System for regulating the expression of a transgene of interest

Abstract

The present invention relates in general to the field of medicine. More particularly, it relates to expression vectors provided with a safety system for transcriptional and post-transcriptional regulation of the expression of a transgene of interest. The invention also relates to the production of these expression vectors and the use thereof for the implementation of safe cellular therapies.

Description

[0001] SYSTEM FOR REGULATING THE EXPRESSION OF A TRANSGENE OF INTEREST

[0002] FIELD OF THE INVENTION

[0003] The present invention relates generally to the field of medicine. More particularly, it relates to expression vectors provided with a safety system for regulating transcriptionally and / w.s7-transcriptionally the expression of a transgene of interest. The invention also relates to the production of these expression vectors and the use thereof for implementing safe cell therapies.

[0004] PRIOR ART

[0005] The development of gene therapy is a revolution in the history of medicine and opens the door to treating some diseases previously considered incurable. Over the past 30 years, several thousand gene therapy protocols have been tested worldwide (Arabi, F. et al. Gene therapy clinical trials, where do we go? An overview. Biomedicine & Pharmacotherapy 153, 113324 (2022)).

[0006] Gene therapies are divided into two major groups (Maldonado, R. et al. Curative gene therapies for rare diseases. J Community Genet 12, 267-276 (2021)):

[0007] ■ in vivo gene therapy which consists of the delivery of an exogenous nucleic acid sequence to diseased cells, directly in the body, with the aim of correcting their phenotype; and

[0008] ■ ex vivo gene therapy consisting of genetic modification in the laboratory of cells taken from the patient and then regrafted.

[0009] Taking advantage of the significant growth in gene therapy, lentiviral vectors have been developed and involved in numerous clinical trials. However, in many pathological situations, the expression of the therapeutic transgene must be finely controlled in order to prevent the harmful effects of an overdose, or to favor the expression of the therapeutic transgene in an iterative manner.

[0010] BRIEF OVERVIEW OF THE INVENTION

[0011] Faced with this major challenge of having effective, controllable and safe therapeutic tools, the inventor has designed a novel physiological regulation system for transcriptional regulation allowing the control of the expression of a transgene by an exogenous stimulus. Also, a first aim of the invention is to propose the use of this physiological regulation system with which it is possible to construct new cassettes making it possible to regulate, both transcriptionally and / w.s7-transcriptionally, the expression of a transgene of interest. A second aim of the invention is therefore to provide the medical profession with a doubly regulable expression cassette, which can be introduced into a eukaryotic cell by transfection of a DNA fragment or a plasmid, or by transduction using a viral vector, in particular a lentiviral vector, or by a vector derived from adenovirus or adenovirus-associated virus (AAV).Also, another object of the invention is to propose the use of said doubly regulable expression cassette for transfecting or transducing a eukaryotic cell, which is then intended to be used in safe and effective in vivo gene or cell therapy. Another object of the invention is therefore to propose a transduced eukaryotic cell and its use in cell therapy.

[0012] DETAILED DESCRIPTION

[0013] According to a first aspect, the subject of the invention is the in vitro use of a coding or non-coding sequence having regulatory properties at the / w.s7-transcriptional level to reduce or suppress the leakage of expression of a transgene of interest located downstream of an inducible promoter, said coding or non-coding sequence having regulatory properties at the post-transcriptional level being located at the 5' end of said transgene of interest.

[0014] The expression "coding or non-coding sequence having regulatory properties at the / w.s7-transcriptional level" designates a nucleic acid sequence which can be either coding (having the capacity to code for proteins) or non-coding (not coding for proteins), and which has regulatory properties acting after the transcription process. That is to say, after the production of an mRNA, the presence of said nucleic acid sequence within it inhibits under certain conditions (for example, normal physiological conditions) the translation of said mRNA and therefore, the production of the protein that the mRNA codes for. Under other conditions (for example, conditions of cellular stress), the presence of said nucleic acid sequence within the mRNA no longer has its role of inhibiting translation. Translation then takes place and the protein coded by said mRNA is produced.

[0015] Among the coding or non-coding sequences having regulatory properties at the post-transcriptional level, the invention particularly uses nucleic acid sequences, which are advantageously chosen from the sequences having at least 90% identity with the sequences SEQ ID NOs: 1 to 27. According to another embodiment, the subject of the invention is therefore the in vitro use as described above of a coding or non-coding sequence having regulatory properties at the / w.s7-transcriptional level to reduce or suppress the leakage of expression of a transgene of interest located downstream of an inducible promoter, said coding or non-coding sequence having regulatory properties at the post-transcriptional level being located at the 5' end of said transgene of interest and being in particular chosen from the sequences having at least 90% identity with the sequences SEQ ID NOs: 1 to 27.

[0016] In the invention, said coding or non-coding sequence having regulatory properties at the / w.s7-transcriptional level is located, in an expression cassette, between a transgene of interest and an inducible promoter, said transgene of interest being located downstream of said inducible promoter. In other words, said coding or non-coding sequence having regulatory properties at the / w.s7-transcriptional level is located at the 5' end (upstream) of said transgene of interest (Fig. 2). This arrangement of said expression cassette (5'-Inducible promoter_ Coding or non-coding sequence having regulatory properties at the post-transcriptional level Transgene of interest-3') makes it possible, in the event of unwanted transcription of an mRNA from said inducible promoter (i.e. leakage of expression in the absence of induction), to inhibit its translation using said coding or non-coding sequence having regulatory properties at the / w level.s7-transcriptional and therefore, to inhibit the production of said transgene of interest.

[0017] The tool described above and developed by the inventor is therefore a revolutionary security key making it possible to reduce or eliminate the leakage of expression of a transgene of interest located downstream of an inducible promoter by acting at a / w.s7-transcriptional level. With this and the presence of an inducible promoter, the inventor has thus developed an innovative double security (control of the induction of transcription whose unwanted leakage is secured by a control of the induction of translation) making it possible to offer patients who need it a safe and effective in vivo gene or cell therapy.

[0018] According to another embodiment, the invention therefore relates to the in vitro use as described above, in which said animal eukaryotic cell is different from a pluripotent or totipotent stem cell, or from a stem cell isolated from a tissue of the organism.

[0019] According to another embodiment, the invention also relates to the in vitro use as described above of a sequence chosen from the sequences having at least 90% identity with the sequences SEQ ID NOs: 1 to 27 to reduce or suppress the leakage of expression of a transgene of interest located downstream of an inducible promoter, said sequence having regulatory properties at the / w.s7-transcriptional level and being located at the 5' end of said transgene of interest.

[0020] The term "% identity" means the percentage determined by direct comparison of two oligonucleotide sequences (nucleic acid sequence), determining the number of identical nucleotides between the two sequences, then dividing it by the number of nucleotides in the longer sequence of the two, and multiplying the result by 100. By "having at least 90% identity" is therefore meant that the aforementioned percentage identity is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or is 100%. In this regard, it should be noted that this definition applies to all embodiments of the invention including when it is a direct comparison of two polypeptide sequences (amino acid sequence).Furthermore, it is understood that sequences having at least 90% identity with a reference sequence retain the same properties and functions, or even these are improved.

[0021] According to another embodiment, the invention relates to the in vitro use as described above, in which said coding or non-coding sequence having regulatory properties at the / w.s7-transcriptional level is chosen from the sequences having at least 95% identity with the sequences SEQ ID NOs: 1 to 27.

[0022] According to another embodiment, the subject of the invention is the in vitro use as described above, in which said coding or non-coding sequence having regulatory properties at the / ?as7-transcriptional level is chosen from the sequences SEQ ID NOs: 1 to 27. In particular, the subject of the invention is the in vitro use as described above, in which said coding or non-coding sequence having regulatory properties at the / w.s7-transcriptional level is the sequence SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 or 27 (Table 1).

[0023] Table 1. List of 5'UTR sequences with regulatory properties at the post-transcriptional level

[0024] Advantageously, the subject of the invention is the in vitro use as described above, in which said coding or non-coding sequence having regulatory properties at the / ?<95t-transcriptional level is the 5'UTR sequence of ATF4 of sequence SEQ ID NO: 1.

[0025] As mentioned above, this technology aims to be implemented within an expression cassette to secure its operation, and to trigger the production of the protein of interest encoded by the transgene of interest only at the desired time and advantageously to control the duration of expression and production, and the location of expression and production. According to a second aspect, the invention in fact relates to an expression cassette comprising an inducible promoter upstream of a transgene of interest, said transgene of interest comprising at its 5' end a coding or non-coding sequence having regulatory properties at the / w.s7-transcriptional level. The expression "expression cassette" designates, as described above, a nucleic acid comprising an inducible promoter upstream of a transgene of interest, said transgene of interest comprising at its 5' end a coding or non-coding sequence having regulatory properties at the / w.s7-transcriptional level.s7-transcriptional. Advantageously, this nucleic acid comprises at the 3' end of said transgene of interest a nucleic acid sequence allowing the transcription of a polyA tail.

[0026] According to another embodiment, the subject of the invention is the expression cassette as described above comprising an inducible promoter upstream of a transgene of interest, said transgene of interest comprising at its 5' end a coding or non-coding sequence having regulatory properties at the / w.s7-transcriptional level, said coding or non-coding sequence having regulatory properties at the post-transcriptional level being in particular chosen from the sequences having at least 90% identity with the sequences SEQ ID NOs: 1 to 27.

[0027] According to another embodiment, the subject of the invention is the expression cassette as described above comprising an inducible promoter upstream of a transgene of interest, said transgene of interest comprising at its 5' end a sequence chosen from the sequences having at least 90% identity with the sequences SEQ ID NOs: 1 to 27, said sequence having regulatory properties at the / w.s7-transcriptional level.

[0028] According to another embodiment, the subject of the invention is the expression cassette as described above, in which said coding or non-coding sequence having regulatory properties at the / w.s7-transcriptional level is chosen from the sequences having at least 95% identity with the sequences SEQ ID NOs: 1 to 27.

[0029] According to another embodiment, the subject of the invention is the expression cassette as described above, in which said coding or non-coding sequence having regulatory properties at the / ?as7-transcriptional level is chosen from the sequences SEQ ID NOs: 1 to 27. Advantageously, the subject of the invention is the expression cassette as described above, in which said coding or non-coding sequence having regulatory properties at the / ?as7-transcriptional level is the 5'UTR sequence of ATF4 of sequence SEQ ID NO: 1.

[0030] The expression "inducible promoter" designates a nucleic acid located upstream of a gene (or transgene) of interest and which controls its expression, in particular by regulating its transcription. In the invention, this promoter is described as inducible because the expression of the gene (or transgene) of interest that it controls is not constitutive and is only induced after its activation in response to the right stimulus (small molecule, hormone, etc.) or the right cellular environment. Thus, the expression "inducible promoter" also includes tissue-specific promoters.

[0031] In the invention, these are the 2XAARE YB - TATA , the 2xAARE TK , the 4xSRE YB - TATA , the 9XHRE YB - TATA , the GRP78 YB - TATA , the miniCHACl YB - TATA (or 2XAARE CR| - AC I ) and the miR223 promoter. The promoters, 2XAARE YB - TATA , 2xAARE TK, and miniCHACl YB - TATA are activated by an inducer inducing the expression of the transcription factor ATF4; the GRP78 promoter YB TATA is activated by an inducer inducing the transcription factor ATF6; the 4xSRE promoter YB - TATA is induced by steroid hormones and more specifically by dexamethasone; the 9xHRE promoter YB TATA is induced by hypoxia and the miR223 promoter is specifically induced in myeloid cells and is an example of a tissue-specific promoter not expressed in HEK-293T cells. Interestingly, the aforementioned inducible promoters are dependent on the expression of cellular transcription factors that are poorly or not expressed under vector production conditions in HEK 293T cells.

[0032] According to another embodiment, the subject of the invention is the expression cassette as described above, in said inducible promoter is chosen from:

[0033] ■ the 2XAARE YB TATA whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 28;

[0034] ■ the 2XAARE TK whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 29;

[0035] ■ the 4XSRE YB TATA whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 30;

[0036] ■ the 9XHRE YB TATA whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 31;

[0037] ■ the GRP78 YB TATAwhose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 32;

[0038] ■ the tissue-specific promoter of miR223 whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 33; and

[0039] ■ the 2XAARE CRE ' ACM (OR miniCHACl YB - TATA ) whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 34.

[0040] As before, by "% identity" is meant the percentage determined by direct comparison of two oligonucleotide sequences (nucleic acid sequence), determining the number of identical nucleotides between the two sequences, then dividing it by the number of nucleotides in the longer sequence of the two, and multiplying the result by 100. Also, by "having at least 80% identity" is meant that the aforementioned percentage identity is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or is 100%.In this regard, it should be noted that this definition applies to all embodiments of the invention, including when it involves a direct comparison of two polypeptide sequences (amino acid sequence). Furthermore, it is understood that sequences having at least 80% identity with a reference sequence retain the same properties and the same functions, or even these are improved. According to another embodiment, the invention relates to the expression cassette as described above, in which said inducible promoter is 2XAARE. YB TATA whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 28. According to another embodiment, the subject of the invention is the expression cassette as described above, in which said inducible promoter is 2XAARE TKwhose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 29. According to another embodiment, the subject of the invention is the expression cassette as described above, in which said inducible promoter is the 4xSRE YB TATA whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 30. According to another embodiment, the subject of the invention is the expression cassette as described above, in which said inducible promoter is the 9xHRE YB TATA whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 31. According to another embodiment, the subject of the invention is the expression cassette as described above, in which said inducible promoter is GRP78 YB TATAwhose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 32. According to another embodiment, the subject of the invention is the expression cassette as described above, in which said inducible promoter is the tissue-specific promoter of miR223 whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 33. According to another embodiment, the subject of the invention is the expression cassette as described above, in which said inducible promoter is the 2XAARE CRE ' ACM (OR miniCHACl YB TATA ) whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 34.

[0041] According to another embodiment, the subject of the invention is the expression cassette as described above, in said inducible promoter is chosen from:

[0042] ■ the 2XAARE YB TATA whose nucleic acid has a sequence corresponding to the nucleic acid of sequence SEQ ID NO: 28;

[0043] ■ the 2XAARE TK whose nucleic acid has a sequence corresponding to the nucleic acid of sequence SEQ ID NO: 29;

[0044] ■ the 4XSRE YB TATA whose nucleic acid has a sequence corresponding to the nucleic acid of sequence SEQ ID NO: 30;

[0045] ■ the 9XHRE YB TATA whose nucleic acid has a sequence corresponding to the nucleic acid of sequence SEQ ID NO: 31;

[0046] ■ the GRP78 YB TATA whose nucleic acid has a sequence corresponding to the nucleic acid of sequence SEQ ID NO: 32;

[0047] ■ the tissue-specific promoter of miR223 whose nucleic acid has a sequence corresponding to the nucleic acid of sequence SEQ ID NO: 33; and

[0048] ■ the 2XAARE CRE ' ACM (OR miniCHACl YB - TATA) whose nucleic acid has a sequence corresponding to the nucleic acid of sequence SEQ ID NO: 34.

[0049] According to another embodiment, the invention relates to the expression cassette as described above, in which said inducible promoter is 2XAARE YB TATA whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 28. According to another embodiment, the subject of the invention is the expression cassette as described above, in which said inducible promoter is the 2xAARE TK whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 29. According to another embodiment, the subject of the invention is the expression cassette as described above, in which said inducible promoter is the 4xSRE YB TATAwhose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 30. According to another embodiment, the subject of the invention is the expression cassette as described above, in which said inducible promoter is 9XHRE YB TATA whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 31. According to another embodiment, the subject of the invention is the expression cassette as described above, in which said inducible promoter is GRP78 YB TATAwhose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 32. According to another embodiment, the subject of the invention is the expression cassette as described above, in which said inducible promoter is the tissue-specific promoter of miR223 whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 33. According to another embodiment, the subject of the invention is the expression cassette as described above, in which said inducible promoter is the 2XAARE CRE ' ACM (OR miniCHACl YB TATA ) whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 34.

[0050] The expression "transgene of interest" designates a nucleic acid located downstream (3') of said inducible or tissue-specific promoter and which codes for a protein of interest in the genetically modified cell. That is to say that after the activation (induction) of said inducible or tissue-specific promoter and the lifting of the inhibition of translation by said coding or non-coding sequence having regulatory properties at the / w.s7-transcriptional level and this, only in response to the right stimulus and / or the right cellular environment, the protein of interest (i.e. that coded by said transgene of interest) is produced in the cell expressing it. In the invention, the latter may be chosen from:

[0051] ■ a toxic or suicide transgene capable of inducing the death of a cell;

[0052] ■ a therapeutic transgene selected from: oncogenes, antioncogenes, transcription factors, trophic factors, cytokines, enzymes, hormones, receptors, ligands, heterologous proteins, chimeric proteins, immunogenic proteins and antibodies; and

[0053] ■ a transgene for gene editing.

[0054] According to another embodiment, the invention therefore relates to the expression cassette as described above, in which said transgene of interest is a transgene chosen from:

[0055] ■ a toxic or suicide transgene capable of inducing the death of a cell;

[0056] ■ a therapeutic transgene selected from: oncogenes, antioncogenes, transcription factors, trophic factors, cytokines, enzymes, hormones, receptors, ligands, heterologous proteins, chimeric proteins, immunogenic proteins and antibodies; and

[0057] ■ a transgene for gene editing. The term "toxic or suicide transgene" refers to a nucleic acid sequence carrying the information of a toxic or suicide protein, which, upon transcription and translation of this nucleic acid, causes (leads to) cell death in the cell expressing it. In the invention, the latter may be chosen from toxic or suicide transgenes coding: inducible Caspase-9 (iC9), Bax (S 184 del), Noxa (the wild-type protein or one of its mutants, in particular the S 13 A mutant), Gasdermin B (N-ter), constitutively active caspase-3 (V266E), an M2 ion channel (H37A) of the influenza virus, the A subunit of diphtheria toxin (DTA) and an attenuated aDTA mutant (G128D), a streptolysin O (in particular that of S. pyogenes) and an enterotoxin (in particular that of C. perfringens). These are non-secreted toxic or suicide proteins, iewhose expression after activation of said inducible or tissue-specific promoter upstream of the nucleic acid encoding them and the lifting of the inhibition of translation by said coding or non-coding sequence having regulatory properties at the / w.s7-transcriptional level is not found in the extracellular medium and therefore only results in the cell death of the cell expressing them.

[0058] According to another embodiment, the invention therefore relates to the expression cassette as described above, in which said transgene of interest is a toxic or suicide transgene chosen from:

[0059] ■ an inducible Caspase-9 (iC9) protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 35 or whose nucleic acid encodes an inducible Caspase-9 (iC9) protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 36;

[0060] ■ a Bax protein (S 184 del) whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 37 or whose nucleic acid codes for a Bax protein (S 184 del) whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 38;

[0061] ■ an influenza virus M2 (H37A) ion channel whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 39 or whose nucleic acid encodes an influenza virus M2 (H37A) ion channel whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 40;

[0062] ■ a constitutively active caspase-3 protein (V266E) whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 41 or whose nucleic acid encodes a constitutively active caspase-3 protein (V266E) whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 42;

[0063] ■ a diphtheria toxin A subunit (DTA) whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 43 or whose nucleic acid encodes a diphtheria toxin A subunit (DTA) whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 44, and an attenuated mutant aDTA (G128D) whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 45 or whose nucleic acid encodes an attenuated mutant aDTA (G128D) whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 46;

[0064] ■ a Gasdermin B (N-ter) protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 47 or whose nucleic acid encodes a Gasdermin B (N-ter) protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 48;

[0065] ■ a Noxa protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 49 or whose nucleic acid encodes a protein a Noxa protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 50;

[0066] ■ a streptolysin O whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4470 or whose nucleic acid encodes a streptolysin O whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4471; and

[0067] ■ an enterotoxin whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4472 or whose nucleic acid encodes an enterotoxin whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4473.

[0068] According to another embodiment, the subject of the invention is the expression cassette as described above, in which said transgene of interest is a toxic or suicide transgene and is a toxic or suicide transgene and is an inducible Caspase-9 (iC9) protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 35 or whose nucleic acid codes for an inducible Caspase-9 (iC9) protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 36.According to another embodiment, the subject of the invention is the expression cassette as described above, in which said transgene of interest is a toxic or suicide transgene and is a Bax protein (S184 del) whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 37 or whose nucleic acid codes for a Bax protein (S 184 del) whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 38.According to another embodiment, the subject of the invention is the expression cassette as described above, in which said transgene of interest is a toxic or suicide transgene and is an M2 ion channel (H37A) of the influenza virus whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 39 or whose nucleic acid codes an M2 ion channel (H37A) of the influenza virus whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 40.According to another embodiment, the subject of the invention is the expression cassette as described above, in which said transgene of interest is a toxic or suicide transgene and is a constitutively active caspase-3 protein (V266E) whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 41 or whose nucleic acid codes for a constitutively active caspase-3 protein (V266E) whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 42.According to another embodiment, the subject of the invention is the expression cassette as described above, in which said transgene of interest is a toxic or suicide transgene and is a subunit A of diphtheria toxin (DTA) whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 43 or whose nucleic acid encodes a subunit A of diphtheria toxin (DTA) whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 44, or is an attenuated mutant aDTA (G128D) whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 45 or whose nucleic acid encodes an attenuated mutant aDTA (G128D) whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 46.According to another embodiment, the subject of the invention is the expression cassette as described above, in which said transgene of interest is a toxic or suicide transgene and is a Gasdermin B (N-ter) protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 47 or whose nucleic acid encodes a Gasdermin B (N-ter) protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 48. According to another embodiment, the subject of the invention is the expression cassette as described above, in which said transgene of interest is a toxic or suicide transgene and is a Noxa protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 49 or whose nucleic acid encodes a protein a Noxa protein whose sequence of amino acids is at least 80% identical to the sequence SEQ ID NO: 50.According to another embodiment, the subject of the invention is the expression cassette as described above, in which said transgene of interest is a toxic or suicide transgene and is a streptolysin O whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4470 or whose nucleic acid codes for a streptolysin O whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4471. According to another embodiment, the subject of the invention is the expression cassette as described above, in which said transgene of interest is a toxic or suicide transgene and is an enterotoxin whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4472 or whose nucleic acid codes for an enterotoxin whose sequence of amino acids is at least 80% identical to the sequence SEQ ID NO: 4473.

