. 17G) (n = 6) and the overall survival (FIG. 17H, n=6) were compared in the recipients transplanted with PDX #3 cells, followed by 15mg / kg IPI-549 treatment starting 24 hours post-transplantation. (FIGS. 17I-17K) NADPH (FIG. 17I) and NADP+ (FIG. 17J) levels were measured in CD34+ PDX cells upon in vitro 5^M IPI-549 treatment for 12 hours and the ratio of NADPH / NADP+ (FIG. 17K) was calculated (n=3). (FIG. 17L) Flow cytometric analysis of ROS levels in CD34+ PDX cells upon in vitro 5^M IPI-549 treatment for 12 hours (n=3). (FIG. 17M) The protein levels of cytoplasmic p-AKT (S473), p- AKT (T308), AKT, PGD, and nuclear NRF2 in CD34+ PDX cells were measured by Western blot upon in vitro 5^M IPI-549 treatment for 12 hours. (FIGS. 17N-17P) Gene set enrichment analyses evaluating changes in the pentose phosphate pathway (FIG. 17N), purine metabolism (FIG. 17O) and pyrimidine metabolism (FIG. 17P) in Lin-CD34+CD38- PDX #1 cells treated with 15mg / kg IPI-549 and vehicle, 2 weeks post-treatment. (FIGS. 17Q-17S) Gene set enrichment analyses evaluating changes in the pentose phosphate pathway (FIG. 17Q), purine metabolism (FIG. 17R) and pyrimidine metabolism (FIG. 17S) in Lin-CD34+CD38- PDX #2 cells treated with 15mg / kg IPI-549 and vehicle, 2 weeks post- treatment. (FIGS. 17T-17V) Gene set enrichment analyses evaluating changes in the pentose phosphate pathway (FIG. 17T), purine metabolism (FIG. 17U) and pyrimidine metabolism (FIG. 17V) in Lin-CD34+CD38- PDX #3 cells treated with 15mg / kg IPI-549 and vehicle, 2 weeks post- treatment. NES, normalized enrichment score; FDR q-val, false-discovery rate q-value. Data are ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^represented as mean ± standard error of the mean. Student 2-tailed unpaired t test (FIGS. 17A, 17C, 17E, 17G, 17I, 17J, 17K, and 17L) and log-rank test (FIGS. 17B, 17D, 17F, and 17H) were used for the comparison of statistical significance. *, P <0.05; **, P <0.01; ***, P<0.001. DETAILED DESCRIPTION

[0030] Disclosed herein and without being bound by theory, PI3K^ was shown to be enriched in acute myeloid LSCs and facilitated self-renewal, but was dispensable for normal hematopoietic stem cells. Further, PI3K^-AKT signaling promoted NRF2 nuclear accumulation, which induced 6- phosphogluconate dehydrogenase (PGD) and the pentose phosphate pathway, thereby maintaining LSC stemness. Genetic or pharmacological inhibition of PI3K^ impaired expansion and stemness of murine and human AML cells in vitro and in vivo. Thus, PI3K^ selectively maintained LSC function by regulating the AKT-NRF2-PGD metabolic pathway, enhancing resistance to oxidative stress and sustaining nucleotide synthesis. Targeting the PI3K^ pathway, therefore, will target LSCs without damaging normal hematopoiesis, providing a therapeutic strategy for AML. Further, the disclosure herein elucidates the lack of efficacy observed for duvelisib or MK-2206 in AML patients and discloses precise, isoform-specific inhibition within the PI3K-AKT pathway, rather than broad multi-targeting, which facilitates superior potency, while averting issues of excessive toxicity, leading to better clinical outcomes. Methods of Detecting

[0031] The present disclosure provides methods of detecting leukemia stem cells (LSCs). The methods provided herein include detecting leukemia stem cells in a bone marrow or blood sample. The methods provided herein include performing immunochemistry or qPCR using a detectable means for binding PI3K^ or a detectable means for amplifying cDNA reverse transcribed from PI3KCG mRNA, respectively, for bone marrow or blood samples. In embodiments, the detectable means for binding PI3K^ is detected or quantified. In embodiments, the detectable means for amplifying cDNA reverse transcribed from PI3KCG mRNA is detected or quantified. In embodiments, the bone marrow or blood sample comprises or is a test sample. In embodiments, the bone marrow or blood sample is a control sample without LSCs. In embodiments, the control sample without LSCs is from or representative of a healthy subject.

[0032] The methods provided herein can be used for a variety of bone marrow and blood samples. In embodiments, the bone marrow sample is a human or veterinary bone marrow sample (such as a whole bone marrow sample or a bone marrow aspirate sample). In embodiments, the bone marrow ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^sample is a human bone marrow sample (such as a whole human bone marrow sample or a human bone marrow aspirate sample). In embodiments, the bone marrow sample is a whole human bone marrow sample. In embodiments, the bone marrow sample is a human bone marrow aspirate sample. In embodiments, the bone marrow sample is a veterinary bone marrow sample (such as a dog, cat, horse, pig, sheep, goat, cow, rabbit, llama, deer, elk, or poultry whole bone marrow sample or a dog, cat, horse, pig, sheep, goat, cow, rabbit, llama, deer, elk, or poultry bone marrow aspirate sample). In embodiments, the blood sample is a human or veterinary bone marrow sample (such as a whole bone marrow sample or a bone marrow aspirate sample). In embodiments, the blood sample is a peripheral blood sample. In embodiments, the blood sample is a human peripheral blood sample. In embodiments, the blood sample is a veterinary blood sample (such as a dog, cat, horse, pig, sheep, goat, cow, rabbit, llama, deer, elk, or poultry peripheral blood sample).

[0033] In embodiments, the methods of detecting disclosed herein comprise qPCR with or without a reverse transcription step. In embodiments, a sample is already reverse transcribed from mRNA to cDNA. In other embodiments, the methods herein include steps for reverse transcribing mRNA to cDNA. Reverse transcription is a method that is well-known by a person of ordinary skill in the art. For example, kits for reverse transcribing samples are readily available. Briefly, steps for reverse transcribing mRNA (such as mRNA in a blood or bone marrow sample) comprise contacting mRNA with an oligomeric primer, reverse transcriptase, and deoxynucleotide triphosphates (dNTPs)) for primer annealing to the mRNA and cDNA synthesis. cDNA synthesis steps can occur in the same in vitro container as qPCR or amplification steps. Briefly, steps for qPCR amplification comprise contacting cDNA with primers that bind PI3KCG cDNA, DNA polymerase, and deoxynucleotide triphosphates (dNTPs) for primer annealing to the cDNA and DNA amplification. In embodiments, the detectable means for amplifying cDNA reverse transcribed from PI3KCG mRNA comprises fluorescence. Methods for detecting amplifying or amplification of cDNA are known by a person of ordinary skill in the art. In embodiments, the dNTPs are fluorescently labeled for detecting amplifying or amplification of cDNA. In embodiments, contacting comprises contacting cDNA with primers that bind PI3KCG cDNA, DNA polymerase, deoxynucleotide triphosphates (dNTPs), and a fluorophore that intercalates DNA for detecting amplifying or amplification of cDNA. In embodiments, the detecting amplifying or amplification of cDNA comprises measuring the number of qPCR amplification cycles. In embodiments, the detecting amplifying or amplification of cDNA comprises comparing the number of qPCR amplification cycles to a threshold value for a standard curve. In embodiments, a standard curve is formed by measuring a control sample, such as a sample ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^without LSCs. In embodiments, a standard curve is formed by measuring a sample from or representative of a healthy subject. In embodiments, a standard curve is formed by measuring a sample without PI3KCG cDNA.

[0034] The methods of detecting disclosed herein can include immunochemistry, such as western blotting or immunoblotting and immunohistochemistry. In embodiments, the methods provided herein comprise western blotting or immunoblotting. Steps for western blotting or immunoblotting are well-known by a person of ordinary skill in the art. Briefly, the proteins in a sample, such as a blood or bone marrow sample, are separated based on size, for example, using gel electrophoresis, and transferred to a solid membrane, which is contacted with an antibody that binds PI3K^. The bound antibody is detectable, such as visually or digitally detectable, for example, through a stain or signal, such as luminescence or fluorescence. The detectable bound antibody is qualifiable. In embodiments, the methods provided herein comprise immunohistochemistry. Steps for immunohistochemistry are well-known by a person of ordinary skill in the art. Briefly, a sample, such as a blood sample or a bone marrow sample, is sectioned and fixed, and the sectioned, fixed sample is contacted with an antibody that binds PI3K^. The bound antibody is detectable, such as visually or digitally detectable, for example, through a stain or signal, such as luminescence or fluorescence. The detectable bound antibody is qualifiable. In embodiments, the detectable means for binding PI3K^ comprise antibodies that bind PI3K^. Various anti-PI3K^ antibodies are useful for the methods provided herein. In examples, the anti-PI3K^ comprises monoclonal or polyclonal antibodies. In examples, the anti-PI3K^ is a monoclonal or polyclonal antibody. In examples, the anti-PI3K^ comprises a polyclonal antibody. In examples, the anti-PI3K^ is a polyclonal antibody. In examples, the anti-PI3K^ comprises a monoclonal antibody. In examples, the anti-PI3K^ is a monoclonal antibody. A person of ordinary skill in the art will understand that anti-PI3K^ antibodies useful for the methods herein are widely available.

[0035] In examples, the anti-PI3K^ of the methods herein is a monoclonal antibody. In examples, the anti-PI3K^ of the methods herein are polyclonal antibodies.

[0036] In embodiments, the detectable means for means for amplifying cDNA reverse transcribed from PI3KCG mRNA comprises qPCR using PI3KCG primers. Various PI3KCG primers or PI3KCG cDNA primers can be used. PI3KG primers are primers that bind or anneal to the mRNA that encodes anti-phosphatidylinositol 3-kinase gamma (PI3K^) protein and are useful for the methods provided herein. In embodiments, PI3KCG primers are used to reverse transcribe mRNA in a blood sample (such as a peripheral blood sample) or bone marrow sample (such as the whole bone ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^marrow or bone marrow aspirate). PI3KCG cDNA primers are primers that bind or anneal to reverse transcribed PI3KCG mRNA and are useful for PCR, such as qPCR, in a blood sample (such as a peripheral blood sample) or bone marrow sample (such as the whole bone marrow or bone marrow aspirate). In embodiments, a forward or reverse PI3KCG cDNA primer is used. The orientation of a forward or reverse primer for binding or annealing is understood by a person of ordinary skill in the art. In embodiments, the methods comprise using a forward PI3KCG cDNA primer. In embodiments, the forward primer is or includes GGCTACCATGAGCAGCTTACC (SEQ ID NO: 1). In embodiments, the methods comprise using a reverse PI3KCG cDNA primer. In embodiments, the reverse primer is or includes CTGTGAGGTCGGTGTTCCG (SEQ ID NO: 2). In embodiments, the methods comprise using a forward and reverse PI3KCG cDNA primers. In examples, the methods comprise using a forward and reverse PI3KCG cDNA primer; in embodiments, the forward PI3KCG cDNA primer is or includes SEQ ID NO: 1, and the reverse PI3KCG cDNA primer is or includes SEQ ID NO: 2.

[0037] In embodiments, the detected or quantified means for binding PI3K^ in a test sample is compared with a detected or quantified control bone marrow or blood sample. In embodiments, the detected or quantified means for amplifying cDNA reverse transcribed from PI3KCG mRNA in a test sample is compared with a detected or quantified control bone marrow or blood sample. In embodiments, the means for binding PI3K^ is detected or quantified as greater in the test sample compared with the control sample by at least 1.5-fold, at least 1.75-fold, at least 2-fold, at least 2.5- fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 25-fold, at least 50-fold, at least 100-fold, at least 500-fold, at least 1000-fold, at least 10,000-fold, 1.5-fold to 2-fold, 1.5-fold to 2.5-fold, 1.5-fold to 3-fold, 2-fold to 3.5-fold, 2-fold to 4-fold, 2-fold to 5-fold, 2- fold to 10-fold, 5-fold to 10-fold, 5-fold to 25-fold, 10-fold to 50-fold, 10-fold to 100-fold, 100-fold to 500-fold, 100-fold to 1000-fold, or 10-fold to 10,000-fold. In embodiments, the means for amplifying cDNA reverse transcribed from PI3KCG mRNA is detected or quantified as greater in the test sample compared with the control sample by at least 1.5-fold, at least 1.75-fold, at least 2- fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 25-fold, at least 50-fold, at least 100-fold, at least 500-fold, at least 1000-fold, at least 10,000-fold, 1.5-fold to 2-fold, 1.5-fold to 2.5-fold, 1.5-fold to 3-fold, 2-fold to 3.5-fold, 2-fold to 4- fold, 2-fold to 5-fold, 2-fold to 10-fold, 5-fold to 10-fold, 5-fold to 25-fold, 10-fold to 50-fold, 10- fold to 100-fold, 100-fold to 500-fold, 100-fold to 1000-fold, or 10-fold to 10,000-fold.

[0038] A variety of test sample and control samples are possible. In embodiments, the test sample ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^and control samples are bone marrow samples. In embodiments, the test sample and control samples are whole bone marrow samples. In embodiments, the test sample and control samples are bone marrow aspirate samples. In embodiments, the test sample and control samples are blood samples. In embodiments, the test sample and control samples are peripheral blood samples.

[0039] In embodiments, the methods of detecting leukemia stem cells disclosed herein comprise performing rt-qPCR for a bone marrow or blood sample using PI3KCG cDNA primers, wherein the bone marrow or blood test sample reaches the amplification threshold by completing fewer amplification cycles than a bone marrow or blood control sample without LSCs. In embodiments, the PI3KCG cDNA primers are or include SEQ ID NOS: 1-2. In embodiments, the test sample and control samples are bone marrow samples. In embodiments, the test sample and control samples are whole bone marrow samples. In embodiments, the test sample and control samples are bone marrow aspirate samples. In embodiments, the test sample and control samples are blood samples. In embodiments, the test sample and control samples are peripheral blood samples. In embodiments, the bone marrow sample is a human or veterinary bone marrow sample. In embodiments, the bone marrow sample is a human bone marrow sample.

[0040] In embodiments, the methods of detecting leukemia stem cells disclosed herein comprise performing immunochemistry for a bone marrow or blood sample using an anti-phosphatidylinositol 3-kinase gamma (PI3K^), wherein the bone marrow or blood test sample binds more anti-PI3K^ than a bone marrow or blood control sample without LSCs. In embodiments, the anti-PI3K^ is a monoclonal or polyclonal antibody. In embodiments, the anti-PI3K^ is a polyclonal antibody. In embodiments, the anti-PI3K^ is a monoclonal antibody. In embodiments, the bone marrow sample is a human or veterinary bone marrow sample. In embodiments, the bone marrow sample is a human bone marrow sample. In embodiments, the test sample and control samples are bone marrow samples. In embodiments, the test sample and control samples are whole bone marrow samples. In embodiments, the test sample and control samples are bone marrow aspirate samples. In embodiments, the test sample and control samples are blood samples. In embodiments, the test sample and control samples are peripheral blood samples. Diagnostic Methods

[0041] Methods of diagnosing acute myeloid leukemia (AML) are disclosed herein, comprising detecting leukemia stem cells using the methods of detecting LSCs as disclosed herein, wherein the bone marrow sample or blood sample is a human blood sample or bone marrow sample from a subject with or at risk of having AML. ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^

[0042] In embodiments, the methods of diagnosing AML comprise performing rt-qPCR for a bone marrow or blood sample using PI3KCG cDNA primers, wherein the bone marrow or blood test sample reaches the amplification threshold by completing fewer amplification cycles than a bone marrow or blood control sample without LSCs. In embodiments, the test sample and control samples are bone marrow samples. In embodiments, the test sample and control samples are whole bone marrow samples. In embodiments, the test sample and control samples are bone marrow aspirate samples. In embodiments, the test sample and control samples are blood samples. In embodiments, the test sample and control samples are peripheral blood samples. In embodiments, the PI3KCG cDNA primers are or include SEQ ID NOS: 1-2. In embodiments, the bone marrow sample is a human or veterinary bone marrow sample. In embodiments, the bone marrow sample is a human bone marrow sample.

