Composition for promoting differentiation of periodontal ligament stem cells, comprising scutellaria baicalensis extract as active ingredient
The use of Scutellaria baicalensis extract and gingival cell exosomes in compositions for periodontal disease management promotes stem cell differentiation, offering a comprehensive solution to prevent and treat periodontal disease and its systemic impacts.
Patent Information
- Application Number
- PCT/KR2025/001331
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-01-26
- Filing Date
- 2025-01-23
- Publication Date
- 2025-07-31
AI Technical Summary
Periodontal disease, exacerbated by fine dust exposure, poses significant health risks and lacks effective preventive or therapeutic solutions, particularly for dental and systemic health issues.
A composition comprising Scutellaria baicalensis extract and exosomes derived from gingival cells treated with the extract, which are incorporated into pharmaceutical, food, and oral hygiene products to promote differentiation of periodontal ligament stem cells and enhance oral health.
The composition effectively prevents and treats periodontal disease by promoting stem cell differentiation, reducing the impact of fine dust, and improving oral hygiene, thereby addressing both dental and systemic health concerns.
Smart Images

Figure KR2025001331_31072025_PF_FP_ABST
Abstract
Description
Composition for promoting differentiation of periodontal ligament stem cells containing golden extract as an active ingredient
[0001] This patent application claims priority to Republic of Korea Patent Application No. 10-2024-0012268, filed with the Korean Intellectual Property Office on January 26, 2024, the disclosure of which is incorporated herein by reference.
[0002] The present invention relates to a composition for promoting differentiation of periodontal ligament stem cells, which comprises a golden extract as an active ingredient.
[0003]
[0004] Common dental diseases include dental caries and periodontal disease. It's estimated that over 80% of adults in Korea have periodontal disease. Periodontal disease has been reported to be directly and indirectly linked to diseases such as gastrointestinal disorders, lipid metabolic disorders, and stroke. Periodontal disease cannot be attributed to a single cause; it is a chronic condition typically caused by a complex mix of factors.
[0005] Particulate matter (fine dust) refers to particles so small they float in the atmosphere that they are invisible to the naked eye. Fine dust is composed of ions such as nitrate (NO3-), ammonium ion (NH4+), and sulfate (SO42-), as well as carbon compounds and metal compounds. Long-term exposure to fine dust can rapidly weaken the immune system, leading to respiratory diseases such as colds, asthma, and bronchitis, as well as various diseases such as cardiovascular disease, skin disease, and eye disease. In particular, ultrafine dust with a diameter of 2.5 μm or less can easily penetrate deep into the human body's bronchi and lungs, sticking to them and causing various diseases. (PM 2.5 Environmental Standard Establishment Study, National Institute of Environmental Research, 2006)
[0006] Harmful substances in fine dust have been reported to negatively impact not only respiratory health but also dental health. When foreign substances in fine dust are inhaled into the oral cavity, the concentration of oral bacteria increases, contributing to various gum diseases such as cavities and periodontitis. This is especially true for orthodontic patients, who breathe with their mouths open due to wearing braces. This increases the risk of fine dust accumulating on the braces, potentially negatively impacting the gums. Therefore, to maintain oral health, it's crucial to use appropriate oral hygiene products that can mitigate the effects of fine dust.
[0007] Scutellaria baicalensis (Scutellaria baicalensis) is a plant in the Lamiaceae family, found primarily in East Asia. Scutellaria baicalensis is a particularly important medicinal plant in traditional Korean medicine, and its root is called "Hwanggeum" or "Baekgeum." Scutellaria baicalensis root contains compounds with diverse biological activities, exhibiting anti-inflammatory, anticancer, antiviral, antioxidant, and anti-allergic effects. Its neuroprotective properties have also been reported. Scutellaria baicalensis has traditionally been used to treat colds, inflammation, hypertension, liver disease, and heart disease. However, its preventative or therapeutic effects in periodontal disease have not been elucidated.
[0008] Numerous papers and patents are referenced and cited throughout this specification. The disclosures of these cited papers and patents are incorporated herein by reference in their entirety to provide a clearer understanding of the state of the art and the scope of the present invention.
[0009]
[0010] The present inventors, while studying the uses of various biomaterials derived from Scutellaria baicalensis, completed the present invention by discovering that a Scutellaria baicalensis extract and exosomes derived from gingival cells treated with the Scutellaria baicalensis extract have a preventive or therapeutic effect on periodontal disease.
[0011] Accordingly, an object of the present invention is to provide a pharmaceutical composition for preventing or treating periodontal disease, comprising as an active ingredient i) a gold extract, ii) exosomes derived from gingival cells treated with a gold extract, or iii) a combination thereof.
[0012] Another object of the present invention is to provide a food composition for preventing or improving periodontal disease, comprising i) a gold extract, ii) exosomes derived from gingival cells treated with a gold extract, or iii) a combination thereof.
[0013] Another object of the present invention is to provide an oral hygiene composition comprising i) a gold extract, ii) exosomes derived from gingival cells treated with a gold extract, or iii) a combination thereof.
[0014]
[0015] The present invention provides the following inventions 1 to 8.
[0016] 1. A pharmaceutical composition for preventing or treating periodontal disease, comprising as an active ingredient i) a Scutellaria baicalensis extract, ii) exosomes derived from gingival cells treated with a Scutellaria baicalensis extract, or iii) a combination thereof.
[0017] 2. A pharmaceutical composition for preventing or treating periodontal disease, wherein the golden extract in 1 is an extract of golden root.