[0069] According to another embodiment, the subject of the invention is the expression cassette as described above, in which said transgene of interest is a toxic or suicide transgene which is chosen from:

[0070] ■ an inducible Caspase-9 (iC9) protein whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 35 or whose nucleic acid encodes an inducible Caspase-9 (iC9) protein whose amino acid sequence corresponds to the sequence SEQ ID NO: 36;

[0071] ■ a Bax protein (S184 del) whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 37 or whose nucleic acid codes for a Bax protein (S 184 del) whose amino acid sequence corresponds to the sequence SEQ ID NO: 38; ■ an influenza virus M2 ion channel (H37A) whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 39 or whose nucleic acid codes for an influenza virus M2 ion channel (H37A) whose amino acid sequence corresponds to the sequence SEQ ID NO: 40;

[0072] ■ a constitutively active caspase-3 protein (V266E) whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 41 or whose nucleic acid encodes a constitutively active caspase-3 protein (V266E) whose amino acid sequence corresponds to the sequence SEQ ID NO: 42;

[0073] ■ a diphtheria toxin A subunit (DTA) whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 43 or whose nucleic acid encodes a diphtheria toxin A subunit (DTA) whose amino acid sequence corresponds to the sequence SEQ ID NO: 44, and an attenuated mutant aDTA (G128D) whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 45 or whose nucleic acid encodes an attenuated mutant aDTA (G128D) whose amino acid sequence corresponds to the sequence SEQ ID NO: 46;

[0074] ■ a Gasdermin B (N-ter) protein whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 47 or whose nucleic acid encodes a Gasdermin B (N-ter) protein whose amino acid sequence corresponds to the sequence SEQ ID NO: 48;

[0075] ■ a Noxa protein whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 49 or whose nucleic acid encodes a protein a Noxa protein whose amino acid sequence corresponds to the sequence SEQ ID NO: 50;

[0076] ■ a streptolysin O whose nucleic acid has a sequence corresponding to the nucleic acid of sequence SEQ ID NO: 4470 or whose nucleic acid encodes a streptolysin O whose amino acid sequence corresponds to the sequence SEQ ID NO: 4471; and

[0077] ■ an enterotoxin whose nucleic acid has a sequence corresponding to the nucleic acid of sequence SEQ ID NO: 4472 or whose nucleic acid encodes an enterotoxin whose amino acid sequence corresponds to the sequence SEQ ID NO: 4473.

[0078] According to another embodiment, the subject of the invention is the expression cassette as described above, in which said transgene of interest is a toxic or suicide transgene and is an inducible Caspase-9 (iC9) protein whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 35 or whose nucleic acid encodes an inducible Caspase-9 (iC9) protein whose amino acid sequence corresponds to the sequence SEQ ID NO: 36. According to another embodiment, the subject of the invention is the expression cassette as described above, in which said transgene of interest is a toxic or suicide transgene and is a Bax protein (S 184 del) whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 37 or whose nucleic acid encodes a Bax protein (S 184 del) whose amino acid sequence corresponds to the sequence SEQ ID NO: : 38.According to another embodiment, the subject of the invention is the expression cassette as described above, in which said transgene of interest is a toxic or suicide transgene and is an M2 ion channel (H37A) of the influenza virus whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 39 or whose nucleic acid codes an M2 ion channel (H37A) of the influenza virus whose amino acid sequence corresponds to the sequence SEQ ID NO: 40. According to another embodiment, the subject of the invention is the expression cassette as described above, in which said transgene of interest is a toxic or suicide transgene and is a constitutively active caspase-3 protein (V266E) whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 41 or whose nucleic acid codes a constitutively active caspase-3 protein (V266E) whose amino acid sequence corresponds to the sequence SEQ ID NO: 42.According to another embodiment, the subject of the invention is the expression cassette as described above, in which said transgene of interest is a toxic or suicide transgene and is a subunit A of diphtheria toxin (DTA) whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 43 or whose nucleic acid encodes a subunit A of diphtheria toxin (DTA) whose amino acid sequence corresponds to the sequence SEQ ID NO: 44, or is an attenuated mutant aDTA (G128D) whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 45 or whose nucleic acid encodes an attenuated mutant aDTA (G128D) whose amino acid sequence corresponds to the sequence SEQ ID NO: 46.According to another embodiment, the subject of the invention is the expression cassette as described above, in which said transgene of interest is a toxic or suicide transgene and is a Gasdermin B (N-ter) protein whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 47 or whose nucleic acid encodes a Gasdermin B (N-ter) protein whose amino acid sequence corresponds to the sequence SEQ ID NO: 48. According to another embodiment, the subject of the invention is the expression cassette as described above, in which said transgene of interest is a toxic or suicide transgene and is a Noxa protein whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 49 or whose nucleic acid encodes a Noxa protein whose amino acid sequence corresponds to the sequence SEQ ID NO: 50.According to another embodiment, the subject of the invention is the expression cassette as described above, in which said transgene of interest is a toxic or suicide transgene and is a streptolysin O whose nucleic acid has a sequence corresponding to the nucleic acid of sequence SEQ ID NO: 4470 or whose nucleic acid codes a streptolysin O whose amino acid sequence corresponds to the sequence SEQ ID NO: 4471. According to another embodiment, the subject of the invention is the expression cassette as described above, in which said transgene of interest is a toxic or suicide transgene and is an enterotoxin whose nucleic acid has a sequence corresponding to the nucleic acid of sequence SEQ ID NO: 4472 or whose nucleic acid codes an enterotoxin whose amino acid sequence corresponds to the sequence SEQ ID NO: 4473.

[0079] The expression "therapeutic transgene" designates a nucleic acid sequence carrying the information of a therapeutic protein, which, through the transcription and translation of this nucleic acid, contributes to, leads to, the cure of a patient in need thereof, after having been administered to him, a plasmid carrying said therapeutic transgene, a vector of viral or non-viral origin carrying said therapeutic transgene, a nanoparticle carrying said therapeutic transgene, or a genetically modified therapeutic cell capable of expressing said therapeutic transgene. In the invention, the latter may be chosen from therapeutic transgenes encoding: oncogenes, antioncogenes, transcription factors, trophic factors, cytokines, enzymes, hormones, receptors, ligands, heterologous proteins, chimeric proteins, immunogenic proteins or antibodies.

[0080] The expression "transgene for gene editing" designates a nucleic acid sequence carrying the information of a protein allowing gene editing, which, following transcription and translation of this nucleic acid, contributes to, or leads to, the editing of one or more genes. In the invention, the latter may be the one coding for a Cas nuclease, in particular the Cas9 nuclease of S. aureus (saCas9).

[0081] The term "Cas protein" generally refers to CRISPR associated protein (Clustered Regularly Interspaced Short Palindromic Repeats associated protein) and the term "Cas9 protein" refers to CRISPR associated protein 9 (Clustered Regularly Interspaced Short Palindromic Repeats associated protein 9). These correspond to the nucleases of the CRISPR-Cas system, which constitutes a prokaryotic adaptive defense mechanism for destroying invading foreign DNA. To do this and interfere with the expression and replication of foreign DNA or RNA, the host expresses a Cas nuclease gene, the sequence motif of exogenous DNA or RNA, acquired during previous encounters between bacteria and phages, plasmids or mobile genetic elements, which encodes non-coding rcRNA, and a sequence expressing transactivating rcRNA (trcRNA).The processed rcRNA and rctraRNA form a duplex guide RNA (gRNA) that guides Cas nuclease to a target DNA sequence for double-strand cleavage. DNA cleavage is restricted by an adjacent DNA motif, called a protospacer adjacent motif (P AM), which is specific to each CRISPR-Cas system. This functional framework has since been diverted from its original function in prokaryotic immunity and is now applied in biotechnology for gene targeting, processing, modification, destruction, and programmed repair, hence the above term “transgene for gene editing.” To date, several Cas proteins (Cas9, Casl2a, Casl2b, CasX or Casl2e, Casl2f or Casl4, Casl2j or Cas®) from different hosts have been identified and characterized, or even modified (e.g. improvement of their function), which can be implemented by the invention, for the engineering of mammalian genomes.Generally, the Cas proteins mentioned above have decreasing sizes of 1,500 amino acids (AA) for Cas9, 1,000 AA for Casl2a and less than 1,000 AA for CasX, Casl2f and Casl2j.

[0082] It is therefore understood that according to another embodiment, the subject of the invention is the expression cassette as described above, in which said transgene of interest is a transgene for gene editing which is chosen from:

[0083] - Cas9, Cas 12a, Cas 12b, CasX or Cas 12e, CRISPR type V, Cas 12j or Cas® nucleases;

[0084] - Cas9, Cas 12a, Cas 12b, CasX or Cas 12e, CRISPR type V, Cas 12j or Cas® orthologs; and - Cas9, Cas 12a, Cas 12b, CasX or Cas 12e, CRISPR type V, Cas 12j or Cas® mutants or functional variants.

[0085] The term "orthologs" refers to similar Cas proteins present in two or more different species. The term "mutants" refers to a Cas protein into which one or more mutations have been introduced, including the deletion, substitution, and / or addition of one or more amino acids. These mutations may, in particular, increase nuclease activity and / or increase the fidelity of target DNA recognition. The term "functional mutants" refers to Cas proteins modified by human intervention (e.g., by genetic engineering), e.g., to increase Cas activity. The term "functional variants" refers to Cas proteins naturally modified through evolution, which exhibit, e.g., increased activity.

[0086] Advantageously, the invention uses Cas9 nucleases such as those of S. pyogenes, S. aureus, C. diphtheriae, N. meningitidis, S. canis, S. macacae, F. tularensis, Acidaminococcus, C. jejuni, S. pneumoniae and S. thermophilus, the mutants thereof. According to another embodiment, the invention therefore relates to the expression cassette as described above, in which said transgene of interest is a transgene for gene editing which is chosen from:

[0087] - Cas9 nucleases from S. pyogenes, S. aureus, C. diphtheriae, N. meningitidis, S. canis, S. macacae, F. tularensis, Acidaminococcus, C. jejuni, S. pneumoniae and S. thermophilus; And

[0088] - Cas9 orthologs and Cas9 mutants or functional variants derived from these organisms.

[0089] In particular, the subject of the invention is the expression cassette as described above, in which said transgene of interest is a transgene for gene editing which is saCas9 whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 51 or whose nucleic acid encodes a saCas9 protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 52. In particular, the subject of the invention is also the expression cassette as described above, in which said transgene of interest is a transgene for gene editing which is saCas9 whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 51 or whose nucleic acid encodes a saCas9 protein whose amino acid sequence corresponds to the sequence SEQ ID NO: 52.

[0090] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 54 to 296. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence chosen from the sequences SEQ ID NOs: 54 to 296.In other words, the subject of the invention is the expression cassette as described above, said expression cassette comprising the nucleic acid sequence of sequence SEQ ID NO: 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131,.

[0091] 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150,

[0092] 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169,

[0093] 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207,

[0094] 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226,

[0095] 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245,

[0096] 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264,

[0097] 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295 or 296 (Table 2).

[0098] Table 2. List of 5'UTR-Transgene sequences of interest

[0099] In each box the 5'UTR is followed by the name of the gene from which it comes.

[0100] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of ATF4 (SEQ ID NO: 1) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 54, 81, 108, 135, 162, 189, 216, 243 and 270. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of ATF4 (SEQ ID NO: 1) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 54, 81, 108, 135, 162, 189, 216, 243 and 270.According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of AASS (SEQ ID NO: 2) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 55, 82, 109, 136, 163, 190, 217, 244 and 271. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of AASS (SEQ ID NO: 2) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 55, 82, 109, 136, 163, 190, 217, 244 and 271.

[0101] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of ATF5 (SEQ ID NO: 3) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 56, 83, 110, 137, 164, 191, 218, 245 and 272. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of ATF5 (SEQ ID NO: 3) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 56, 83, 110, 137, 164, 191, 218, 245 and 272.

[0102] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of AZIN1 (SEQ ID NO: 4) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 57, 84, 111, 138, 165, 192, 219, 246 and

[0103] 273. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of AZIN1 (SEQ ID NO: 4) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 57, 84, 111, 138, 165, 192, 219, 246 and 273.

[0104] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of BACE1 (SEQ ID NO: 5) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 58, 85, 112, 139, 166, 193, 220, 247 and

[0105] 274. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of BACE1 (SEQ ID NO: 5) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 58, 85, 112, 139, 166, 193, 220, 247 and 274.

[0106] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of CAT1 (SEQ ID NO: 6) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 59, 86, 113, 140, 167, 194, 221, 248 and

[0107] 275. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of CAT1 (SEQ ID NO: 6) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 59, 86, 113, 140, 167, 194, 221, 248 and 275.

[0108] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of C / EBPa (SEQ ID NO: 7) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 60, 87, 114, 141, 168, 195, 222, 249 and

[0109] 276. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of C / EBPa (SEQ ID NO: 7) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 60, 87, 114, 141, 168, 195, 222, 249 and 276.

[0110] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of CHOP (SEQ ID NO: 8) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 61, 88, 115, 142, 169, 196, 223, 250 and

[0111] 277. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of CHOP (SEQ ID NO: 8) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 61, 88, 115, 142, 169, 196, 223, 250 and 277.

[0112] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of CITED2 (SEQ ID NO: 9) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 62, 89, 116, 143, 170, 197, 224, 251 and

[0113] 278. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of CITED2 (SEQ ID NO: 9) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 62, 89, 116, 143, 170, 197, 224, 251 and 278.

[0114] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of CDK16 (SEQ ID NO: 10) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 63, 90, 117, 144, 171, 198, 225, 252 and

[0115] 279. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of CDK16 (SEQ ID NO: 10) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 63, 90, 117, 144, 171, 198, 225, 252 and 279.

[0116] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of CPT1C (SEQ ID NO: 11) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 64, 91, 118, 145, 172, 199, 226, 253 and

[0117] 280. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of CPT1C (SEQ ID NO: 11) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 64, 91, 118, 145, 172, 199, 226, 253 and 280.

[0118] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of DEDD2 (SEQ ID NO: 12) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 65, 92, 119, 146, 173, 200, 227, 254 and

[0119] 281. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of DEDD2 (SEQ ID NO: 12) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 65, 92, 119, 146, 173, 200, 227, 254 and 281.

[0120] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of DIAPH1 (SEQ ID NO: 13) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 66, 93, 120, 147, 174, 201, 228, 255 and

[0121] 282. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of DIAP (SEQ ID NO: 13) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 66, 93, 120, 147, 174, 201, 228, 255 and 282.

[0122] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of GADD34 (SEQ ID NO: 14) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 67, 94, 121, 148, 175, 202, 229, 256 and

[0123] 283. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of GADD34 (SEQ ID NO: 14) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 67, 94, 121, 148, 175, 202, 229, 256 and 283.

[0124] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of HOXB2 (SEQ ID NO: 15) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 68, 95, 122, 149, 176, 203, 230, 257 and

[0125] 284. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of HOXB2 (SEQ ID NO: 15) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 68, 95, 122, 149, 176, 203, 230, 257 and 284.

[0126] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of IFDR1 (SEQ ID NO: 16) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 69, 96, 123, 150, 177, 204, 231, 258 and 285. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of IFDR1 (SEQ ID NO: 16) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 69, 96, 123, 150, 177, 204, 231, 258 and 285.

[0127] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of JUN (SEQ ID NO: 17) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 70, 97, 124, 151, 178, 205, 232, 259 and

[0128] 286. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of JUN (SEQ ID NO: 17) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 70, 97, 124, 151, 178, 205, 232, 259 and 286.

[0129] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of MIEF1 (SEQ ID NO: 18) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 71, 98, 125, 152, 179, 206, 233, 260 and

[0130] 287. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of MIEF1 (SEQ ID NO: 18) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 71, 98, 125, 152, 179, 206, 233, 260 and 287.

[0131] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of NDST1 (SEQ ID NO: 19) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 72, 99, 126, 153, 180, 207, 234, 261 and

[0132] 288. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of NDST1 (SEQ ID NO: 19) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 72, 99, 126, 153, 180, 207, 234, 261 and 288.

[0133] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of PCNXL4 (SEQ ID NO: 20) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 73, 100, 127, 154, 181, 208, 235, 262 and

[0134] 289. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of PCNXL4 (SEQ ID NO: 20) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 73, 100, 127, 154, 181, 208, 235, 262 and 289.

[0135] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of PPP1R15B (SEQ ID NO: 21) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 74, 101, 128, 155, 182, 209, 236, 263 and

[0136] 290. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of PPP1R15B (SEQ ID NO: 21) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 74, 101, 128, 155, 182, 209, 236, 263 and 290.

[0137] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of PTP4A1 (SEQ ID NO: 22) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 75, 102, 129, 156, 183, 210, 237, 264 and

[0138] 291. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of PTP4A1 (SEQ ID NO: 22) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 75, 102, 129, 156, 183, 210, 237, 264 and 291.

[0139] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of SELK (SEQ ID NO: 23) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 76, 103, 130, 157, 184, 211, 238, 265 and

[0140] 292. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of SELK (SEQ ID NO: 23) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 76, 103, 130, 157, 184, 211, 238, 265 and 292.

[0141] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of TIE2 (SEQ ID NO: 24) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 77, 104, 131, 158, 185, 212, 239, 266 and

[0142] 293. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of TIE2 (SEQ ID NO: 24) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 77, 104, 131, 158, 185, 212, 239, 266 and 293.

[0143] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of TRB3 (SEQ ID NO: 25) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 78, 105, 132, 159, 186, 213, 240, 267 and

[0144] 294. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of TRB3 (SEQ ID NO: 25) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 78, 105, 132, 159, 186, 213, 240, 267 and 294.

[0145] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of UCP2 (SEQ ID NO: 26) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 79, 106, 133, 160, 187, 214, 241, 268 and

[0146] 295. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of UCP2 (SEQ ID NO: 26) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 79, 106, 133, 160, 187, 214, 241, 268 and 295.

[0147] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of VEGFa (SEQ ID NO: 27) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 80, 107, 134, 161, 188, 215, 242, 269 and

[0148] 296. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of VEGFa (SEQ ID NO: 27) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 80, 107, 134, 161, 188, 215, 242, 269 and 296.

[0149] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 540 to 2213. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence chosen from the sequences SEQ ID NOs: 540 to 2213 (Table 3).

[0150]

[0151]

[0152]

[0153]

[0154]

[0155]

[0156]

[0157] Table 3. Sequence list of expression cassettes Since the doubly regulatable expression cassette of the invention can be introduced into a eukaryotic cell by transfection of a DNA fragment or a plasmid, or by transduction using a viral vector, in particular a lentiviral vector, or by a vector derived from adenovirus or adenovirus-associated virus (AAV), it should be noted that another aspect of the invention relates to a vector genome comprising a viral genome (e.g. lentiviral vector, or a vector derived from adenovirus or adenovirus-associated virus (AAV)) into which the expression cassette as described above has been introduced.

[0158] The expression “vector genome” designates a nucleic acid sequence comprising both:

[0159] ■ the nucleic acid comprising the genetic information (= viral genome) necessary for the production of a viral vector also called viral particle, said viral vector or said viral particle comprising said vector genome and being effective for entering the cell and being non-replicative; and

[0160] ■ the nucleic acid comprising the genetic information of the expression cassette as described above.

[0161] Advantageously, the viral genome used is that of a lentiviral genome. That is to say, a nucleic acid carrying the genetic information necessary for the production of a lentiviral vector, also called a (lenti-)viral particle, said lentiviral vector or said (lenti-)viral particle comprising said encapsidated and enveloped vector genome. This lentiviral vector is also efficient for entering the cell, it is non-replicative, and it leads to the integration (targeted or not) of said vector genome into the genome of an infected cell. In certain cases, the lentiviral particle will contain a mutant integrase (D64V), which will result in a non-integrating provirus (post-reverse transcription vector DNA) in the genome of the transduced cell. Consequently, the genome of this vector will be in the form of an episome in the cell nucleus.Classically, the structure of this lentiviral genome after reverse transcription includes: The cis sequences of the HIV lentiviral genome, i.e. two Long Terminal Repeats (LTR) flanking the ends of the vector genome with the U3, R and U5 regions but where the U3 region is mutant (AU3), lacking its enhancer sequence and therefore without promoter activity. Lentiviral vectors with AU3 in the LTR are called "self-inactivating" since they cannot be transcribed by a wild-type HIV virus. The 5' LTR of the genome is followed by a "psi" sequence for the encapsidation of the vector RNA genome, a Rev Responsive element (RRE) sequence for the export of the vector RNA genome, the Central Polypurine Tract "cppt" and Central Termination Sequence "cts" sequences, for the formation of the central DNA triplex during reverse transcription and a 3' LTR.In addition to the cis sequences of the virus, these vectors contain the expression cassette as described above, placed between the two LTRs, which may comprise at its 3' end a nucleic acid sequence allowing the transcription of a polyA tail. According to another embodiment, the invention therefore relates to the vector genome as described above comprising a lentiviral genome into which an expression cassette as described above has been introduced.

[0162] According to another embodiment, the subject of the invention is the vector genome as described above, in which said lentiviral genome into which said expression cassette as described above has been introduced is a Self-inactivating Lentivirus (SIN) or a Respiratory syncytial virus (RSV).

[0163] According to another embodiment, the subject of the invention is the vector genome as described above, in which said lentiviral genome into which said expression cassette as described above has been introduced is a Self-inactivating Lentivirus (SIN). In particular, the subject of the invention is the vector genome as described above, in which said lentiviral genome into which said expression cassette as described above has been introduced is a Self-inactivating Lentivirus (SIN) whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 3888. In particular, the subject of the invention is also the vector genome as described above, in which said lentiviral genome into which said expression cassette as described above has been introduced is a Self-inactivating Lentivirus (SIN) whose nucleic acid has a sequence corresponding to the nucleic acid of sequence SEQ ID NO: 3888.Note that the insertion of said expression cassette as described above into said Self-inactivating Lentivirus (SIN) of sequence SEQ ID NO: 3888 can be or is carried out at nucleotides 2229 and 2230 of this SEQ ID NO: 3888. That is to say that said expression cassette as described above is located in this case between the sequences SEQ ID NOs: 3889 and 3890.

[0164] According to another embodiment, the subject of the invention is the vector genome as described above, in which said lentiviral genome into which said expression cassette as described above has been introduced is a Respiratory syncytial virus (RSV). In particular, the subject of the invention is the vector genome as described above, in which said lentiviral genome into which said expression cassette as described above has been introduced is a Respiratory syncytial virus (RSV) whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 3891. In particular, the subject of the invention is also the vector genome as described above, in which said lentiviral genome into which said expression cassette as described above has been introduced is a Respiratory syncytial virus (RSV) whose nucleic acid has a sequence corresponding to the nucleic acid of sequence SEQ ID NO: 3891.Note that the insertion of said expression cassette as described above into said Respiratory syncytial virus (RSV) of sequence SEQ ID NO: 3891 can be or is carried out at nucleotides 1737 and 1738 of this SEQ ID NO: 3891. That is to say that said expression cassette as described above is located in this case between the sequences SEQ ID NOs: 3892 and 3893.