[0043] In embodiments, the methods of diagnosing AML comprise performing immunochemistry for a bone marrow or blood sample using a anti-phosphatidylinositol 3-kinase gamma (PI3K^), wherein the bone marrow or blood test sample binds more anti-PI3K^ than a bone marrow or blood control sample without LSCs. In embodiments, the test sample and control samples are bone marrow samples. In embodiments, the test sample and control samples are whole bone marrow samples. In embodiments, the test sample and control samples are bone marrow aspirate samples. In embodiments, the test sample and control samples are blood samples. In embodiments, the test sample and control samples are peripheral blood samples. In embodiments, the anti-PI3K^ is a monoclonal or polyclonal antibody. In embodiments, the anti-PI3K^ is a polyclonal antibody. In embodiments, the anti-PI3K^ is a monoclonal antibody. In embodiments, the bone marrow sample is a human or veterinary bone marrow sample. In embodiments, the bone marrow sample is a human bone marrow sample.

[0044] Methods of diagnosing minimal residual disease (MRD) are disclosed herein, comprising detecting leukemia stem cells using the methods of detecting LSCs as disclosed herein, wherein the bone marrow is a human bone marrow sample from a subject with or at risk of having MRD.

[0045] In embodiments, the methods of diagnosing MRD comprise performing rt-qPCR for a bone marrow or blood sample using PI3KCG cDNA primers, wherein the bone marrow or blood test sample reaches the amplification threshold by completing fewer amplification cycles than a bone marrow or blood control sample without LSCs. In embodiments, the test sample and control samples are bone marrow samples. In embodiments, the test sample and control samples are whole bone marrow samples. In embodiments, the test sample and control samples are bone marrow aspirate ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^samples. In embodiments, the test sample and control samples are blood samples. In embodiments, the test sample and control samples are peripheral blood samples. In embodiments, the PI3KCG cDNA primers are or include SEQ ID NOS: 1-2. In embodiments, the bone marrow sample is a human or veterinary bone marrow sample. In embodiments, the bone marrow sample is a human bone marrow sample.

[0046] In embodiments, the methods of diagnosing MRD comprise performing immunochemistry for a bone marrow or blood sample using a anti-phosphatidylinositol 3-kinase gamma (PI3K^), wherein the bone marrow or blood test sample binds more anti-PI3K^ than a bone marrow or blood control sample without LSCs. In embodiments, the test sample and control samples are bone marrow samples. In embodiments, the test sample and control samples are whole bone marrow samples. In embodiments, the test sample and control samples are bone marrow aspirate samples. In embodiments, the test sample and control samples are blood samples. In embodiments, the test sample and control samples are peripheral blood samples. In embodiments, the anti-PI3K^ is a monoclonal or polyclonal antibody. In embodiments, the anti-PI3K^ is a polyclonal antibody. In embodiments, the anti-PI3K^ is a monoclonal antibody. In embodiments, the bone marrow sample is a human or veterinary bone marrow sample. In embodiments, the bone marrow sample is a human bone marrow sample.

[0047] Methods of diagnosing medium-risk (or intermediate-risk) acute myeloid leukemia (AML) are disclosed herein, comprising detecting leukemia stem cells using the methods of detecting LSCs as disclosed herein, wherein the bone marrow sample or blood sample is a human blood sample or bone marrow sample from a subject with or at risk of having medium-risk (or intermediate-risk) AML.

[0048] In embodiments, the methods of diagnosing medium-risk (or intermediate-risk) AML comprise performing rt-qPCR for a bone marrow or blood sample using PI3KCG cDNA primers, wherein the bone marrow or blood test sample reaches the amplification threshold by completing fewer amplification cycles than a bone marrow or blood control sample without LSCs. In embodiments, the test sample and control samples are bone marrow samples. In embodiments, the test sample and control samples are whole bone marrow samples. In embodiments, the test sample and control samples are bone marrow aspirate samples. In embodiments, the test sample and control samples are blood samples. In embodiments, the test sample and control samples are peripheral blood samples. In embodiments, the PI3KCG cDNA primers are include SEQ ID NOS: 1-2. In embodiments, the bone marrow sample is a human or veterinary bone marrow sample. In ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^embodiments, the bone marrow sample is a human bone marrow sample.

[0049] In embodiments, the methods of diagnosing medium-risk (or intermediate-risk) AML comprise performing immunochemistry for a bone marrow or blood sample using a anti- phosphatidylinositol 3-kinase gamma (PI3K^), wherein the bone marrow or blood test sample binds more anti-PI3K^ than a bone marrow or blood control sample without LSCs. In embodiments, the test sample and control samples are bone marrow samples. In embodiments, the test sample and control samples are whole bone marrow samples. In embodiments, the test sample and control samples are bone marrow aspirate samples. In embodiments, the test sample and control samples are blood samples. In embodiments, the test sample and control samples are peripheral blood samples. In embodiments, the anti-PI3K^ is a monoclonal or polyclonal antibody. In embodiments, the anti- PI3K^ is a polyclonal antibody. In embodiments, the anti-PI3K^ is a monoclonal antibody. In embodiments, the bone marrow sample is a human or veterinary bone marrow sample. In embodiments, the bone marrow sample is a human bone marrow sample.

[0050] Methods of diagnosing high-risk acute myeloid leukemia (AML) are disclosed herein, comprising detecting leukemia stem cells using the methods of detecting LSCs as disclosed herein, wherein the bone marrow sample or blood sample is a human blood sample or bone marrow sample from a subject with or at risk of having high-risk AML.

[0051] In embodiments, the methods of diagnosing high-risk AML comprise performing rt-qPCR for a bone marrow or blood sample using PI3KCG cDNA primers, wherein the bone marrow or blood test sample reaches the amplification threshold by completing fewer amplification cycles than a bone marrow or blood control sample without LSCs. In embodiments, the test sample and control samples are bone marrow samples. In embodiments, the test sample and control samples are whole bone marrow samples. In embodiments, the test sample and control samples are bone marrow aspirate samples. In embodiments, the test sample and control samples are blood samples. In embodiments, the test sample and control samples are peripheral blood samples. In embodiments, the PI3KCG cDNA primers are include SEQ ID NOS: 1-2. In embodiments, the bone marrow sample is a human or veterinary bone marrow sample. In embodiments, the bone marrow sample is a human bone marrow sample.

[0052] In embodiments, the methods of diagnosing high-risk AML comprise performing immunochemistry for a bone marrow or blood sample using a anti-phosphatidylinositol 3-kinase gamma (PI3K^), wherein the bone marrow or blood test sample binds more anti-PI3K^ than a bone marrow or blood control sample without LSCs. In embodiments, the test sample and control samples ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^are bone marrow samples. In embodiments, the test sample and control samples are whole bone marrow samples. In embodiments, the test sample and control samples are bone marrow aspirate samples. In embodiments, the test sample and control samples are blood samples. In embodiments, the test sample and control samples are peripheral blood samples. In embodiments, the anti-PI3K^ is a monoclonal or polyclonal antibody. In embodiments, the anti-PI3K^ is a polyclonal antibody. In embodiments, the anti-PI3K^ is a monoclonal antibody. In embodiments, the bone marrow sample is a human or veterinary bone marrow sample. In embodiments, the bone marrow sample is a human bone marrow sample. Methods of Treating

[0053] Methods of treating acute myeloid leukemia (AML) are disclosed herein, comprising detecting leukemia stem cells using the methods of detecting LSCs as disclosed herein, wherein the bone marrow sample or blood sample is a human blood sample or bone marrow sample from a subject with or at risk of having AML; and administering a PI3K^ inhibitor. In embodiments, the AML is high-risk AML or medium-risk (or intermediate-risk) AML. In embodiments, the AML is high-risk AML. In embodiments, the AML is medium-risk (or intermediate-risk) AML.

[0054] In embodiments, the methods of treating AML comprise performing rt-qPCR for a bone marrow or blood sample using PI3KCG cDNA primers, wherein the bone marrow or blood test sample reaches the amplification threshold by completing fewer amplification cycles than a bone marrow or blood control sample without LSCs. In embodiments, the test sample and control samples are bone marrow samples. In embodiments, the test sample and control samples are whole bone marrow samples. In embodiments, the test sample and control samples are bone marrow aspirate samples. In embodiments, the test sample and control samples are blood samples. In embodiments, the test sample and control samples are peripheral blood samples. In embodiments, the PI3KCG cDNA primers are include SEQ ID NOS: 1-2. In embodiments, the bone marrow sample is a human or veterinary bone marrow sample. In embodiments, the bone marrow sample is a human bone marrow sample.

[0055] In embodiments, the methods of treating AML comprise performing immunochemistry for a bone marrow or blood sample using a anti-phosphatidylinositol 3-kinase gamma (PI3K^), wherein the bone marrow or blood test sample binds more anti-PI3K^ than a bone marrow or blood control sample without LSCs. In embodiments, the test sample and control samples are bone marrow samples. In embodiments, the test sample and control samples are whole bone marrow samples. In embodiments, the test sample and control samples are bone marrow aspirate samples. In ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^embodiments, the test sample and control samples are blood samples. In embodiments, the test sample and control samples are peripheral blood samples. In embodiments, the anti-PI3K^ is a monoclonal or polyclonal antibody. In embodiments, the anti-PI3K^ is a polyclonal antibody. In embodiments, the anti-PI3K^ is a monoclonal antibody. In embodiments, the bone marrow sample is a human or veterinary bone marrow sample. In embodiments, the bone marrow sample is a human bone marrow sample.

[0056] In embodiments, the methods of treating AML comprise administering a PI3K^ inhibitor, wherein the inhibitor is a biologic or a small molecule. A PI3K^ inhibitor can inhibit PI3K^ activity by direct interaction with the PI3K^ or by inhibiting expression of PI3K^. In embodiments, the PI3K^ inhibitor is a small molecule that inhibits PI3K^ kinase activity or signaling activity. In embodiments, the PI3K^ inhibitor is a small molecule selected from the list consisting of: apitolisib, buparlisib, dactolisib, duvelisib (Copiktra), eganelisib (also known as IPI-549), gedatolisib, GSK1059615, omipalisib, paxalisib, samotolisib, tenalisib, taselisib, voxtalisib, wortmannin, AS252424, AS605240, AZD3458, ZX-101a, and ZX-4081. In particular embodiments, the PI3K^ inhibitor is eganelisib (also known as IPI-549). In embodiments, the PI3K^ inhibitor is a biologic comprising an antibody that binds PI3K^ and inhibits PI3K^ activity. In embodiments, the PI3K^ inhibitor inhibits expression of PI3K^, such as using nucleic acids. In embodiments, the PI3K^ inhibitor is a small molecule or biologic that inhibits PI3K^ expression. In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising a nucleic acid sequence antisense to PI3K^ mRNA (also known as PI3KCG). In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising a nucleic acid sequence that binds to: ACATGGGGGTGTGTGTGTGTGTGCGCGCGCGCGCTGAAGTGTCTTGGTGTGACAGCTCA CAGGTTACATGTGGAAACTGCAGAAACAGACGCTGCTTCTTGTCAGAATTAATTCCACT TTATTCGCATCAATGCCTCGGGATCCGTTTGTCCTCCGTCGGGGATTCAGCTGGACCTGT GTTTGTTAAACGCATTGGTTATGGAGCAGCAAGTTAGTGATGATGAATCACCAGTAGTT CTAAGAGGTGAAAACCGAAGGAGGAGAAGAAAAATGAAAGCATTTACATCGAACACA TCTGCAACAATGGACCATTTAACGGTGGAGTTTGTGCTTCCGACGACTAACAAAACAAC CAAGAACCCTGACACGCTGCAGCTGGATGTGATTGGGAACTGGACGGTCGAGCAGGTA AAAGCCCAGCTGTGGCTGAAGGCCGTCACGACCAACATGTGCCCTGAATTCTACCAGA AGTATTCACCAGACCACTGCATCCTGCTGTACCAAAAGAAAGGAAGCTGTTGTGAGATT TATGACAAACACCAGGTGTTTCAGACCCTTGACTGCATTCGCTACTGGAAAGCTCTTAA AAAGGAGGTTGGGAAAATCTATCTGGTTCTCCGGCCACAGCTTTCTGAAGAATCCATCC AGTACCAGAAATTTCTAAATCATCTTATCGGGTATGATGTCACAGATGTCAGTAATGTT CACGACGATGAGCTGGAGTTCACTAGGAGGAAGTTACTAACAACCAGGAAAATTGAAT TGGCTGACCGAGATCCCAGATTTTACTCAATGGACCCCTGGATAACTACCAAATCCTTA CCTGATTACATGCTGAGTAAAATCTCTAACAACAACATTCTACTTGTGATACACAGAGA AACTTCAAGTCAGACGATAAAGGTGTCGATCGATGACACACCATTTCATATTCTTCAGA ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^GTTTTTTCATAAAGACTGTCAACAAGAGGGCTCTGCTTGGCATACCAGAGGATGTCAAC GAATCCGATTTTGTTCTGAGGGTTTGTGGAAGAGAAGAATATCTTTTTGGAGACTATCC CATCAAAGACTTCCACTGGATCAGACAGTGCCTGAAAAGTGGAGAAGAGATCCATTTG GTGCTTGAATCCCCCCCAGACCCTGAACAAGATGTTGTCCCAAAGGAGGACTGGGCAC AGGTGGATGACTGCACTGGTGTAGCTGGCACACATGAGCAACTGACTATTAATGAGAA GGACCATGAGAAGGTGTTCACAGTCTCCCTGTGGGACTGCAATCGCAAGTTTAGAGTCA AAATCCTGGGCATAGATATACCAGTCCTGCCCTGTAACTCCGAACTGATGGTCTTTGTG GAGGCCAGCATTTTCCATGGGCAGCAGCTGCTTGCTCAGGAGAGGACCCCCTTAAAGCC CTTCACTGAAGAGGTGCTGTGGAACATCTGGCTTGATTTCAACATTAAGATCAAGGATT TACCCAAAGGTGCCCGGTTGAACCTGCAGGTGCTGTGTGGTAAAGCCCAAACACAGCC CTCAAGAGACAGCTCTTCACTCGATAGCAAGAACAAGAGCCGTCTGCTCTACTACGTAA ACCTGTTAGTGGTCGACCACAGGTCTTTACTCAGACAGGGTGAATTTATCCTGCACATG TGGAAGATGCCTGAGAAAAGTGAGGATAACAGTAGCGTAAATGCAGATAAACTCACTT CTGCCACCAATCCAGACAAAACCAGTTCCATGGCAATTGCAGTGCTACTGGACAAGTAT TGCTACCCAGTTGCTTTGCCTAAGAGCAGGGATTCCCAAAACACATCGGAAATGGAAGG AGAAAGGGGGACACGAGAGATGCCGAACCATTTACGGAAGCAGTTTGATCAAATCATG GCTACCGATCCTCTGCATCCACTCAGTGTGGAAGATAAGGAGCTCCTATGGCATTTCAG ACAGGAGTGTGTGCGACATCCTTCGGCCTACCCGAAGTTTCTTGGCTCTGTGAAATGGG GAAAACAGGAAGCCGTCATGGCCACACATCATCTTTTAGAGAGAAGCACCGCATGGGA CCGGAGCCCTCCAGATGTGGGGTTAGCGATGCAGCTATTGGACTGTCACTTTTCTGATG CAAACGTGCGCACTATGGCGGTCAGGAAATTGGAGACTTTTGGCGATGACGATGTCCTT CGGTACCTTTTGCAGCTGGTCCAGGCTGTTAAGTTTGAACCCTATCATGATAGTGCGCTT GCCAGGTTTCTCCTTAAGCGTGCTCTCAGGAGCAAACGAATCGGCCATTTCCTCTTCTGG TTCCTGCGGAGTGAGATAGCTCAGTCTATGCACTACCAACAGCGGTATGCAGTTATTTT AGAGGCTTACCTTCGGGGCTGTGGAGATGCCATGCTGCAGGACTTTAGTAAGCAGGTGG AAATTACTGAGGCATTACAGAAGGTCACTCGTGAGATCAAAGCCATATCTGCTGAAAA ATATGATGTTTCAGCACAAGTTGTTTTTCTGTTGCGCCAGAAACTGGAGAGTCTGCAAA TGCAGGGTTTGCCCAAGAGCTTTAAAGTACCATATGATCCCGGTCTACGAGCTGGGTCA CTTGTGATTGAGCAATGCAAAGTAATGGCATCCAAAAAGAAACCCCTGTGGCTGCAGTT TAAGCGAGCCGACCCCACCACCTTGTCGAGCGACACCATTGGGATCATTTTCAAGGATG GAGATGATCTTCGTCAGGACATGTTAATTTTACAGATTCTGTTGATCATGGAGTCTATAT GGGAGACGGAATCTCTAGATCTGTCCTTATTGCCCTATGGTTGTATTTCTACCGGAAATA AAATTGGGATGATTGAGATCGTGAAGGACGCTACCACCATTGCTAACATCCAGCAAAG CACTGTGGGGAATACTGGAGCTTTTAAAGATGAAATCCTGAACCAGTGGCTGCGAGAC AAATGTGTGAATGAGGACAAGTATCAGCAGGCAGTGGAGCGCTTTGTGTATTCCTGTGG AGGTTACTGCGTAGCAACCTACGTCCTGGGGATAGGCGATCGCCATAATGACAACATCA TGATCACTGAATCTGGTAACCTGTTCCACATTGACTTTGGACACATTCTTGGAAACTACA AGAGCTTTCTGGGTATAACCAAGGAAAGGGTGCCTTTTGTTTTGACGCCTGACTTTCTCT ATGTAATGGGAACAACGGGAAAGAAGTCCAGCCCGAATTTCATTATGTTCCAGGATATT TGTCTGAAGGCCTACCTGGCACTCCGACATCACTCCAACTTGCTCATCATCTTGTTCTCA ATGATGCTGATGACTGGCATGCCCCAGCTGACCAGCAAGGAGGACATAGAGTACATTC GAGAGGCTCTGACTGTAGGCTGTACAGAAGATGTGGCTCAGAGACACTTCCTGGATCAG ATCGAAATCTGCCGGGACAAAGGCTGGACAGTGCAGTTCAACTGGTCTCTACACTTAGT GCTCAGGATTAAACAAGGTGTAGAAAAACGATCAGCTTAAGACTGATGAAAAGGCACC ATGAGACAGTGTTTTTATAAAGTATTTTATCCACAAATTACATTTTTATATCAAGGTTTA GGTTTTATTTGAGTTTTTTTCAATTGCTTTTATTTGAGGTAAATTTTTTTCTCAATTTTGA ATTTTTTTTTCTCTGATAATCATCCCAAGTTTGTTTGTATCTCACATTTTACGCAAAAATG ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^AAGTCTACACATATATATTGTTCAACACATGGAGTATGTGACATTAAAATAAGCTTTAA TGAAAAAAAAAAAA (SEQ ID NO: 5).