[0018] 3. A pharmaceutical composition for preventing or treating periodontal disease, wherein the extract is extracted with water, an alcohol having 1 to 4 carbon atoms, or a mixed solvent thereof.
[0019] 4. A pharmaceutical composition for preventing or treating periodontal disease, wherein the extract is extracted by distillation.
[0020] 5. A pharmaceutical composition for preventing or treating periodontal disease, wherein the periodontal disease is caused by fine dust.
[0021] 6. A food composition for preventing or improving periodontal disease, comprising i) a Scutellaria baicalensis extract, ii) exosomes derived from gingival cells treated with a Scutellaria baicalensis extract, or iii) a combination thereof.
[0022] 7. An oral hygiene composition comprising i) a Scutellaria baicalensis extract, ii) exosomes derived from gingival cells treated with a Scutellaria baicalensis extract, or iii) a combination thereof.
[0023] 8. In 7, the oral hygiene composition is selected from the group consisting of toothpaste, oral cleanser, oral spray, oral ointment, and gum.
[0024] 9. A method for preventing or treating periodontal disease, comprising the step of administering a composition of 1 to an individual in need of administration.
[0025] 10. A method for preventing or improving periodontal disease, comprising administering a composition of 6 to a subject in need of administration.
[0026] 11. A method for improving oral hygiene, comprising a step of washing the oral cavity using a composition of 7.
[0027]
[0028] According to one aspect of the present invention, the present invention provides a pharmaceutical composition for preventing or treating periodontal disease, comprising as an active ingredient i) a gold extract, ii) exosomes derived from gingival cells treated with a gold extract, or iii) a combination thereof.
[0029] While studying the uses of various biomaterials derived from Scutellaria baicalensis, the present inventors discovered that Scutellaria baicalensis extract and exosomes derived from gingival cells treated with Scutellaria baicalensis extract have preventive or therapeutic effects on periodontal disease.
[0030] In this specification, Scutellaria baicalensis is a perennial herb belonging to the Lamiaceae family of the mint order, which is widely distributed in mountainous areas throughout Korea and is also known as "Zijin," "Tiaoqin," "Pianqin," etc. Young Scutellaria baicalensis can be eaten, and its roots have medicinal properties such as hemostasis and are used medicinally. Traditionally, it has been used as a medicinal herb for infectious hepatitis, diuresis, anti-inflammatory fever, hemorrhagic inflammation, etc. The Scutellaria baicalensis may be raw Scutellaria baicalensis, a pulverized product of the raw herb itself, a dried product of the raw herb, a dried pulverized product of the raw herb, or a fermented product of Scutellaria baicalensis. More specifically, it may be a dried product obtained by hot-air drying Scutellaria baicalensis, but is not limited thereto. In addition, the Scutellaria baicalensis used in this specification is not limited by its acquisition method, and it may be cultivated and used or purchased and used commercially available ones.
[0031] In one embodiment of the present invention, the Scutellaria baicalensis extract may be an extract of Scutellaria baicalensis roots. The Scutellaria baicalensis extract used in the composition of the present invention may be an extract of a part or all of the aerial part or root part of the Scutellaria baicalensis herb. More specifically, the Scutellaria baicalensis extract used in the composition of the present invention is one or more extracts selected from the group consisting of leaves, flowers, stems, fruits, roots of the Scutellaria baicalensis herb, combinations thereof, and the whole herb, and most specifically, it may be an extract of Scutellaria baicalensis roots, but is not limited thereto.
[0032] In one embodiment of the present invention, the Scutellaria baicalensis extract used in the composition of the present invention is an extract obtained by extracting the above-described dried Scutellaria baicalensis. More specifically, the drying may be performed by spray drying, hot-air drying, freeze drying, natural drying, vacuum drying, etc., but is not limited thereto.
[0033] In one embodiment of the present invention, the gold extract used in the composition of the present invention is an extract extracted from the dried product of the gold described above by hot air drying. More specifically, the hot air drying may be performed at a temperature of 25°C to 150°C, more specifically at a temperature of 25°C to 150°C, 25°C to 120°C, 25°C to 100°C, 25°C to 85°C, 25°C to 70°C, 45°C to 150°C, 45°C to 120°C, 45°C to 100°C, 45°C to 85°C, 45°C to 70°C, 60°C to 150°C, 60°C to 120°C, 60°C to 100°C, 60°C to 85°C, 60°C to 70°C, 70°C to 150°C, 70°C to 120°C, 70°C to 100°C or 70°C to 85°C, but is not limited thereto.
[0034] The gold extract used in the composition of the present invention can be purchased or obtained by direct extraction. When the gold extract used in the composition of the present invention is obtained by treating gold with an extraction solvent, various extraction solvents such as polar solvents or non-polar solvents can be used. Suitable polar solvents include (i) water, (ii) alcohols (preferably, methanol, ethanol, propanol, butanol, normal-propanol, isopropanol, normal-butanol, 1-pentanol, 2-butoxyethanol, or ethylene glycol), (iii) acetic acid, (iv) dimethyl-formamide (DMFO), and (v) dimethylsulfoxide (DMSO). Suitable non-polar solvents include acetone, acetonitrile, ethyl acetate, methyl acetate, fluoroalkane, pentane, hexane, 2,2,4-trimethylpentane, decane, cyclohexane, cyclopentane, diisobutylene, 1-pentene, 1-chlorobutane, 1-chloropentane, o-xylene, diisopropyl ether, 2-chloropropane, toluene, 1-chloropropane, chlorobenzene, benzene, diethyl ether, diethyl sulfide, chloroform, dichloromethane, 1,2-dichloroethane, aniline, diethylamine, ether, carbon tetrachloride and THF (Tetrahydrofuran).