[0165] According to another embodiment, the subject of the invention is the vector genome as described above, in which: ■ said lentiviral genome is chosen from the sequences having at least 80% identity with the sequences SEQ ID NOs: 3,888 and 3,891; and

[0166] ■ said expression cassette introduced into said lentiviral genome is chosen from sequences having at least 80% identity with the sequences SEQ ID NOs: 540 to 2213.

[0167] In particular, the subject of the invention is the vector genome as described above, in which:

[0168] ■ said lentiviral genome is chosen from the sequences having at least 80% identity with the sequences SEQ ID NOs: 3,888 and 3,891; and

[0169] ■ said expression cassette introduced into said lentiviral genome is chosen from the sequences SEQ ID NOs: 540 to 2213.

[0170] In particular, the invention also relates to the vector genome as described above, in which:

[0171] ■ said lentiviral genome is chosen from the sequences SEQ ID NOs: 3,888 and 3,891; and

[0172] ■ said expression cassette introduced into said lentiviral genome (respectively between nucleotides 2,229 and 2,230, and nucleotides 1,737 and 1,738, of the sequences SEQ ID NOs: 3,888 and 3,891) is chosen from the sequences SEQ ID NOs: 540 to 2,213.

[0173] In view of the above, it is understood that the invention implements in particular a vector genome as described above which is an artificial construction made from a first brick corresponding to said lentiviral genome, into which has been introduced an expression cassette comprising at least 3 other bricks, namely: an inducible promoter (brick 2), a coding or non-coding sequence having regulatory properties at the post-transcriptional level (brick 3 - abbreviated 5'UTR) and a transgene (toxic or suicide, or therapeutic, or for gene editing - brick 4). The invention therefore makes available, for example, to the medical profession, at least 4 bricks from which to reconstitute a vector genome according to the invention, among all the possible combinations (Table 4).

[0174] Table 4. Bricks of invention

[0175] The name of the original gene of the invention corresponds to the concatenation of the names of this brique. C'est-à-dire un génome vecteur choisi parmi : LV G2(SIN)-2XAARE YB - TATA - 5'UTR ATF4-iC9, LV G2(SIN)-2XAARE YB TATA -5'UTR AASS-iC9, LV G2(SIN)- 2XAARE YB TATA -5'UTR ATF5-iC9, ..., LV G3(RSV)-miniCHACl YB TATA -5'UTR TRB3- saCas9, LV G3(RSV)-miniCHACl YB TATA -5'UTR UCP2-saCas9, LV G3(RSV)- miniCHACl YB TATA -5'UTR VEGFa-saCas9, LV G2(SIN)-2XAARE YB TATA -5'UTR ATF4- Cas9, LV G2(SIN)-2XAARE YB TATA -5'UTR AASS-Cas9, LV G2(SIN)-2xAARE YB TATA - 5'UTR ATF5-Cas9, ..., LV G3(RSV)-miniCHACl YB TATA -5'UTR TRB3-CasO, LV G3(RSV)- miniCHACl YB TATA -5'UTR UCP2-Cas and LV G3(RSV)-miniCHACl YB TATA -5'UTR VEGFa-CasO.

[0176] For example and in detail, when it comes to the LV G2(SIN)-2XAARE vector genome YB - TATA -5'UTR ATF4-iC9. This vector genome is constructed on the basis of a G2(SIN) lentiviral genome whose sequence has at least 80% identity with the sequence SEQ ID NO: 3888, into which a 2XAARE expression cassette has been introduced between nucleotides 2229 and 2230 YB TATA -5'UTR ATF4-iC9 having at least 80% identity with the sequence SEQ ID NO: 540, which comprises from the 5' end to the 3' end:

[0177] ■ an inducible 2XAARE promoter YB TATA having at least 80% identity with the sequence SEQ ID NO: 28;

[0178] ■ a coding or non-coding sequence having regulatory properties at the post-transcriptional level having at least 80% identity with the sequence SEQ ID NO: 1 (5'UTR of ATF4); and

[0179] ■ a toxic or suicide transgene, which is an inducible Caspase-9 (iC9) protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 35 or whose nucleic acid encodes an inducible Caspase-9 (iC9) protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 36.

[0180] This is the case for all the vector genomes described above. According to another embodiment, the subject of the invention is the vector genome as described above, in which said vector genome comprises a coding or non-coding sequence having regulatory properties at the / w.s7-transcriptional level having at least 80% identity with the sequence SEQ ID NO: 1 (5'UTR of ATF4) and is chosen from the sequences having at least 80% identity with the sequences SEQ ID NOs: 3,894 to 4,017. In particular, the subject of the invention is the vector genome as described above, in which said vector genome comprises a coding or non-coding sequence having regulatory properties at the / ?<95t-transcriptional level of sequence SEQ ID NO: 1 (5'UTR of ATF4) and is chosen from the sequences SEQ ID NOs: 3,894 to 4,017 (Table 5).

[0181] Table 5. List of vector genomes

[0182] Interestingly, it should be noted that to facilitate the production of said vector genome as described above and to add safety, the 5' to 3' (5' > 3') orientation of the transcription of said expression cassette as described above is reversed with respect to the 5' to 3' orientation of the transcription of said viral (in particular lentiviral) genome. Also, according to another embodiment, the subject of the invention is the vector genome as described above comprising a viral (in particular lentiviral) genome into which an expression cassette as described above has been introduced, in particular in which the 5' to 3' orientation of the transcription of said expression cassette as described above is reversed with respect to the 5' to 3' orientation of the transcription of said viral (in particular lentiviral) genome.

[0183] Advantageously, the subject of the invention is the vector genome as described above comprising a viral genome (in particular lentiviral) into which an expression cassette as described above has been introduced, and in which the 5' to 3' orientation of the transcription of said expression cassette as described above is reversed with respect to the 5' to 3' orientation of the transcription of said viral genome (in particular lentiviral).

[0184] When this embodiment is implemented, the vector genome as described above, comprises in particular at the 3' end of said transgene of interest a polyA sequence (eg SEQ ID NO: 53). Indeed, the 5' to 3' orientation of the transcription of said expression cassette as described above being inverted with respect to the 5' to 3' orientation of the transcription of said viral genome (in particular lentiviral), the addition of this polyA sequence (eg SEQ ID NO: 53) to the 3' end of the nucleic acid coding for said transgene of interest makes it possible to promote, after (and only after) induction of said inducible promoter, the transcription and stability of an mRNA, which authorizes the translation of said transgene of interest when the inhibition of translation by said coding or non-coding sequence having regulatory properties at the / w.s7-transcriptional level is lifted.

[0185] According to another embodiment, the subject of the invention is therefore the expression cassette as described above, said expression cassette further comprising a polyA tail (eg SEQ ID NO: 53) at the 3' end of said transgene of interest. According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 297 to 539. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence chosen from the sequences SEQ ID NOs: 297 to 539.In other words, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence of sequence SEQ ID NO: 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331.

[0186] 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350,

[0187] 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369,

[0188] 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, ​​383, 384, 385, 386, 387, 388,

[0189] 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407,

[0190] 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426,

[0191] 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445,

[0192] 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464,

[0193] 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483,

[0194] 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502,

[0195] 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521,

[0196] 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538 or 539 (Table 6).

[0197]

[0198] Table 6. List of 5'UTR-Transgene of Interest-PolyA Tail Sequences

[0199] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of ATF4 (SEQ ID NO: 1) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 297, 324, 351, 378, 405, 432, 459, 486 and 513. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of ATF4 (SEQ ID NO: 1) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 297, 324, 351, 378, 405, 432, 459, 486 and 513.

[0200] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of AASS (SEQ ID NO: 2) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 298, 325, 352, 379, 406, 433, 460, 487 and 514. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of AASS (SEQ ID NO: 2) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 298, 325, 352, 379, 406, 433, 460, 487 and 514.

[0201] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of ATF5 (SEQ ID NO: 3) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 299, 326, 353, 380, 407, 434, 461, 488 and 515. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of ATF5 (SEQ ID NO: 3) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 299, 326, 353, 380, 407, 434, 461, 488 and 515.

[0202] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of AZIN1 (SEQ ID NO: 4) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 300, 327, 354, 381, 408, 435, 462, 489 and

[0203] 516. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of AZIN (SEQ ID NO: 4) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 300, 327, 354, 381, 408, 435, 462, 489 and 516.

[0204] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of BACE1 (SEQ ID NO: 5) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 301, 328, 355, 382, ​​409, 436, 463, 490 and

[0205] 517. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of BACE (SEQ ID NO: 5) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 301, 328, 355, 382, ​​409, 436, 463, 490 and 517.

[0206] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of CAT1 (SLC7A1) (SEQ ID NO: 6) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 302, 329, 356, 383, 410, 437, 464, 491 and 518. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of CAT1 (SEQ ID NO: 6) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 302, 329, 356, 383, 410, 437, 464, 491 and 518.

[0207] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of C / EBPa (SEQ ID NO: 7) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 303, 330, 357, 384, 411, 438, 465, 492 and

[0208] 519. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of C / EB (SEQ ID NO: 7) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 303, 330, 357, 384, 411, 438, 465, 492 and 519.

[0209] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of CHOP (SEQ ID NO: 8) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 304, 331, 358, 385, 412, 439, 466, 493 and

[0210] 520. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of CHOP (SEQ ID NO: 8) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 304, 331, 358, 385, 412, 439, 466, 493 and 520.

[0211] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of CITED2 (SEQ ID NO: 9) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 305, 332, 359, 386, 413, 440, 467, 494 and

[0212] 521. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of CITE (SEQ ID NO: 9) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 305, 332, 359, 386, 413, 440, 467, 494 and 521.

[0213] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of CDK16 (SEQ ID NO: 10) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 306, 333, 360, 387, 414, 441, 468, 495 and

[0214] 522. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of CDK1 (SEQ ID NO: 10) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 306, 333, 360, 387, 414, 441, 468, 495 and 522.

[0215] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of CPT1C (SEQ ID NO: 11) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 307, 334, 361, 388, 415, 442, 469, 496 and

[0216] 523. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of CPT1 (SEQ ID NO: 11) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 307, 334, 361, 388, 415, 442, 469, 496 and 523.

[0217] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of DEDD2 (SEQ ID NO: 12) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 308, 335, 362, 389, 416, 443, 470, 497 and

[0218] 524. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of DEDD (SEQ ID NO: 12) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 308, 335, 362, 389, 416, 443, 470, 497 and 524.

[0219] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of DIAPH1 (SEQ ID NO: 13) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 309, 336, 363, 390, 417, 444, 471, 498 and

[0220] 525. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of DIAP (SEQ ID NO: 13) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 309, 336, 363, 390, 417, 444, 471, 498 and 525. According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of GADD34 (SEQ ID NO: 14) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 310, 337, 364, 391, 418, 445, 472, 499 and

[0221] 526. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of GADD (SEQ ID NO: 14) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 310, 337, 364, 391, 418, 445, 472, 499 and 526.

[0222] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of HOXB2 (SEQ ID NO: 15) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 311, 338, 365, 392, 419, 446, 473, 500 and

[0223] 527. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of HOXB (SEQ ID NO: 15) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 311, 338, 365, 392, 419, 446, 473, 500 and 527.

[0224] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of IFDR1 (SEQ ID NO: 16) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 312, 339, 366, 393, 420, 447, 474, 501 and

[0225] 528. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of IFDR (SEQ ID NO: 16) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 312, 339, 366, 393, 420, 447, 474, 501 and 528.

[0226] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of JUN (SEQ ID NO: 17) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 313, 340, 367, 394, 421, 448, 475, 502 and

[0227] 529. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of JUN- (SEQ ID NO: 17) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 313, 340, 367, 394, 421, 448, 475, 502 and 529.

[0228] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of MIEF1 (SEQ ID NO: 18) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 314, 341, 368, 395, 422, 449, 476, 503 and

[0229] 530. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of MIEF (SEQ ID NO: 18) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 314, 341, 368, 395, 422, 449, 476, 503 and 530.

[0230] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of NDST1 (SEQ ID NO: 19) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 315, 342, 369, 396, 423, 450, 477, 504 and

[0231] 531. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of ndst (SEQ ID NO: 19) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 315, 342, 369, 396, 423, 450, 477, 504 and 531.

[0232] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of PCNXL4 (SEQ ID NO: 20) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 316, 343, 370, 397, 424, 451, 478, 505 and

[0233] 532. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of PCNX (SEQ ID NO: 20) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 316, 343, 370, 397, 424, 451, 478, 505 and 532.

[0234] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of PPP1R15B (SEQ ID NO: 21) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 317, 344, 371, 398, 425, 452, 479, 506 and

[0235] 533. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of PPP1 (SEQ ID NO: 21) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 317, 344, 371, 398, 425, 452, 479, 506 and 533.

[0236] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of PTP4A1 (SEQ ID NO: 22) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 318, 345, 372, 399, 426, 453, 480, 507 and

[0237] 534. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of PTP4 (SEQ ID NO: 22) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 318, 345, 372, 399, 426, 453, 480, 507 and 534.

[0238] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of SELK (SEQ ID NO: 23) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 319, 346, 373, 400, 427, 454, 481, 508 and

[0239] 535. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of SELK (SEQ ID NO: 23) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 319, 346, 373, 400, 427, 454, 481, 508 and 535.

[0240] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of TIE2 (SEQ ID NO: 24) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 320, 347, 374, 401, 428, 455, 482, 509 and

[0241] 536. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of TIE2 (SEQ ID NO: 24) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 320, 347, 374, 401, 428, 455, 482, 509 and 536.

[0242] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of TRB3 (SEQ ID NO: 25) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 321, 348, 375, 402, 429, 456, 483, 510 and

[0243] 537. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of TRB3 (SEQ ID NO: 25) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 321, 348, 375, 402, 429, 456, 483, 510 and 537.

[0244] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of UCP2 (SEQ ID NO: 26) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 322, 349, 376, 403, 430, 457, 484, 511 and

[0245] 538. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of UCP2 (SEQ ID NO: 26) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 322, 349, 376, 403, 430, 457, 484, 511 and 538.

[0246] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of VEGFa (SEQ ID NO: 27) and being at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 323, 350, 377, 404, 431, 458, 485, 512 and

[0247] 539. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence comprising the 5'UTR of VEGF (SEQ ID NO: 27) and corresponding to a sequence chosen from the sequences SEQ ID NOs: 323, 350, 377, 404, 431, 458, 485, 512 and 539.

[0248] According to another embodiment, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence at least 80% identical to a sequence chosen from the sequences SEQ ID NOs: 2,214 to 3,887. In particular, the subject of the invention is the expression cassette as described above, said expression cassette comprising a nucleic acid sequence chosen from the sequences SEQ ID NOs: 2,214 to 3,887 (Table 7).

[0249]

[0250]

[0251]

[0252]

[0253]

[0254]

[0255]

[0256]

[0257] Table 7. List of expression cassette sequences including a polyA tail

[0258] According to another embodiment, the subject of the invention is the vector genome as described above, in which:

[0259] ■ said lentiviral genome is chosen from the sequences having at least 80% identity with the sequences SEQ ID NOs: 3,888 and 3,891; and

[0260] ■ said expression cassette introduced into said lentiviral genome is chosen from the sequences having at least 80% identity with the sequences SEQ ID NOs: 2,214 to 3,887, the 5' to 3' orientation of the transcription of said expression cassette being inverted with respect to the 5' to 3' orientation of the transcription of said lentiviral genome. In particular, the subject of the invention is the vector genome as described above, in which:

[0261] ■ said lentiviral genome is chosen from the sequences having at least 80% identity with the sequences SEQ ID NOs: 3,888 and 3,891; and

[0262] ■ said expression cassette introduced into said lentiviral genome is chosen from the sequences SEQ ID NOs: 2,214 to 3,887, the 5' to 3' orientation of the transcription of said expression cassette being inverted with respect to the 5' to 3' orientation of the transcription of said lentiviral genome.

[0263] In particular, the invention also relates to the vector genome as described above, in which:

[0264] ■ said lentiviral genome is chosen from the sequences SEQ ID NOs: 3888 and 3891; and ■ said expression cassette introduced into said lentiviral genome (respectively between nucleotides 2229 and 2230, and nucleotides 1737 and 1738, of the sequences SEQ ID NOs: 3888 and 3891) is chosen from the sequences SEQ ID NOs: 2214 to 3887, the 5' to 3' orientation of the transcription of said expression cassette being inverted with respect to the 5' to 3' orientation of the transcription of said lentiviral genome.

[0265] In view of the above, it is understood that the invention implements in particular a vector genome as described above which is an artificial construction made from a first brick corresponding to said lentiviral genome, into which has been introduced and inverted an expression cassette comprising at least 4 other bricks, namely: an inducible promoter (brick 2), a coding or non-coding sequence having regulatory properties at the / w.s7-transcriptional level (brick 3 - abbreviated 5'UTR), a transgene (toxic or suicide, or therapeutic, or for gene editing - brick 4), and a polyA tail (brick 5). The invention therefore makes available, for example, to the medical profession, at least 5 bricks from which to reconstitute a vector genome according to the invention, among all the possible combinations (Table 8).

[0266] Table 8. Bricks of invention

[0267] The name of the “inverted” vector genome of the invention then corresponds to the concatenation of the names of each brick, the suffix “i” being added to “LV” to indicate the inversion of the expression cassette. That is to say a vector genome chosen from: LVi G2(SIN)- 2XAARE YB TATA -5'UTR ATF4-iC9-polyA sV40, LVi G2(SIN)-2XAARE YB TATA -5'UTR AASS-iC9-polyA sV40, LVi G2(SIN)-2XAARE YB - TATA -5'UTR ATF5-iC9-polyA sV40, LVi G3(RSV)-miniCHACl YB TATA -5'UTR TRB3-saCas9-polyA sv40, LVi G3(RSV)- miniCHACl YB - TATA -5'UTR UCP2-saCas9-polyA sv40, LVi G3(RSV)-miniCHACl YB - TATA - 5'UTR VEGFa-saCas9-polyA sv40, LVi G2(SIN)-2XAARE YB - TATA -5'UTR ATF4-Cas9-polyA sV40, LVi G2(SIN)-2XAARE YB TATA -5'UTR AASS-Cas9-polyA sV40, LVi G2(SIN)- 2XAARE YB - TATA -5'UTR ATF5-Cas9-polyA sV40, LVi G3(RSV)-miniCHACl YB - TATA - 5'UTR TRB3-CasO-polyA sv40, LVi G3(RSV)-miniCHACl YB TATA -5'UTR UCP2-CasO- polyA sv40 and LVi G3(RSV)-miniCHACl YB - TATA -5'UTR VEGFa-CasO-polyA sv40.

[0268] For example and in detail, when it comes to the LVi G2(SIN)-2XAARE vector genome YB - TATA -5'UTR ATF4-iC9-polyA sV40. This vector genome is constructed on the basis of a G2(SIN) lentiviral genome whose sequence has at least 80% identity with the sequence SEQ ID NO: 3888, into which a 2XAARE expression cassette has been introduced and inverted between nucleotides 2229 and 2230 YB - TATA -5'UTR ATF4-iC9-polyA sV40 having at least 80% identity with the sequence SEQ ID NO: 2214, which comprises from the 5' end to the 3' end:

[0269] ■ an inducible 2XAARE promoter YB TATA having at least 80% identity with the sequence SEQ ID NO: 28;

[0270] ■ a coding or non-coding sequence having regulatory properties at the post-transcriptional level having at least 80% identity with the sequence SEQ ID NO: 1 (5'UTR of ATF4);

[0271] ■ a toxic or suicide transgene, which is an inducible Caspase-9 (iC9) protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 35 or whose nucleic acid encodes an inducible Caspase-9 (iC9) protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 36; and

[0272] ■ a polyA tail having at least 80% identity with the sequence SEQ ID NO: 53.

[0273] This is the case for all of the "inverted" vector genomes described above. It should also be noted that due to the inversion of the expression cassette as described above with respect to the orientation of the transcription of the vector genome as described above, all of the sequences provided relating to said expression cassette as described above are found on the complementary strand of said vector genome as described above, of which only the sense sequences (5' > 3') are provided.According to another embodiment, the subject of the invention is the vector genome as described above, in which said vector genome comprises an expression cassette as described above, the 5' to 3' orientation of the transcription of which is reversed with respect to the 5' to 3' orientation of the transcription of said lentiviral genome, said expression cassette as described above comprising a coding or non-coding sequence having regulatory properties at the / w.s7-transcriptional level having at least 80% identity with the sequence SEQ ID NO: 1 (5'UTR of ATF4), and in which said vector genome is chosen from the sequences having at least 80% identity with the sequences SEQ ID NOs: 4018 to 4141.

[0274] In particular, the subject of the invention is the vector genome as described above, in which said vector genome comprises an expression cassette as described above, the 5' to 3' orientation of transcription of which is reversed with respect to the 5' to 3' orientation of transcription of said lentiviral genome, said expression cassette as described above comprising a coding or non-coding sequence having regulatory properties at the / ?<95t-transcriptional level of sequence SEQ ID NO: 1 (5'UTR of ATF4), and in which said vector genome is chosen from the sequences SEQ ID NOs: 4,018 to 4,141 (Table 9).

[0275] Table 9. List of reverse vector genomes

[0276] As indicated above, the doubly regulatable expression cassette of the invention can be introduced into a eukaryotic cell by transfection of a DNA fragment or a plasmid, or by transduction using a viral vector, in particular a lentiviral vector, or by a vector derived from adenovirus or adenovirus-associated virus (AAV). Also, another aspect of the invention relates to a plasmid comprising an expression cassette as described above, or a vector genome as described above and the means for expressing it.

[0277] The term "plasmid" designates a double-stranded circular DNA molecule, which necessarily has a bacterial origin of replication and, incidentally, the SV40 virus, so that it can replicate autonomously, e.g., in E. coli for its amplification and, e.g., in the HEK 293T cell after transfection, and a selection gene so that it is not lost during its bacterial amplification during cell multiplications. In the invention, this further comprises the nucleic acid of said expression cassette of the invention, the nucleic acid of said vector genome of the invention and the means for expressing it.

[0278] The expression “the means of expressing it” refers to the existence in the plasmid of the invention of the genetic elements necessary for the expression of the vector genome of the invention and the production of a viral vector (in particular lentiviral) according to the invention.

[0279] According to another embodiment, the subject of the invention is the plasmid as described above, said plasmid being a pLV-SIN plasmid or a pLV-RSV plasmid.