[0057] In particular embodiments, the PI3K^ inhibitor is a short hairpin (shRNA). In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising CTCCAGATCTACTGCGGTAAA (SEQ ID NO: 3) or GCCTTATCCATTTCCCATTTA (SEQ ID NO: 4). In particular embodiments, the PI3K^ inhibitor also inhibits the serine / threonine protein kinase (AKT) pathway, such as IPI-549 or a nucleic acid sequence that binds to PI3K^ mRNA (PI3KCG).

[0058] Methods of treating minimal residual disease (MRD) are disclosed herein, comprising detecting leukemia stem cells using the methods of detecting LSCs as disclosed herein, wherein the bone marrow is a human bone marrow sample from a subject with or at risk of having MRD; and administering a PI3K^ inhibitor. Methods of treating minimal residual disease (MRD) are disclosed herein, comprising administering a PI3K^ inhibitor.

[0059] In embodiments, the methods of treating MRD comprise performing rt-qPCR for a bone marrow or blood sample using PI3KCG cDNA primers, wherein the bone marrow or blood test sample reaches the amplification threshold by completing fewer amplification cycles than a bone marrow or blood control sample without LSCs. In embodiments, the test sample and control samples are bone marrow samples. In embodiments, the test sample and control samples are whole bone marrow samples. In embodiments, the test sample and control samples are bone marrow aspirate samples. In embodiments, the test sample and control samples are blood samples. In embodiments, the test sample and control samples are peripheral blood samples. In embodiments, the PI3KCG cDNA primers are include SEQ ID NOS: 1-2. In embodiments, the bone marrow sample is a human or veterinary bone marrow sample. In embodiments, the bone marrow sample is a human bone marrow sample.

[0060] In embodiments, the methods of treating MRD comprise performing immunochemistry for a bone marrow or blood sample using a anti-phosphatidylinositol 3-kinase gamma (PI3K^), wherein the bone marrow or blood test sample binds more anti-PI3K^ than a bone marrow or blood control sample without LSCs. In embodiments, the test sample and control samples are bone marrow samples. In embodiments, the test sample and control samples are whole bone marrow samples. In embodiments, the test sample and control samples are bone marrow aspirate samples. In embodiments, the test sample and control samples are blood samples. In embodiments, the test sample and control samples are peripheral blood samples. In embodiments, the anti-PI3K^ is a monoclonal or polyclonal antibody. In embodiments, the anti-PI3K^ is a polyclonal antibody. In ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^embodiments, the anti-PI3K^ is a monoclonal antibody. In embodiments, the bone marrow sample is a human or veterinary bone marrow sample. In embodiments, the bone marrow sample is a human bone marrow sample.

[0061] In embodiments, the methods of treating MRD comprise administering a PI3K^ inhibitor, wherein the inhibitor is a biologic or a small molecule. In embodiments, the methods of treating MRD comprise administering a PI3K^ inhibitor, wherein the inhibitor is a biologic or a small molecule. A PI3K^ inhibitor can inhibit PI3K^ activity by direct interaction with the PI3K^ or by inhibiting expression of PI3K^. In embodiments, the PI3K^ inhibitor is a small molecule that inhibits PI3K^ kinase activity or signaling activity. In embodiments, the PI3K^ inhibitor is a small molecule selected from the list consisting of: apitolisib, buparlisib, dactolisib, duvelisib (Copiktra), eganelisib (also known as IPI-549), gedatolisib, GSK1059615, omipalisib, paxalisib, samotolisib, tenalisib, taselisib, voxtalisib, wortmannin, AS252424, AS605240, AZD3458, ZX-101a, and ZX-4081. In particular embodiments, the PI3K^ inhibitor is eganelisib (also known as IPI-549). In embodiments, the PI3K^ inhibitor is a biologic comprising an antibody that binds PI3K^. In embodiments, the PI3K^ inhibitor inhibits expression of PI3K^, such as using nucleic acids. In embodiments, the PI3K^ inhibitor is a small molecule or biologic that inhibits PI3K^ expression. In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising a nucleic acid sequence antisense to PI3K^ mRNA (also known as PI3KCG). In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising a nucleic acid sequence that binds to SEQ ID NO: 5. In particular embodiments, the PI3K^ inhibitor is a short hairpin (shRNA). In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising SEQ ID NO: 3 or SEQ ID NO: 4. In particular embodiments, the PI3K^ inhibitor also inhibits the serine / threonine protein kinase (AKT) pathway, such as IPI-549 or a nucleic acid sequence that binds to PI3K^ mRNA (PI3KCG).

[0062] Methods of treating medium-risk (or intermediate-risk) acute myeloid leukemia (AML) are disclosed herein, comprising detecting leukemia stem cells using the methods of detecting LSCs as disclosed herein, wherein the bone marrow sample or blood sample is a human blood sample or bone marrow sample from a subject with or at risk of having medium-risk (or intermediate-risk) AML; and administering a PI3K^ inhibitor. Methods of treating medium-risk (or intermediate-risk) acute myeloid leukemia (AML) are disclosed herein, comprising administering a PI3K^ inhibitor.

[0063] In embodiments, the methods of treating medium-risk (or intermediate-risk) AML comprise performing rt-qPCR for a bone marrow or blood sample using PI3KCG cDNA primers, wherein the bone marrow or blood test sample reaches the amplification threshold by completing fewer ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^amplification cycles than a bone marrow or blood control sample without LSCs. In embodiments, the test sample and control samples are bone marrow samples. In embodiments, the test sample and control samples are whole bone marrow samples. In embodiments, the test sample and control samples are bone marrow aspirate samples. In embodiments, the test sample and control samples are blood samples. In embodiments, the test sample and control samples are peripheral blood samples. In embodiments, the PI3KCG cDNA primers are include SEQ ID NOS: 1-2. In embodiments, the bone marrow sample is a human or veterinary bone marrow sample. In embodiments, the bone marrow sample is a human bone marrow sample.

[0064] In embodiments, the methods of treating medium-risk (or intermediate-risk) AML comprise performing immunochemistry for a bone marrow or blood sample using a anti-phosphatidylinositol 3-kinase gamma (PI3K^), wherein the bone marrow or blood test sample binds more anti-PI3K^ than a bone marrow or blood control sample without LSCs. In embodiments, the test sample and control samples are bone marrow samples. In embodiments, the test sample and control samples are whole bone marrow samples. In embodiments, the test sample and control samples are bone marrow aspirate samples. In embodiments, the test sample and control samples are blood samples. In embodiments, the test sample and control samples are peripheral blood samples. In embodiments, the anti-PI3K^ is a monoclonal or polyclonal antibody. In embodiments, the anti-PI3K^ is a polyclonal antibody. In embodiments, the anti-PI3K^ is a monoclonal antibody. In embodiments, the bone marrow sample is a human or veterinary bone marrow sample. In embodiments, the bone marrow sample is a human bone marrow sample.

[0065] In embodiments, the methods of treating medium-risk (or intermediate-risk) AML comprise administering a PI3K^ inhibitor, wherein the inhibitor is a biologic or a small molecule. In embodiments, the methods of treating medium-risk (or intermediate-risk) AML comprise administering a PI3K^ inhibitor, wherein the inhibitor is a biologic or a small molecule. A PI3K^ inhibitor can inhibit PI3K^ activity by direct interaction with the PI3K^ or by inhibiting expression of PI3K^. In embodiments, the PI3K^ inhibitor is a small molecule that inhibits PI3K^ kinase activity or signaling activity. In embodiments, the PI3K^ inhibitor is a small molecule selected from the list consisting of: apitolisib, buparlisib, dactolisib, duvelisib (Copiktra), eganelisib (also known as IPI-549), gedatolisib, GSK1059615, omipalisib, paxalisib, samotolisib, tenalisib, taselisib, voxtalisib, wortmannin, AS252424, AS605240, AZD3458, ZX-101a, and ZX-4081. In particular embodiments, the PI3K^ inhibitor is eganelisib (also known as IPI-549). In embodiments, the PI3K^ inhibitor is a biologic comprising an antibody that binds PI3K^. In embodiments, the PI3K^ inhibitor ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^inhibits expression of PI3K^, such as using nucleic acids. In embodiments, the PI3K^ inhibitor is a small molecule or biologic that inhibits PI3K^ expression. In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising a nucleic acid sequence antisense to PI3K^ mRNA (also known as PI3KCG). In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising a nucleic acid sequence that binds to SEQ ID NO: 5. In particular embodiments, the PI3K^ inhibitor is a short hairpin (shRNA). In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising SEQ ID NO: 3 or SEQ ID NO: 4. In particular embodiments, the PI3K^ inhibitor also inhibits the serine / threonine protein kinase (AKT) pathway, such as IPI-549 or a nucleic acid sequence that binds to PI3K^ mRNA (PI3KCG).

[0066] Methods of treating high-risk acute myeloid leukemia (AML) are disclosed herein, comprising detecting leukemia stem cells using the methods of detecting LSCs as disclosed herein, wherein the bone marrow sample or blood sample is a human blood sample or bone marrow sample from a subject with or at risk of having high-risk AML; and administering a PI3K^ inhibitor. Methods of treating high-risk acute myeloid leukemia (AML) are disclosed herein, comprising administering a PI3K^ inhibitor.

[0067] In embodiments, the methods of treating high-risk AML comprise performing rt-qPCR for a bone marrow or blood sample using PI3KCG cDNA primers, wherein the bone marrow or blood test sample reaches the amplification threshold by completing fewer amplification cycles than a bone marrow or blood control sample without LSCs. In embodiments, the test sample and control samples are bone marrow samples. In embodiments, the test sample and control samples are whole bone marrow samples. In embodiments, the test sample and control samples are bone marrow aspirate samples. In embodiments, the test sample and control samples are blood samples. In embodiments, the test sample and control samples are peripheral blood samples. In embodiments, the PI3KCG cDNA primers are include SEQ ID NOS: 1-2. In embodiments, the bone marrow sample is a human or veterinary bone marrow sample. In embodiments, the bone marrow sample is a human bone marrow sample.

[0068] In embodiments, the methods of treating high-risk AML comprise performing immunochemistry for a bone marrow or blood sample using a anti-phosphatidylinositol 3-kinase gamma (PI3K^), wherein the bone marrow or blood test sample binds more anti-PI3K^ than a bone marrow or blood control sample without LSCs. In embodiments, the test sample and control samples are bone marrow samples. In embodiments, the test sample and control samples are whole bone marrow samples. In embodiments, the test sample and control samples are bone marrow aspirate ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^samples. In embodiments, the test sample and control samples are blood samples. In embodiments, the test sample and control samples are peripheral blood samples. In embodiments, the anti-PI3K^ is a monoclonal or polyclonal antibody. In embodiments, the anti-PI3K^ is a polyclonal antibody. In embodiments, the anti-PI3K^ is a monoclonal antibody. In embodiments, the bone marrow sample is a human or veterinary bone marrow sample. In embodiments, the bone marrow sample is a human bone marrow sample.

[0069] In embodiments, the methods of treating high-risk AML comprise administering a PI3K^ inhibitor, wherein the inhibitor is a biologic or a small molecule. In embodiments, the methods of treating high-risk AML comprise administering a PI3K^ inhibitor, wherein the inhibitor is a biologic or a small molecule. In embodiments, the methods of treating high-risk AML comprise administering a pharmaceutical composition comprising a PI3K^ inhibitor, wherein the inhibitor is a biologic or a small molecule. A PI3K^ inhibitor can inhibit PI3K^ activity by direct interaction with the PI3K^ or by inhibiting expression of PI3K^. In embodiments, the PI3K^ inhibitor is a small molecule that inhibits PI3K^ kinase activity or signaling activity. In embodiments, the PI3K^ inhibitor is a small molecule selected from the list consisting of: apitolisib, buparlisib, dactolisib, duvelisib (Copiktra), eganelisib (also known as IPI-549), gedatolisib, GSK1059615, omipalisib, paxalisib, samotolisib, tenalisib, taselisib, voxtalisib, wortmannin, AS252424, AS605240, AZD3458, ZX-101a, and ZX-4081. In particular embodiments, the PI3K^ inhibitor is eganelisib (also known as IPI-549). In embodiments, the PI3K^ inhibitor is a biologic comprising an antibody that binds PI3K^. In embodiments, the PI3K^ inhibitor inhibits expression of PI3K^, such as using nucleic acids. In embodiments, the PI3K^ inhibitor is a small molecule or biologic that inhibits PI3K^ expression. In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising a nucleic acid sequence antisense to PI3K^ mRNA (also known as PI3KCG). In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising a nucleic acid sequence that binds to SEQ ID NO: 5.. In particular embodiments, the PI3K^ inhibitor is a short hairpin (shRNA). In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising SEQ ID NO: 3 or SEQ ID NO: 4. In particular embodiments, the PI3K^ inhibitor also inhibits the serine / threonine protein kinase (AKT) pathway, such as IPI-549 or a nucleic acid sequence that binds to PI3K^ mRNA (PI3KCG).

[0070] Methods of treating minimal residual disease (MRD) are disclosed herein, comprising administering a PI3K^ inhibitor to a patient or subject with MRD, wherein the inhibitor is a biologic or a small molecule. In embodiments, the methods of treating MRD comprise administering a PI3K^ ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^inhibitor, wherein the inhibitor is a biologic or a small molecule. In embodiments, the methods of treating minimal residual disease (MRD) comprise administering a pharmaceutical composition comprising a PI3K^ inhibitor, wherein the inhibitor is a biologic or a small molecule. A PI3K^ inhibitor can inhibit PI3K^ activity by direct interaction with the PI3K^ or by inhibiting expression of PI3K^. In embodiments, the PI3K^ inhibitor is a small molecule that inhibits PI3K^ kinase activity or signaling activity. In embodiments, the PI3K^ inhibitor is a small molecule selected from the list consisting of: apitolisib, buparlisib, dactolisib, duvelisib (Copiktra), eganelisib (also known as IPI-549), gedatolisib, GSK1059615, omipalisib, paxalisib, samotolisib, tenalisib, taselisib, voxtalisib, wortmannin, AS252424, AS605240, AZD3458, ZX-101a, and ZX-4081. In particular embodiments, the PI3K^ inhibitor is eganelisib (also known as IPI-549). In embodiments, the PI3K^ inhibitor is a biologic comprising an antibody that binds PI3K^. In embodiments, the PI3K^ inhibitor inhibits expression of PI3K^, such as using nucleic acids. In embodiments, the PI3K^ inhibitor is a small molecule or biologic that inhibits PI3K^ expression. In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising a nucleic acid sequence antisense to PI3K^ mRNA (also known as PI3KCG). In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising a nucleic acid sequence that binds to SEQ ID NO: 5.. In particular embodiments, the PI3K^ inhibitor is a short hairpin (shRNA). In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising SEQ ID NO: 3 or SEQ ID NO: 4. In particular embodiments, the PI3K^ inhibitor also inhibits the serine / threonine protein kinase (AKT) pathway, such as IPI-549 or a nucleic acid sequence that binds to PI3K^ mRNA (PI3KCG).