[0035] In one embodiment of the present invention, the gold extract may be extracted with water, an alcohol having 1 to 4 carbon atoms, or a mixed solvent thereof.
[0036] In one embodiment of the present invention, the extract may be distilled, but is not limited thereto.
[0037] Distillation is a common method for extracting essences from most substances. Distillation methods developed to date include water distillation, steam distillation, and water diffusion.
[0038] In one embodiment of the present invention, solvent distillation is a method of extracting essential oils by directly boiling plant materials immersed in a solvent and liquefying the resulting vapor. Using solvent distillation (e.g., water distillation), both the floral solution and the essential oil are extracted together.
[0039] In one embodiment of the present invention, steam distillation is a method of extracting essence by spraying steam from boiling a solvent onto a plant material, rather than directly boiling the plant material while it is immersed in a solvent.
[0040] In one embodiment of the present invention, the hydro diffusion method is substantially similar to the steam distillation method, but while steam is injected from the bottom up in the steam distillation method, steam is injected from the top down in the hydro diffusion method. This method allows for the extraction of a greater amount of oil in a shorter processing time with a smaller amount of steam.
[0041] In one embodiment of the present invention, cohobation is a method of separately extracting a specific component (e.g., phenyl ethyl alcohol, etc.) by cohobating the solvent used in the distillation after extraction by solvent distillation.
[0042] In one embodiment of the present invention, rectification refers to a process of distilling the essential oil once again to remove certain impurities if the essential oil contains such impurities.
[0043] The extraction temperature of the extract of the present invention is not particularly limited, and may be, for example, 0°C to 140°C, and specifically, 0°C to 140°C, 0°C to 120°C, 0°C to 100°C, 0°C to 85°C, 0°C to 75°C, 0°C to 70°C, 20°C to 140°C, 20°C to 120°C, 20°C to 100°C, 20°C to 85°C, 20°C to 75°C, 20°C to 70°C, 40°C to 140°C, 40°C to 120°C, 40°C to 100°C, 40°C to 85°C, 40°C to 75°C, 40°C to 70°C, 55°C to 140°C, 55°C to 120°C, 55°C It may be, but is not limited to, 55°C to 85°C, 55°C to 75°C, 55°C to 70°C, 65°C to 140°C, 65°C to 120°C, 65°C to 100°C, 65°C to 85°C, 65°C to 75°C, 65°C to 70°C, 70°C to 140°C, 70°C to 120°C, 70°C to 100°C, 70°C to 85°C, or 70°C to 75°C.
[0044] The extraction time of the extract of the present invention is not particularly limited, and for example, 30 minutes to 10 days, 30 minutes to 5 days, 30 minutes to 48 hours, 30 minutes to 36 hours, 30 minutes to 27 hours, 30 minutes to 24 hours, 3 hours to 10 days, 3 hours to 5 days, 3 hours to 48 hours, 3 hours to 36 hours, 3 hours to 27 hours, 3 hours to 24 hours, 9 hours to 10 days, 9 hours to 5 days, 9 hours to 48 hours, 9 hours to 36 hours, 9 hours to 27 hours, 9 hours to 24 hours, 15 hours to 10 days, 15 hours to 5 days, 15 hours to 48 hours, 15 hours to 36 hours, 15 hours to 27 hours, 15 hours to 24 hours, 21 It may be, but is not limited to, 21 hours to 10 days, 21 hours to 5 days, 21 hours to 48 hours, 21 hours to 36 hours, 21 hours to 27 hours, or 21 hours to 24 hours.
[0045] In one embodiment of the present invention, the extract is included in an amount of 0.001 to 30 wt% based on the total weight of the composition. More specifically, the extract is present in an amount of 0.001 to 30 wt%, 0.001 to 20 wt%, 0.001 to 10 wt%, 0.001 to 5 wt%, 0.001 to 3 wt%, 0.001 to 2 wt%, 0.001 to 1 wt%, 0.01 to 30 wt%, 0.01 to 20 wt%, 0.01 to 10 wt%, 0.01 to 5 wt%, 0.01 to 3 wt%, 0.01 to 2 wt%, 0.01 to 1 wt%, 0.03 to 30 wt%, 0.03 to 20 wt%, 0.03 to 10 wt%, 0.03 to 5 wt%, 0.03 to 3 wt%, 0.03 to 2 wt%, 0.03 to 1 wt%, 0.05 to 30 wt%, 0.05 to 20 wt%, 0.05 to 10 wt%, 0.05 to 5 wt%, 0.05 to 3 wt%, 0.05 to 2 wt%, 0.05 to 1 wt%, but is not limited thereto.
[0046] In the present invention, the gold extract can be used in the form of a crude extract extracted by a solvent, and can also be used after being purified to a high purity.
[0047] The term 'extract' used herein has the meaning commonly used in the art as a crude extract as described above, but in a broad sense, it also includes fractions obtained by further fractionation of the extract. That is, the gold extract includes not only those obtained using the above-described extraction solvent, but also those obtained by additionally applying a purification process thereto. For example, fractions obtained by passing the extract through an ultrafiltration membrane having a certain molecular weight cut-off value, separation by various chromatographies (designed for separation according to size, charge, hydrophobicity, or affinity), and other additionally performed fractions obtained through various purification methods are also included in the gold extract of the present invention.