[0280] According to another embodiment, the subject of the invention is the plasmid as described above, said plasmid being a pLV-SIN plasmid. In particular, the subject of the invention is the plasmid as described above, said plasmid being a plasmid pLV-SIN whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 10 590. In particular, the subject of the invention is also the plasmid as described above, said plasmid being a plasmid pLV-SIN whose nucleic acid has a sequence corresponding to the nucleic acid of sequence SEQ ID NO: 4 142. Note that the insertion of said vector genome into said plasmid pLV-SIN of sequence SEQ ID NO: 4 142 can be or is carried out at nucleotides 4 939 and 4 940 of this SEQ ID NO: 4 142. That is to say that said vector genome is located in this case between the sequences SEQ ID NOs: 4 143 and 4 144.

[0281] According to another embodiment, the subject of the invention is the plasmid as described above, said plasmid being a pLV-RSV plasmid. In particular, the subject of the invention is the plasmid as described above, said plasmid being a pLV-RSV plasmid whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 10 593. In particular, the subject of the invention is also the plasmid as described above, said plasmid being a pLV-RSV plasmid whose nucleic acid has a sequence corresponding to the nucleic acid of sequence SEQ ID NO: 4 145. Note that the insertion of said vector genome into said pLV-RSV plasmid of sequence SEQ ID NO: 4 145 can be or is carried out at nucleotides 234 and 235 of this SEQ ID NO: 4 145. That is to say that said vector genome is located in this case between the sequences SEQ ID NOs: 4 146 and 4 147.

[0282] According to another embodiment, the subject of the invention is the plasmid as described above, in which the 5' to 3' orientation of the cryptic promoter of the bacterial origin of replication is reversed with respect to the 5' to 3' orientation of the transcription of said expression cassette as described above.

[0283] According to another embodiment, the invention relates to the plasmid as described above, in which:

[0284] ■ said plasmid is chosen from the sequences having at least 80% identity with the sequences SEQ ID NOs: 4142 and 4145;

[0285] ■ said lentiviral genome introduced into said plasmid is chosen from the sequences having at least 80% identity with the sequences SEQ ID NOs: 3,888 and 3,891; and ■ said expression cassette introduced into said lentiviral genome is chosen from the sequences having at least 80% identity with the sequences SEQ ID NOs: 540 to 2,213.

[0286] In particular, the subject of the invention is the plasmid as described above, in which:

[0287] ■ said plasmid is chosen from the sequences having at least 80% identity with the sequences SEQ ID NOs: 4142 and 4145;

[0288] ■ said lentiviral genome introduced into said plasmid is chosen from the sequences having at least 80% identity with the sequences SEQ ID NOs: 3,888 and 3,891; and

[0289] ■ said expression cassette introduced into said lentiviral genome is chosen from the sequences SEQ ID NOs: 540 to 2213.

[0290] In particular, the invention also relates to the plasmid as described above, in which:

[0291] ■ said plasmid is chosen from the sequences having at least 80% identity with the sequences SEQ ID NOs: 4142 and 4145;

[0292] ■ said lentiviral genome introduced into said plasmid is chosen from the sequences SEQ ID NOs: 3,888 and 3,891; and

[0293] ■ said expression cassette introduced into said lentiviral genome (respectively between nucleotides 2,229 and 2,230, and nucleotides 1,737 and 1,738, of the sequences SEQ ID NOs: 3,888 and 3,891) is chosen from the sequences SEQ ID NOs: 540 to 2,213.

[0294] Advantageously, the invention also relates to the plasmid as described above, in which:

[0295] ■ said plasmid is chosen from the sequences SEQ ID NOs: 4142 and 4145;

[0296] ■ said lentiviral genome introduced into said plasmid (respectively between nucleotides 4939 and 4940, and nucleotides 234 and 235, of the sequences SEQ ID NOs: 4142 and 4145) is chosen from the sequences SEQ ID NOs: 3888 and 3891; and

[0297] ■ said expression cassette introduced into said lentiviral genome (respectively between nucleotides 2,229 and 2,230, and nucleotides 1,737 and 1,738, of the sequences SEQ ID NOs: 3,888 and 3,891) is chosen from the sequences SEQ ID NOs: 540 to 2,213.

[0298] In view of the above, it is understood that the invention implements in particular a plasmid as described above comprising a vector genome as described above which is an artificial construction made from a first brick corresponding to said lentiviral genome, into which has been introduced an expression cassette comprising at least 3 other bricks, namely: an inducible promoter (brick 2), a coding or non-coding sequence having regulatory properties at the / w.s7-transcriptional level (brick 3 - abbreviated 5'UTR) and a transgene (toxic or suicide, or therapeutic, or for gene editing - brick 4). The invention therefore makes available, for example, to the medical profession, at least 4 bricks from which to reconstitute a plasmid according to the invention, among all the possible combinations (Table 4).

[0299] The name of the plasmid of the invention, the backbone of which is chosen from the sequences SEQ ID NOs: 4142 (empty pLV G2 (SIN)) and 4145 (empty pLV G 3 (RSV)) then corresponds to the concatenation of the names of each brick, the prefix “p” being added to “LV” to indicate that it is a plasmid. That is to say a vector genome chosen from: pLV G2(SIN)-

[0300] For example and in detail, when it comes to the plasmid pLV G2(SIN)-2XAARE YB TATA - 5'UTR ATF4-iC9. This plasmid is constructed on the basis of a plasmid pLV G2(SIN) whose sequence has at least 80% identity with the sequence SEQ ID NO: 4142, into which has been introduced, between nucleotides 4939 and 4940, a vector genome constructed on the basis of a lentiviral genome G2(SIN) whose sequence has at least 80% identity with the sequence SEQ ID NO: 3888, into which has been introduced, between nucleotides 2229 and 2230, a 2XAARE expression cassette YB TATA -5'UTR ATF4-iC9 having at least 80% identity with the sequence SEQ ID NO: 540, which comprises from the 5' end to the 3' end:

[0301] ■ an inducible 2XAARE promoter YB TATA having at least 80% identity with the sequence SEQ ID NO: 28;

[0302] ■ a coding or non-coding sequence having regulatory properties at the post-transcriptional level having at least 80% identity with the sequence SEQ ID NO: 1 (5'UTR of ATF4); and

[0303] ■ a toxic or suicide transgene, which is an inducible Caspase-9 (iC9) protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 35 or whose nucleic acid encodes an inducible Caspase-9 (iC9) protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 36.

[0304] This is the case for all the plasmids described above.

[0305] According to another embodiment, the subject of the invention is the plasmid as described above, said plasmid comprising:

[0306] ■ a vector genome as described above which comprises a coding or non-coding sequence having regulatory properties at the / w.s7-transcriptional level having at least 80% identity with the sequence SEQ ID NO: 1 (5'UTR of ATF4); and

[0307] ■ the means for expressing it, said plasmid being chosen from the sequences having at least 80% identity with the sequences SEQ ID NOs: 4,148 to 4,271. In particular, the subject of the invention is the plasmid as described above, said plasmid comprising: ■ a vector genome as described above which comprises a coding or non-coding sequence having regulatory properties at the transcriptional level of sequence SEQ ID NO: 1 (5'UTR of ATF4); and

[0308] ■ the means of expressing it, said plasmid being chosen from the sequences SEQ ID NOs: 4,148 to 4,271 (Table 10).

[0309] Table 10. List of plasmids comprising a vector genome

[0310] According to another embodiment, the invention relates to the plasmid as described above, in which:

[0311] ■ said plasmid is chosen from the sequences having at least 80% identity with the sequences SEQ ID NOs: 4142 and 4145;

[0312] ■ said lentiviral genome introduced into said plasmid is chosen from the sequences having at least 80% identity with the sequences SEQ ID NOs: 3,888 and 3,891; and

[0313] ■ said expression cassette introduced into said lentiviral genome is chosen from the sequences having at least 80% identity with the sequences SEQ ID NOs: 2,214 to 3,887, the 5' to 3' orientation of the transcription of said expression cassette being inverted with respect to the 5' to 3' orientation of the transcription of said lentiviral genome.

[0314] In particular, the subject of the invention is the plasmid as described above, in which:

[0315] ■ said plasmid is chosen from the sequences having at least 80% identity with the sequences SEQ ID NOs: 4142 and 4145;

[0316] ■ said lentiviral genome introduced into said plasmid is chosen from the sequences having at least 80% identity with the sequences SEQ ID NOs: 3,888 and 3,891; and

[0317] ■ said expression cassette introduced into said lentiviral genome is chosen from the sequences SEQ ID NOs: 2,214 to 3,887, the 5' to 3' orientation of the transcription of said expression cassette being inverted with respect to the 5' to 3' orientation of the transcription of said lentiviral genome.

[0318] In particular, the invention also relates to the plasmid as described above, in which:

[0319] ■ said plasmid is chosen from the sequences having at least 80% identity with the sequences SEQ ID NOs: 4,142 and 4,145; ■ said lentiviral genome introduced into said plasmid is chosen from the sequences SEQ ID NOs: 3,888 and 3,891; and

[0320] ■ said expression cassette introduced into said lentiviral genome (respectively between nucleotides 2229 and 2230, and nucleotides 1737 and 1738, of the sequences SEQ ID NOs: 3888 and 3891) is chosen from the sequences SEQ ID NOs: 2214 to 3887, the 5' to 3' orientation of the transcription of said expression cassette being inverted with respect to the 5' to 3' orientation of the transcription of said lentiviral genome.

[0321] Advantageously, the invention also relates to the plasmid as described above, in which:

[0322] ■ said plasmid is chosen from the sequences SEQ ID NOs: 4142 and 4145;

[0323] ■ said lentiviral genome introduced into said plasmid (respectively between nucleotides 4939 and 4940, and nucleotides 234 and 235, of the sequences SEQ ID NOs: 4142 and 4145) is chosen from the sequences SEQ ID NOs: 3888 and 3891; and

[0324] ■ said expression cassette introduced into said lentiviral genome (respectively between nucleotides 2229 and 2230, and nucleotides 1737 and 1738, of the sequences SEQ ID NOs: 3888 and 3891) is chosen from the sequences SEQ ID NOs: 2214 to 3887, the 5' to 3' orientation of the transcription of said expression cassette being inverted with respect to the 5' to 3' orientation of the transcription of said lentiviral genome.

[0325] In view of the above, it is understood that the invention implements in particular a plasmid as described above comprising a vector genome as described above which is an artificial construction made from a first brick corresponding to said lentiviral genome, into which has been introduced and inverted an expression cassette comprising at least 4 other bricks, namely: an inducible promoter (brick 2), a coding or non-coding sequence having regulatory properties at the / w.s7-transcriptional level (brick 3 - abbreviated 5'UTR), a transgene (toxic or suicide, or therapeutic, or for gene editing - brick 4) and a polyA tail (brick 5). The invention therefore makes available, for example, to the medical profession, at least 5 bricks from which to reconstitute a vector genome according to the invention, among all the possible combinations (Table 8).

[0326] The name of the “inverted” plasmid of the invention, the backbone of which is chosen from the sequences SEQ ID NOs: 4142 (empty pLV G2 (SIN)) and 4145 (empty pLV G3 (RSV)) then corresponds to the concatenation of the names of each brick, the prefix “p” being added to “LV” to indicate that it is a plasmid and the suffix “i” being added to “LV” to indicate the inversion of the expression cassette. That is to say a vector genome chosen from: pLVi G2(SIN)- 2XAARE YB - TATA -5'UTR ATF4-iC9-polyA sV40, pLVi G2(SIN)-2XAARE YB - TATA -5'UTR AASS-iC9-polyA sV40, pLVi G2(SIN)-2XAARE YB - TATA -5'UTR ATF5-iC9-polyA sV40, ..., pLVi G3(RSV)-miniCHACl YB - TATA -5'UTR TIE2-saCas9-polyA sv40, pLVi G3(RSV)- miniCHACl YB - TATA -5'UTR TRB3-saCas9-polyA sv40, pLVi G3(RSV)-miniCHACl YB - TATA - 5'UTR UCP2-saCas9-polyA sv40, pLVi G3(RSV)-miniCHACl YB TATA -5'UTR VEGFa- saCas9-polyA sv40, pLVi G2(SIN)-2XAARE YB - TATA -5'UTR ATF4-Cas9-polyA sV40, pLVi G2(SIN)-2XAARE YB - TATA -5'UTR AASS-Cas9-polyA sV40, pLVi G2(SIN)-2XAARE YB - TATA - I ll

[0327] 5'UTR ATF5-Cas9-polyA sV40, ..., pLVi G3(RSV)-miniCHACl YB TATA -5'UTR TRB3-CasO- polyA sv40, pLVi G3(RSV)-miniCHACl YB - TATA -5'UTR UCP2-CasO-polyA sv40 and pLVi G3(RSV)-miniCHACl YB TATA -5'UTR VEGFa-CasO-polyA sv40.

[0328] In this way, it is possible, for example, to implement the plasmid pLVi G2(SIN)- 2XAARE YB - TATA -5'UTR ATF4-iC9-polyA sV40. This plasmid is constructed on the basis of a plasmid pLV G2(SIN) whose sequence has at least 80% identity with the sequence SEQ ID NO: 4142, into which has been introduced, between nucleotides 4939 and 4940, a vector genome constructed on the basis of a lentiviral genome G2(SIN) whose sequence has at least 80% identity with the sequence SEQ ID NO: 3888, into which has been introduced and inverted, between nucleotides 2229 and 2230, a 2XAARE expression cassette YB - TATA -5'UTR ATF4-iC9-polyA sV40 having at least 80% identity with the sequence SEQ ID NO: 2214, which comprises from the 5' end to the 3' end:

[0329] ■ an inducible 2XAARE promoter YB TATA having at least 80% identity with the sequence SEQ ID NO: 28;

[0330] ■ a coding or non-coding sequence having regulatory properties at the post-transcriptional level having at least 80% identity with the sequence SEQ ID NO: 1 (5'UTR of ATF4);

[0331] ■ a toxic or suicide transgene, which is an inducible Caspase-9 (iC9) protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 35 or whose nucleic acid encodes an inducible Caspase-9 (iC9) protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 36; and

[0332] ■ a polyA tail having at least 80% identity with the sequence SEQ ID NO: 53.

[0333] This is the case for all of the "inverted" plasmids described above. It should also be noted that due to the inversion of the expression cassette as described above with respect to the orientation of the transcription of the vector genome as described above, all of the sequences provided relating to said expression cassette as described above are found on the complementary strand of said vector genome as described above, of which only the sense sequences (5' > 3') are provided.

[0334] According to another embodiment, the subject of the invention is the plasmid as described above, said plasmid comprising:

[0335] ■ a vector genome as described above which comprises an expression cassette as described above whose 5' to 3' orientation of transcription is reversed with respect to the 5' to 3' orientation of transcription of said lentiviral genome, said expression cassette as described above comprising a coding or non-coding sequence having regulatory properties at the / w.s7-transcriptional level having at least 80% identity with the sequence SEQ ID NO: 1 (5'UTR of ATF4); and

[0336] ■ the means of expressing it, said plasmid being chosen from the sequences having at least 80% identity with the sequences SEQ ID NOs: 4,272 to 4,395. In particular, the subject of the invention is the plasmid as described above, said plasmid comprising:

[0337] ■ a vector genome as described above which comprises an expression cassette as described above whose 5' to 3' orientation of transcription is reversed with respect to the 5' to 3' orientation of transcription of said lentiviral genome, said expression cassette as described above comprising a coding or non-coding sequence having regulatory properties at the transcriptional level of sequence SEQ ID NO: 1 (5'UTR of ATF4); and ■ the means for expressing it, said plasmid being chosen from the sequences SEQ ID NOs: 4,272 to 4,395 (Table 11).

[0338] Table 11. List of plasmids comprising an inverted vector genome

[0339] According to another aspect, the invention relates to the use of a plasmid as described above for producing a viral vector (e.g. lentiviral vector, or a vector derived from adenovirus or adenovirus-associated virus (AA V)) comprising a vector genome as described above.

[0340] The expression "viral vector" means a recombinant viral (in particular lentiviral) particle obtained using the plasmid of the invention, which makes it possible to produce the (lenti-)viral particle of the invention. This comprises said encapsidated and / or enveloped vector genome. It is effective for entering the cell, it is non-replicative and it leads either to the integration (targeted or not) of said vector genome into the genome of an infected cell, or to the presence of an episome not integrated into the cellular genome.

[0341] According to another embodiment, the subject of the invention is the use as described above to produce a lentiviral vector. In particular, the subject of the invention is the use as described above to produce a lentiviral vector, said plasmid as described above being chosen from the sequences having 80% identity with the sequences SEQ ID NOs: 4,148 to

[0342] 4,271 and 4,272 to 4,395. Advantageously, the subject of the invention is the use as described above to produce a lentiviral vector, said plasmid as described above being chosen from the sequences SEQ ID NOs: 4,148 to 4,271 and 4,272 to 4,395.

[0343] According to another aspect, the subject of the invention is a method for producing viral vectors comprising a vector genome as described above. In particular, it involves producing lentiviral vectors. Also, the subject of the invention is also a method for producing lentiviral vectors comprising a vector genome as described above, said method comprising at least the steps: a. co-transfection of an animal eukaryotic cell (eg HEK 293T) with:

[0344] ■ a plasmid as described above;

[0345] ■ a plasmid comprising an envelope protein and the means for expressing it; and

[0346] ■ a plasmid comprising the structural proteins and enzymes of HIV-1, and the means for expressing it, to obtain a transfected animal eukaryotic cell; b. culturing said transfected animal eukaryotic cell to enable the production of lentiviral vectors comprising a vector genome according to claim 5; and c. harvesting and purifying said lentiviral vectors.

[0347] Such a method is illustrated in the examples below and is accessible to those skilled in the art in view of the literature at their disposal (eg Zennou et al. Nat Biotechnol. 2001 May; 19(5):446-50)). Nevertheless, and for the purposes of illustration, it is specified that:

[0348] ■ said animal eukaryotic cell may be a cell belonging to a cell line chosen from: HEK 293T, HEK 293, CHO, GS-CHO, Free style 293-F cells (FS293), Viral Production Cells (VPC and VPC 2.0), COS-1, HeLa, PS5.8 and PS46.2;

[0349] ■ said plasmid comprising a viral envelope protein and the means for expressing it may be chosen from the plasmids: pHCMV-VSV (SEQ ID NO: 4457), pHCMV-Mokola, pHCMV-RabiesG, pHCMV-AmphoEnv, pHCMV-LCMV-WE, pHCMV-LCMV-Arm53b and pHCMV-10Al (Sena-Esteves M et al. Optimized large-scale production of high titer lentivirus vector pseudotypes. J Virol Methods. 2004 Dec 15;122(2):131-9); and

[0350] ■ said plasmid comprising the structural proteins and enzymes of HIV-1, and the means for expressing it can be chosen from the plasmids: p8.92 (SEQ ID NO: 4458), p8.92 (IN D64V) (SEQ ID NO: 4459), psPAX2 (SEQ ID NO: 4460), pMDLg / pRRE (SEQ ID NO: 4461) and pRSV-Rev (SEQ ID NO: 4462).

[0351] For illustrative purposes and without limitation, the following protocol is also provided: Cells (e.g. HEK 293 T) were seeded on supports suitable for cell culture and so as to reach a confluence of 50 to 60% after 24 hours of culture. The next day, the cells were co-transfected, by the calcium phosphate precipitation method, with the plasmid encoding the lentiviral genome and two transcomplementing plasmids encoding the enzymes and structural proteins of HIV-1 (p8.9) and the envelope glycoprotein of the vesicular stomatitis virus (pVSVg). Co-transfection was carried out at a plasmid ratio of 2:2:1. The transfected cells were cultured for 5 hours in contact with the precipitate and then the culture medium was renewed. The supernatant containing the lentiviral particles was harvested 48 hours later.The lentiviral suspension was treated with DNAse I to remove persistent plasmids, filtered (membrane porosity 0.2 µm) and then ultra-centrifuged at 60,000g for 90 minutes at 4°C. The particle pellets were taken up in a volume of phosphate buffered saline (PBS) corresponding to a concentration of a factor of 1000. The suspensions obtained were aliquoted and stored at -80°C until use.

[0352] According to another embodiment, the subject of the invention is the method for producing lentiviral vectors as described above, in which said animal eukaryotic cell belongs to a cell line chosen from: HEK 293T, HEK 293, CHO, GS-CHO, Free style 293-F cells (FS293), Viral Production Cells (VPC and VPC 2.0), COS-1, HeLa, PS5.8 and PS46.2. Advantageously, the subject of the invention is the method for producing lentiviral vectors as described above, in which said animal eukaryotic cell belongs to the HEK 293T cell line.

[0353] According to another embodiment, the subject of the invention is the method for producing lentiviral vectors as described above, in which said plasmid as described above is chosen from the sequences having 80% identity with the sequences SEQ ID NOs: 4148 to 4271 and 4272 to 4395. Advantageously, the subject of the invention is the method for producing lentiviral vectors as described above, in which said plasmid as described above is chosen from the sequences SEQ ID NOs: 4148 to 4271 and 4272 to 4395.

[0354] In order to facilitate and optimize the production of the lentiviral vectors of the invention, it is possible to use an innovative eukaryotic cell which expresses a ribonucleoprotein complex constructed specifically to repress the expression of the transgene of interest (in particular when it is a toxic or suicide transgene) of the lentiviral vector to be produced. According to another embodiment, the invention therefore relates to the method for producing lentiviral vectors as described above, in which said animal eukaryotic cell expresses at least one ribonucleoprotein complex comprising:

[0355] ■ a fusion protein comprising the fusion:

[0356] - an inactive Cas endonuclease (dCas); and

[0357] - a KRAB transcriptional repression domain or a methylation domain selected from: DNMT3A, DNMT3B, DNMT3A-L and DNMT3B-L, or a fusion protein comprising the fusion:

[0358] - a KRAB transcriptional repression domain;

[0359] - an inactive Cas endonuclease (dCas); and - a methylation domain chosen from: DNMT3A, DNMT3B, DNMT3 AL, DNMT3B-L and MeCP2; and

[0360] ■ a guide RNA (gRNA) specifically recognizing the promoter sequence of said inducible promoter, said at least one ribonucleoprotein complex dCas-KRAB / gRNA, dCas-DNMT3A / gRNA, dCas-DNMT3B / gRNA, dCas-DNMT3A-L / gRNA, dCas-DNMT3B-L / gRNA, KRAB-dCas- DNMT3A / gRNA, KRAB-dCas-DNMT3B / gRNA, KRAB-dCas-DNMT3A-L / gRNA, KRAB-dCas-DNMT3B-L / gRNA or dCas-KRAB-MeCP2 / gRNA being in particular expressed stably.

[0361] According to another embodiment, the subject of the invention is the method for producing lentiviral vectors as described above, in which said KRAB transcriptional repression domain or said methylation domain chosen from: DNMT3 A, DNMT3B, DNMT3 AL and DNMT3B-L is in the N-terminal or C-terminal position of said inactive Cas endonuclease (dCas). Advantageously, the subject of the invention is the method for producing lentiviral vectors as described above, in which said KRAB transcriptional repression domain or said methylation domain chosen from: DNMT3 A, DNMT3B, DNMT3A-L and DNMT3B-L is in the C-terminal position of said inactive Cas endonuclease (dCas).