[0071] Methods of treating medium-risk (or intermediate-risk) acute myeloid leukemia (AML) are disclosed herein, comprising administering a PI3K^ inhibitor to a patient or subject with medium- risk (or intermediate-risk) AML, wherein the inhibitor is a biologic or a small molecule. In embodiments, the methods of treating medium-risk (or intermediate-risk) AML comprise administering a PI3K^ inhibitor, wherein the inhibitor is a biologic or a small molecule. In embodiments, the methods of treating medium-risk (or intermediate-risk) AML comprise administering a pharmaceutical composition comprising a PI3K^ inhibitor, wherein the inhibitor is a biologic or a small molecule. A PI3K^ inhibitor can inhibit PI3K^ activity by direct interaction with the PI3K^ or by inhibiting expression of PI3K^. In embodiments, the PI3K^ inhibitor is a small molecule that inhibits PI3K^ kinase activity or signaling activity. In embodiments, the PI3K^ inhibitor is a small molecule selected from the list consisting of: apitolisib, buparlisib, dactolisib, duvelisib (Copiktra), eganelisib (also known as IPI-549), gedatolisib, GSK1059615, omipalisib, ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^paxalisib, samotolisib, tenalisib, taselisib, voxtalisib, wortmannin, AS252424, AS605240, AZD3458, ZX-101a, and ZX-4081. In particular embodiments, the PI3K^ inhibitor is eganelisib (also known as IPI-549). In embodiments, the PI3K^ inhibitor is a biologic comprising an antibody that binds PI3K^. In embodiments, the PI3K^ inhibitor inhibits expression of PI3K^, such as using nucleic acids. In embodiments, the PI3K^ inhibitor is a small molecule or biologic that inhibits PI3K^ expression. In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising a nucleic acid sequence antisense to PI3K^ mRNA (also known as PI3KCG). In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising a nucleic acid sequence that binds to SEQ ID NO: 5.. In particular embodiments, the PI3K^ inhibitor is a short hairpin (shRNA). In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising SEQ ID NO: 3 or SEQ ID NO: 4. In particular embodiments, the PI3K^ inhibitor also inhibits the serine / threonine protein kinase (AKT) pathway, such as IPI-549 or a nucleic acid sequence that binds to PI3K^ mRNA (PI3KCG).

[0072] Methods of treating high-risk acute myeloid leukemia (AML) are disclosed herein, comprising administering a PI3K^ inhibitor to a patient or subject with high-risk AML, wherein the inhibitor is a biologic or a small molecule. In embodiments, the methods of treating high-risk AML comprise administering a PI3K^ inhibitor, wherein the inhibitor is a biologic or a small molecule. In embodiments, the methods of treating high-risk AML comprise administering a pharmaceutical composition comprising a PI3K^ inhibitor, wherein the inhibitor is a biologic or a small molecule. A PI3K^ inhibitor can inhibit PI3K^ activity by direct interaction with the PI3K^ or by inhibiting expression of PI3K^. In embodiments, the PI3K^ inhibitor is a small molecule that inhibits PI3K^ kinase activity or signaling activity. In embodiments, the PI3K^ inhibitor is a small molecule selected from the list consisting of: apitolisib, buparlisib, dactolisib, duvelisib (Copiktra), eganelisib (also known as IPI-549), gedatolisib, GSK1059615, omipalisib, paxalisib, samotolisib, tenalisib, taselisib, voxtalisib, wortmannin, AS252424, AS605240, AZD3458, ZX-101a, and ZX-4081. In particular embodiments, the PI3K^ inhibitor is eganelisib (also known as IPI-549). In embodiments, the PI3K^ inhibitor is a biologic comprising an antibody that binds PI3K^. In embodiments, the PI3K^ inhibitor inhibits expression of PI3K^, such as using nucleic acids. In embodiments, the PI3K^ inhibitor is a small molecule or biologic that inhibits PI3K^ expression. In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising a nucleic acid sequence antisense to PI3K^ mRNA (also known as PI3KCG). In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising a nucleic acid sequence that binds to SEQ ID NO: 5.. In particular embodiments, the ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^PI3K^ inhibitor is a short hairpin (shRNA). In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising SEQ ID NO: 3 or SEQ ID NO: 4. In particular embodiments, the PI3K^ inhibitor also inhibits the serine / threonine protein kinase (AKT) pathway, such as IPI-549 or a nucleic acid sequence that binds to PI3K^ mRNA (PI3KCG).

[0073] Methods of increasing ROS (reactive oxygen species) in acute myeloid leukemia (AML), such as medium-risk (or intermediate-risk) AML, high-risk of AML, AML relapse, recurrent AML, or refractory AML, are disclosed herein, comprising administering a PI3K^ inhibitor to a patient or subject with medium-risk (or intermediate-risk) AML, high-risk of AML, AML relapse, recurrent AML, or refractory AML, wherein the inhibitor is a biologic or a small molecule. In embodiments, the methods of increasing ROS in AML comprise administering a PI3K^ inhibitor, wherein the inhibitor is a biologic or a small molecule. In embodiments, the methods of increasing ROS (reactive oxygen species) in acute myeloid leukemia (AML) comprise administering a pharmaceutical composition comprising a PI3K^ inhibitor, wherein the inhibitor is a biologic or a small molecule. A PI3K^ inhibitor can inhibit PI3K^ activity by direct interaction with the PI3K^ or by inhibiting expression of PI3K^. In embodiments, the PI3K^ inhibitor is a small molecule that inhibits PI3K^ kinase activity or signaling activity. In embodiments, the PI3K^ inhibitor is a small molecule selected from the list consisting of: apitolisib, buparlisib, dactolisib, duvelisib (Copiktra), eganelisib (also known as IPI-549), gedatolisib, GSK1059615, omipalisib, paxalisib, samotolisib, tenalisib, taselisib, voxtalisib, wortmannin, AS252424, AS605240, AZD3458, ZX-101a, and ZX-4081. In particular embodiments, the PI3K^ inhibitor is eganelisib (also known as IPI-549). In embodiments, the PI3K^ inhibitor is a biologic comprising an antibody that binds PI3K^. In embodiments, the PI3K^ inhibitor inhibits expression of PI3K^, such as using nucleic acids. In embodiments, the PI3K^ inhibitor is a small molecule or biologic that inhibits PI3K^ expression. In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising a nucleic acid sequence antisense to PI3K^ mRNA (also known as PI3KCG). In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising a nucleic acid sequence that binds to SEQ ID NO: 5.. In particular embodiments, the PI3K^ inhibitor is a short hairpin (shRNA). In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising SEQ ID NO: 3 or SEQ ID NO: 4. In particular embodiments, the PI3K^ inhibitor also inhibits the serine / threonine protein kinase (AKT) pathway, such as IPI-549 or a nucleic acid sequence that binds to PI3K^ mRNA (PI3KCG).

[0074] Methods of delaying acute myeloid leukemia (AML) development are disclosed herein, comprising administering a PI3K^ inhibitor to a patient or subject with AML, wherein the inhibitor ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^is a biologic or a small molecule. In embodiments, the methods of delaying AML development comprise administering a PI3K^ inhibitor, wherein the inhibitor is a biologic or a small molecule. In embodiments, the methods of delaying acute myeloid leukemia (AML) development comprise administering a pharmaceutical composition comprising a PI3K^ inhibitor, wherein the inhibitor is a biologic or a small molecule. A PI3K^ inhibitor can inhibit PI3K^ activity by direct interaction with the PI3K^ or by inhibiting expression of PI3K^. In embodiments, the PI3K^ inhibitor is a small molecule that inhibits PI3K^ kinase activity or signaling activity. In embodiments, the PI3K^ inhibitor is a small molecule selected from the list consisting of: apitolisib, buparlisib, dactolisib, duvelisib (Copiktra), eganelisib (also known as IPI-549), gedatolisib, GSK1059615, omipalisib, paxalisib, samotolisib, tenalisib, taselisib, voxtalisib, wortmannin, AS252424, AS605240, AZD3458, ZX-101a, and ZX-4081. In particular embodiments, the PI3K^ inhibitor is eganelisib (also known as IPI-549). In embodiments, the PI3K^ inhibitor is a biologic comprising an antibody that binds PI3K^. In embodiments, the PI3K^ inhibitor inhibits expression of PI3K^, such as using nucleic acids. In embodiments, the PI3K^ inhibitor is a small molecule or biologic that inhibits PI3K^ expression. In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising a nucleic acid sequence antisense to PI3K^ mRNA (also known as PI3KCG). In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising a nucleic acid sequence that binds to SEQ ID NO: 5.. In particular embodiments, the PI3K^ inhibitor is a short hairpin (shRNA). In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising SEQ ID NO: 3 or SEQ ID NO: 4. In particular embodiments, the PI3K^ inhibitor also inhibits the serine / threonine protein kinase (AKT) pathway, such as IPI-549 or a nucleic acid sequence that binds to PI3K^ mRNA (PI3KCG).

[0075] Methods of treating recurrent AML are disclosed herein, comprising administering a PI3K^ inhibitor to a patient or subject with recurrent AML, wherein the inhibitor is a biologic or a small molecule. In embodiments, the methods of treating recurrent AML comprise administering a PI3K^ inhibitor, wherein the inhibitor is a biologic or a small molecule. In embodiments, the methods of treating recurrent AML comprise administering a pharmaceutical composition comprising a PI3K^ inhibitor, wherein the inhibitor is a biologic or a small molecule. A PI3K^ inhibitor can inhibit PI3K^ activity by direct interaction with the PI3K^ or by inhibiting expression of PI3K^. In embodiments, the PI3K^ inhibitor is a small molecule that inhibits PI3K^ kinase activity or signaling activity. In embodiments, the PI3K^ inhibitor is a small molecule selected from the list consisting of: apitolisib, buparlisib, dactolisib, duvelisib (Copiktra), eganelisib (also known as IPI-549), ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^gedatolisib, GSK1059615, omipalisib, paxalisib, samotolisib, tenalisib, taselisib, voxtalisib, wortmannin, AS252424, AS605240, AZD3458, ZX-101a, and ZX-4081. In particular embodiments, the PI3K^ inhibitor is eganelisib (also known as IPI-549). In embodiments, the PI3K^ inhibitor is a biologic comprising an antibody that binds PI3K^. In embodiments, the PI3K^ inhibitor inhibits expression of PI3K^, such as using nucleic acids. In embodiments, the PI3K^ inhibitor is a small molecule or biologic that inhibits PI3K^ expression. In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising a nucleic acid sequence antisense to PI3K^ mRNA (also known as PI3KCG). In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising a nucleic acid sequence that binds to SEQ ID NO: 5.. In particular embodiments, the PI3K^ inhibitor is a short hairpin (shRNA). In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising SEQ ID NO: 3 or SEQ ID NO: 4. In particular embodiments, the PI3K^ inhibitor also inhibits the serine / threonine protein kinase (AKT) pathway, such as IPI-549 or a nucleic acid sequence that binds to PI3K^ mRNA (PI3KCG).

[0076] Methods of treating refractory AML are disclosed herein, comprising administering a PI3K^ inhibitor to a patient or subject with refractory AML, wherein the inhibitor is a biologic or a small molecule. In embodiments, the methods of treating refractory AML comprise administering a PI3K^ inhibitor, wherein the inhibitor is a biologic or a small molecule. In embodiments, the methods of treating refractory AML comprise administering a pharmaceutical composition comprising a PI3K^ inhibitor, wherein the inhibitor is a biologic or a small molecule. A PI3K^ inhibitor can inhibit PI3K^ activity by direct interaction with the PI3K^ or by inhibiting expression of PI3K^. In embodiments, the PI3K^ inhibitor is a small molecule that inhibits PI3K^ kinase activity or signaling activity. In embodiments, the PI3K^ inhibitor is a small molecule selected from the list consisting of: apitolisib, buparlisib, dactolisib, duvelisib (Copiktra), eganelisib (also known as IPI-549), gedatolisib, GSK1059615, omipalisib, paxalisib, samotolisib, tenalisib, taselisib, voxtalisib, wortmannin, AS252424, AS605240, AZD3458, ZX-101a, and ZX-4081. In particular embodiments, the PI3K^ inhibitor is eganelisib (also known as IPI-549). In embodiments, the PI3K^ inhibitor is a biologic comprising an antibody that binds PI3K^. In embodiments, the PI3K^ inhibitor inhibits expression of PI3K^, such as using nucleic acids. In embodiments, the PI3K^ inhibitor is a small molecule or biologic that inhibits PI3K^ expression. In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising a nucleic acid sequence antisense to PI3K^ mRNA (also known as PI3KCG). In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising a nucleic acid sequence that binds to SEQ ID NO: 5. In particular embodiments, the PI3K^ inhibitor is a short ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^hairpin (shRNA). In particular embodiments, the PI3K^ inhibitor is a nucleic acid comprising SEQ ID NO: 3 or SEQ ID NO: 4. In particular embodiments, the PI3K^ inhibitor also inhibits the serine / threonine protein kinase (AKT) pathway, such as IPI-549 or a nucleic acid sequence that binds to PI3K^ mRNA (PI3KCG).

[0077] The present disclosure also provides PI3K^ inhibitors for use in therapy. In an embodiment, the present disclosure provides PI3K^ inhibitors for use in the treatment of acute myeloid leukemia (AML). In an embodiment, the present disclosure provides PI3K^ inhibitors for use in the treatment of minimal residual disease (MRD). In an embodiment, the present disclosure provides PI3K^ inhibitors for use in the treatment of medium-risk (or intermediate-risk) acute myeloid leukemia (AML). In an embodiment, the present disclosure provides PI3K^ inhibitors for use in the treatment of high-risk acute myeloid leukemia (AML). In an embodiment, the present disclosure provides PI3K^ inhibitors for use in the treatment of refractory acute myeloid leukemia (AML). In an embodiment, the present disclosure provides PI3K^ inhibitors for use in the treatment of recurrent acute myeloid leukemia (AML).

[0078] In an embodiment, the present disclosure provides a pharmaceutical composition comprising PI3K^ inhibitors for use in the treatment of cancer. The present disclosure also provides a pharmaceutical composition comprising a PI3K^ inhibitor for use in therapy. In an embodiment, the present disclosure provides a pharmaceutical composition comprising a PI3K^ inhibitor for use in the treatment of acute myeloid leukemia (AML). In an embodiment, the present disclosure provides a pharmaceutical composition comprising a PI3K^ inhibitor for use in the treatment of minimal residual disease (MRD). In an embodiment, the present disclosure provides a pharmaceutical composition comprising a PI3K^ inhibitor for use in the treatment of medium-risk (or intermediate- risk) acute myeloid leukemia (AML). In an embodiment, the present disclosure provides a pharmaceutical composition comprising a PI3K^ inhibitor for use in the treatment of high-risk acute myeloid leukemia (AML). In an embodiment, the present disclosure provides a pharmaceutical composition comprising a PI3K^ inhibitor for use in the treatment of refractory acute myeloid leukemia (AML). In an embodiment, the present disclosure provides a pharmaceutical composition comprising a PI3K^ inhibitor for use in the treatment of recurrent acute myeloid leukemia (AML).