[0048] The gold extract used in the present invention can be manufactured into a powder form by additional processes such as reduced pressure distillation and freeze drying or spray drying.
[0049] In one embodiment of the present invention, the exosomes derived from gingival cells treated with a gold extract are obtained by treating gingival cells with a gold extract and purifying the cells.
[0050] In the present invention, exosomes are small membrane-structured vesicles secreted from various cells, and are defined as a type of extracellular vesicles (EVs). All cells secrete EVs to exchange information with other cells or the external environment. Exosomes are approximately 50 to 200 nm in size and contain physiologically active substances such as proteins, lipids, and nucleic acids. Exosomes exist in various cells such as mammals, bacteria, and plants, and reflect the state of the cells they originate from, so they can be used for diagnosis and treatment. Exosomes have a double phospholipid membrane structure, allowing them to easily penetrate cells and perform various physiological and pathological functions such as immune responses and signal transduction.
[0051] According to one embodiment of the present invention, the gingival cell-derived exosomes treated with the gold extract are prepared by administering the gold extract to the gingival cells at a concentration of 100 ug / ml to 800 ug / ml, 100 ug / ml to 700 ug / ml, 100 ug / ml to 600 ug / ml, 100 ug / ml to 500 ug / ml, 100 ug / ml to 400 ug / ml, 200 ug / ml to 800 ug / ml, 200 ug / ml to 700 ug / ml, 200 ug / ml to 600 ug / ml, 200 ug / ml to 500 ug / ml, 200 ug / ml to 400 ug / ml, 300 ug / ml to 800 ug / ml, 300 ug / ml to 700 ug / ml, 300 ug / ml to 600 ug / ml, or 300 ug / ml to It may be obtained by treating the cells with 500ug / ml, most specifically 400mg / ml, and purifying them.
[0052] The exosomes derived from gingival cells treated with a gold extract according to one embodiment of the present invention may be obtained by treating gingival cells with a gold extract for 12 to 48 hours and purifying the cells, and most specifically, by treating the cells for 24 hours and purifying the cells.
[0053] The above exosomes may be purified from gingival cells by, but are not limited to, centrifugation, ultracentrifugation, density gradient ultracentrifugation, size exclusion chromatography, immunoaffinity column, tangential flow filtration (TFF), polymer precipitation, etc.
[0054]
[0055] The composition of the present invention can be prepared as a pharmaceutical composition.
[0056] According to a specific embodiment of the present invention, the composition of the present invention comprises (a) the golden extract described above as an active ingredient; and (b) a pharmaceutically acceptable carrier. The pharmaceutical composition of the present invention comprises a pharmaceutically effective amount of the golden extract.
[0057] The term “pharmaceutically effective amount” in this specification means an amount sufficient to achieve the preventive or improving effect of the golden extract described above on periodontal disease.
[0058] As used herein, the term "prevention" means any action that inhibits the onset of a disease or pathological condition by administering the composition of the present invention, and "improvement" means any action that delays the progression of a disease or pathological condition by administering the composition of the present invention; and alleviates a disease or pathological condition.
[0059] When the composition of the present invention is prepared as a pharmaceutical composition, the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier is one commonly used in the preparation of a pharmaceutical composition, and includes, but is not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.
[0060] The pharmaceutical composition of the present invention may further comprise, in addition to the above ingredients, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).
[0061] The pharmaceutical composition of the present invention can be administered orally or parenterally, and in the case of parenteral administration, it can be administered by intravenous administration, subcutaneous administration, intradermal administration, transdermal administration, skin administration, intramuscular administration, intranasal administration, intramucosal administration, intrathecal administration, intraperitoneal administration, intraocular administration, etc., and specifically, it can be administered orally.
[0062] The appropriate dosage of the pharmaceutical composition of the present invention varies depending on factors such as the formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and response sensitivity, and a generally skilled physician can easily determine and prescribe a dosage effective for the desired treatment or prevention.
[0063] According to a specific embodiment of the present invention, the daily dosage of the golden extract, which is an active ingredient of the pharmaceutical composition of the present invention, is 0.001-100 mg / kg. The daily dosage of the pharmaceutical composition of the present invention may be, for example, 0.1-100 mg / kg, 0.1-50 mg / kg, 0.1-30 mg / kg, 0.1-20 mg / kg, 0.1-10 mg / kg, 0.1-7 mg / kg, 0.1-5 mg / kg, 1-100 mg / kg, 1-50 mg / kg, 1-30 mg / kg, 1-20 mg / kg, 1-10 mg / kg, 1-7 mg / kg, 1-5 mg / kg, and more specifically, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mg / kg.
[0064] The pharmaceutical composition of the present invention can be manufactured in a unit dose form or can be manufactured by inserting it into a multi-dose container by formulating it using a pharmaceutically acceptable carrier and / or excipient according to a method that can be easily performed by a person having ordinary skill in the art to which the present invention pertains. In this case, the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or in the form of an extract, powder, granules, tablet or capsule, and may additionally include a dispersing agent or stabilizer.
[0065] The pharmaceutical composition of the present invention can be administered in parallel with a known compound or pharmaceutical composition having an effect of preventing and treating periodontal disease.
[0066] In one embodiment of the present invention, the periodontal disease is caused by fine dust, but is not limited thereto.