[0362] The expression "animal eukaryotic cell expressing at least one ribonucleoprotein complex" refers to the fact that the animal eukaryotic cell can express a single ribonucleoprotein complex (the interference one dCas-KRAB / gRNA; or one of the methylation ones dCas-DNMT3A / gRNA, dCas-DNMT3B / gRNA, dCas-DNMT3A-L / gRNA or dCas-DNMT3B-L / gRNA; or one of the bifunctional ones KRAB-dCas-DNMT3A, gRNA, KRAB-dCas-DNMT3B / gRNA, KRAB-dCas-DNMT3 AL / gRNA, KRAB-dCas-DNMT3B-L / gRNA or dCas-KRAB-MeCP2 / gRNA) as it can express several and in particular at least two, namely:

[0363] ■ a dCas-KRAB / gRNA interference ribonucleoprotein complex (CRISPRi); and

[0364] ■ a ribonucleoprotein methylation complex (called CRISPRm) chosen from: dCas- DNMT3A / gRNA, dCas-DNMT3B / gRNA, dCas-DNMT3A-L / gRNA and dCas- DNMT3B-L / gRNA.

[0365] The CRISPR interference (CRISPRi) and CRISPR-targeted methylation (CRISPRm) strategies according to the invention are based on the fusion of an inactive or "dead" CRISPR-Cas endonuclease (dCas) and a transcriptional repression domain KRAB (Krüppel-Associated Box) or methylation domain DNMT3A, DNMT3B, DNMT3A-L or DNMT3B-L (DNA methyltransferase). The dCas, thanks to its guide RNA (gRNA), makes it possible to target a specific sequence. This targeting allows the KRAB domain to sterically block transcription and the DNMT3 A, DNMT3B, DNMT3A-L or DNMT3B-L domains to block transcription by de novo methylation of the targeted DNA. The implementation of a CRISPRi and / or CRISPRm strategy on a sequence internal to the lentiviral vector during the production of recombinant particles requires the co-expression of at least one CRISPRi and / or CRISPRm complex and a gRNA in the transfected animal eukaryotic cells.Alternatively, the invention implements a bifunctional CRISPRi / m complex comprising the fusion of an inactive or "dead" CRISPR-Cas endonuclease (dCas), a KRAB transcriptional repression domain and a DNMT3 A, DNMT3B, DNMT3 AL, DNMT3B-L or MeCP2 methylation domain, and a gRNA in the transfected animal eukaryotic cells.

[0366] The term "gRNA (guide RNA)" refers to an RNA that associates with an enzyme or protein complex, which, when paired with a complementary RNA or DNA sequence, allows the enzyme or protein complex to position itself on this complementary RNA or DNA.

[0367] The term "dCas-KRAB / gRNA ribonucleoprotein complex" refers to an interference system comprising the association of a dCas-KRAB fusion protein and a guide RNA (gRNA) specifically recognizing a succession of 17 to 24 bases followed by a single or repeated "PAM" (Protospacer Adjacent Motif) motif in the promoter sequence of a promoter present in the genome of the lentiviral vector to be produced. These two elements can work together, in synergy with the inversion of said expression cassette, and unexpectedly make it possible to produce lentiviral vector titers carrying a transgene of interest (in particular a toxic or suicide transgene) that have never been achieved before. In this sense, this embodiment is a real revolution since it finally makes it possible to offer patients the safe and effective cell therapies they need.

[0368] The term “dCas-DNMT3A / gRNA, dCas-DNMT3B / gRNA, dCas-DNMT3 AL / gRNA or dCas-DNMT3B-L / gRNA ribonucleoprotein complex” refers to a methylation system comprising the association of a dCas-DNMT3A, dCas-DNMT3B, dCas-DNMT3 AL or dCas-DNMT3B-L fusion protein and a guide RNA (gRNA) specifically recognizing a sequence of 17 to 24 bases followed by a single or repeated “PAM” (Protospacer Adjacent Motif) motif in the promoter sequence of a promoter present in the genome of the lentiviral vector to be produced. These two elements can work in concert, in synergy with the inversion of said expression cassette, and unexpectedly make it possible to produce lentiviral vector titers carrying a transgene of interest (notably a toxic or suicide transgene) never before achieved.In this sense, this method is a real revolution since it finally makes it possible to offer patients the safe and effective cell therapies they need.

[0369] The term “KRAB-dCas-DNMT3A / gRNA, KRAB-dCas-DNMT3B / gRNA, KRAB-dCas-DNMT3A-L / gRNA, KRAB-dCas-DNMT3B-L / gRNA or dCas-KRAB-MeCP2 / gRNA ribonucleoprotein complex” refers to a bifunctional interference and methylation system comprising the association of a KRAB-dCas-DNMT3A, KRAB-dCas-DNMT3B, KRAB-dCas-DNMT3A-L, KRAB-dCas-DNMT3B-L or dCas-KRAB-MeCP2 fusion protein and a guide RNA (gRNA) specifically recognizing a sequence of 17 to 24 bases followed by a single or repeated “PAM” (Protospacer Adjacent Motif) motif in the promoter sequence of a promoter present in the genome of the lentiviral vector to be produced. These three elements can work together, in synergy with the inversion of said expression cassette, and unexpectedly make it possible to produce lentiviral vector titers carrying a transgene of interest (in particular a toxic or suicide transgene) never before achieved.In this sense, this method is a real revolution since it finally makes it possible to offer patients the safe and effective cell therapies they need.

[0370] The term "dCas-KRAB fusion protein" refers to the combination of two amino acid sequences from different proteins or fragments thereof to create an artificial and functional protein. In the invention, these two fused components are, as mentioned, an inactive Cas endonuclease (dCas) and a KRAB transcriptional repression domain, and a nuclear import signal (NLS) peptide is added to ensure its nuclear localization (e.g. encoded by a nucleic acid of sequence SEQ ID NO: 4403).

[0371] The term “dCas-DNMT3A, dCas-DNMT3B, dCas-DNMT3A-L or dCas-DNMT3B-L fusion protein” refers to the combination of two amino acid sequences from different proteins or fragments thereof to create an artificial and functional protein. In the invention, these two fused components are, as mentioned, an inactive Cas endonuclease (dCas) and a DNMT3A, DNMT3B, DNMT3A-L or DNMT3B-L methylation domain. A nuclear import signal (NLS) peptide is also added to ensure its nuclear localization (e.g. encoded by a nucleic acid of sequence SEQ ID NO: 4403).

[0372] The term “KRAB-dCas-DNMT3A, KRAB-dCas-DNMT3B, KRAB-dCas-DNMT3A-L, KRAB-dCas-DNMT3B-L or dCas-KRAB-MeCP2 fusion protein” refers to the combination of three amino acid sequences from different proteins or fragments thereof to create an artificial and functional protein. In the invention, these three fused components are, as mentioned, a KRAB transcriptional repression domain, an inactive Cas endonuclease (dCas) and a DNMT3A, DNMT3B, DNMT3A-L or DNMT3B-L methylation domain. A nuclear import signal (NLS) peptide is also added to ensure its nuclear localization (e.g. encoded by a nucleic acid of sequence SEQ ID NO: 4403).

[0373] The expression "inactive Cas endonuclease (dCas)" or the equivalent expression "dead" Cas endonuclease (dCas) refers to endonucleases whose activity of cleaving one or two DNA strands does not function. To date, several Cas endonucleases (Cas9, Casl2a, Casl2b, CasX or Cas 12e, Casl2f or Cas 14, Casl2j or Cas®) from different hosts have been identified and characterized, or even modified (e.g. improvement of their function), which can be implemented by the invention after their inactivation. According to another embodiment, the subject of the invention is therefore the method for producing lentiviral vectors as described above, in which said inactive Cas endonuclease (dCas) is chosen from:

[0374] ■ inactive Cas9 endonucleases from S. pyogenes, S. aureus, C. diphtheriae, N. meningitidis, S. canis, S. macacae, F. tularensis, Acidaminococcus, C. jejuni, S. pneumoniae and S. thermophilus, '

[0375] ■ inactive Caslla endonucleases from Lachnospiraceae bacterium and Acidaminococcus sp, ' ■ inactive Casllb endonucleases from Alicyclobacillus kakegawensis and Bacillus hisashii

[0376] ■ inactive CasX or Caslle endonucleases of Deltaproteobacteria and Planctomycetes

[0377] ■ inactive type V CRISPR endonucleases from Syntrophomonas palmitatica and Acidibacillus sulfuroxidans

[0378] ■ inactive Cas 12j or Cas® endonucleases of the Biggiephage clade

[0379] ■ inactive Cas9, Casl2a, Casl2b, CasX or Casl2e, CRISPR type V, Cas 12j or Cas® orthologs derived from these organisms; and

[0380] ■ Cas9, Casl2a, Casl2b, CasX or Casl2e, CRISPR type V, Cas 12j or Cas® mutants or inactive variants derived from these organisms.

[0381] The term "orthologs" refers to similar endonucleases present in two or more different species. These, due to evolution, may be inactive and if this is not the case, it is possible to render them non-functional by mutation to exploit them for the purposes of the invention.

[0382] The term "mutants" refers to a Cas endonuclease into which one or more mutations have been introduced, including the deletion, substitution, and / or addition of one or more amino acids. "Inactive mutants" therefore refers to Cas proteins modified by human intervention (e.g., by genetic engineering) to inactivate their DNA cleavage activity.

[0383] The term "inactive variants" refers to naturally evolving Cas endonucleases that lack DNA cleavage activity.

[0384] According to another embodiment, the invention relates to the method for producing lentiviral vectors as described above, in which said inactive Cas endonuclease is an inactive Cas9 endonuclease (dCas9). This is a ribonucleoprotein complex dCas9-KRAB / gRNA, dCas9-DNMT3A / gRNA, dCas9-DNMT3B / gRNA, dCas9-DNMT3A-L / gRNA, dCas9-DNMT3B-L / gRNA, KRAB-dCas9-DNMT3A / gRNA, KRAB-dCas9-DNMT3B / gRNA, KRAB-dCas9-DNMT3A-L / gRNA, KRAB-dCas9-DNMT3B-L / gRNA or dCas9-KRAB-MeCP2 / gRNA. In particular, the subject of the invention is the method for producing lentiviral vectors as described above, in which said inactive Cas endonuclease is an inactive Cas9 endonuclease (dCas9) whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4401 or whose nucleic acid codes for an inactive Cas9 endonuclease (dCas9) whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4402.In particular, the invention also relates to the method for producing lentiviral vectors as described above, in which said inactive Cas endonuclease is an inactive Cas9 endonuclease (dCas9) whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 4401 or whose nucleic acid codes for an inactive Cas9 endonuclease (dCas9) whose amino acid sequence corresponds to the sequence SEQ ID NO: 4402.

[0385] The expression "KRAB transcriptional repression domain" refers to the KR AB (Kruppel-associated suppression box) domain of the human zinc finger protein Koxl (or zinc finger protein 10) or Zim3, which causes specific inhibition of RNA polymerases II and III. In doing so, this KRAB domain inhibits the expression of the gene(s) present on the DNA where it is recruited. In particular, the subject of the invention is the method for producing lentiviral vectors as described above, in which said KRAB transcriptional repression domain is encoded by a nucleic acid having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4399 or 4408, or whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4400 or 4409.In particular, the invention also relates to the method for producing lentiviral vectors as described above, in which said KRAB transcriptional repression domain is encoded by the nucleic acid of sequence SEQ ID NO: 4399 or 4408, or whose amino acid sequence corresponds to the sequence SEQ ID NO: 4400 or 4409.

[0386] According to another embodiment, the invention relates to the method for producing lentiviral vectors as described above, in which said dCas-KRAB fusion protein is a dCas9-KRAB fusion protein. In particular, the invention relates to the method for producing lentiviral vectors as described above, in which said dCas-KRAB fusion protein is a dCas9-KRAB fusion protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4404 or 4410, or whose nucleic acid encodes a dCas9-KRAB fusion protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4405 or 4411.In particular, the invention also relates to the method for producing lentiviral vectors as described above, in which said dCas-KRAB fusion protein is a dCas9-KRAB fusion protein whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 4404 or 4410, or whose nucleic acid encodes a dCas9-KRAB fusion protein whose amino acid sequence corresponds to the sequence SEQ ID NO: 4405 (encoded by the plasmid pLV-EFla-dCas9-KRAB-P2A-BlastR of sequence SEQ ID NO: 4407) or 4411.

[0387] The expression "methylation domain selected from: DNMT3A, DNMT3B, DNMT3A-L, DNMT3B-L and MeCP2" refers to the functional domain of DNA methyltransferase, which catalyzes the covalent modification of DNA by transfer of S-adenosyl-1-methionine (SAM) by converting cytosine into 5-methylcytosine. In doing so, this DNMT3A, DNMT3B, DNMT3A-L, DNMT3B-L or MeCP2 domain inhibits the expression of the gene(s) present on the DNA where it is recruited. In particular, the subject of the invention is the method for producing lentiviral vectors as described above, in which said methylation domain:

[0388] ■ DNMT3 A is encoded by a nucleic acid having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4413 or whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4414; ■ DNMT3B is encoded by a nucleic acid having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4425 or whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4426;

[0389] ■ DNMT3A-L is encoded by a nucleic acid having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4417 or whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4418; or

[0390] ■ DNMT3B-L is encoded by a nucleic acid having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4427 or whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4428.

[0391] In particular, the invention also relates to the method for producing lentiviral vectors as described above, in which said methylation domain:

[0392] ■ DNMT3A is encoded by the nucleic acid of sequence SEQ ID NO: 4413 or whose amino acid sequence corresponds to the sequence SEQ ID NO: 4414;

[0393] ■ DNMT3B is encoded by the nucleic acid of sequence SEQ ID NO: 4425 or whose amino acid sequence corresponds to the sequence SEQ ID NO: 4426;

[0394] ■ DNMT3A-L is encoded by the nucleic acid of sequence SEQ ID NO: 4417 or whose amino acid sequence corresponds to the sequence SEQ ID NO: 4418; or

[0395] ■ DNMT3B-L is encoded by the nucleic acid of sequence SEQ ID NO: 4427 or whose amino acid sequence corresponds to the sequence SEQ ID NO: 4428.

[0396] According to another embodiment, the subject of the invention is the method for producing lentiviral vectors as described above, in which said MeCP2 methylation domain is encoded by a nucleic acid having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4429 or whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4430. In particular, the subject of the invention is the method for producing lentiviral vectors as described above, in which said MeCP2 methylation domain is encoded by the nucleic acid of sequence SEQ ID NO: 4429 or whose amino acid sequence corresponds to the sequence SEQ ID NO: 4430.

[0397] According to another embodiment, the subject of the invention is the method for producing lentiviral vectors as described above, in which said dCas-DNMT3A, dCas-DNMT3B, dCas-DNMT3A-L or dCasDNMT3B-L fusion protein is respectively a dCas9-DNMT3 A, dCas9-DNMT3B, dCas9-DNMT3 AL or dCas9-DNMT3B-L fusion protein. In particular, the subject of the invention is the method for producing lentiviral vectors as described above, in which:

[0398] ■ said dCas-DNMT3A fusion protein is a dCas9-DNMT3A fusion protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4419 or whose nucleic acid encodes a dCas9-DNMT3A fusion protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4420;

[0399] ■ said dCas-DNMT3B fusion protein is a dCas9-DNMT3B fusion protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4431 or whose nucleic acid encodes a dCas9-DNMT3B fusion protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4432;

[0400] ■ said dCas-DNMT3A-L fusion protein is a dCas9-DNMT3A-L fusion protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4423 or whose nucleic acid encodes a dCas9-DNMT3A-L fusion protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4424; or

[0401] ■ said dCas-DNMT3B-L fusion protein is a dCas9-DNMT3B-L fusion protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4433 or whose nucleic acid encodes a dCas9-DNMT3B-L fusion protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4434.

[0402] In particular, the invention also relates to the method for producing lentiviral vectors as described above, in which

[0403] ■ said dCas-DNMT3A fusion protein is a dCas9-DNMT3A fusion protein whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 4419 or whose nucleic acid encodes a dCas9-DNMT3A fusion protein whose amino acid sequence corresponds to the sequence SEQ ID NO: 4420;

[0404] ■ said dCas-DNMT3B fusion protein is a dCas9-DNMT3B fusion protein whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 4431 or whose nucleic acid encodes a dCas9-DNMT3B fusion protein whose amino acid sequence corresponds to the sequence SEQ ID NO: 4432;

[0405] ■ said dCas-DNMT3A-L fusion protein is a dCas9-DNMT3A-L fusion protein whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 4423 or whose nucleic acid encodes a dCas9-DNMT3A-L fusion protein whose amino acid sequence corresponds to the sequence SEQ ID NO: 4424; or

[0406] ■ said dCas-DNMT3B-L fusion protein is a dCas9-DNMT3B-L fusion protein whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 4433 or whose nucleic acid encodes a dCas9-DNMT3B-L fusion protein whose amino acid sequence corresponds to the sequence SEQ ID NO: 4434.

[0407] Interestingly, if the DNMT3L enzyme is catalytically inactive, it stimulates the activity of DNMT3A and DNMT3B and thus promotes the silencing of a promoter by methylation. Hence the DNMT3 AL and DNMT3B-L methylation domains where respectively DNMT3A or DNMT3B have been combined with DNMT3L. This being the case, it is possible to envisage the addition of a dCas-DNMT3L / gRNA ribonucleoprotein complex in the animal eukaryotic cell of the invention. According to another embodiment, the invention relates to the method for producing lentiviral vectors as described above, in which said animal eukaryotic cell further expresses another ribonucleoprotein complex comprising:

[0408] ■ a fusion protein comprising the fusion:

[0409] - an inactive Cas endonuclease (dCas); and - a DNMT3L methylation-promoting domain (dCas-DNMT3L fusion) ■ and

[0410] ■ a guide RNA (gRNA) specifically recognizing the promoter sequence of said inducible promoter, said other dCas-DNMT3L / gRNA ribonucleoprotein complex being in particular stably expressed.

[0411] According to another embodiment, the subject of the invention is the method for producing lentiviral vectors as described above, in which said DNMT3L methylation-promoting domain is in the N-terminal or C-terminal position of said inactive Cas endonuclease (dCas). Advantageously, the subject of the invention is the use of an animal eukaryotic cell as described above, in which said DNMT3L methylation-promoting domain is in the C-terminal position of said inactive Cas endonuclease (dCas).

[0412] According to another embodiment, the subject of the invention is the method for producing lentiviral vectors as described above, in which said methylation-promoting domain DNMT3L is encoded by a nucleic acid having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4415 or whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4416. In particular, the subject of the invention is the method for producing lentiviral vectors as described above, in which said methylation-promoting domain DNMT3L is encoded by the nucleic acid of sequence SEQ ID NO: 4415 or whose amino acid sequence corresponds to the sequence SEQ ID NO: 4416.

[0413] According to another embodiment, the subject of the invention is the method for producing lentiviral vectors as described above, in which said dCas-DNMT3L fusion protein is a dCas9-DNMT3L fusion protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4421 or whose nucleic acid encodes a dCas9-DNMT3L fusion protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4422. In particular, the subject of the invention is the method for producing lentiviral vectors as described above, in which said dCas-DNMT3L fusion protein is a dCas9-DNMT3L fusion protein whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 4421 or whose nucleic acid encodes a fusion protein dCas9-DNMT3L whose amino acid sequence corresponds to the sequence SEQ ID NO: 4422.

[0414] As mentioned above, the invention also implements a bifunctional CRISPRi / m complex comprising:

[0415] ■ the fusion of an inactive or “dead” CRISPR-Cas endonuclease (dCas), a KRAB transcriptional repression domain and a DNMT3A, DNMT3B, DNMT3 AL, DNMT3B-L or MeCP2 methylation domain; and

[0416] ■ a guide RNA (gRNA) specifically recognizing the promoter sequence of said inducible promoter (that of the expression cassette of the invention). In particular, this bifunctional complex (advantageously expressed in a stable manner) is chosen from: KRAB-dCas-DNMT3A-L / gRNA, KRAB-dCas-DNMT3B-L / gRNA and dCas-KRAB-MeCP2 / gRNA, and is advantageously chosen from: KRAB-dCas9-DNMT3A-L / gRNA, KRAB-dCas9-DNMT3B-L / gRNA and dCas9-KRAB-MeCP2 / gRNA. Also, the subject of the invention is the method for producing lentiviral vectors as described above, in which:

[0417] ■ said KRAB-dCas-DNMT3 AL fusion protein is a KRAB-dCas9-DNMT3A-L fusion protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4435 or 4441, or whose nucleic acid encodes a KRAB-dCas9-DNMT3A-L fusion protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4436 or 4442;

[0418] ■ said KRAB-dCas-DNMT3B-L fusion protein is a KRAB-dCas9-DNMT3B-L fusion protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4437 or 4443, or whose nucleic acid encodes a KRAB-dCas9-DNMT3B-L fusion protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4438 or 4444; or

[0419] ■ said dCas-KRAB-MeCP2 / gRNA fusion protein is a dCas9-KRAB-MeCP2 / gRNA fusion protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4439 or 4445, or whose nucleic acid encodes a dCas9-KRAB-MeCP2 / gRNA fusion protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4440 or 4446.

[0420] In particular, the subject of the invention is the method for producing lentiviral vectors as described above, in which:

[0421] ■ said KRAB-dCas-DNMT3 AL fusion protein is a KRAB-dCas9-DNMT3A-L fusion protein whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 4,435 or 4,441, or whose nucleic acid encodes a KRAB-dCas9-DNMT3A-L fusion protein whose amino acid sequence corresponds to the sequence SEQ ID NO: 4,436 (encoded by the plasmid pLV-EF la-KRAB l-dCas9-DNMT3a-l-P2A-BlastR of sequence SEQ ID NO: 4,447) or 4,442;

[0422] ■ said KRAB-dCas-DNMT3B-L fusion protein is a KRAB-dCas9-DNMT3B-L fusion protein whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 4437 or 4443, or whose nucleic acid encodes a KRAB-dCas9-DNMT3B-L fusion protein whose amino acid sequence corresponds to the sequence SEQ ID NO: 4438 or 4444; or

[0423] ■ said dCas-KRAB-MeCP2 / gRNA fusion protein is a dCas9-KRAB-MeCP2 / gRNA fusion protein whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 4439 or 4445, or whose nucleic acid encodes a dCas9-KRAB-MeCP2 / gRNA fusion protein whose amino acid sequence corresponds to the sequence SEQ ID NO: 4440 or 4446.