[0079] Provided herein are uses of a PI3K^ inhibitor or pharmaceutical composition thereof in treating acute myeloid leukemia (AML), wherein the pharmaceutical composition comprises PI3K^ inhibitor and a pharmaceutically acceptable carrier. Provided herein are uses of a PI3K^ inhibitor or pharmaceutical composition thereof in treating minimal residual disease (MRD), wherein the ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^pharmaceutical composition comprises PI3K^ inhibitor and a pharmaceutically acceptable carrier. Provided herein are uses of a PI3K^ inhibitor or pharmaceutical composition thereof in treating high- risk acute myeloid leukemia (AML), wherein the pharmaceutical composition comprises PI3K^ inhibitor and a pharmaceutically acceptable carrier. Provided herein are uses of a PI3K^ inhibitor or pharmaceutical composition thereof in treating medium-risk (or intermediate-risk) acute myeloid leukemia (AML), wherein the pharmaceutical composition comprises PI3K^ inhibitor and a pharmaceutically acceptable carrier. Provided herein are uses of a PI3K^ inhibitor or pharmaceutical composition thereof in treating refractory acute myeloid leukemia (AML), wherein the pharmaceutical composition comprises PI3K^ inhibitor and a pharmaceutically acceptable carrier. Provided herein are uses of a PI3K^ inhibitor or pharmaceutical composition thereof in treating recurrent acute myeloid leukemia (AML), wherein the pharmaceutical composition comprises PI3K^ inhibitor and a pharmaceutically acceptable carrier. Terms

[0080] Acute myeloid leukemia (AML) refers to a class of leukemias characterized by bone marrow that produces abnormal myeloblasts. AML patients can experience relapse (AML after an interval of remission, also known as recurrent AML) or refractory AML (nonresponsive to one or more cycles of standard therapy). Standard therapies can vary depending on patient age as well as overall health and include chemotherapy, chemotherapy with or followed by stem cell therapy, radiation therapy, and targeted therapy, either alone or as a combination of two or more therapies. A patient or subject is at risk of AML where the patient or subject is older than 65; has a history of smoking or exposure to benzene; has certain genetic conditions or abnormalities, such as down syndrome, ataxia telangiectasia, Li-Fraumeni syndrome, Klinefelter syndrome, Fanconi anemia, Wiskott-Aldrich syndrome, Bloom syndrome, familial platelet disorder syndrome, or changes to GATA2, ETV6, CEBPA, and RUNX1 genes; has been exposed to chemotherapy or high doses of radiation; or certain bone disorders, such as polycythemia vera, myelofibrosis, essential thrombocytosis, myelodysplastic syndromes, or aplastic anemia. The presence of LSCs are known to raise the risk of AML of a patient or subject. Thus, the methods of detecting LSCs as disclosed herein can be used to diagnose patients or subjects.

[0081] Risk of AML can be stratified as low-risk, medium-risk (or intermediate-risk), or high-risk. The presence of LSCs are known to raise the risk of AML of a patient or subject. Thus, the methods of detecting LSCs as disclosed herein can be used to stratify patients or subjects as medium-risk (or intermediate-risk) or high-risk of AML, such as relapse (AML after an interval of remission, also ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^known as recurrent AML) or refractory AML (nonresponsive to one or more cycles of standard therapy). A patient or subject has a medium-risk (or intermediate-risk) or high-risk of AML where LSCs are detected using the methods disclosed herein. Risk categories for AML are known by persons of ordinary skill in the art (see, e.g., Ofir Wolach, Richard M. Stone; How I treat mixed- phenotype acute leukemia. Blood 2015; 125 (16): 2477–2485), such as low risk (a patient has low risk of relapse, is likely cured, and is typically treated with chemotherapy), medium-risk and intermediate risk are used interchangeably herein (a patient has a risk of relapse between high and low risk and is typically treated chemotherapy as well as possibly a stem cell transplant), and high risk (a patient has a high risk of relapse and is typically treated with chemotherapy followed by a stem cell transplant early into treatment).

[0082] The small molecules and biologics disclosed herein can be administered to subjects or patients. Herein, “administration” refers to the act of the attending physician or caregiver, prescribing the agent for administration and thereby causing the application of an agent to a subject, through ingestion, infusion, injection, or any other means, whether self-administered or administered by a clinician or other qualified care giver. Herein, a “subject” includes both human patient and veterinary subjects, including human and non-human mammals. In embodiments, the subject or patient has or has a risk of AML.

[0083] Herein, contacting refers to placement in direct physical association, including both solid and liquid forms. Contacting can occur in vitro by adding an agent or at least one agent to a sample, such as a blood sample (for example, a peripheral blood sample), a bone marrow sample (for example, a whole blood biopsy sample or bone marrow aspirate), cells, proteins, nucleic acids (such as DNA, cDNA, or mRNA).

[0084] Herein, an “effective amount” is a quantity sufficient to achieve a desired effect in a subject. For instance, this can be the amount necessary to prevent, treat, or ameliorate a disease, for example, inhibiting or suppressing AML. In embodiments, an effective amount is the amount necessary to eliminate, reduce the size, or prevent metastasis of AML. Efficacy is first evident in the cellular response, for which a variety of in vitro and cell assays are well-known to measure. Kristina V. Kitaeva et al., Cell Culture Based In vitro Test Systems for Anticancer Drug Screening, 8 Front. Bioeng. Biotechnol. 322(2020)). In embodiments, an effective amount is the amount necessary to significantly inhibit or reduce AML or LSC proliferation or migration, invasion, or adhesion. A cellular response manifests as significantly reduced LSCs detected; reduced or inhibited disease progression; and improvement in survival in a subject. More particularly, an effective amount ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^provides improvement in important cancer endpoints, Overall Survival (OS), Disease-Free Survival (DFS), Objective Response Rate, Complete Response Rate or Progression Free Survival (PFS). See Dept. of Health and Human Services, Food and Drug Admin, Clinical Trial Endpoints for the Approval of Cancer Drugs and Biologics: Guidance for Industry (2018); E.A. Eisenhauer et al., New Response Evaluation Criteria in Solid Tumours: Revised RECIST Guideline (Version 1.1), 45 Eur. J. Cancer 228 (2009).

[0085] Leukemia stem cells (LSCs) refer to clonogenic cells with long-term self renewal capacity. LSCs reside in the bone marrow and drive initiation as well as progression of acute myeloid leukemia (AML). Further, LSCs can remain quiescent in bone marrow for years after an AML patient has completed treatment for AML to apparent remission and are responsible for minimal residual disease (MRD). Certain cell surface markers can be used to identify LSCs from bone marrow samples, but the combinations of markers are not fully determinative due to the heterogeneity of LSCs and the bone marrow microenvironment. Examples of surface markers include CD123, CCL1, CD25, CD32, CD44, GPR56, IL1RAP, CD47, CD33, TIM3, and CD56. Further, examples of surface marker combinations include CD34+CD38^^^^^^^^^^^^^^^^^^^^^^^ CD34+ / CD38^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ CD33 / TIM3; CLL1 / TIM3; CCL1 / CD56; and CD33 / CD123.

[0086] Minimal residual disease (MRD, also known as molecular residual disease or measurable residual disease) refers to treatment resistance in AML patients, which can take the form of AML relapse or recurrence or refractory AML. MRD results from the continued presence of LSCs in bone marrow even after an AML patient has completed treatment for AML, which can re-initiate AML even years after apparent remission. MRD is clinically assessed by targeted sequence or flow cytometry. A patient or subject is at risk of MRD after achieving remission during or after treatment for cancer, such as AML.

[0087] The pharmaceutically acceptable carriers of use are conventional (e.g., as described in Remington, The Science and Practice of Pharmacy, 22nd Edition, Loyd V., ed., Pharmaceutical Press, 2012). In general, the nature of the carrier will depend on the mode of administration. For instance, parenteral formulations typically comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids, such as water, physiological saline, balanced salt solutions or the like as a vehicle. Pharmaceutical compositions can additionally include minor amounts of non- toxic auxiliary substances for stability.

[0088] In embodiments, the carrier may be sterile and / or suspended or otherwise contained in a unit ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^dosage form including one or more measured doses of the composition suitable for administration to a subject of an effective amount of the antibodies and fragments thereof disclosed herein. Medications for use in treatment may also be included in embodiments. In embodiments, the unit dosage form may be in a sealed vial that contains sterile contents or a syringe for injection into a subject, lyophilized for subsequent solubilization and administration, or in a solid or controlled release dosage.

[0089] Phosphatidylinositol-4,5-bisphosphate 3-kinase gamma (PI3K^; also known as phosphatidylinositol 3-kinase, catalytic, 110-KD, gamma; PIK3CG; p110-gamma; PI3K-gamma; PIK3-gamma; and p120-PI3K; e.g., OMIM 601232) has both a regulatory subunit and a catalytic subunit, and the PIK3CG gene encodes the catalytic subunit. Herein, PI3K^ refers to the catalytic subunit, unless indicated otherwise. PI3K^ phosphorylates phosphoinositide lipids on the 3- hydroxyl group of the inositol and is found in various human tissues and organs, including bone marrow. Further, PI3K^ plays a role in pathophysiological conditions, ranging from cancers to inflammatory and autoimmune diseases.

[0090] PI3K^ nucleic acid molecules and proteins are included. PI3K^ sequences are publicly available. For example, GenBank® Accession No. BC035683.1 discloses an exemplary human PI3K^ nucleotide sequence, and GenBank® Accession No. AAH35683.1 discloses an exemplary human protein sequence. One of ordinary skill in the art can identify additional PI3K^ nucleic acid and protein sequences, including PI3K^ variants that retain PI3K^ biological activity (such as having increased levels in a bone marrow sample, such as whole bone marrow or bone marrow aspirate, from a subject with AML, such as relapsed, recurrent, or refractory AML; medium- or high-risk AML; or MRD).

[0091] Herein, reactive oxygen species (ROS) refer to highly reactive chemicals formed from diatomic oxygen (O2), water, and hydrogen peroxide. In particular embodiments, ROS refers to hydrogen peroxide (H2O2). A person of ordinary skill in the art understands that methods and kits are readily available for measuring a variety of ROS in various types of samples, such as biological samples (including blood or bone marrow samples).

[0092] A sample refers to a specimen containing DNA, RNA (including mRNA), proteins, or combinations thereof. In embodiments, the sample is obtained from a subject. In embodiments, the sample was previously obtained from a subject. In embodiments, the sample is subjected to pre- processing steps. In embodiments, the sample comprises blood, tissue biopsy, or aspirate, for example, a peripheral blood sample or a bone marrow biopsy sample, such as a whole bone marrow ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^biopsy sample or a bone marrow aspirate sample. Samples can be obtained from human subjects or veterinary subjects (for example, dog, cat, horse, pig, sheep, goat, cow, rabbit, llama, deer, elk, or poultry).

[0093] A blood sample can include a sample obtained from a fingerstick or venipuncture or an arterial blood sample and comprise peripheral blood (such as a peripheral blood smear), whole blood, plasma, or serum. A control, such as a control sample, refers to a sample or standard used for comparison with an experimental or test sample, such as a blood or bone marrow sample obtained from a subject with or at risk of acute myeloid leukemia (AML). In embodiments, a control is a sample obtained from a healthy patient or a non-tumor tissue sample. In embodiments, the control is a historical control or standard reference value or range of values, for example, a previously tested control sample, such as a healthy group of subjects. A bone marrow sample refers to either a whole bone marrow sample or bone marrow aspirate. Various means for collecting bone marrow samples are well-known in the art. Examples of procedures for bone marrow collection include manual or powered needles and trocar (e.g., US Patent Pub. No. 2022 / 0409321, incorporated by reference herein in its entirety on January 19, 2024).

[0094] Short hairpin RNA or small hairpin RNA (shRNA) is RNA that includes a tight hairpin turn, and is often used to silence target gene expression through RNA interference (RNAi). shRNA can be expressed using a plasmid or other vector, such as a viral or bacterial vector. Advantages of shRNA include low rates of degradation and turnover. Herein, short hairpin RNA (shRNA) can include shRNA that binds and silences PIK3CG mRNA, thus decreasing or reducing PI3K^ protein expression. A person of ordinary skill in the art would understand that shRNA can be derived from a known sequence, such as using computer technology (e.g., as described in US Patent No. 9212363 and US Patent Pub. No. 2017 / 0283802, both of which are incorporated by reference in their entireties on January 19, 2024).

[0095] The term “therapeutic” in conjunction with antibody disclosed herein refers to an antibody suitable for use in human treatment of AML, including medium- or high-risk AML or MRD. Such an antibody has a KDof less than 10-6molar, such as less than 10-7molar, less than 10-8molar, less than 10-9molar, or less than 10-10molar and any toxic or detrimental effects of the antibody are outweighed by the therapeutic beneficial effects.

[0096] The small molecules and biologics disclosed herein can be used in therapy. In embodiments, the small molecules and biologics disclosed herein can be used to treat, prevent (such as through prophylactic treatment), or ameliorate AML, including medium- or high-risk AML or MRD. Herein, ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^"preventing" a disease refers to inhibiting the full development of a disease, such as AML, including medium- or high-risk AML or MRD. "Treating" refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition after it has begun to develop, such as a decrease in the number of AML cells or LSCs. "Ameliorating" refers to the reduction in the number or severity of signs or symptoms of a disease, such as AML, including medium- or high- risk AML or MRD. A "prophylactic" treatment is a treatment administered to a subject who does not exhibit signs of a disease or exhibits only early signs for the purpose of decreasing the risk of developing a pathology, such as AML, including medium- or high-risk AML or MRD.

[0097] As used herein, "increased expression" refers to a 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200% or higher increase in detectable levels of a protein or nucleic acid, such as PI3K^ or PI3KCG mRNA (for example, using PI3KCG cDNA reverse transcribed from mRNA in a test sample compared with a control sample. "Decreased expression" refers to a 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200% or higher decrease in detectable levels of a protein or nucleic acid, such as PI3K^ or PI3KCG mRNA (for example, using PI3KCG cDNA reverse transcribed from mRNA), in a test sample compared with a control sample.

[0098] As used herein, “primers” refer to short nucleic acid molecules, such as DNA that is 10 to 100 nucleotides in length, such as about 15, 20, 25, 30, or 50 nucleotides or more in length. Primers can be annealed to a complementary target DNA strand by hybridization. Pairs of primers can be used to amplify a nucleic acid, such as using rt-qPCR. A person of ordinary skill in the art would understand that PCR primer pairs can be derived from a known sequence, such as using computer technology (e.g., Primer, Version 0.5, © 1991, Whitehead Institute for Biomedical Research, Cambridge, MA). EXAMPLES Example 1

[0099] This embodiment shows an example in which PI3K^ is highly expressed in LSCs and promotes AML development. The mRNA levels of PIK3CG in the bone marrow (BM) were compared between MLL-AF9-induced-AML mice and healthy wild-type (WT) mice using quantitative reverse transcriptase PCR (qRT-PCR). PIK3CG expression is ~2-fold higher in AML- BM and is significantly elevated in the Lin-CD127-Sca-1-c-Kit+CD34+CD16 / 32+ leukemic granulocyte macrophage progenitors (L-GMPs, enriched in LSCs) compared to normal-BM and normal-hematopoietic stem cells (HSCs) (FIG. 1A). To explore a potential function of PI3K^ in ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^leukemogenesis, we established an MLL-AF9-induced AML model with WT and PIK3CG-knockout (KO) mice (supplemental Figure 1A). Flow cytometry analysis in PIK3CG-KO AML mice showed fewer leukemia cells, increased Mac-1+Gr-1+ cells, and decreased Mac-1+Gr-1- cells in peripheral blood (PB) and BM compared to PIK3CG-WT counterparts (FIGS. 1B-1E and 7B-7D), showing PI3K^ loss promoted LSC differentiation. The delayed leukemia development led to reduced spleen and liver infiltration (FIGS. 1F-1G and 7E), along with extended survival in PIK3CG-null AML mice compared to controls (71 vs. 59 days; FIG. 1H), indicating that PI3K^ is involved in promoting leukemogenesis. In the secondary transplantation, PIK3CG-null cell recipients displayed further decreased leukemia cell frequencies, undifferentiated Mac-1+Gr-1- cells in the PB and BM, and much reduced spleen and liver infiltration (FIGS. 1I-1L and 7F-7I). The overall survival of recipients transplanted with PIK3CG-KO cells was dramatically extended compared to WT cell recipients (111 vs. 35 days; FIG. 1M). PIK3CG was silenced using shRNAs in established MLL- AF9+ leukemia cells, and subsequently transplantation was performed. The results showed similar effects, showing that PI3K^ contributes to both the initiation and maintenance of AML (FIGS. 7J- 7L). A rescue assay was conducted by ectopic expression of PIK3CG in the WT and PIK3CG-null AML cells, followed by transplantation into recipients. The results showed that recovery of PIK3CG expression in PIK3CG-null AML cells could completely reverse the phenotypes caused by the PIK3CG ablation, while PIK3CG overexpression in WT AML cells accelerated leukemia development (FIGS. 1N-1O and 7M), underscoring the role of PIK3CG in AML development.