[0067] Particulate matter (PM) refers to particulate matter with a diameter of 10㎛ or less (PM10) containing chemicals derived from industrial hazardous substances designated as Group 1 carcinogens by the World Health Organization (WHO) in 2013. Ultrafine dust refers to particulate matter with a diameter of 2.5㎛ or less (PM2.5). Fine dust and ultrafine dust contain chemical components such as nitrates, sulfates, and polycyclic aromatic hydrocarbons (PAHs), as well as heavy metals such as lead and cadmium.
[0068]
[0069] According to another aspect of the present invention, the present invention provides a food composition for preventing or improving periodontal disease, comprising as an active ingredient i) a gold extract, ii) exosomes derived from gingival cells treated with a gold extract, or iii) a combination thereof.
[0070] The above food composition can be used as a health functional food or added to various foods.
[0071] The present invention also provides a health functional food comprising the food composition. The health functional food may be a beverage, meat, chocolate, food, confectionery, pizza, ramen, other noodles, gum, ice cream, alcoholic beverage, vitamin complex, or health supplement.
[0072] The content of the extract mixture of the present invention contained in the food composition may be appropriately adjusted depending on the form of the food, the desired use, etc., and there is no particular limitation. For example, the content of the extract mixture may be 0.001 to 30 wt% or 0.01 to 20 wt% of the total food weight, and in the case of a health beverage composition, it may be 0.001 to 15 g, 0.02 to 10 g, or 0.3 to 1 g based on 100 ml, but is not limited thereto.
[0073] When a composition including the golden extract of the present invention is manufactured into a food composition, it may include not only the extract as an active ingredient but also ingredients commonly added during food manufacturing. The added ingredients include, for example, proteins, carbohydrates, fats, nutrients, seasonings, and flavoring agents. Examples of the carbohydrates mentioned above include monosaccharides such as glucose, fructose, etc.; disaccharides such as maltose, sucrose, oligosaccharides, etc.; and polysaccharides such as dextrin, cyclodextrin, etc., and sugar alcohols such as xylitol, sorbitol, and erythritol. Natural flavoring agents [thaumatin, stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.)] and synthetic flavoring agents (saccharin, aspartame, etc.) can be used. For example, when the food composition of the present invention is manufactured as a drink, citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, juice, Eucommia extract, jujube extract, licorice extract, etc. may be additionally included in addition to the extract of the present invention.
[0074] Since the food composition of the present invention contains a golden extract as an effective ingredient, similar to the pharmaceutical composition described above, description of common matters between the two inventions is omitted to avoid excessive duplication in the present specification.
[0075]
[0076] According to another aspect of the present invention, the present invention provides an oral hygiene composition comprising i) a gold extract, ii) exosomes derived from gingival cells treated with a gold extract, or iii) a combination thereof as an active ingredient.
[0077] In the present invention, the oral hygiene composition refers to a composition for promoting oral hygiene that helps improve oral health. The oral hygiene composition may be a composition that performs functions such as suppressing the occurrence and growth of various harmful bacteria in the oral cavity, suppressing bad breath, suppressing dental plaque formation, preventing or improving periodontal disease, suppressing dental caries, or suppressing tongue coating, and specifically, may be a composition for preventing or improving periodontal disease.
[0078] In the present invention, the periodontal disease includes gingivitis, periodontitis, and periodontal abscess. Specifically, it includes, but is not limited to, necrotizing gingivitis, exfoliative gingivitis, chronic gingivitis, acute ulcerative gingivitis, eruptive gingivitis, adolescent gingivitis, pregnancy gingivitis, refractory periodontitis, rapidly progressive periodontitis, chronic periodontitis, adult periodontitis, juvenile periodontitis, invasive periodontitis, hormone-related periodontitis, apical periodontitis, and periodontal abscess.
[0079] The oral hygiene composition of the present invention may additionally contain inactive ingredients within a range that does not impair the effects of the present invention. Such inactive ingredients include, but are not limited to, diluents, antioxidants, pH regulators, humectants, sweeteners, flavoring agents, coloring agents, and preservatives.
[0080] In the present invention, the humectant is a component for suppressing the evaporation of moisture within the composition, and may be selected from the group consisting of polyhydric alcohols such as glycerin, sorbitol solution, non-crystalline sorbitol solution, polyethylene glycol, and propylene glycol, and preferably glycerin. Glycerin is not harmful compared to other substances, has almost no odor or taste, and prevents moisture and other substances contained in other ingredients from evaporating easily.
[0081] In the present invention, the sweetener is an ingredient that improves the taste when the product is used, and may be xylitol, sodium saccharin, aspartame, stevioside, licorice acid, etc., and preferably xylitol. Xylitol is a natural sweetener extracted from plants, has a sweet taste similar to sugar, and weakens the bacteria that cause dental caries by fermenting sugar to produce acid, and eliminates the cause of dental caries by preventing sugar fermentation.
[0082] In the present invention, a flavoring agent refers to an ingredient that provides a refreshing scent when the product is used. The flavoring agent may be an essential oil, preferably peppermint, lemon, tea tree, or orange oil. Lemon oil helps suppress bad breath, tea tree oil is good for oral inflammation, and orange oil adds a refreshing scent.
[0083] In the present invention, the preservative is a component for extending the preservation period of the composition, and may be methyl parahydroxybenzoate, benzoic acid, or sodium benzoate.
[0084] In one embodiment of the present invention, the oral hygiene composition may be selected from the group consisting of toothpaste, mouthwash, oral spray, oral ointment, and gum (chewing gum, dog gum, etc.), but is not limited thereto.