[0424] Advantageously, the subject of the invention is the method for producing lentiviral vectors as described above, in which said ribonucleoprotein complex dCas-KRAB / sgRNA, dCas-DNMT3A / sgRNA, dCas-DNMT3B / sgRNA, dCas-DNMT3L / sgRNA, dCas-DNMT3A-L / sgRNA, dCas-DNMT3B-L / sgRNA, KRAB-dCas-DNMT3A / sgRNA, KRAB-dCas-DNMT3B / sgRNA, KRAB-dCas-DNMT3A-L / sgRNA, KRAB-dCas-DNMT3B-L / sgRNA or dCas-KRAB-MeCP2 / sgRNA is stably expressed via targeted integration into the genome of said animal eukaryotic cell.

[0425] According to another embodiment, the subject of the invention is the method for producing lentiviral vectors as described above, in which said gRNA comprises or consists of a nucleic acid having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4,397 (which specifically recognizes the inducible promoter 2XAARE YB TATA (SEQ ID NO: 28)). In particular, the subject of the invention is the method for producing lentiviral vectors as described above, in which said gRNA comprises or consists of a nucleic acid corresponding to the nucleic acid of sequence SEQ ID NO: 4,397.

[0426] According to another embodiment, the invention therefore relates to the method for producing lentiviral vectors as described above, in which:

[0427] ■ said fusion protein:

[0428] - dCas-KRAB is a dCas9-KRAB fusion protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4404 or 4410, or whose nucleic acid encodes a dCas9-KRAB fusion protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4405 or 4411,

[0429] - dCas-DNMT3A is a dCas9-DNMT3A fusion protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4419 or whose nucleic acid encodes a dCas9-DNMT3 A fusion protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4420,

[0430] - dCas-DNMT3B is a dCas9-DNMT3B fusion protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4431 or whose nucleic acid encodes a dCas9-DNMT3B fusion protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4432,

[0431] - dCas-DNMT3A-L is a dCas9-DNMT3A-L fusion protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4423 or whose nucleic acid encodes a dCas9-DNMT3A-L fusion protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4424,

[0432] - dCas-DNMT3B-L is a dCas9-DNMT3B-L fusion protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4433 or whose nucleic acid encodes a dCas9-DNMT3B-L fusion protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4434, - dCas-DNMT3L is a dCas9-DNMT3L fusion protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4421 or whose nucleic acid encodes a dCas9-DNMT3L fusion protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4422,

[0433] - KRAB-dCas-DNMT3A-L is a KRAB-dCas9-DNMT3A-L fusion protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4435 or 4441, or whose nucleic acid encodes a KRAB-dCas9-DNMT3 AL fusion protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4436 or 4442,

[0434] - KRAB-dCas-DNMT3B-L is a KRAB-dCas9-DNMT3B-L fusion protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4437 or 4443, or whose nucleic acid encodes a KRAB-dCas9-DNMT3B-L fusion protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4438 or 4444, and / or

[0435] - dCas-KRAB-MeCP2 / gRNA is a dCas9-KRAB-MeCP2 / gRNA fusion protein whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4439 or 4445, or whose nucleic acid encodes a dCas9-KRAB-MeCP2 / gRNA fusion protein whose amino acid sequence is at least 80% identical to the sequence SEQ ID NO: 4440 or 4446;

[0436] ■ said gRNA comprises or consists of a nucleic acid having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 4397; and

[0437] ■ said inducible promoter is 2XAARE YB TATA whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 28.

[0438] In particular, the subject of the invention is the method for producing lentiviral vectors as described above, in which:

[0439] ■ said fusion protein:

[0440] - dCas-KRAB is a dCas9-KRAB fusion protein whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 4404 or 4410, or whose nucleic acid encodes a dCas9-KRAB fusion protein whose amino acid sequence corresponds to the sequence SEQ ID NO: 4405 encoded by the plasmid pLV-EF la-dCas9-KRAB-P2A-BlastR of sequence SEQ ID NO: 4407) or 4411,

[0441] - dCas-DNMT3A is a dCas9-DNMT3A fusion protein whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 4419 or whose nucleic acid encodes a dCas9-DNMT3A fusion protein whose amino acid sequence corresponds to the sequence SEQ ID NO: 4420,

[0442] - dCas-DNMT3B is a dCas9-DNMT3B fusion protein whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 4431 or whose nucleic acid encodes a dCas9-DNMT3B fusion protein whose amino acid sequence corresponds to the sequence SEQ ID NO: 4432,

[0443] - dCas-DNMT3A-L is a dCas9-DNMT3A-L fusion protein whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 4423 or whose nucleic acid encodes a dCas9-DNMT3A-L fusion protein whose amino acid sequence corresponds to the sequence SEQ ID NO: 4424,

[0444] - dCas-DNMT3B-L is a dCas9-DNMT3B-L fusion protein whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 4433 or whose nucleic acid encodes a dCas9-DNMT3B-L fusion protein whose amino acid sequence corresponds to the sequence SEQ ID NO: 4434,

[0445] - dCas-DNMT3L is a dCas9-DNMT3L fusion protein whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 4421 or whose nucleic acid encodes a dCas9-DNMT3L fusion protein whose amino acid sequence corresponds to the sequence SEQ ID NO: 4422,

[0446] - KRAB-dCas-DNMT3A-L is a KRAB-dCas9-DNMT3A-L fusion protein whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 4435 or 4441, or whose nucleic acid encodes a KRAB-dCas9-DNMT3A-L fusion protein whose amino acid sequence corresponds to the sequence SEQ ID NO: 4436 encoded by the plasmid pLV-EF la-KRAB l-dCas9-DNMT3a-l-P2A-BlastR of sequence SEQ ID NO: 4447) or 4442,

[0447] - KRAB-dCas-DNMT3B-L is a KRAB-dCas9-DNMT3B-L fusion protein whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 4437 or 4443, or whose nucleic acid encodes a KRAB-dCas9-DNMT3B-L fusion protein whose amino acid sequence corresponds to the sequence SEQ ID NO: 4438 or 4444, and / or

[0448] - dCas-KRAB-MeCP2 / gRNA is a dCas9-KRAB-MeCP2 / gRNA fusion protein whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 4439 or 4445, or whose nucleic acid encodes a dCas9-KRAB-MeCP2 / gRNA fusion protein whose amino acid sequence corresponds to the sequence SEQ ID NO: 4440 or 4446;

[0449] ■ said gRNA comprises or consists of a nucleic acid corresponding to the nucleic acid of sequence SEQ ID NO: 4397; and

[0450] ■ said inducible promoter is 2XAARE YB TATA whose nucleic acid corresponds to the nucleic acid of sequence SEQ ID NO: 28.

[0451] According to this embodiment, it is therefore possible to produce a lentiviral vector comprising an expression cassette chosen from the sequences SEQ ID NOs: 540 to 782 and 2,214 to 2,456, and / or whose vector genome can be chosen from the sequences SEQ ID NOs: 3,894 to 3,902, 3,956 to 3,964, 4,018 to 4,026 and 4,080 to 4,088, which can be encoded by a plasmid chosen from the sequences SEQ ID NOs: 4,148 to 4,156, 4,210 to 4,218, 4,272 to 4,280 and 4,334 to 4,342. Since a method for producing a viral vector (in particular a lentiviral) is described, it is understood that another aspect of the invention relates to a viral vector comprising a vector genome as described above, in particular said viral vector being a lentiviral vector, or a vector derived from adenovirus or adenovirus-associated virus (AAV).According to this same aspect, the invention also relates to a viral vector (in particular lentiviral) capable of being obtained by the method of producing viral vectors (in particular lentiviral) as described above.

[0452] According to another embodiment, the subject of the invention is the viral vector as described above, said viral vector being a lentiviral vector.

[0453] It is also understood that another aspect of the invention relates to the in vitro use of an expression cassette as described above, of a plasmid as described above comprising an expression cassette as described above, or of a viral vector as described above for transfecting / transducing an animal eukaryotic cell, said animal eukaryotic cell being in particular chosen from:

[0454] ■ a cancer cell, including a cancer cell forming a solid tumor or being involved in a blood cancer;

[0455] ■ an immune cell chosen in particular from: the T lymphocyte and the NK cell;

[0456] ■ a myofibroblast, in particular a myofibroblast involved in a fibrosis process;

[0457] ■ an astrocyte, particularly an astrocyte activated during brain or spinal cord trauma and forming a glial scar preventing regeneration; and

[0458] ■ an induced stem cell (iPS).

[0459] According to another embodiment, the subject of the invention is the in vitro use of an expression cassette as described above, of a plasmid as described above comprising an expression cassette as described above, or of a viral vector as described above, in which said animal eukaryotic cell is different from a pluripotent or totipotent stem cell, or from a stem cell isolated from a tissue of the organism.

[0460] The expression "a cancer cell" designates an abnormal cell having acquired specific characteristics at the origin of a cancer (or malignant tumor), which is a disease characterized by an uncontrolled and abnormally significant cell proliferation (tumor) within a normal (healthy) tissue of the organism, in such a way that the survival of the latter is threatened. Among these tumors, there are solid tumors and liquid tumors. According to another embodiment, the invention therefore relates to the in vitro use of a viral vector (in particular lentiviral) as described above, of a plasmid as described above comprising an expression cassette as described above, or of a viral vector as described above, in which said animal eukaryotic cell is a cancer cell, in particular a cancer cell forming a solid tumor or being involved in a blood cancer.In particular, the invention also relates to the in vitro use of a viral vector (in particular lentiviral) as described above, of a plasmid as described above comprising an expression cassette as described above, or of a viral vector as described above, in which said animal eukaryotic cell is a cancer cell forming a solid tumor. In particular, the invention also relates to the in vitro use of a viral vector (in particular lentiviral) as described above, of a plasmid as described above comprising an expression cassette as described above, or of a viral vector as described above, in which said animal eukaryotic cell is a cancer cell being involved in a blood cancer.

[0461] The expression "an immune cell" designates a cell involved in the functioning of the immune system. Many examples exist such as lymphocytes (e.g. T, B, NK and NKT), phagocytes (e.g. macrophage and dendritic cell) and granulocytes (e.g. neutrophil, eosinophil and basophil) and the precursor cells of these cells. These cells can be of autologous, syngeneic, allogeneic or xenogeneic origin. Finally, these cells can be genetically modified. It should be noted that the invention particularly uses a T lymphocyte and an NK cell. By "T lymphocyte", the invention refers in particular to a naive, effector or memory T lymphocyte, with auxiliary, cytotoxic or regulatory properties. By "NK cell", the invention refers in particular to a primary, cancerous or immortalized NK cell.

[0462] According to another embodiment, the invention therefore relates to the in vitro use of a viral vector (in particular lentiviral) as described above, of a plasmid as described above comprising an expression cassette as described above, or of a viral vector as described above, in which said animal eukaryotic cell is an immune cell chosen in particular from: the T lymphocyte and the NK cell. In particular, the invention also relates to the in vitro use of a viral vector (in particular lentiviral) as described above, of a plasmid as described above comprising an expression cassette as described above, or of a viral vector as described above, in which said animal eukaryotic cell is a T lymphocyte or an NK cell.

[0463] The term "myofibroblast" designates a cell characterized by properties of matrix protein production, proliferation, migration and contraction, activated in repair and healing processes. These myofibroblasts are found in certain organs such as the liver, lung, heart or kidney during chronic diseases. The process of tissue replacement by myofibroblasts is called fibrosis. According to another embodiment, the invention therefore relates to the in vitro use of a viral vector (in particular lentiviral) as described above, of a plasmid as described above comprising an expression cassette as described above, or of a viral vector as described above, in which said animal eukaryotic cell is a myofibroblast.In particular, the invention also relates to the in vitro use of a viral vector (in particular lentiviral) as described above, of a plasmid as described above comprising an expression cassette as described above, or of a viral vector as described above, in which said animal eukaryotic cell is a myofibroblast involved in a fibrosis process.

[0464] The term "astrocyte" refers to a glial cell in the central nervous system. Typically star-shaped, it performs a variety of important functions, centered on supporting and protecting neurons.

[0465] According to another embodiment, the invention therefore relates to the in vitro use of a viral vector (in particular lentiviral) as described above, of a plasmid as described above comprising an expression cassette as described above, or of a viral vector as described above, in which said animal eukaryotic cell is an astrocyte, in particular an astrocyte activated during brain or spinal cord trauma and forming a glial scar preventing regeneration.In particular, the invention also relates to the in vitro use of a viral vector (in particular lentiviral) as described above, of a plasmid as described above comprising an expression cassette as described above, or of a viral vector as described above, in which said animal eukaryotic cell is an astrocyte activated during brain or spinal cord trauma forming a glial scar preventing regeneration.

[0466] The term "stem cell" refers to a cell characterized by its undifferentiation and its ability to differentiate and generate or regenerate tissue, such as hematopoietic tissue, muscle, brain (neurons), retina, liver (hepatocytes), pancreatic beta cells, kidney, cartilage, bone, or skin. These cells, taken from an adult organism or induced from differentiated cells (iPS), can be of autologous, syngeneic, allogeneic, or xenogeneic origin.

[0467] According to another embodiment, the invention therefore relates to the in vitro use of a viral vector (in particular lentiviral) as described above, of a plasmid as described above comprising an expression cassette as described above, or of a viral vector as described above, in which said animal eukaryotic cell is an induced stem cell (iPS).

[0468] According to another aspect of the invention, the subject of the invention is an animal eukaryotic cell transfected / transduced by an expression cassette as described above, a plasmid as described above comprising an expression cassette as described above, or a viral vector (in particular lentiviral) as described above, said transfected / transduced animal eukaryotic cell being in particular chosen from:

[0469] ■ a cancer cell, including a cancer cell forming a solid tumor or being involved in a blood cancer;

[0470] ■ an immune cell chosen in particular from: the T lymphocyte and the NK cell;

[0471] ■ a myofibroblast, in particular a myofibroblast involved in a fibrosis process;

[0472] ■ an astrocyte, particularly an astrocyte activated during brain or spinal cord trauma and forming a glial scar preventing regeneration; and

[0473] ■ an induced stem cell (iPS).

[0474] According to another embodiment, the invention relates to the transfected / transduced animal eukaryotic cell as described above, in which said transduced animal eukaryotic cell is different from a pluripotent or totipotent stem cell, or from a stem cell isolated from a tissue of the organism.

[0475] According to another embodiment, the subject of the invention is the transfected / transduced animal eukaryotic cell as described above, wherein said animal eukaryotic cell is a cancer cell, in particular a cancer cell forming a solid tumor or being involved in a blood cancer. In particular, the subject of the invention is also the transfected / transduced animal eukaryotic cell as described above, wherein said animal eukaryotic cell is a cancer cell forming a solid tumor. In particular, the subject of the invention is also the transfected / transduced animal eukaryotic cell as described above, wherein said animal eukaryotic cell is a cancer cell being involved in a blood cancer.

[0476] According to another embodiment, the subject of the invention is the transfected / transduced animal eukaryotic cell as described above, in which said animal eukaryotic cell is an immune cell chosen in particular from: the T lymphocyte and the NK cell. In particular, the subject of the invention is also the transfected / transduced animal eukaryotic cell as described above, in which said animal eukaryotic cell is a T lymphocyte or an NK cell.

[0477] According to another embodiment, the invention relates to the transfected / transduced animal eukaryotic cell as described above, wherein said animal eukaryotic cell is a myofibroblast. In particular, the invention also relates to the transfected / transduced animal eukaryotic cell as described above, wherein said animal eukaryotic cell is a myofibroblast involved in a fibrosis process.

[0478] According to another embodiment, the subject of the invention is the transfected / transduced animal eukaryotic cell as described above, in which said animal eukaryotic cell is an astrocyte, in particular an astrocyte activated during brain or spinal cord trauma and forming a glial scar preventing regeneration. In particular, the subject of the invention is also the transfected / transduced animal eukaryotic cell as described above, in which said animal eukaryotic cell is an astrocyte activated during brain or spinal cord trauma forming a glial scar preventing regeneration.

[0479] According to another embodiment, the invention relates to the transfected / transduced animal eukaryotic cell as described above, in which said animal eukaryotic cell is an induced stem cell (iPS).

[0480] According to another aspect of the invention, the subject of the invention is a transfected / transduced animal eukaryotic cell as described above for its use in cell therapy, in particular for treating a pathology chosen from: cancer, leukemia and fibrosis.

[0481] According to another embodiment, the subject of the invention is the transfected / transduced animal eukaryotic cell as described above for its use as described above for treating a pathology chosen from: cancer, leukemia and fibrosis. In particular, the subject of the invention is the transfected / transduced animal eukaryotic cell as described above for its use as described above for treating cancer. In particular, the subject of the invention is the transfected / transduced animal eukaryotic cell as described above for its use as described above for treating leukemia.

[0482] The term "cell therapy" refers to a method known as "biotherapy" which aims to treat an organ or organism by providing therapeutic cells to replace, supplement or kill defective cells.

[0483] Alternatively and according to this same aspect, the subject of the invention is a method for treating a pathology chosen from: cancer, leukemia and fibrosis, said method comprising the administration of a transfected / transduced animal eukaryotic cell according to the invention (or of a pharmaceutical composition comprising at least one transfected / transduced animal eukaryotic cell according to the invention and a pharmaceutically acceptable excipient) to a patient in need thereof.

[0484] With the help of the tools of the invention, it allows the implementation of effective and safe cell therapies. These in fact exploit the so-called safety switch technology, which under the action of the right stimulus (and only the right stimulus) allows the activation of the inducible promoter of said expression cassette and the lifting of the inhibition of translation, making possible the expression of the transgene of interest, in particular a toxic or suicide transgene. In this case and by way of example, the therapeutic use of an immune cell:

[0485] ■ modified and armed to target and destroy cancer cells; and ■ transduced according to the invention with a toxic or suicide transgene, will, after its administration to a patient who needs it, play its role of targeting and destroying cancer cells. Only if this same immune cell becomes dysfunctional, it will then be possible to destroy it in order to avoid adverse effects, thanks to the safety systems provided by the invention (control of transcription induction and control of translation inhibition).

[0486] In any respect, it should be noted that the various aspects of the invention, as well as the various embodiments thereof, are interdependent. The latter can therefore be combined with each other as much as necessary to obtain preferred aspects and / or embodiments of the invention not explicitly described. This is also valid for all the definitions provided in this description, which applies to all aspects of the invention and its embodiments.

[0487] Further, the present invention is illustrated, but not limited to, the following figures and examples.

[0488] LIST OF FIGURES

[0489] Figure 1. Schematic of two 2xAARE promoters and functional comparison.

[0490] The synthetic 2xAARE promoter consists of two AARE sequences of the Trb3 gene coupled to a TATA box. The strength of the 2xAARE promoter under induced conditions, in the presence of the TATA box of the HSV TK gene (TK; SEQ ID NO: 29) or a synthetic TATA box (YB; SEQ ID NO: 28) was compared, a) Schematic of the two 2XAARE promoters TK (SEQ ID NO: 29) and 2xAARE YB (SEQ ID NO: 28). b) Transduction of Jurkat cells with pLV-2xAARE vectors TK -GFP-P2A-nLuc (SEQ ID NO: 4,448) and pLV-2xAARE YB -GFP-P2A-nLuc (SEQ ID NO: 4449). After transduction, cells were cultured in control media (complete and complete + DMSO) or in ATF4 induction conditions, either with leucine-deficient medium (Leu-) or with tunicamycin (1 pg / mL). Each bar represents the average of 5 independent experiments. Statistics, Two-way ANOVA.

[0491] Figure 2. Schematics of the vectors used, inducible by ATF4. a) 2xAARE vector YB -GFP-P2A-nLuc, b) 2xAARE vector YB -UTR-GFP-P2A-nLuc, c) 2xAARE vector CRE ' ACM -GFP-P2A-nLuc, d) 2xAARE vector CRE ACM -UTR-GFP-P2A-nLuc. UTR: Untranslated Region of the ATF4 gene. LTR: long terminal repeat, : psi packaging sequence, RRE: REV Responsive Element, cPPT / CTS: central polyplurine tract / central termination sequence, p2A: peptide 2A, SIN: se If -inactivated vector. These viral sequences are from the human immunodeficiency virus-1 (HIV-1). Figure 3. GFP expression under the control of the 2xAARE promoter YB with or without UTR in different cell lines. ac) Cells transduced with the pLV-2xAARE vector YB -GFP-P2A-nLuc (SEQ ID NO: 4449): a) B16F10, b) HEK-293T, c) EST10. df) Cells transduced with the pLV-2xAARE vector YB -UTR-GFP-P2A-nLuc (SEQ ID NO: 4450): d) B16F10, e) HEK-293T, f) EST109. Cells were transduced at MOI 10; B16F10 and HEK-293T were treated with artesunate (5 pM) and EST109 were treated with tunicamycin (1 pg / mL). Cells were labeled with the viability marker and then fixed with 1% PFA after an induction time of 16 h.

[0492] Figure 4. Expression of nanoluciferase under the control of the 2xAARE promoter YB with or without UTR in different cell lines. ac) Cells transduced with the pLV-2xAARE vector YB -GFP-P2A-nLuc (SEQ ID NO: 4449): a) B16F10, b) HEK-293T, c) EST10. df) Cells transduced with the pLV-2xAARE vector YB -UTR-GFP-P2A-nLuc (SEQ ID NO: 4450): d) B16F10, e) HEK-293T, f) EST 109. In each experiment n > 3, cells were transduced at MOI 10; B16F10 and HEK-293T were treated with artesunate (5pM), EST 109 were treated with tunicamycin (1 pg / mL). Supernatants were collected after 24h of induction. Statistical test: Student's t-test, ns: not significant; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001. RLU: Relative Light Units

[0493] Figure 5. Comparison of GFP expression levels under basal and induced conditions in 3 lines. ac) Cells transduced with the pLV-2xAARE vector YB -GFP-P2A-nLuc (SEQ ID NO: 4,449) or pLV-2xAARE YB -UTR-GFP-P2A-nLuc (SEQ ID NO: 4450), uninduced, a) B16F10, b) HEK-293T, c) EST109. Cells were labeled with the viability marker and then fixed with 1% PFA after an induction time of 16 h.

[0494] Figure 6. Induction rate of transgene expression under the control of the 2XAARE promoter YB with or without UTR in three cell lines.

[0495] Cells were transduced at MOI 10; B16F10 and HEK-293T were treated with artesunate (5 pM), EST109 were treated with tunicamycin (1 pg / mL). Left: GFP; right: nLuc.