[0100] Simultaneously, other class I PI3K isoforms were assessed for leukemia development. To examine the function of PI3K^, shRNAs were used agaainst Pik3ca in MLL-AF9+ murine AML cells (FIG. 8A) for serial transplantation. PIK3CA knockdown did not significantly alter leukemic cell frequencies in PB and BM cells or host survival across initial and secondary transplantations (FIGS. 8B-8G). To evaluate the role of PI3K^ or PI3K^ in leukemia development, an MLL-AF9- induced AML model was established either with WT; Mx-1-Cre+ and Pik3cbfl / fl; Mx-1-Cre+ mice (referred to as PIK3CB+ / + and PIK3CB- / - mice, respectively) or with WT and PIK3CD-knockout mice (referred to as PIK3CD+ / + and PIK3CD- / - mice, respectively). Loss of PIK3CB or PIK3CD did not affect MLL-AF9-induced leukemia development (FIGS. 8H-8U).

[0101] To further examine the role of PI3K^ in AML, another myeloid leukemia model was used, the AML1-ETO9a-induced AML model. Mice receiving PIK3CG-null AML1-ETO9a+ AML cells had a markedly decreased frequencies of leukemia cells in PB and BM and extended survival during serial transplantation (FIGS. 9A-9H). Together, the results show that, among the class I PI3Ks, ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^PI3K^ is required for AML development. Example 2

[0102] This embodiment shows an example in which genetic ablation of PIK3CG in AML depletes LSCs. L-GMP frequencies in recipient BM cells were measured after serial transplantation. PIK3CG-KO MLL-AF9+ BM showed L-GMP frequencies reduced to 9.66% or 8.64% of PIK3CG- WT MLL-AF9+ BM upon primary or secondary transplantation (FIGS. 2A-2C). In concordance, mice receiving PIK3CG-KO AML1-ETO9a donor cells had much less immunophenotypic EGFP+Lin-Sca-1-c-Kit+ LSCs than control mice upon 1st and 2nd transplantation in AML1- ETO9a-induced AML model (FIGS. 10A-10D). An in vitro colony-forming assay showed that the clonogenic potential of PIK3CG-null L-GMPs was largely abolished, as exhibited by the markedly decreased colony size and number as well as the derived cell number during primary and secondary plating (FIGS. 2D-2F). Importantly, the survival of mice transplanted with PIK3CG-null L-GMPs was dramatically extended compared with that of their counterparts (128 vs. 44 days; FIG. 2G). The LSC frequencies were further assayed by a limiting dilution assay, which showed that loss of PIK3CG led to a 96.92% decrease in the functional LSCs compared to PIK3CG-WT counterparts (1 in 2924 vs. 1 in 90; FIGS. 2H-2I). Transcriptomics revealed reduced leukemia stemness gene expression and heightened myeloid-differentiation gene expression in PIK3CG-null L-GMPs (FIGS. 2J-2K). PI3K^ was assayed for other aspects of LSC function, including homing ability, quiescence, and apoptosis. To assay PI3K^ deletion in LSC migration impairment, a total of two million 5(6)- carboxyfluorescein succinimidyl ester (CFSE)-labeled WT and PIK3CG-null Mac-1+c-Kit+ LSCs were injected into lethally irradiated mice. Subsequent analyses of homed cells in the bone marrow, spleen, and liver at 16 hours after transplantation revealed no significant differences in homing abilities between WT and PIK3CG-null LSCs (FIG. 10E). To assess loss of PI3K^ on the quiescence of LSCs, the G0 phase in PIK3CG-null LSCs was assessed using Ki-67 / Hoechst 33342 staining. The results show that PIK3CG-null LSCs exhibited similar percentages of the G0 phase compared to control cells (FIGS. 10F-10G). To assess the impact of PI3K^ loss on the apoptosis of LSCs, Annexin V / 7-AAD staining assays revealed that the frequencies of apoptotic L-GMPs were significantly increased in PIK3CG-KO leukemic mice (FIG. 10H). Collectively, these data show that PI3K^ promotes the self-renewal and suppresses the differentiation and apoptosis of LSCs, contributing to leukemogenesis. ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^Example 3

[0103] This embodiment shows an example in which PI3K^ is not required for the maintenance of normal HSCs. To assess the roles of PI3K^ in normal hematopoiesis, the frequencies of differentiated and stem / progenitor cells were assessed in the BM of WT and PIK3CG-KO mice. The frequencies of mature cells, myeloid progenitors, lymphoid progenitors, Lin-Sca-1+c-Kit+ cells, multipotent progenitors, short term-HSCs, and long term-HSCs were not significantly changed upon PIK3CG deletion (FIGS. 11A-11H). To assess the function of PIK3CG-null HSCs, serial whole bone marrow competitive transplantation was performed, and the resulting WT and PIK3CG-null HSCs had similar repopulation abilities at 4, 8, 12, and 16 weeks upon primary and secondary transplantations (FIGS. 11I-11L). Thus, the results show that PI3K^ maintains the self-renewal ability of LSCs, but not normal HSCs. Example 4

[0104] This embodiment shows an example in which PI3K^ regulates the pentose phosphate pathway of LSCs. To assess the mechanism underlying the role of PI3K^ in LSCs, transcriptome analysis of PIK3CG-WT and -KO L-GMPs was performed. KEGG analysis revealed that multiple metabolic pathways were significantly downregulated in PIK3CG-null L-GMPs (FIG. 3A). Further examination with GSEA showed that genes involved in the pentose phosphate pathway (PPP) were dramatically downregulated in PIK3CG-KO L-GMPs (FIG. 3B). The PPP is involved in cellular metabolism, regulating redox balance and nucleotide biosynthesis. Enzymes included are glucose-6- phosphate dehydrogenase (G6PD), 6-phosphogluconate dehydrogenase (PGD), transketolase (TKT), and transaldolase 1 (TALDO1) in PPP. While the expression of G6PD was not altered, PGD, TKT and TALDO1 expression levels were significantly downregulated in PIK3CG-null L-GMPs, as measured using qRT-PCR (FIG. 3C), showing that PI3K^ is involved in the regulation of the PPP of LSCs.

[0105] This embodiment shows an example in which metabolomic analysis of PIK3CG-WT and - KO L-GMPs revealed markedly decreased PPP metabolites, NADPH levels, and NADPH / NADP+ ratios in PIK3CG-KO L-GMPs (FIGS. 3D-3F). Enzyme assays also showed lower NADPH levels in PIK3CG-null L-GMPs and Mac-1+c-Kit- leukemia blasts (FIGS. 6A-6D). NADPH supplies reducing power to counter oxidative stress. As expected, PIK3CG-null L-GMPs and leukemia blasts exhibited significantly higher intracellular ROS levels than their WT counterparts (FIGS. 3G and 12E). Interestingly, loss of PI3K^ did not affect the PPP metabolites, NADPH, and ROS levels in ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^normal GMPs (FIGS. 12F-12G). Further, different types of ROS species were measured in WT and PIK3CG-null L-GMPs, showing that, of common oxidative species, only H2O2 levels were significantly increased upon PI3K^ deletion (FIGS. 12H-12K). Moreover, supplementing cells with N-acetylcysteine (NAC) could largely rescue both H2O2and ROS levels as well as the colony formation abilities of PIK3CG-null L-GMPs (FIGS. 3H-3J and 12L-12R). Phospho-AKT (p-AKT) and PGD levels were also reduced in PIK3CG-null L-GMPs and total AML cells (FIGS. 3K and 13A), showing that PI3K^ contributes to the AKT activation in AML cells. To assess AKT isoforms’ responses to PI3K^, the levels of p-AKT1 Ser473 and p-AKT2 Ser474 (the activated forms of AKT1 and AKT2, respectively) were assessed in WT and PIK3CG-null L-GMPs. p-AKT1 Ser473 levels were decreased, while p-AKT2 Ser474 levels showed a decreased by a relatively lower amount upon PI3K^ deletion (FIG. 13B). A rescue assay revealed that mice injected with PIK3CG-null AML cells overexpressing Akt1 exhibited a notable rise in leukemia cell frequency and a decrease in survival, compared to those injected with PIK3CG-null control cells (FIGS. 13C-13E). In contrast, Akt2 overexpression did not significantly impact outcomes (FIGS. 13F-13H). These data show AKT1 is the AKT isoform that mediates PI3K^ signaling in AML cells. Because it is known in the art that AKT-mediated ^-catenin Ser552 phosphorylation induces the expression of immune- checkpoint genes, disclosed herein are mRNA levels of multiple immune-checkpoint genes measured in L-GMPs under continuous treatment with Wnt3a and the PI3K^ inhibitor IPI-549. Inhibition of the PI3K^-AKT pathway blocked the upregulation of these immune-checkpoint genes in L-GMPs induced by Wnt3a treatment (FIGS. 13I-13J). It is known in the field that, in T cell acute lymphoblastic leukemia, LSCs display distinctive immune resistance properties that can be mitigated by inhibiting AKT-activated ^-catenin. It is known in the field that the PPP produces most cytosolic NADPH, and intracellular NADPH can also be derived from either the cytosolic or mitochondrial malic enzymes (ME1 or ME2), isocitrate dehydrogenases (IDH1 or IDH2), and methylenetetrahydrofolate dehydrogenases (MTHFD1 or MTHDF2). Disclosed herein, significant changes of the levels of any of these proteins were not observed between PIK3CG-WT and PIK3CG-null leukemia cells (FIG. 13A), disclosing herein PI3K^'s contribution to NADPH via PPP in LSCs.

[0106] Downregulation of PGD also led to a decrease of downstream metabolites in PIK3CG-null L-GMPs, including ribulose 5-phosphate, ribose 5-phosphate, xylulose 5-phosphate, sedoheptulose 7-phosphate, and erythrose 4-phosphate (FIG. 3L). Moreover, in vivo13C6 glucose labeling experiments demonstrated that PIK3CG-null L-GMPs displayed a reduction of metabolites ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^downstream from PGD and an accumulation of upstream metabolites; further, PIK3CG-null L- GMPs had a significant increase in glycolysis metabolites and reduction in TCA cycle metabolites (FIG. 13K). Together, the disclosure herein shows that PI3K^ deletion suppressed the PPP flux while simultaneously increased glycolysis in L-GMPs, demonstrating a rewiring of metabolic programming in L-GMPs upon PI3K^ inhibition.

[0107] To further assess Pgd as a target gene of PI3K^, a rescue assay showed that the mice receiving Pgd-overexpressing PIK3CG-null AML cells had significantly increased leukemia cell frequencies and reduced survival compared with recipients injected with PIK3CG-null control cells, which was comparable to the PIK3CG-WT counterparts. Notably, the overexpression of Pgd did not affect PIK3CG-WT AML cells (FIGS. 3M-3N and 13L), showing that PGD is a downstream component of PI3K^ signaling for the maintenance of the self-renewal of LSCs. Moreover, metabolomics analysis revealed that the levels of NADPH, NADP+, and metabolites associated with the PPP in Pgd-overexpressing PIK3CG-null LSCs were fully restored to the levels found in PIK3CG-WT LSCs (FIGS. 3O-3P). Without being bound by theory, these results show that PI3K^ promotes leukemogenesis by regulating the PPP through PGD. Example 5

[0108] This embodiment shows an example in which PI3K^ maintains the nucleotide metabolism of LSCs. A function of the PPP is to generate ribose-5-phosphate, an essential precursor of nucleotide synthesis. Since deletion of Pik3cg downregulated the PPP, nucleotide synthesis was further assayed. GO analysis showed that several important nucleotide metabolic processes were significantly impaired in PIK3CG-null L-GMPs (FIG. 4A). Consistently, PIK3CG-null LSCs had much reduced expression of the genes involved in both purine and pyrimidine metabolism and synthesis than that observed in PIK3CG-WT LSCs (FIGS. 4B-4C). Notably, PI3K^ deletion significantly decreased the abundances of various nucleotide metabolites in L-GMPs but not in normal GMPs (FIGS. 4D and 14A), further demonstrating that PI3K^ regulates the nucleotide anabolism of LSCs. An EdU incorporation assay showed that PIK3CG-null L-GMPs had a significantly extended S phase (FIGS. 14B-14C). Addition of a mixture of all four nucleosides restored the growth of PIK3CG-null cells (FIG. 4E) and the colony forming abilities of PIK3CG- null LSCs (Figure 4F-G), although supplementation with either purines or pyrimidines alone failed to rescue the retarded growth of PIK3CG-null leukemia cells (FIGS. 14D-14E). Overexpressing Pgd in PIK3CG-null LSCs led to complete restoration of nucleotide levels to normal (FIGS. 4H and ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^14F-14U). Without being bound by theory, these data show that PI3K^ is required for the nucleotide synthesis to sustain the growth of AMLs. Example 6

[0109] This embodiment shows an example in which PI3K^ knockdown suppresses the growth of human AML cells. Analysis of the mRNA levels of PIK3CG in human AML cells, using curated databases, revealed that the level of PIK3CG expression was much higher in AML cells than in normal HSCs (FIG. 5A) and was negatively correlated with the overall survival of AML patients (FIG. 5B). Consistently, qRT-PCR results showed that the expression levels of PIK3CG in differentiated human AML cells and Lin-CD34+CD38-CD90-CD45RA+ lymphoid-primed multipotential progenitors (LMPPs, LSCs-enriched cell population) were about 2-, 4-fold higher than those in human cord blood Lin-CD34+CD38-CD90+CD45RA- HSCs (FIG. 5C), showing that PI3K^ is involved in human leukemogenesis.

[0110] To explore PI3K^’s role in human AML, PIK3CG was silenced in THP-1, MV4-11, and U937 cell lines using shRNAs (FIG. 15A). PIK3CG knockdown markedly inhibited the proliferation of the three human AML cell lines in vitro (FIGS. 15B-15D). Transplantation experiments showed that NSG mice bearing PIK3CG-knockdown (KD) THP-1 or MV4-11 cells exhibited delayed leukemia development as evidenced by the significantly reduced disease burden and extended survival (FIGS. 15E-15J). PIK3CG-KD decreased the levels of NADPH, p-AKT, and PGD in all human AML cell lines examined (FIGS. 15K-15N). Further, PIK3CG was knocked down in three PDXs (patient-derived xenografts) (FIG. 5D). Transplantation experiments revealed that mice receiving PIK3CG-KD PDX cells had remarkably reduced engraftment, prolonged survival, and fewer LSCs than their controls (FIGS. 5E-5K). PIK3CG-KD LSCs exhibited higher ROS levels and increased apoptosis; additionally, PIK3CG-KD PDX cells showed elevated CD11B levels compared to the controls (FIGS. 5L-5N). An in vitro colony forming assay further showed that the clonogenic potential of PIK3CG-KD LSCs was significantly diminished (FIGS. 15O-15P). Downregulation of PI3K^ also decreased the levels of NADPH and levels of p-AKT and PGD in the three CD34+ PDX cells (FIGS. 5O-5R). These data show that PI3K^ is required for the self-renewal, differentiation, and survival of human acute myeloid LSCs.

[0111] It is known in the art that PGD can be transcriptionally regulated by nuclear factor erythroid 2-related factor 2 (NRF2) and PI3K-AKT activation enhances the nuclear translocation of NRF2, enabling it to activate metabolic genes. Disclosed herein, nuclear NRF2 was assayed in PIK3CG- ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^knockdown CD34+ PDX cells, which exhibited a decrease in the protein levels of nuclear NRF2 (FIG. 5R). ChIP and luciferase reporter assays showed that NRF2 directly bound to the PGD promoter and effectively transactivated PGD expression (FIGS. 5S-5T). To demonstrate the role of active AKT signaling in NRF2's nuclear accumulation in AML cells, MK-2206, an AKT inhibitor, was administered to CD34+ PDX cells. MK-2206 effectively hindered NRF2's nuclear translocation and decreased PGD protein levels (FIG. 15Q). A rescue assay showed that mice receiving Nrf2- overexpressing PIK3CG-null AML cells exhibited a substantial increase in leukemia cell frequency and decreased survival compared to recipients injected with control cells (FIGS. 5U-5V and 15R). Furthermore, the expression levels of PPP enzymes and nucleotide metabolites in Nrf2- overexpressing Pik3cg-null LSCs were completely restored to the levels observed in PIK3CG-WT LSCs (FIGS. 15S-15T). These data show PI3K^ maintains the leukemogenic capacities of LSCs, and, without being bound by theory, show this occurs through an AKT / NRF2 / PGD axis. Example 7

[0112] This embodiment shows an example in which pharmaceutical inhibition of PI3K^ suppresses the progression of AML. IPI-549, a selective PI3K^ inhibitor in clinical trials (NCT02637531), was assessed for its therapeutic impact on AML. Addition of IPI-549 efficiently inhibited the growth of human AML cell lines (THP-1, MV4-11 and U937) (FIGS. 16A-16C). IPI-549 treatment decreased p-AKT, PGD, nuclear NRF2, NADPH, and ROS levels in these cells (FIGS. 16D-16H), disrupting the PPP. In the MLL-AF9-induced AML model, IPI-549 impaired colony formation in AML cells, evidenced by smaller size, reduced numbers of colonies and total cells upon serial replating (FIGS. 6A-6C). IPI-549-treated AML cells displayed lower NADPH and higher ROS levels (FIGS. 16I- 16L). Pgd overexpression induced resistance to IPI-549, as shown by reduced ROS levels and enhanced colony formation abilities (FIGS. 16M-16O). Upon IPI-549 treatment, mice injected with AML cells exhibited a significant delay in AML development compared to vehicle-treated mice, as evidenced by reduced leukemia cell frequencies and prolonged survival (FIGS. 6D-6E and 17A- 17B).