[0085] The oral hygiene composition of the present invention may be in the form of a liquid, solid, suspension, gel, or aerosol, but is not limited thereto. To apply the oral hygiene composition of the present invention, appropriate additives, carriers, etc. may be additionally included in the composition, and those skilled in the art can appropriately select and combine the additives and carriers.
[0086] As demonstrated in specific embodiments of the present invention, the pharmaceutical composition for preventing or treating periodontal disease comprising the golden extract of the present invention promotes differentiation of periodontal ligament stem cells treated with or without fine dust, and thus has a preventive or therapeutic effect on periodontal disease, and in particular, has an excellent preventive or therapeutic effect on periodontal disease caused by fine dust.
[0087] According to one aspect of the present invention, the present invention provides a method for preventing or treating periodontal disease, comprising a step of administering the composition for preventing or treating periodontal disease of the present invention described above to a subject in need of administration.
[0088] According to another aspect of the present invention, the present invention provides a method for preventing or improving periodontal disease, comprising a step of administering the composition for preventing or improving periodontal disease described above to a subject in need of administration.
[0089] According to another aspect of the present invention, the present invention provides a method for improving oral hygiene, comprising a step of washing the oral cavity using the oral hygiene composition described above.
[0090] The method inventions according to the above aspects of the present invention utilize the composition according to one aspect of the present invention described above, and thus, any content common to both inventions applies equally to each other. Furthermore, to avoid complicating the present specification, description of any overlapping content is omitted.
[0091]
[0092] The features and advantages of the present invention are summarized as follows:
[0093] (a) The present invention provides a pharmaceutical composition for preventing or treating periodontal disease, comprising as an active ingredient i) a gold extract, ii) exosomes derived from gingival cells treated with a gold extract, or iii) a combination thereof.
[0094] (b) The present invention provides a food composition for preventing or improving periodontal disease, comprising i) a gold extract, ii) exosomes derived from gingival cells treated with a gold extract, or iii) a combination thereof.
[0095] (c) The present invention provides an oral hygiene composition comprising i) a gold extract, ii) exosomes derived from gingival cells treated with a gold extract, or iii) a combination thereof.
[0096] (d) The pharmaceutical composition for preventing or treating periodontal disease of the present invention exhibits a protective effect on gingival cells and periodontal ligament stem cells, and therefore can be used as a raw material for drugs and foods for preventing, improving, or treating periodontal disease, and can also be usefully used as a raw material for oral hygiene products.
[0097]
[0098] Figure 1 shows a summary of the present invention.
[0099] Figure 2 shows the results of confirming the gingival cell protective effect of Scutellaria baicalensisextract (SBE) through Annexin-V-PI staining analysis and flow cytometry.
[0100] Figure 3 shows the cellular viability of periodontal ligament stem cells in response to golden extract. (Con indicates the control group, ns indicates a nonsignificant difference, *P<0.05, **P<0.01, ***P<0.001)
[0101] Figure 4 shows the cell viability of periodontal ligament stem cells in response to exosomes derived from golden extract.
[0102] Figure 5 shows the cell survival rate of periodontal ligament stem cells in response to fine dust.
[0103] Figures 6 to 8 are diagrams showing the degree of differentiation of periodontal ligament stem cells into osteoblasts (Figure 6), periodontal ligament cells (PDLC, Figure 7), and pulp progenitor cells (PPC, Figure 8) when treated with the golden extract of the present invention. (SBEM; Scutellaria baicalensiseextracts conditioned medium, Con; control, ns; not significant, PM10; fine dust)
[0104] Figures 9 to 11 are diagrams showing the degree of differentiation of PDLSC (periodontal ligament stem cells) into osteoblasts (Figure 9), periodontal ligament (PDLC, Figure 10), and pulp forming cells (PPC, Figure 11) when treated with the induced exosomes of the present invention. (IE; Induced exosomes)
[0105] Figure 12 shows the results of immunocytochemistry for localization of periodontal ligament stem cells (PDLSCs) cultured under various conditions (Con, PM10, SBEM, IE, SBEM + PM10, IE + PM10). (yellow scale bar = 20 μm)
[0106] Figure 13 shows the results of analyzing the mRNA levels of osteoblast marker genes (BMP2, RUNX2, DLX2) by treatment material of the present invention (con, PM10, SBEM, SBEM+PM10).
[0107] Figure 14 shows the results of analyzing the mRNA levels of osteoblast marker genes (BMP2, RUNX2, DLX2) by treatment material of the present invention (con, PM10, IE, IE+PM10).
[0108] Figures 15 and 16 are diagrams showing the degree of bone formation activation from PDLSCs of two biomaterials under fine dust (scale bar = 20 μm).
[0109] Figures 17 to 19 show the results of culturing THP-1 cells in various conditioned media (con, PM10, SBEM, SBEM+PM10, IE, IE+PM10) and treating them with human papillomavirus peptides to confirm the phagocytosis-promoting effects of SBEM and IE on the virus.
[0110] Figures 20 to 22 show the results of culturing THP-1 cells in various conditioned media (con, PM10, SBEM, SBEM+PM10, IE, IE+PM10) and treating them with bacterial particles to confirm the phagocytosis-promoting effect of SBEM and IE on bacteria.
[0111]
[0112] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples, in accordance with the gist of the present invention.
[0113]
[0114] Example
[0115]
[0116] Throughout this specification, "%" used to indicate the concentration of a particular substance is (weight / weight) % for solid / solid, (weight / volume) % for solid / liquid, and (volume / volume) % for liquid / liquid, unless otherwise noted.