[0496] Figure 7. Effect of UTR sequence on GFP expression at 24h and 48h before and after induction of the 2xAARE promoter YB and the promoter 2XAARE CRE ACM on EST109 cells. a) GFP expression at 24h. b) GFP expression at 48h. EST 109 cells were transduced at MOI 10 and treated with tunicamycin (1 pg / mL). The cells were labeled with the viability marker and then fixed with 1% PFA after an induction time of 24h or 48h. Figure 8. Study of GFP expression in NK-92 cells by the 2 AARE promoters YB and 2XAARE CRE ACM with and without UTR.

[0497] NK-92 cells were transduced at MOI 10 with pLV-2xAARE vectors YB -GFP-p2A- nLuc (SEQ ID NO: 4,449), pLV-2xAARE YB -UTR-GFP-p2A-nLuc (SEQ ID NO: 4,450), pLV-2xAARE CRE ACM -GFP-p2A-nLuc (SEQ ID NO: 4,451) or pLV-2xAARE CRE ACM -UTR- GFP-p2A-nLuc (SEQ ID NO: 4452) and treated or not with artesunate (1 pM). GFP expression was analyzed 48 hours after treatment by cytometry, a) Cells transduced by pLV-2xAARE vectors YB -GFP-p2A-nLuc (SEQ ID NO: 4,449) and pLV-2xAARE YB -UTR-GFP-p2A- nLuc (SEQ ID NO: 4450). b) Cells transduced by pLV-2xAARE vectors CRE ' ACM - GFP-p2A-nLuc (SEQ ID NO: 4,451) and pLV-2xAARE CRE ACM -UTR-GFP-p2A-nLuc (SEQ ID NO: 4452). Each column represents the average of 3 independent experiments. Statistics: ANOVA and multiple comparison test, ns: not significant; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.

[0498] Figure 9. Effect of UTR sequence on GFP expression in primary lymphocytes transduced with the 2xAARE vector YB ± UTR.

[0499] In each experiment n = 3 donors, primary lymphocytes were transduced at MOI 10 and treated with artesunate (2 μM). Cells were labeled with the viability marker and then fixed with 1% PFA after a 24-h induction time, and analyzed by cytometry. Statistical test: ANOVA and multiple comparison test, ns: not significant; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.

[0500] Figure 10. Induction rate of GFP expression under the control of the 2XAARE promoter YB ± UTR at 24h on transduced primary lymphocytes.

[0501] In each experiment n = 3 donors, primary lymphocytes were transduced at MOI 10 and treated with artesunate (2 pM). Cells were labeled with the viability marker then fixed with 1% PFA after a 24h induction time and analyzed by cytometry. Statistical test used: Student's t-test, ns: not significant; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.

[0502] Figure 11. Effect of UTR sequence on toxic gene expression in primary lymphocytes transduced with the 2xAARE vector YB ± UTR. a) Schematic of pLV-2xAARE vectors YB -Caspase3 (SEQ ID NO: 4,453), pLV-2xAARE YB - 5'UTR ATF4-Caspase3 (SEQ ID NO: 4,151), pLV-2xAARE YB -M2 (SEQ ID NO: 4,454), pLV-2xAARE YB -5'UTR ATF4-M2 (SEQ ID NO: 4150). b) Cell death rate of T lymphocytes transduced with vectors expressing the activated proapoptotic caspase 3 protein ± UTR in induced and uninduced conditions (n ​​= 5 donors), c) Cell death rate of T lymphocytes transduced with vectors expressing the M2 ion channel ± UTR in induced and uninduced conditions (n ​​= 5 donors). In all cases, stress induction was obtained by artesunate treatment (2 pM) and control by DMSO treatment; cells were analyzed by cytometry 24h after treatment; death was detected by annexin V and propidium iodide labeling. Statistical test: one-way ANOVA and multiple comparison test, ns: not significant; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.

[0503] Figure 12. Effect of the 5'UTR sequence of ATF4 on the expression of GFP and Cas9 nuclease in AML12 liver cells by the 2xAARE promoter YB . a) Measurement of GFP expression in AML-12 cells (mouse hepatocyte lines) transduced with pLV-2xAARE vectors YB -GFP-p2A-nLuc (SEQ ID NO: 4,449) and pLV-2xAARE YB -UTR-GFP-p2A-nLuc (SEQ ID NO: 4450) treated with artesunate (5 pM) or DMSO, by counting green cells / non-green cells; statistics, t-test and one-way ANOVA, ns: not significant; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001. b) Detection of cleavage of the PCR product of the genomic region of the PCSK9 gene targeted by Cas9 (c), based on T7 endonuclease I, in AML-12 cells transduced with pLV-2xAARE vectors YB -Cas9_U6-gRNA-PCSK9 (SEQ ID NO: 4,455) and pLV-2xAARE YB -UTR- Cas9_U6-gRNA-PCSK9 (SEQ ID NO: 4,456), 72h ast-induction by artesunate (ART) at 5 pM, or after treatment with DMSO.

[0504] EXAMPLES

[0505] MATERIALS & METHODS

[0506] Cloning of lentiviral plasmids

[0507] The lentiviral plasmids used in the experiments were cloned by enzymatic linearization and homology recircularization using the NEBuilder HiFi DNA Assembly protocol (New England Biolabs) by inserting synthesized sequences (Twist Bioscience) into a plasmid carrying the second-generation self-inactivating (SIN) lentiviral genome (pLV; SEQ ID NO: 4,142).

[0508] Cell culture

[0509] Cells were cultured in an incubator with a humidified and controlled atmosphere at 37°C and 5% CO2.

[0510] HEK-293T (Human Embryonic Kidney, ATTC-CRL-11268) were cultured in High Glucose Dulbecco's modified Eagle's medium (DMEM, Thermo Fischer) containing 10% fetal bovine serum (FCS) and 100 U / mL Penicillin / Streptomycin. Stress induction was achieved by treatment with tunicamycin (Sigma Aldrich).

[0511] EST109 cells (published as UKRV-Mel-2 [ECACC 13012436]; Artuc M et al. Biochem Biophys Res Commun. 213(2):699-705) were cultured under the same conditions, but in Roswell Park Memorial Institute medium (RPMI 1640, Thermo Fischer) containing 10% FCS and 100 U / mL Penicillin / Streptomycin; stress induction was achieved by treatment with artesunate (Sigma Aldrich).

[0512] B16F10 cells are a murine melanoma cell line (ATCC, CRL-6475). These cells were seeded at a density of 6,000 cells / cm 2 and cultured in Roswell Park Memorial Institute medium (RPMI 1640, Thermo Fischer) containing 10% FCS and 100 U / mL Penicillin / Streptomycin; stress induction was achieved by treatment with artesunate (Sigma Aldrich). They were passaged every 3 to 4 days.

[0513] NK-92 cells are a suspension-cultured cell line derived from NK lymphocytes from a patient with non-Hodgkin's lymphoma (ATCC, CRL-2407). These cells were seeded at a density of 200,000 cells / mL and cultured in RPMI + Glutamax medium (ThermoFisher, Ref: 61870-01), 20% FCS and 1% penicillin / streptomycin. They were passaged every 3 to 4 days.

[0514] Primary T lymphocytes isolated from the blood of healthy donors were cultured in serum-free, feeder-free medium (SFM) GIBCO OpTmizer™ CTS™ (Thermo Fischer) supplemented with Glutamax (Thermo Fischer) and 100 U / mL Penicillin / Streptomycin.

[0515] Alpha mouse liver 12 (AML-12; ATCC, CRL-2254) cells are a hepatocyte line from normal mouse liver. AML-12 cells were cultured in DMEM:F12 supplemented with 10% fetal bovine serum, 10 pg / mL insulin, 5.5 pg / mL transferrin, 5 ng / mL selenium, and 40 ng / mL dexamethasone.

[0516] Production of lentiviral vectors

[0517] Non-replicating lentiviral particles were obtained using the second-generation production protocol described by Zennou et al. in 2001 (NatBiotechnol. 2001 May;19(5):446-50). HEK 293T cells were seeded onto media suitable for cell culture and grown to 50-60% confluence after 24 hours of culture. The next day, the cells were cotransfected, by the calcium phosphate precipitation method, with the plasmid encoding the lentiviral genome (pLV or pLVi) and two transcomplementing plasmids encoding the HIV-1 enzymes and structural proteins (p8.9; SEQ ID NO: 4458 or 4459) and the envelope glycoprotein of the vesicular stomatitis virus (pVSVg; SEQ ID NO: 4457). Cotransfection was carried out at a plasmid ratio of 2:2:1. The transfected cells were cultured for 5 hours in contact with the precipitate and then the culture medium was renewed.The supernatant containing the lentiviral particles was harvested 48 hours later. The lentiviral suspension was treated with DNAse I to remove persistent plasmids, filtered (membrane porosity 0.2 μm) and then ultra-centrifuged at 60,000g for 90 minutes at 4°C. The particle pellets were taken up in a volume of phosphate-buffered saline (PBS) corresponding to a concentration of a factor of 1000. The suspensions obtained were aliquoted and stored at -80°C until use.

[0518] Titration

[0519] The concentration of lentiviral particles was determined by quantification of the lentiviral capsid protein p24. For this, an aliquot of lentiviral suspension was thawed, lysed and diluted according to the supplier protocol of the HIV-1 p24 Antigen ELISA 2.0 titration kit (Zeptometrix ref. 0801008). The p24 concentration obtained was expressed in pg / pL, the equivalent of which is 1 pg of p24 for 104 VSVg-pseudotyped physical lentiviral particles (Dull, T et al. J Virol. 1998 Nov;72(l 1 ):8463-71 ). Tests can specify these values, but, on average, 1% of the physical particles obtained are infectious, i.e. 1 pg ~ 100 transduction units (TU). Transduction

[0520] To integrate a transgene by infection of a lentiviral vector, the quantity of particles necessary to obtain the desired multiplicity of infection (vector:target ratio) was diluted in culture medium. This lentiviral suspension was brought into contact with the target cells. The infected cells were cultured for at least 24 hours. Depending on the integrated promoter / gene cassette, transgene expression could be observed or measured the following day by microscopy, cytometry, or biochemical analysis.

[0521] Establishment of a KRAB line (CRISPRi)

[0522] HEK 293 T cells were transduced with a lentiviral vector (SEQ ID NO: 4407) carrying the constitutive expression cassettes:

[0523] ■ the dCas9-KRAB fusion protein (SEQ ID NO: 4405) fused by a 2A peptide (SEQ ID NO: 4463) to the blasticidin resistance gene (BlastR) (SEQ ID NO: 4406) under the control of the eF-1a minimal promoter (SEQ ID NO: 4398); and

[0524] ■ guide RNA specific to the targeted promoter (SEQ ID NO: 4397) under the control of the U6 promoter (SEQ ID NO: 4396).

[0525] Two days later, transduced cells were selected by treatment with blasticidin (2 μg / mL). Cells were cloned by limiting dilution, and each clone was characterized.

[0526] Establishment of a KRAB (CRISPRi) and DNMT (CRISRPm) line

[0527] HEK 293 T cells are transduced with a lentiviral vector (SEQ ID NO: 4447) carrying the constitutive expression cassettes:

[0528] ■ the KRAB-dCas9-DNMT3 AL fusion protein (SEQ ID NO: 4446) fused by a 2A peptide (SEQ ID NO: 4463) to the blasticidin resistance gene (BlastR) (SEQ ID NO: 4406) under the control of the eF-1a minimal promoter (SEQ ID NO: 4398); and

[0529] ■ guide RNA specific to the targeted promoter (SEQ ID NO: 4397) under the control of the U6 promoter (SEQ ID NO: 4396).

[0530] Two days later, transduced cells were selected by treatment with blasticidin (2 pg / mL). HEK-CRISPRi / m cells SV40 are cloned by limiting dilution and each clone is characterized.

[0531] Flow cytometry analysis

[0532] At the end of the experiment, the cultured cells were harvested and rinsed with PB S. For GFP analysis, the cells were then fixed in PB S with 1% paraformaldehyde for 15 minutes at 4°C. For cell death analysis, after rinsing with PBS, the cells were incubated for 30 minutes with F Annexin-V (AnV) and propidium iodide (PI), then rinsed and fixed in PBS with 1% paraformaldehyde for 15 minutes at 4°C. After rinsing, the AnV+ / PI+ co-labeling allows the death rate (proportion of cells in the late phase of apoptosis) to be measured using the MACSQuant Analyzer 10 cytometer (Miltenyi). Luciferase activity measurement

[0533] The nanoluciferase assay was performed to characterize the effect of the UTR on secreted nano-Luc transgene expression. For this, supernatants were collected and diluted 1 / 500 eme The Nano-Gio Luciferase Assay kit protocol (Promega, Ref: NI 120) was used following the supplier's instructions. Samples and reagents were deposited on a 96-well Lumitrac plate (Greiner Bio-One) (V / V), then incubated for 3 minutes and read on the Spectramax i3000.

[0534] A protein assay of the same samples was also performed from the cell pellets to normalize the nanoluciferase assay results. The cell pellets were lysed with 20 μL of RIPA buffer (ThermoFisher, Ref: 89901) for 10 min at 4°C. The Pierce BCA Protein Assay Kit (ThermoFisher, Ref: 23225) was used and the supplier's instructions were followed to deposit the samples and the BCA reagent on a 96-well UV-STAR plate (Greiner Bio-One). The plate was incubated for 30 minutes at 37°C and read on the Spectramax i3000.

[0535] PCSK9 gene cutting analyses

[0536] Detection of genomic cleavage of the PCSK9 gene, based on T7 endonuclease I (GeneArt Genomic detection kit, Thermofisher Scientific), in AML-12 cells, 72 h / lo t-induction by 5 pM artesunate (ART) or with its vehicle (DMSO). Nip analysis was performed as recommended by the manufacturer. Briefly, the genomic cleavage detection kit relies on the presence of genomic insertions or deletions (indels) created by cellular repair mechanisms following a Cas9 nuclease-induced gene cut. The loci where gene-specific double-strand breaks occur were amplified by PCR. The approximately 500 bp PCR product around the cleavage site was denatured and reannealed so that mismatches were generated.These mismatches were then detected and cleaved by T7 endonuclease I, and the resulting bands were analyzed by gel electrophoresis and band densitometry (LabChip GX Touch Nucleic Acid Analyzer, PerkinElmer).

[0537] Mouse PCSK9 oligos, sense: AGTACCCACACCCCAGAAGG (SEQ ID NO: 4464) and antisense: CACCAGACGGCTAGATGAGC (SEQ ID NO: 4465). The uncleaved PCSK9 PCR product is 505 bp, and the exon 1 cleavage product gives two bands of approximately 350 and 150 bp. The PCSK9 gRNA sequence is TGCTCGCCCTCCCGTCCCAG (SEQ ID NO: 4466).

[0538] RESULTS

[0539] A more efficient TATA gearbox

[0540] The 2XAARE promoter structure contains two tandems of three AARE response elements from the TRIB3 gene and a TATA box from the HSV thymidine kinase gene (TATA TK ; SEQ ID NO: 29) or a synthetic TATA box (TATA YB ; SEQ ID NO: 28) (Fig. 1A). After transduction of IURKAT cells with the lentiviral vectors pLV-2xAARE TK -GFP-P2A- nLuc (SEQ ID NO: 4,448) or pLV-2xAARE YB -GFP-P2A-nLuc (SEQ ID NO: 4449), it was measured that both constructs have equivalent basal expression of the GFP transgene, but that the pLV-2xAARE vector YB -GFP-P2A-nLuc (SEQ ID NO: 4449), allows approximately two times higher induced expression than the pLV-2xAARE vector TK -GFP-P2A-nLuc (SEQ ID NO: 4,448) (Fig. 1B).

[0541] These data therefore demonstrated that the association of 2xAARE sequences with the TATA box YB is more efficient than the combination of the 2xAARE sequence with a TATA box TK .

[0542] Furthermore, a new optimized 2xAARE promoter (hereinafter 2XAARE CRE ' ACM ) was also constructed (SEQ ID NO: 34). This contains, in addition to the two AARE tandems of the TRIB3 gene coupled to the minimal synthetic promoter TATA YB , the ATF / CRE (ATF-associated APMc response element) and ACM (an ATF / CRE modifying element) sequences of the CHAC1 gene that bind the transcription factors ATF4, ATF3, and CEBPb (Fig. 2).

[0543] Functionality test of the association of an inducible promoter with the UTR of the ATF4 gene. The effect of the 5'UTR of ATF4 was studied on the expression of a transgene placed under the control of the 2xAARE-TATA promoters. YB (SEQ ID NO: 28) or 2XAARE CRE ACM (SEQ ID NO: 34). For this, in the following experiments, four lentiviral vectors were obtained to transduce the three cell lines, B16F10 (murine melanoma), HEK-293T (human embryonic kidney) and EST109 (human melanoma). These vectors carried, i) the GFP-P2A-nLuc reporter gene expression cassette (SEQ ID NO: 4,467), or ii) the UTR-GFP-P2A-nLuc expression cassette (SEQ ID NO: 4,468), distinguished only by the presence or absence of the 5'UTR region of ATF4 (SEQ ID NO: 1) 5' of the GFP-P2A-nLuc transgene sequence (SEQ ID NO: 4,467). In these vectors, the expression of the GFP-P2A-nLuc and UTR-GFP-P2A-nLuc transgenes is controlled by the inducible 2xAARE promoters YB (SEQ ID NO: 28) or 2XAARE CRE ACM (SEQ ID NO: 34) (Fig. 2).

[0544] Characterization of the coupling of an inducible promoter and the 5'UTR of ATF4

[0545] Mouse (B16F10) or human (HEK-293T, EST109) cell lines were initially transduced with a lentiviral vector (pLV) pLV-2xAARE YB -GFP-P2A-nLuc (SEQ ID NO: 4,449) or pLV-2xAARE YB -UTR-GFP-P2A-nLuc (SEQ ID NO: 4450). In the three cell types transduced with the pLV-2xAARE vector YB -GFP-P2A-nLuc (SEQ ID NO: 4449), an increase in the number of GFP-expressing cells was observed after the induction of stress for 16 hours. This rate of GFP-expressing cells under stress conditions was 28 times higher in B16F10 cells, 17 times higher in HEK-293T cells and 3 times higher in EST 109 cells, compared to non-stressed cells. This indicates that ATF4 was indeed induced in B16F10 and HEK-293T cells by artesunate treatment and in EST109 cells by tunicamycin treatment (Fig. 3a-c).

[0546] To evaluate the effect of the UTR, these same cells were transduced with the pLV-2xAARE vector YB -UTR-GFP-P2A-nLuc (SEQ ID NO: 4450) with the same multiplicity of infection (MOI) of 10. These cells were treated in the same way as the cells transduced with the vector without UTR and it was observed that the presence of the UTR allows a significant induced expression of GFP after the induction of stress for 16 hours in the three cell types. Thus, with the pLV-2xAARE vector YB -UTR-GFP-P2A-nLuc (SEQ ID NO: 4450), the percentage of cells expressing GFP under stress conditions was 31 times higher in B16F10 cells, 60 times higher in HEK-293T cells and 7 times higher in EST109 cells than in untreated cells, i.e. induction rates 2 to 3 times higher than with the construct without UTR. This indicates that the presence of the 5' UTR of ATF4 (SEQ ID NO: 1) increased the induction rate in these cells by stress (Fig.

[0547] 3d-f)

[0548] Since the vectors used also express secreted nanoluciferase (nLuc), similar experiments were conducted to evaluate nLuc expression in the supernatant of cells transduced with pLV-2xAARE vectors. YB -GFP-P2A-nLuc (SEQ ID NO: 4,449) and pLV-2xAARE YB -UTR-GFP-P2A-nLuc (SEQ ID NO: 4,450).

[0549] Regarding cells transduced with the pLV-2xAARE vector YB -GFP-P2A-nLuc (SEQ ID NO: 4449), it was observed that stress induction in transduced HEK-293T cells resulted in a significant approximately 9-fold increase in nanoluciferase secretion (Fig. 4b). A non-significant (ns) increase in nanoluciferase (nLuc) secretion was also observed in 16F 10 and EST 109 B cells (Fig. 4a, c).

[0550] Regarding cells transduced with the pLV-2xAARE vector YB -UTR-GFP-P2A-nLuc (SEQ ID NO: 4450), it was observed that the presence of the UTR decreased the basal expression of nLuc, and that this construct also allowed a significant increase in nanoluciferase secretion after stress induction in the three cell types B 16F 10 (30x, p<0.05), HEK-293T (130x, p<0.01) and EST109 (4x, p<0.05) (Fig. 4d-f).

[0551] These experiments therefore established that the presence of the 5' UTR of ATF4 (SEQ ID NO: 1) leads to a decrease in transgene expression under basal conditions and that it does not hinder regulation of transgene expression by stress in three lines.

[0552] The decrease in basal GFP expression levels in the absence of stress was then quantified in the three cell lines transduced with the pLV-2xAARE-GFP-P2A-nLuc vectors (SEQ ID NO: 4,449) and pLV-2xAARE YB -UTR-GFP-P2A-nLuc (SEQ ID NO: 4450). Thus, it was observed that the 5' UTR of ATF4 (SEQ ID NO: 1) significantly reduced the basal level of GFP expression in all three cell types: 3-fold in B16F10 cells, 13-fold in HEK-293T cells and 8-fold in EST109 cells (Fig. 5a-c).

[0553] Furthermore, by looking at the induction rate, which was measured using the following formula:

[0554] Transgene expression after induction Induction rate — -

[0555] Transgene expression before induction it was observed that by an effect of reduction of the basal expression of the transgene by the 2xAARE promoter YB (SEQ ID NO: 28), the 5'UTR of ATF4 (SEQ ID NO: 1) increased the induction rate of transgene expression + UTR compared to the transgene without UTR. Indeed, this measurement showed that the transgene induction rates at 24h are 2 to 3.5 times higher in the presence of the 5'UTR of ATF4 (SEQ ID NO: 1) for GFP, and 1.5 to 12 times higher for secreted nLuc (Fig. 6a, b).

[0556] These results therefore showed that the addition of the effects of the 2xAARE promoter YB (SEQ ID NO: 28) and the 5'UTR of ATF4 (SEQ ID NO: 1) promotes a decrease in basal transgene expression and therefore, a greater increase in the induction rate of transgene expression in the three cell lines EST109, B16F10 and HEK-293T.

[0557] In order to explore whether induction time increases transgene expression, another experiment was performed focusing on the EST 109 line in which the lowest induction rate of GFP and nLuc transgene expression was measured at 24 h. In this experiment, GFP expression was compared after 24 h and 48 h after tunicamycin induction. In addition, in this experiment, two other vectors carrying a 2XAARE promoter were also studied. CRE ' ACM (SEQ ID NO: 34) with and without 5' UTR of ATF4 (SEQ ID NO: 1). These vectors are the pLV-2xAARE CRE ACM -GFP-p2A-nLuc (SEQ ID NO: 4,451) and pLV-2xAARE CRE - ACM -UTR-GFP-p2A-nLuc (SEQ ID NO: 4,452) (Fig. 2).