[0113] The effects of IPI-549 on PDX models were further assessed. Treatment with IPI-549 significantly reduced the engraftment of human cells and extended the survival of recipient mice in all three PDX models tested (FIGS. 6F-6K and 17C-17H). Additionally, the levels of NADPH, ROS, p-AKT, PGD, and nuclear accumulation of NRF2 were decreased in IPI-549-treated CD34+ PDX cells (FIGS. 17I-17M). Transcriptome analysis of Lin-CD34+CD38- PDX cells from BM of ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^mice treated with IPI-549 or vehicle revealed that downregulated genes in PPP, purine, and pyrimidine metabolism were enriched in IPI-549-treated cells (FIGS. 17N-17V). Finally, the effects of IPI-549 on a panel of eight primary AML cells were assessed. IPI-549 treatment significantly inhibited the growth and colony forming abilities across all eight AML patient samples (FIGS. 6L- 6U). Together, these data show a novel role for PI3K^ in regulating LSC fate and AML progression. Example 8

[0114] This embodiment shows an example in which This embodiment shows the methods and materials used in Examples 1-7.

[0115] Mice. All animal experiments were conducted with approval. PIK3CG-knockout mice, Pik3cbfl / fl;Mx-1-Cre+, WT;Mx-1-Cre+, and PIK3CD- / - mice were generated as previously described. C57BL / 6J, B6 CD45.1, NSG, and NSG-SGM3 mice were ordered from the Jackson Laboratory.

[0116] Murine leukemia models. The pMSCV-MLL-AF9-IRES-GFP or pMigR1-AML1-ETO9a- IRES-EGFP plasmids were mixed with pCL-ECO packaging plasmid (2:1) and transfected into 293T cells. Lin- cells from bone marrow (BM), isolated six days after 5-FU (150mg / kg) intraperitoneal injection, were infected with retroviruses through two rounds of spinoculation with 4 ^g / ml polybrene. Retro-orbital injection of infected cells (3×105) occurred in lethally irradiated (10Gy) C57BL / 6J mice, followed by secondary transplantations using 1×104sorted BM GFP+ cells or 100 sorted L-GMPs with 2×105normal BM cells. To assess LSC frequencies, indicated sorted BM leukemia cells from primary recipients were transplanted with 2×105normal BM cells into recipients. Functional LSC frequencies were calculated using L-Calc software.

[0117] Transcriptome analyses. The RNA of sorted mouse L-GMP cells or IPI-549-treated Lin- CD34+CD38- PDX cells were extracted using the RNeasy Plus Mini Kit (#74134, QIAGEN). Sequencing was done on Ion Torrent with AmpliSeq kits (#4488990, A36554, A26326, Thermo Fisher Scientific). Data was processed using Torrent Suite and AmpliSeqRNA plugin. DESeq2 determined differential gene expression, with subsequent gene set enrichment analysis (GSEA), Kyoto Encyclopedia of Genes and Genomes (KEGG), and gene ontology (GO) analyses.

[0118] Cell lines and primary human cells. The acute myeloid leukemia (AML) cell lines THP-1, MV4-11, and U937 were procured from ATCC and cultured in RPMI 1640 (#11875093, Gibco) supplemented with 10% fetal bovine serum (A5256801, Gibco) and 1% penicillin-streptomycin (#15140122, Gibco). The absence of mycoplasma contamination was confirmed using a ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^Mycoplasma Detection Kit (LT07-710; Lonza), and the identity of all cell lines was confirmed through short tandem repeat profiling.

[0119] Human cord blood mononuclear cells (frozen) were ordered from Stem Cell Technologies (#70007.1) and used to isolate human HSCs. PDX samples were obtained. The tissue source of PDX1 and PDX2 is the bone marrow, while PDX3 originates from peripheral blood. The PDX samples underwent one passage (P1) at the CPDM. To generate additional PDX cells, P1 cells were further passaged in mice to obtain P2 cells for subsequent experiments.

[0120] PIK3CA-knockdown, PIK3CB-knockout, PIK3CD-knockout, and PIK3CG-knockdown mouse AML models. For the PIK3CA-knockdown and PIK3CG- AML model, pLKO.1-sh-Pik3ca-#1-puro, pLKO.1-sh-Pik3ca-#2-puro, pLKO.1-sh-puro, pLKO.1-sh- Pik3cg-#2-puro, or pLKO.1-Scramble-puro was co-transfected with psPAX2 and pMD2.G packaging plasmids into 293 T cells. Primary wild-type BM MLL-AF9-GFP+ cells were infected with lentiviruses carrying shRNAs and subsequently selected with puromycin (2^g / ml) for 3 days. Selected 1×104cells, along with 2×105normal BM cells, were transplanted into lethally irradiated (10Gy) C57BL / 6J recipient mice. 1×104sorted GFP+ cells from primary recipients, in combination with 2×105normal BM cells, were used for secondary transplantation.

[0121] For the Pik3cb-knockout mouse AML model, Pik3cbfl / fl; Mx-1-Cre+ and control mice were treated with 5-FU (150mg / kg) after the third pIpC injection, and Lin- cells, isolated six days after 5- FU intraperitoneal injection, were infected with MLL-AF9-GFP retrovirus. For the Pik3cd-knockout mouse AML model, Pik3cd-KO and control mice were intraperitoneally injected with 5-FU (150mg / kg), and Lin- cells, isolated six days after 5-FU injection, were infected with MLL-AF9- GFP retrovirus. Retro-orbital injection of infected cells (3×105) occurred in lethally irradiated (10Gy) C57BL / 6J recipient mice. 1×104sorted GFP+ cells from primary recipients, along with 2×105normal BM cells, were utilized for secondary transplantation.

[0122] Wright-Giemsa staining, and hematoxylin and eosin staining. Wright-Giemsa staining was performed with leukemia cells in peripheral blood of primary and secondary recipients at 4 weeks after transplantations. For histological analysis, spleens and livers of leukemic mice at 4 weeks after transplantations were fixed in 10% Formalin overnight and transferred to 70% ethanol. Embedding, sectioning and hematoxylin & eosin staining were performed.

[0123] BM competitive transplantation. For competitive reconstitution analysis, 5×105CD45.2 wild- type or PIK3CG-null BM cells mixed with 5×105CD45.1 competitor cells were transplanted into lethally irradiated (10Gy) CD45.1 recipients. Peripheral blood was collected and analyzed at 4, 8, ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^12, and 16 weeks after transplantation. Hematological cell multilineage potential was evaluated at 16 weeks. One million BM cells from primary recipients were used for the secondary transplantation.

[0124] In vivo rescue assay. To conduct in vivo rescue experiments, the pBABE-Pik3cg-IRES-puro, pBABE-Pgd-IRES-puro, or pBABE-Nrf2-IRES-puro plasmids were mixed with pCL-ECO packaging plasmid (2:1) and transfected into 293T cells. The resulting virus-containing supernatant was used to infect primary WT and PIK3CG- / - BM MLL-AF9-GFP+ leukemia cells. Puromycin (2^g / ml) selection commenced at the end of secondary infection, with uninfected cells serving as the control. Three days after puromycin selection (by this time, uninfected control cells had died), we transplanted 1×104selected cells along with 2×105normal BM cells into lethally irradiated (10Gy) mice for further analysis.

[0125] Colony forming unit assay. Ten thousand BM MLL-AF9-GFP+ leukemia cells, 500 sorted L- GMPs, or 1×105PDX LMPPs of primary recipient mice were seeded in methylcellulose medium (M3534 for mouse, H4535 for human, Stem Cell Technologies). The numbers of colonies and cells were counted 6 days after culture, followed by re-plating with the same numbers of primarily plated leukemia cells.

[0126] Homing assay. A total of 2 million WT and PIK3CG-null Mac-1+c-Kit+ LSCs of primary recipient mice were labeled with 5^M 5(6)-carboxyfluorescein succinimidyl ester (CFSE; #423801, BioLegend) and transplanted into lethally irradiated mice. Total CFSE+ cells were measured in the BM, spleen, and liver 16h after transplantation by flow cytometric analysis.

[0127] Wnt3a treatment. One million sorted WT BM L-GMPs were treated with recombinant mouse Wnt3a (200ng / ml; #772302, BioLegend) for 4 hours, followed by addition of the PI3K^ inhibitor IPI-549 (1^M; HY-100716, MCE) or vehicle treatment for an additional 6 hours. Then, the RNA and protein from treated cells was harvested for subsequent Western blot and qRT-PCR experiments.

[0128] Quantitative RT-PCR. cDNA was synthesized using high-capacity RNA-to-cDNA kit (#4387406, Applied Biosystems). PCR reactions (10^L) were conducted using SYBRTM select master mix (#4367659, Applied Biosystems), along with gene-specific primers and cDNA. Applied Biosystems QuantStudio 3 analyzed mRNA expression with ^-actin normalization.

[0129] Immunoblot analysis. Whole cell lysates were electrophoresed on 8% sodium dodecyl sulfate-polyacrylamide gels and transferred to nitrocellulose membrane (Millipore). The membranes were incubated with primary antibodies overnight at 4°C, followed by incubation with secondary antibodies. Nuclear protein was extracted using the NE-PER Nuclear and Cytoplasmic Extraction Kit (#78833, Thermo Fisher Scientific). The immunoblot antibodies were used: AKT (#9272; CST), ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^p-AKT(Ser473) (#9271; CST), p-AKT(Thr308) (#4056; CST), G6PD (#8866; CST), PGD (#13389; CST), NRF2 (#12721; CST); ME1 (#16619-1-AP; Proteintech), ME2 (#67457-1-Ig; Proteintech), MTHFD1 (#10794-1-AP; Proteintech), MTHFD2 (#12270-1-AP; Proteintech), IDH1 (#12332-1-AP; Proteintech), IDH2 (#15932-1-AP; Proteintech), PIK3CA (#4255; CST), PIK3CB (#3011; CST), PIK3CD (#34050; CST), PIK3CG (#4252; CST), ^-actin (A5441; Sigma), Lamin B (#12987-1-AP; Proteintech), AKT1 (#2938; CST), AKT2 (#3063; CST), p-AKT1(Ser473) (#9018; CST), p- AKT2(Ser474) (#8599; CST), ^-catenin (#8480; CST), p-^-catenin(Ser552) (#5651; CST), p62 (#5114; CST), anti-rabbit IgG-AlexaFluor 680 (A21109, Life Technologies), and anti-mouse IgG- DyLight 800 (#610-145-002, Rockland Immunochemicals).

[0130] Flow cytometry. PB cells and BM cells were treated with red blood lysis buffer and washed with PBS. Dead cells were excluded using LIVE / DEAD Fixable Aqua Dead Cell Stain Kit (L34957, Invitrogen). For cell cycle analysis, L-GMP cells were treated with BD Fixation / Permeabilization Kit (#554714, BD Biosciences) after cell surface staining, followed by staining with Ki-67 (#652413, BioLegend) and Hoechst 33342 (5^g / mL) (#4082S, CST). For ROS level detection, leukemia cells were stained with L-GMP markers, followed by the incubation with 2^M CM- H2DCFDA (C6827, Invitrogen) at 37°C for 30 min.

[0131] In vivo EdU incorporation assay. To assay the impact of PIK3CG deletion on the cell cycle of LSCs, EdU (A10044, Life Technologies) (50^g / g) was intraperitoneally injected into WT and PIK3CG-null AML mice at 6 weeks after primary transplantation. Subsequently, the cell cycle status of L-GMPs was assayed 4 hours post EdU injection using the Click-iT Plus EdU Alexa Fluor 647 Flow Cytometry Assay Kit (C10634, Life Technologies) and Hoechst 33342 (5^g / mL).

[0132] Detection of ROS species and antioxidants rescue assay. To assay for the type of ROS elevated in PIK3CG-null L-GMPs, 1×105WT and PIK3CG-null L-GMPs, collected 4 weeks after primary transplantation, were incubated with different ROS probes at 37°C for 20 min, followed by flow cytometry analyses. The ROS probes used were as follows: H2O2 probe (OxiVision Blue peroxide sensor, 1:500; #11505, AAT Bioquest), superoxide probe (MitoSOX Red, 1^M; M36007, Invitrogen), hydroxyl radical probe (MitoROS OH580, 1:400; #16055, AAT Bioquest), and nitric oxide (NO) probe (DAX-J2 Red, 1^M; #16301, AAT Bioquest).

[0133] To assess the different types of antioxidants, 1×105WT and Pik3cg-null L-GMPs were treated with N-acetylcysteine (NAC) (1mM; A7250, Sigma), Vitamin E (^-Tocopherol) (10^M; HY- N0683, MCE), or Vitamin C (L-ascorbic acid) (100^M; A4034, Sigma) at 37°C for 2 hours, respectively. Subsequently, ROS levels were detected using CM-H2DCFDA or H2O2 probe staining. ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^Additionally, 500 WT and PIK3CG-null BM L-GMPs, collected 4 weeks after primary transplantation, were seeded in a methylcellulose-based medium (M3534, Stem Cell Technologies) with NAC (1mM), Vitamin E (10^M), or Vitamin C (100^M), respectively. The numbers of colonies and cells were counted 6 days after culture, followed by re-plating with the same numbers of initially plated cells and treatments.

[0134] NADPH / NADP+level measurement. NADPH and NADP+levels were assessed following the manufacturer’s instruction (G9081, Promega). In summary, 5×105mouse bulk BM AML cells, MLL-AF9+Mac-1+c-kit- BM leukemic blasts, BM L-GMPs, 3×105human AML cell lines, or CD34+BM PDX cells were resuspended in 50^L PBS in a 96-well plate well. Subsequently, 50^L of 0.2N NaOH with 1% dodecyltrimethylammonium bromide (DTAB) was added. The plate was briefly mixed on a plate shaker to ensure homogeneity and cell lysis. Next, 50^L of each sample was transferred to an empty well for treatment with 25^L of 0.4N HCL. The original sample wells served as the base-treated samples. The plate was covered, and all samples were incubated for 15 minutes at 60°C. After equilibrating the plate for 10 minutes at room temperature, 25^l of 0.5M Trizma base was added to each well of acid-treated cells to neutralize the acid. Furthermore, 50^l of HCl / Trizma solution was added to each well containing base-treated samples. Subsequently, 100^l of NADP / NADPH-Glo™ Detection Reagent was added to each well, and the plate was gently shaken to mix. After incubating for 30 minutes at room temperature, luminescence was recorded using the GloMax Navigator Microplate Luminometer (GM2010, Promega).

[0135] Targeted metabolomics analyses. For metabolite extraction, mouse BM L-GMPs or normal GMPs were sorted at the indicated time points, washed once with pre-cooled PBS, and immediately collected for resuspension in 1mL -80°C pre-cooled HPLC-grade methanol and water solvent (4:1 methanol: water, OmniSolv LC-MS). The average time between flushing of BM, sorting, and resuspension is within 2 hours per mouse. The cell lysates were vortexed for 1 min at 4°C and then incubated at -80°C for 1 hour before centrifugation at 14,000g and 4°C for 15 minutes. The supernatant containing metabolites was concentrated and dried using a 4°C SpeedVac vacuum concentrator (Thermo Fisher Scientific).