[0117]
[0118] Figure 1 shows a summary of the present invention.
[0119]
[0120] Manufacturing Example 1: Manufacturing of gold extract and gold extract-derived exosomes
[0121] Scutellria baicalensis (Scutellria baicalensis) was purchased from Uiseong, Gyeongsangbuk-do and used as an experimental material. The roots of Scutellaria baicalensis were hot-air-dried at 70°C for 24 h, crushed, extracted with distilled water at 70°C, and then concentrated under reduced pressure using a digital rotary evaporator (DAIHAN). The concentrated Scutellaria baicalensis extract was sterilized using a 0.22 μm microporous membrane (Merck) before use.
[0122] Scutellaria baicalensisextracts (SBE) induced exosomes (IE) were obtained by treating human normal gingival cells with 400 ug / ml of Scutellaria baicalensisextracts (SBE) for one day and purifying the cells to obtain exosomes.
[0123]
[0124] Example 1: Determination of test concentration through cell culture and cytotoxicity evaluation
[0125] Human normal gingival cells (PCS-201-018 cells) were purchased from the American Type Culture Collection (ATCC) (Thermo-Fisher Scientific, USA). Gingival cells were cultured in complete growth media kits (PCS-201-030 and PCS-201-041, ATCC) at 37°C in 5% CO2. Cells were treated with golden extract, fine dust (ERM-CZ100, ERM, Belgium), and golden extract-derived exosomes. Periodontal ligament stem cells (PDLSC) were purchased and used as SKUs: 36085-01 and M36085-01S (Celprogen, USA).
[0126] To confirm the cytotoxicity of SBE on gingival cells, the cells were divided into control group, SBE (Supplemental Behavioral Extract) 100ug / ml treatment group, 200ug / ml treatment group, 400ug / ml treatment group, and 800ug / ml treatment group, and the degree of cell death was observed by staining using an Annexin-V-PI staining kit (Invitrogen, USA). To interpret the results, cell viability was measured using a flow cytometer (BDFACScalibur) and FlowJo 10.6.1 (BD Bioscience), and the results are shown in Fig. 2.
[0127] As a result, as shown in Fig. 2, it was confirmed that neither late cell death nor early cell death was induced in the group treated with 100 ug / ml or 400 ug / ml of SBE.
[0128] To set the concentration of SBE, SBE-induced exosomes (IE), and fine dusts (PM10) for treating periodontal ligament stem cells (PDLSCs; Celprogen, Torrance, CA, USA), CC (cytotoxic concentration), which is the concentration at which 50% of periodontal ligament stem cells survive, was used. 50 Cell viability was evaluated using a flow cytometer (BD FACScalibur, BD Biosciences, CA, USA) and FlowJo 10.6.1 (BD Biosciences).
[0129] The results are shown in Figures 3 to 5.
[0130] As shown in Figures 3 to 5, for PDLSC, SBE was 400 ug / ml (Figure 3), IE was 40 ng / ml (Figure 4), and PM10 was 16 ng / ml (Figure 5). 50 , it was decided to apply the above concentration to future experiments.
[0131]
[0132] Example 2: Analysis of differentiation patterns of periodontal ligament stem cells treated with golden extract.
[0133] Periodontal ligament stem cells were cultured in various conditions [Con, PM10, Scutellaria baicalensiseextracts conditioned medium (SBEM), and SBEM+PM10] in a specific medium (SKU: M36085-01S) for one day. The cultured cells were fixed with 2% paraformaldehyde for 4 h and treated with 0.02% Tween 20 for 5 min. The treated cells were cultured with three fluorescently conjugated immunoglobulins: FITC-anti-asporin (Abbexa, Cambridge, UK), PE-anti-osteopontin (R&D Systems, MN, USA), and APC-anti-cytokeratin 4 (biorbyt, Cambridge, UK) at 37°C for 2 days. Stained cells were evaluated using a flow cytometer (BD FACScalibur), FlowJo 10.6.1 (BD science), and Prism 7 (GraphPad, CA, USA).
[0134] The results are shown in Figures 6 to 8.
[0135] As shown in Figures 6 to 8, the differentiation of periodontal ligament stem cells into osteoblasts, periodontal ligament cells (PDLCs), and pulp progenitor cells (PPCs) was analyzed, and it was confirmed that fine dust inhibits the differentiation of periodontal ligament stem cells into the three types of cells mentioned above, and in particular, it was confirmed that differentiation into PDLCs was inhibited the most.
[0136] In the case of SBEM (Scutellaria baicalensiseextracts conditioned medium), in addition to providing protection against fine dust, it strongly promoted differentiation into three types of cells. It was confirmed that osteoblast differentiation was promoted 4.01 times compared to the fine dust treatment group, and periodontal ligament cells (PDLC) differentiation was promoted 3.5 times compared to the fine dust treatment group.
[0137]
[0138] Example 3: Analysis of differentiation patterns of periodontal ligament stem cells (PDLSCs) treated with golden extract-induced exosomes.
[0139] The experiment was performed in the same manner as in Example 2, except that IE was used instead of SBEM.
[0140] The results are shown in Figures 9 to 11.
[0141] As shown in Figures 9 to 11, the differentiation of PDLSC (periodontal ligament stem cells) into alveolar osteoblasts, periodontal ligament, and pulp-forming cells was analyzed, and it was confirmed that IE strongly promoted differentiation into the three cell types, and in particular, it most strongly promoted differentiation into periodontal ligament cells.