[0558] EST 109 cells were transduced at MOI 10 and then treated with tunicamycin (1 μg / mL) to induce endoplasmic reticulum stress.

[0559] Regarding the activity of the 2xAARE promoter YB (SEQ ID NO: 28) at 24h, the results obtained indicate that after a 24h induction the percentage of cells expressing GFP is equivalent to that observed after 16h of induction (Fig. 7a). However, by maintaining stress for 48h, it was found that the increase in GFP expression is greater in cells transduced with pLV-2xAARE vectors YB and pLV-2xAARE CRE ' ACM containing the UTR (SEQ ID NOs: 4449 and 4451). Indeed, by increasing the induction time from 24h to 48h, a 2.75-fold increase in GFP expression was observed for cells transduced with the pLV-2xAARE vector YB -UTR-GFP-p2A-nLuc (SEQ ID NO: 4450) while maintaining low basal expression of the transgene. This increase was not observed for cells transduced with a vector without a UTR (Fig. 7b). UTR-containing mRNAs were therefore more favorably translated over time in a stress context than UTR-less mRNAs.

[0560] Regarding EST 109 cells transduced with 2xAARE vectors CRE ' ACM -GFP-p2A-nLuc (SEQ ID NO: 4450), high basal GFP expression was observed, approximately 3 times higher than in cells transduced with the pLV-2xAARE vector YB -GFP-p2A-nLuc (SEQ ID NO: 4449) (Fig. 7a). Interestingly, in cells transduced with the pLV-2xAARE vector CRE ACM -UTR-GFP-p2A-nLuc (SEQ ID NO: 4452), it was observed that the sole addition of the 5'UTR of ATF4 (SEQ ID NO: 1) 5' of the transgene caused the basal expression to drop by more than 20-fold with only 1% of cells expressing GFP; a basal expression equivalent to that observed in cells transduced with the pLV-2xAARE vector YB -UTR-GFP-p2A-nLuc (SEQ ID NO: 4450). Finally, EST109 cells transduced with the pLV-2xAARE vector CRE ACM -UTR-GFP-p2A-nLuc (SEQ ID NO: 4452) showed higher induced expression than cells transduced with pLV-2xAARE vectors YB -GFP-p2A-nLuc (SEQ ID NO: 4,449) or pLV-2xAARE YB -UTR-GFP-p2A-nLuc (SEQ ID NO: 4450) at 24 and 48 h after induction of tunicamycin stress (Fig. 7a).

[0561] GFP expression at 24h and 48h was equivalent in EST 109 cells transduced with the pLV-2xAARE vector CRE ' ACM -GFP-p2A-nLuc (SEQ ID NO: 4451). However, the association of the effects of the 2XAARE promoter CRE ' ACM (SEQ ID NO: 34) and the 5'UTR of ATF4 (SEQ ID NO: 1) allowed, in EST 109 cells transduced with the vector pLV-2xAARE CRE ACM -UTR-GFP-p2A-nLuc (SEQ ID NO: 4452), an equivalent induction of GFP as the pLV-2xAARE vector CRE ' ACM without UTR (SEQ ID NO: 4450) while maintaining low basal expression of the transgene in uninduced conditions (Fig. 7b).

[0562] These experiments therefore demonstrated that the 5'UTR of ATF4 (SEQ ID NO: 1) significantly reduced the basal expression of a transgene controlled by a weak inducible promoter (2xAARE YB ; SEQ ID NO: 28) or strong (2XAARE CRE - ACM ; SEQ ID NO: 34). These experiments also demonstrated that the addition of the transcriptional effects of these inducible promoters and / w.s7-transcriptional effects of the 5'UTR of ATF4 (SEQ ID NO: 1), significantly increases the induction rate of both promoters.

[0563] Demonstration of the addition of transcriptional effects of 2xAARE promoters YB or 2XAARE ACM ~ CRE and post-transcriptional 5'UTR of ATF 4 in NK-92 cells and human primary T lymphocytes

[0564] Study on NK-92 cells

[0565] How 2xAARE promoters work YB (SEQ ID NO: 28) and 2XAARE ACM ' CRE (SEQ ID NO: 34) was studied in NK-92 cells in order to measure the expression of the GFP transgene associated or not with the 5'UTR of ATF4 (SEQ ID NO: 1). For this, NK-92 cells were transduced with the pLV-2xAARE vectors YB -GFP-p2A-nLuc (SEQ ID NO: 4,449), pLV-2xAARE YB - UTR-GFP-p2A-nLuc (SEQ ID NO: 4,450), pLV-2xAARE CRE ACM -GFP-p2A-nLuc (SEQ ID NO: 4,451) and pLV-2xAARE CRE ACM -UTR-GFP-p2A-nLuc (SEQ ID NO: 4452) at MOI 10, then induced with artesunate (1 pM) for 48h.

[0566] In these experiments, it was observed that under basal conditions, approximately 15% of NK-92 cells transduced with the pLV-2xAARE vector YB -GFP-p2A-nLuc (SEQ ID NO: 4449), expressed GFP, but that approximately 80% of these cells expressed GFP 48 hours after stress induction, a 5-fold induction rate. In these same cells, transduction with a pLV-2xAARE vector YB -UTR-GFP-p2A-nLuc (SEQ ID NO: 4450), resulted in a 2-fold decrease in basal GFP expression compared to the same vector without UTR, but an 8-fold induction under stress conditions (Fig. 8a). In NK-92 cells transduced with the pLV-2xAARE vector CRE ' ACM -GFP-p2A-nLuc (SEQ ID NO: 4451) very strong basal expression was detected in 90% of cells and almost zero induction rate by stress. However, the addition of the 5'UTR of ATF4 (SEQ ID NO: 1) to this construct and the transduction of NK-92 cells with the pLV-2xAARE vector CRE ACM -UTR-GFP-p2A-nLuc (SEQ ID NO: 4452) promoted a 15-fold reduction in basal expression, to levels equivalent to those obtained with the 2XAARE promoter YB (SEQ ID NO: 28), and 14x induced expression under stress conditions (Fig. 8b)

[0567] These results therefore showed a significant gain in the induction rate obtained by the association of 2xAARE promoters. YB (SEQ ID NO: 28) or 2XAARE CRE ' ACM (SEQ ID NO: 34) and the 5'UTR of ATF4 (SEQ ID NO: 1) compared to these same promoters without UTR. In addition, these experiments showed that there is a linear relationship of proportionality between the transcriptional strength of the inducible promoter and the decrease in basal expression by the 5'UTR of ATF4 (SEQ ID NO: 1). Thus, the 5'UTR of ATF4 (SEQ ID NO: 1) promoted a decrease in basal expression that was all the more significant as the transcriptional leakage of the inducible promoter was strong.

[0568] Study on primary T lymphocytes.

[0569] The function of the 2xAARE promoter was studied in primary T lymphocytes, with and without UTR, transduced with pLV-2xAARE vectors YB -GFP-p2A-nLuc (SEQ ID NO: 4,449) or pLV-2xAARE YB -UTR-GFP-p2A-nLuc (SEQ ID NO: 4450) at MOI 10, then induced with artesunate (2 pM).

[0570] Under basal conditions, 8% of T cells transduced with the pLV-2xAARE vector YB -GFP-p2A- nLuc (SEQ ID NO: 4449) expressed GFP, compared to 30% after 24h of induction. In primary T cells transduced with the pLV-2xAARE vector YB -UTR-GFP-p2A-nLuc (SEQ ID NO: 4450) 4% of cells expressed GFP in basal conditions, but 50% in induced conditions, i.e. an induction rate of approximately 4 times with the vectors without UTR and 12x with the vector with UTR (Fig. 9). Thus, in primary T lymphocytes, the association of the 2xAARE promoter YB (SEQ ID NO: 28) and the 5'UTR of ATF4 (SEQ ID NO: 1) decreased basal expression by 2-fold, but significantly increased the induction rate by 3-fold under stress conditions (Fig. 10).

[0571] To study the effect of the association of the 2xAARE promoter YB (SEQ ID NO: 28) and the 5'UTR of ATF4 (SEQ ID NO: 1) for the regulation of toxic gene expression in T lymphocytes, four new constructs were designed, where the inducible promoter 2XAARE YB (SEQ ID NO: 28) controls the expression of the activated caspase 3 gene (SEQ ID NOs: 41 and 42) or a mutant version of the influenza virus M2 ion channel (SEQ ID NOs: 39 and 40), with or without UTR. Cas constructs are as follows, pLV-2xAARE YB -Caspase3 (SEQ ID NO: 4,453), pLV-2xAARE YB -5'UTR ATF4-Caspase3 (SEQ ID NO: 4,151), pLV-2XAARE YB -M2 (SEQ ID NO: 4,454), pLV-2xAARE YB -5'UTR ATF4-M2 (SEQ ID NO: 4,150) (Fig. Ila).

[0572] T cells from five donors were transduced at MOI 10 with these four vectors and the cells were treated with artesunate to induce stress, or DMSO vehicle as a control. In T cells transduced with the pLV-2xAARE vector YB -Caspase 3 (SEQ ID NO: 4453), cell death was observed in approximately 20% of cells under basal conditions, but in approximately 30% of cells under induced conditions. However, in T cells transduced with the pLV-2xAARE vector YB -5'UTR ATF4-Caspase3 (SEQ ID NO: 4151), cell death was observed in approximately 10% of cells in basal conditions and in 25% of cells in induced conditions, 24 hours after treatment. These results therefore showed that the addition of the 5'UTR of ATF4 (SEQ ID NO: 1) 5' of the Caspase 3 transgene (SEQ ID NOs: 41 and 42) reduced cell death in basal conditions by 2 times and increased the induction rate (Fig. 11b).

[0573] Similarly, transduction of T lymphocytes with the pLV-2xAARE vector YB -M2 (SEQ ID NO: 4454), cell death was observed in approximately 30% of cells under basal conditions, but in approximately 50% of cells under induced conditions. However, in T cells transduced with the pLV-2xAARE vector YB -5'UTR ATF4-M2 (SEQ ID NO: 4150), cell death was observed in approximately 15% of cells in basal conditions and in 50% of cells in induced conditions, 24 hours after treatment. These results therefore showed that the addition of the 5'UTR of ATF4 (SEQ ID NO: 1) 5' of the M2 transgene (SEQ ID NOs: 39 and 40) reduced cell death in basal conditions by 2 times and increased the induction rate after artesunate treatment (Fig. 11c).

[0574] These data therefore demonstrated that the technology implemented by the combination of an inducible promoter and the 5'UTR of ATF4 (SEQ ID NO: 1) offers a new tool of great interest in human clinical practice in that it offers fine regulation of the transgene of interest, in particular:

[0575] ■ for the expression of a toxic transgene to induce the death of the genetically modified cell;

[0576] ■ for the expression of Cas9 nuclease for in vivo gene editing or

[0577] ■ for the expression of any other transgene whose expression requires fine regulation such as oncogenes, antioncogenes, transcription factors, trophic factors, cytokines, enzymes, hormones, receptors, ligands, heterologous proteins, chimeric proteins, immunogenic proteins, antibodies.

[0578] The typical device represented in these results by the association of the inducible promoter 2XAARE YB (SEQ ID NO: 28) and the 5'UTR of ATF4 (SEQ ID NO: 1) is only a particular case to exemplify the association of any promoter inducible by transcription factors other than ATF4 with a coding or non-coding sequence having regulatory properties at the / w.s7-transcriptional level to which it is possible to extrapolate the invention. Functional study of the expression of Cas9 on hepatocyte cells.

[0579] The function of the 2xAARE promoter was studied in immortalized mouse hepatocytes (AML-12) with and without UTR, transduced with pLV-2xAARE vectors YB -GFP-p2A-nLuc (SEQ ID NO: 4,449) or pLV-2xAARE YB -UTR-GFP-p2A-nLuc (SEQ ID NO: 4450), then induced with artesunate (5 pM) or DMSO vehicle for 72h. Under these conditions, it was observed that basal GFP expression is approximately 20 times lower in AML-12 cells transduced with the pLV-2xAARE vector YB -UTR-GFP-p2A-nLuc (SEQ ID NO: 4450) than in cells transduced with the vector without the UTR (Fig. 12a). However, after induction with artesunate, GFP expression was observed in an equivalent proportion of cells between 50 and 60% of the cells. Due to a lower basal expression in cells transduced with the vector possessing the 5'UTR of ATF4 (SEQ ID NO: 1), an induction rate in AML-12 cells of approximately 40 times higher was observed if these were transduced with the vector pLV-2xAARE YB -UTR-GFP-p2A- nLuc (SEQ ID NO: 4450) compared to cells transduced with the pLV-2xAARE vector YB -GFP-p2A-nLuc (SEQ ID NO: 4449) (Fig. 12b). These results therefore showed that the addition of the 2xAARE promoter YB (SEQ ID NO: 28) and the 5'UTR of ATF4 (SEQ ID NO: 1) significantly reduced the background noise in AML-12 cells.

[0580] To investigate whether differences in basal expression between vectors with and without UTRs result in variation in double-stranded cleavage of F genomic DNA by Cas9 nuclease, four vectors were designed expressing the Staphylococcus aureus Cas9 nuclease (saCas9; SEQ ID NOs: 53 and 54) under the control of the inducible 2xAARE promoter. YB (SEQ ID NO: 28) with and without the 5'UTR of ATF4 (SEQ ID NO: 1), or a control vector where saCas9 is under the control of the ubiquitin constitutive C (UBC) promoter (SEQ ID NO: 4,469). These vectors also carried an expression cassette of a gRNA recognizing a 20-base sequence (TGCTCGCCCTCCCGTCCCAG; SEQ ID NO: 4,466) in exon 1 of the mouse PCSK9 gene. As a negative control, a vector expressing saCas9 under the control of the 2xAARE promoter was used. YB (SEQ ID NO: 28) and a scramble (Sc) gRNA that does not recognize any sequence in the mouse genome. Thus, the vectors for the inducible expression of saCas9, pLV-2xAARE YB -Cas9_U6-gRNA-PCSK9 (SEQ ID NO: 4,455), pLV- 2xAARE YB -UTR-Cas9_U6-gRNA-PCSK9 (SEQ ID NO: 4,456), pLV-2xAARE YB -Cas9_U6- gRNA-Sc (SEQ ID NO: 4412) or for constitutive expression of saCas9, pLV- UBC- CAS9_U6-gRNA-PCSK9 (SEQ ID NO: 4469) were used to transduce AML-12 cells at MOI 50. Seventy-two hours after transduction, the cells were treated with artesunate or DMSO. After 72h of treatment, genomic DNA from the cells was purified and then used to measure the level of PCSK9 gene cleavage by saCas9. No cleavage was observed with the pLV-2xAARE vector. YB -Cas9_U6-gRNA-Sc (SEQ ID NO: 4412), but maximal cleavage in cells transduced with the pLV-UBC-CAS9_U6-gRNA-PCSK9 vector (SEQ ID NO: 4469), whether in induced or uninduced conditions.

[0581] Additionally, in cells transduced with the pLV-2xAARE vector YB -Cas9_U6-gRNA-PCSK9 (SEQ ID NO: 4455) a low cleavage rate was observed in basal conditions, but a high cleavage rate in induced conditions. In AML-12 cells transduced with the pLV-2xAARE vector YB - UTR-Cas9_U6-gRNA-PCSK9 (SEQ ID NO: 4456) cleavage was observed only in induced conditions, but not in the absence of induction (Fig. 12a).

[0582] These results therefore showed that the addition of the 2xAARE promoter YB (SEQ ID NO: 28) and the 5'UTR of ATF4 (SEQ ID NO: 1) was able to abolish the cleavage of genomic DNA in AML-12 cells, but that this construct remains functional to cleave DNA under induced conditions. Thus, the addition of an inducible promoter such as the 2xAARE promoter YB (SEQ ID NO: 28) and a 5'UTR with properties equivalent to that of ATF4 is of clinical use to ensure a transient function of the nuclease limited to the induction time.

[0583] CONCLUSION

[0584] This work demonstrated that the 5'UTR of ATF4 (SEQ ID NO: 1) reduced the basal expression of the transgene placed under the control of an inducible promoter, 2xAARE YB (SEQ ID NO: 28) or 2XAARE CRE ' ACM (SEQ ID NO: 34). These experiments established that the assembly of 2xAARE promoters YB (SEQ ID NO: 28) or 2XAARE CRE ' ACM (SEQ ID NO: 34) with the 5'UTR of ATF4 (SEQ ID NO: 1) significantly increased the induction rates of transgene expression under stress conditions. In addition, extending the induction time by stress showed that the expression of a transgene coupled to the 5'UTR of ATF4 (SEQ ID NO: 1) was more gradual, but reached expression levels equivalent to those observed in the absence of the UTR of ATF4 SEQ ID NO: 1 (SEQ ID NO: 1).

[0585] Particularly unexpectedly, it was also observed that the 5'UTR of ATF4 (SEQ ID NO: 1) played a / w.s7-transcriptional regulatory role by strongly reducing the translation of the transgene in basal conditions. This tool is therefore particularly interesting in gene therapy to control the expression of transgenes whose product is toxic, immunogenic or transforming or for the control of the expression of a Cas nuclease for genome engineering.

Claims

CLAIMS 1. In vitro use of a sequence chosen from the sequences having at least 90% identity with the sequences SEQ ID NOs: 1 to 27 to reduce or suppress the leakage of expression of a transgene of interest located downstream of an inducible promoter, said sequence having regulatory properties at the / w.s7-transcriptional level and being located at the 5' end of said transgene of interest.

2. Expression cassette comprising an inducible promoter upstream of a transgene of interest, said transgene of interest comprising at its 5' end a sequence chosen from the sequences having at least 90% identity with the sequences SEQ ID NOs: 1 to 27, said sequence having regulatory properties at the / w.s7-transcriptional level.

3. Expression cassette according to claim 2, wherein said inducible promoter is chosen from: ■ the 2XAARE YB TATAwhose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 28; ■ the 2XAARE TK whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 29; ■ the 4XSRE YB TATA whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 30; ■ the 9XHRE YB TATA whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 31; ■ the GRP78 YB TATA whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 32; ■ the tissue-specific promoter of miR223 whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO: 33; and ■ the 2XAARE CRE ' ACM (OR miniCHACl YB -TATA ) whose nucleic acid has a sequence having at least 80% identity with the nucleic acid of sequence SEQ ID NO:

34.

4. Expression cassette according to claim 2 or 3, wherein said transgene of interest is a transgene chosen from: ■ a toxic or suicide transgene capable of inducing the death of a cell; ■ a therapeutic transgene selected from: oncogenes, antioncogenes, transcription factors, trophic factors, cytokines, enzymes, hormones, receptors, ligands, heterologous proteins, chimeric proteins, immunogenic proteins and antibodies; and ■ a transgene for gene editing.

5. Vector genome comprising a viral genome into which an expression cassette according to any one of claims 2 to 4 has been introduced, in particular in which the 5' to 3' orientation of the transcription of said expression cassette is reversed with respect to the 5' to 3' orientation of the transcription of said viral genome.

6. Plasmid comprising an expression cassette according to any one of claims 2 to 4, or a vector genome according to claim 5 and the means for expressing it.

7. Use of a plasmid according to claim 6 for producing a viral vector comprising a vector genome according to claim 5 using an animal eukaryotic cell.

8. Method for producing lentiviral vectors comprising a vector genome according to claim 5, said method comprising at least the steps of: a. co-transfecting an animal eukaryotic cell with: ■ a plasmid according to claim 6; ■ a plasmid comprising an envelope protein and the means for expressing it; and ■ a plasmid comprising the structural proteins and enzymes of HIV-1, and the means for expressing it, to obtain a transfected animal eukaryotic cell; b. culturing said transfected animal eukaryotic cell to enable the production of lentiviral vectors comprising a vector genome according to claim 5; and c. harvesting and purifying said lentiviral vectors.

9. Method for producing lentiviral vectors according to claim 8, wherein said animal eukaryotic cell expresses at least one ribonucleoprotein complex comprising: ■ a fusion protein comprising the fusion: - an inactive Cas endonuclease (dCas); and - a KRAB transcriptional repression domain or a methylation domain selected from: DNMT3A, DNMT3B, DNMT3A-L and DNMT3B-L, or a fusion protein comprising the fusion: - a KRAB transcriptional repression domain; - an inactive Cas endonuclease (dCas); and - a methylation domain chosen from: DNMT3A, DNMT3B, DNMT3 AL, DNMT3B-L and MeCP2; and ■ a guide RNA (gRNA) specifically recognizing the promoter sequence of said inducible promoter, said at least one ribonucleoprotein complex dCas-KRAB / gRNA, dCas- DNMT3A / gRNA, dCas-DNMT3B / gRNA, dCas-DNMT3 AL / gRNA, dCas-DNMT3B- L / gRNA, KRAB-dCas-DNMT3 A / gRNA, KRAB-dCas-DNMT3B / gRNA, KRAB-dCas-DNMT3A-L / gRNA, KRAB-dCas-DNMT3B-L / gRNA or dCas-KRAB-MeCP2 / gRNA being in particular expressed stably.

10. Viral vector comprising a vector genome according to claim 5, in particular said viral vector being a lentiviral vector, or a vector derived from adenovirus or adenovirus-associated virus (AAV).

11. In vitro use of an expression cassette according to any one of claims 2 to 4, of a plasmid according to claim 6 comprising an expression cassette according to any one of claims 2 to 4, or of a viral vector according to claim 10 for transfecting / transducing an animal eukaryotic cell, said animal eukaryotic cell being in particular chosen from: ■ a cancer cell, including a cancer cell forming a solid tumor or being involved in a blood cancer; ■ an immune cell chosen in particular from: the T lymphocyte and the NK cell; ■ a myofibroblast, in particular a myofibroblast involved in a fibrosis process; ■ an astrocyte, particularly an astrocyte activated during brain or spinal cord trauma and forming a glial scar preventing regeneration; and ■ an induced stem cell (iPS).

12. Animal eukaryotic cell transfected / transduced by an expression cassette according to any one of claims 2 to 4, a plasmid according to claim 6 comprising an expression cassette according to any one of claims 2 to 4, or a lentiviral vector according to claim 10, said transfected / transduced animal eukaryotic cell being in particular chosen from: ■ a cancer cell, including a cancer cell forming a solid tumor or being involved in a blood cancer; ■ an immune cell chosen in particular from: the T lymphocyte and the NK cell; ■ a myofibroblast, in particular a myofibroblast involved in a fibrosis process; ■ an astrocyte, particularly an astrocyte activated during brain or spinal cord trauma and forming a glial scar preventing regeneration; and ■ an induced stem cell (iPS).

13. Transfected / transduced animal eukaryotic cell according to claim 12 for use in cell therapy, in particular for treating a pathology chosen from: cancer, leukemia and fibrosis.

Images