[0136] The targeted metabolomics analyses of WT and PIK3CG-null BM L-GMPs were conducted according to a previously published protocol. Samples were resuspended using 20^L HPLC grade water for mass spectrometry. 5^L of the sample was injected and analyzed using a hybrid 6500 QTRAP triple quadrupole mass spectrometer (AB / SCIEX) coupled to a Prominence UFLC HPLC system (Shimadzu) via selected reaction monitoring (SRM) of a total of 300 endogenous water- ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^soluble metabolites for steady-state analyses of samples. Some metabolites were targeted in both positive and negative ion mode for a total of 311 SRM transitions using positive / negative ion polarity switching. ESI voltage was +4950V in positive ion mode and –4500V in negative ion mode. The dwell time was 3ms per SRM transition and the total cycle time was 1.55 seconds. Approximately 9-12 data points were acquired per detected metabolite. Samples were delivered to the mass spectrometer via hydrophilic interaction chromatography (HILIC) using a 4.6mm I.D. x 10cm Amide XBridge column (Waters) at 400^L / min. Gradients were run starting from 85% buffer B (HPLC grade acetonitrile) to 30% B from 0-3 minutes; 30% B to 2% B from 3-12 minutes; 2% B was held from 12-15 minutes; 2% B to 85% B from 15-16 minutes; 85% B was held for 7 minutes to re-equilibrate the column. Buffer A was comprised of 20mM ammonium hydroxide / 20mM ammonium acetate (pH=9.0) in 95:5 water: acetonitrile. Peak areas from the total ion current for each metabolite SRM transition were integrated using MultiQuant v3.0.2 software (AB / SCIEX).

[0137] The targeted metabolomics analyses of Pgd-overexpessioin rescue, Nrf2-overexpression rescue, in vivo uniformly-labeled 13C6 glucose tracing assays, as well as WT and Pik3cg-null BM normal GMPs were performed. Dried primary cell extracts were redissolved in 20^L of acetonitrile / H2O (4 / 1). LC / MS analysis was conducted on a QExactive HF-X mass spectrometer equipped with a HESI II probe. The mass spectrometer was coupled to a Vanquish binary UPLC system (Thermo Fisher Scientific). For chromatographic separation prior to mass analysis, 5^L of the sample was injected onto a BEH Z-HILIC column (100mm, 1.7^M particle size, 2.1mm internal diameter, Waters). Samples were diluted 1:5 in acetonitrile for the analysis. For chromatography, Mobile phase A was 15mM ammonium bicarbonate in 90% water and 10% acetonitrile, and mobile phase B was 15mM ammonium bicarbonate in 95% acetonitrile and 5% water. The oven was held at 40°C and autosampler at 4°C. The chromatographic gradient was carried out at a flow rate of 0.5 ml / min as follows: 0.75 min initial hold at 95% B; 0.75-2.50 min linear gradient from 95% to 70% B, 0.5 min isocratic hold at 70% B, lowered to 50% B at 3.1 min, kept at 50% B until 4.5 min, lowered to 30% B at 8 min. The column was then equilibrated in initial conditions for 10 column volumes. The mass spectrometer was operated in full-scan negative mode, with the spray voltage set to 3kV, the capillary temperature to 320°C, and the HESI probe to 300°C. The sheath gas flow was set to 50 units, the auxiliary gas flow was set to 10 units, and the sweep gas flow was set to 1 unit. Mass acquisition was performed in a range of mass-to-charge ratio (m / z) = 80–900, with the resolution set at 120,0000. Retention times were determined using authentic standards. Raw data were converted to .mzML and processed using eMZed. Raw peak areas were generated through ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^integration within a retention time window defined by m / z, chemical standards, fragmentation patterns, and isotopologue patterns.

[0138] The peak areas were normalized to baseline, and data were normalized by cell number. MetaboAnalyst 5.0 platform was utilized for the analysis of metabolomics data.

[0139] In vivo13C6 glucose tracing assay. For in vivo glucose tracing, uniformly-labeled13C6 glucose (CLM-1396-1, Cambridge Isotope Laboratories) was dissolved in water at a concentration of 3.3M and injected into WT and PIK3CG-KO cell recipients (4mg / g) 4 weeks after primary transplantation by tail vein injection, followed by the harvest of BM cells one hour later. L-GMPs were sorted for performing the targeted metabolomics analyses.

[0140] Nucleoside rescue. WT and PIK3CG-null AML cells were cultured in StemSpan SFEM (#09600; Stem Cell Technologies) with 2% FBS, 1xpenicillin / streptomycin, 10ng / ml murine IL-6 (#575702, BioLegend), 10ng / ml murine IL-3 (#575502, BioLegend), and 10ng / ml murine SCF (#579702, BioLegend) or seeded in methylcellulose medium (M3534, Stem Cell Technologies). Purines (100^M adenosine and guanosine; A4036-5G, G6264-1G, sigma), pyrimidines (100^M cytosine and thymidine; C3506-1G, T1895-1G, sigma), or all of them were added into the medium, followed by counting of cell numbers and colonies.

[0141] Patient-derived xenografts (PDXs). Plasmids pLKO.1-sh-PIK3CG-#1-puro, pLKO.1-sh- PIK3CG-#2-puro, or pLKO.1-Scramble-puro were co-transfected with pSPAX2 and pMD2G packaging plasmids to produce virus supernatant. THP-1, MV4-11, and PDX blasts were infected with lentiviruses through two rounds of spinoculation with 4 ^g / ml polybrene. Puromycin (2^g / ml) selection commenced at the end of secondary infection, with uninfected cells serving as the control. Three days after puromycin selection (by this time, uninfected control cells had died), 1×106selected THP-1, MV4-11 cells, or 3×106PDX cells were transplanted into NSG or NSG-SGM3 mice via retro-orbital injection for subsequent analysis.

[0142] Chromatin immunoprecipitation (ChIP) assay and luciferase reporter assays. 293T cells were transfected with pGL4.27-PGD-promoter and pBABE-flag-NRF2 plasmids (or control). ChIP assays were conducted using the ChIP Kit (ab500; Abcam). The sonicated DNA was immunoprecipitated using anti-flag M2 Magnetic Beads (sigma) at 4°C overnight. The NucleoSpin kit (740609.50; MACHERERY-NAGEL) further purified ChIP samples. The NRF2-binding sequence was amplified using primers specific for the PGD promoter region.

[0143] To measure luciferase activity, 293T cells were co-transfected with indicated doses of pBABE-flag-NRF2 (or control) plasmid, pGL4.27-PGD-promoter and pRL-TK Renilla luciferase ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^control reporter vector (E2241; Promega). Dual-luciferase assay (E1910; Promega) evaluated luciferase activity 24 hours post-transfection.

[0144] Chemical treatment. For in vitro MK-2206 treatment, 1×105CD34+PDX cells were exposed to 5^M MK-2206 (HY-108232, MCE), harvested 24 hours later for immunoblotting. For in vitro IPI-549 treatment, 1×105human AML cell lines or 3×105CD34+PDX cells were treated with 5^M IPI-549 (HY-100716, MCE), followed by Western blot, NADPH / NADP+assays, and measurement of ROS levels 12 hours later; 3×105mouse MLL-AF9+ AML cells were treated with 1^M IPI-549 and detected the NADPH / NADP+and ROS levels 12 hours later, or 1×104mouse MLL-AF9+AML cells were seeded in Methylcellulose medium (M3534, Stem Cell Technologies) with 1^M IPI-549, counting colonies and derived cells after 6 days, followed by re-plating with the same numbers of primarily plated leukemia cells and the same treatment. For in vivo IPI-549 treatment, 3×106mouse BM MLL-AF9+AML cells or PDX cells were transplanted into recipients via retro-orbital injection, followed by daily oral gavage of either vehicle (5% NMP and 95% PEG 400) or 15 mg / kg IPI-549 24 hours or 2 weeks post-transplantation.

[0145] IPI-549 treatment on primary patient AML cells. For liquid culture, 1×105human primary AML cells were cultured in serum-free medium (#09600; StemCell Technologies) supplemented with 10 ng / mL human SCF (#300-07; PeproTech), 10 ng / mL human IL-3 (#200-03; PeproTech), and 10 ng / mL human IL-6 (#200-06; PeproTech) with or without IPI-549 (5^M; HY-100716, MCE) treatment. Cell numbers were assessed at the indicated time points. For colony-forming assays, 1×105AML cells were seeded into methylcellulose-based medium (H4535; StemCell Technologies) with or without IPI-549 (5^M) treatment. Colonies and derived cell numbers were counted 7 days after primary plating. Subsequently, 5×104AML cells derived from primary plating were seeded for secondary plating, and colonies and cell numbers formed were counted 7 days later.

[0146] In silico analysis for clinical data. To analyze PIK3CG expression in AML patients and normal HSCs, data were retrieved from the HemaExplorer curated database. To assess the association between PIK3CG expression levels and the overall survival of AML patients, w data were extracted from the GEPIA database.

[0147] Study approval. Primary human AML cells were obtained from bone marrow aspirates of AML patients (Table S4).

[0148] Statistics analysis. Statistical analysis was performed using GraphPad, version 9.3.1. Data are presented as mean ± s.e.m. Significance was determined using unpaired two-tailed Student’s t-test for data with two groups, and one-way ANOVA with Tukey’s multiple comparison test or two-way ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^ANOVA with Sidak’s multiple comparison test for data with more than two groups. Survival analysis for different groups was conducted using the Kaplan-Meier method with a log-rank test. Experiments were biologically repeated at least three times. EQUIVALENTS

[0149] Various aspects of the present disclosure may be used alone, in combination, or in a variety of arrangements not specifically discussed in the embodiments described in the foregoing and is, therefore, not limited in its application to the details and arrangement of components set forth in the foregoing description or illustrated in the drawings. For example, aspects described in one embodiment may be combined in any manner with aspects described in other embodiments. ^^^ ^

Claims

^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^What is claimed:

1. A method of detecting leukemia stem cells (LSCs), comprising performing reverse transcriptase quantitative polymerase chain reaction (rt-qPCR) for a bone marrow or a blood sample using PI3KCG cDNA primers, wherein the bone marrow or blood test sample reaches an amplification threshold by completing fewer amplification cycles than a bone marrow or a blood control sample without LSCs.

2. A method of detecting leukemia stem cells, comprising performing immunochemistry for a bone marrow or a blood sample using an anti-phosphatidylinositol 3-kinase gamma (PI3K^), wherein the bone marrow or blood test sample binds more anti-PI3K^ than a bone marrow or blood control sample without LSCs.

3. The method of claim 1 or claim 2, wherein the test sample and control samples are bone marrow samples.

4. The method of any one of claims 1-3, wherein the test sample and control samples are whole bone marrow samples.

5. The method of any one of claims 1-3, wherein the test sample and control samples are bone marrow aspirate samples.

6. The method of claim 1 or claim 2, wherein the test sample and control samples are blood samples.

7. The method of any one of claims 1-2 and 6, wherein the test sample and control samples are peripheral blood samples.

8. The method of any one of claims 1 or 3-7, wherein the PI3KCG cDNA primers are SEQ ID NO: 1 or SEQ ID NO:

2.

9. The method of any one of claims 1 or 3-8, wherein the PI3KCG cDNA primers are SEQ ID NO: 1 and SEQ ID NO:

2.

10. The method of any one of claims 2 or 3-7, wherein the anti-PI3K^ is a monoclonal or polyclonal antibody.

11. The method of any one of claims 2, 3-7, or 10, wherein the anti-PI3K^ is a polyclonal antibody.

12. The method of any one of claims 2, 3-7, or 10, wherein the anti-PI3K^ is a monoclonal antibody. ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^13. The method of any one of claims 1-5 or 8-15, wherein the bone marrow sample is a human or veterinary bone marrow sample.

14. The method of any one of claims 1-5 or 8-15, wherein the bone marrow sample is a human bone marrow sample.

15. The method of any one of claims 1-2 or 7-12, wherein the blood sample is a human blood sample.

16. The method of any one of claims 1-2, 7-12, or 15, wherein the blood sample is a human peripheral blood sample.

17. A method of diagnosing acute myeloid leukemia (AML), comprising detecting leukemia stem cells using the method of any one of claims 1-16, wherein the bone marrow is a human bone marrow sample from a subject with or at risk of having AML.

18. A method of diagnosing medium-risk (or intermediate-risk) acute myeloid leukemia (AML), comprising detecting leukemia stem cells using the method of any one of claims 1-16, wherein the bone marrow is a human bone marrow sample from a subject with or at risk of having AML.

19. A method of diagnosing high-risk acute myeloid leukemia (AML), comprising detecting leukemia stem cells using the method of any one of claims 1-16, wherein the bone marrow is a human bone marrow sample from a subject with or at risk of having AML.

20. A method of diagnosing minimal residual disease (MRD), comprising detecting leukemia stem cells using the method of any one of claims 1-16, wherein the bone marrow is a human bone marrow sample from a subject with or at risk of having MRD.

21. A method of treating acute myeloid leukemia (AML), comprising: a. detecting leukemia stem cells using the method of any one of claims 1-16, wherein the bone marrow is a human bone marrow sample from a subject with or at risk of having AML; and b. administering a PI3K^ inhibitor.

22. A method of treating medium-risk (or intermediate-risk) acute myeloid leukemia (AML), comprising: a. detecting leukemia stem cells using the method of any one of claims 1-16, wherein the bone marrow is a human bone marrow sample from a subject with or at risk of having AML; and b. administering a PI3K^ inhibitor. ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^23. A method of treating high-risk acute myeloid leukemia (AML), comprising: a. detecting leukemia stem cells using the method of any one of claims 1-16, wherein the bone marrow is a human bone marrow sample from a subject with or at risk of having AML; and b. administering a PI3K^ inhibitor.

24. A method of treating minimal residual disease (MRD), comprising: a. detecting leukemia stem cells using the method of any one of claims 1-16, wherein the bone marrow is a human bone marrow sample from a subject with or at risk of having MRD; and b. administering a PI3K^ inhibitor.

25. A method of treating medium-risk (or intermediate-risk) acute myeloid leukemia (AML), comprising administering a PI3K^ inhibitor to a patient or subject with medium-risk (or intermediate-risk) AML.

26. A method of treating high-risk acute myeloid leukemia (AML), comprising administering a PI3K^ inhibitor to a patient or subject with high-risk AML.

27. A method of treating minimal residual disease (MRD), comprising administering a PI3K^ inhibitor to a patient or subject with MRD.

28. A composition for use in treating acute myeloid leukemia (AML), comprising a PI3K^ inhibitor.

29. The composition of claim 28, wherein the AML comprises minimal residual disease (MRD).

30. The composition of claim 28, wherein the AML comprises medium-risk (or intermediate- risk) AML.

31. The composition of claim 28, wherein the AML comprises high-risk AML.

32. The composition of claim 28, wherein the AML comprises refractory AML.

33. The composition of claim 28, wherein the AML comprises recurrent AML.

34. A pharmaceutical composition for use in treating acute myeloid leukemia (AML), comprising PI3K^ inhibitor and a pharmaceutically acceptable carrier.

35. The pharmaceutical composition of claim 34, wherein the AML comprises minimal residual disease (MRD).

36. The pharmaceutical composition of claim 34, wherein the AML comprises medium-risk (or intermediate-risk) AML. ^^^ ^^^^^^^^^^^^^^^^^^^^^^^^ ^ ^^^^^^^^^^^^^^^^^^^^^37. The pharmaceutical composition of claim 34, wherein the AML comprises high-risk AML.

38. The pharmaceutical composition of claim 34, wherein the AML comprises recurrent AML.

39. The pharmaceutical composition of claim 34, wherein the AML comprises refractory AML.

40. Use of a PI3K^ inhibitor or pharmaceutical composition thereof in treating acute myeloid leukemia (AML), wherein the pharmaceutical composition comprises PI3K^ inhibitor and a pharmaceutically acceptable carrier.

41. The use of claim 40, wherein the AML comprises minimal residual disease (MRD).

42. The use of claim 40, wherein the AML comprises high-risk AML.

43. The use of claim 40, wherein the AML comprises medium-risk (or intermediate-risk) AML.

44. The use of claim 40, wherein the AML comprises refractory AML.

45. The use of claim 40, wherein the AML comprises recurrent AML.

46. The method, composition, pharmaceutical composition, or use of any one of claims 21- 45, wherein the PI3K^ inhibitor is a small molecule or a biologic.

47. The method, composition, pharmaceutical composition, or use of any one of claims 21- 45, wherein the PI3K^ inhibitor is a nucleic acid comprising a nucleic acid sequence that binds to PI3K^ mRNA.

48. The method, composition, pharmaceutical composition, or use of claim 45, wherein the nucleic acid comprises SEQ ID NO: 3 or SEQ ID NO:

4.

49. The method, composition, pharmaceutical composition, or use of any one of claims 21- 45, wherein the PI3K^ inhibitor is IPI-549. ^^^ ^

Images