[0142] As a result of comparative evaluation of the effects of IE and SBE, it was confirmed that IE was 2.25 times more effective in promoting differentiation of alveolar osteoblasts, 4.92 times more effective in promoting differentiation of periodontal ligament cells, and 2.35 times more effective in promoting differentiation of pulp-forming cells than SBE. In addition, it was confirmed that IE was 2.26 times, 7.36 times, and 2.60 times more effective in promoting differentiation than SBE even in situations where fine dust was exposed.
[0143]
[0144] In summary of the results of Figures 6 to 8 and Figures 9 to 11, when comparing the functionality of secretions (SBEM) and induced exosomes (IE) of periodontal cells stimulated by gold extract, SBE was found to have 1.78 times higher alveolar osteoblast differentiation activity than IE compared to the control group, and IE was found to have 1.4 times higher periodontal ligament differentiation activity than SBE.
[0145] However, when compared based on PM10, IE was approximately 20 times more effective than SBE in the differentiation activity of alveolar osteoblasts and 1.43 times more effective in periodontal ligament. In addition, in the evaluation of fine dust protection effect, both materials showed similar activity in alveolar osteoblasts and pulp-forming cells, and IE was 1.5 times more effective than SBE in the activity of periodontal ligament.
[0146]
[0147] Example 4: Confirmation of PLDC marker localization using immunocytochemistry.
[0148] Periodontal ligament stem cells (PDLSCs) were cultured under various conditions (Con, PM10, SBEM, IE, SBEM + PM10, IE + PM10). The cultured cells were fixed with 2% paraformaldehyde for 12 h and then treated with 0.02% Tween 20 for 10 min. The treated cells were incubated with fluorescence-conjugated FITC-anti-asporin (Abbexa, Cambridge, UK). The stained cells were evaluated using a fluorescence microscope (Eclipse Ts-2, Nikon, Shinagawa, Japan) and imaging software NIS-elements V5.11 (Nikon).
[0149] The results are shown in Fig. 12.
[0150] As shown in Figure 12, both SBEM and IE promoted the differentiation of periodontal ligament cells and had an excellent protective effect against fine dust, but IE and IE+PM10 showed the strongest staining results, indicating that the effect of IE was particularly outstanding.
[0151]
[0152] Example 5: Evaluation of the bone formation promotion activity of golden extract
[0153] Total RNA of PDLSCs cultured under various conditions (con, PM10, SBEM, SBEM+PM10, IE, IE+PM10) was isolated from treated cells using RiboEx reagent (GeneAll, Seoul, Republic of Korea). cDNA was synthesized from the isolated RNA using Maxime RT PreMix (iNtRON, Seongnam, Republic of Korea). cDNA was amplified using the primers listed in Table 1 under the following conditions:
[0154] 95°C for 1 minute, followed by 35 cycles of 59°C for 35 seconds, and 72°C for 1 minute.
[0155] Sequences of PCR primersGeneSeq (5'→ 3')GAPDHF: GGTCACCAGGGCTGCTTTTA (SEQ ID NO: 1)R: CCCGTTCTCAGCCATGTAGT (SEQ ID NO: 2)DLX2F: CTGCTTAGACCAGAGCAGCC (SEQ ID NO: 3)R: CTGGAACGGAGCTTGGAAGT (SEQ ID NO: 4)RUNX2F: CGCCTCACAAACAACCACAG (SEQ ID NO: 5)R: TCACTGTGCTGAAGAGGCTG (SEQ ID NO: 6)BMP2F: CTGAAACAGAGACCCACCCC (SEQ ID NO: 7)R: TGGTCAGGGGAATTTCGAG (SEQ ID NO: 8)
[0156]
[0157] Amplified DNA was analyzed using iBright FL1000 and iBright Analysis Software 4.0.0 (Invitrogen).
[0158] The results are shown in Figures 13 and 14.
[0159] As shown in Figure 13, in the case of SBEM, the mRNA levels of alveolar osteoblast marker genes (BMP2, RUNX2, DLX2) were analyzed, and the synthesis amount of all three markers was found to have increased, and in particular, the synthesis amount of BMP2 was found to have increased 2.49 times compared to the control group.
[0160] In contrast, as shown in Fig. 14, in the case of IE, the mRNA levels of alveolar osteoblast marker genes (BMP2, RUNX2, DLX2) were analyzed, and among the three markers, the synthesis amount of RUNX2 increased 2.9-fold, and that of BMP2 increased 1.5-fold.
[0161] Accordingly, among the three markers, RUNX2 was predicted to be the most downstream signaling protein, and IE was predicted to most rapidly and strongly promote the differentiation of periodontal ligament stem cells into alveolar osteoblasts.
[0162]
[0163] Example 6: Image analysis of alveolar osteoblasts
[0164] Periodontal ligament stem cells (PDLSCs) were cultured under various conditions (con, PM10, SBE, SBE+PM10, IE, IE+PM10). The cultured cells were fixed with 2% paraformaldehyde for 12 h and then stained with Alizarin O reagent (sigma, St. Louis, MO, USA) for 40 min. The stained cells were evaluated using a fluorescence microscope (Eclipse Ts-2, Nikon, Shinagawa, Japan) and imaging software NIS-elements V5.11 (Nikon).
[0165] The results are shown in Figures 15 and 16.
[0166] As shown in Figures 15 and 16, when osteocytic colonies were counted after exposure to various conditions in PDLSCs, similar to the flow cytometry results, both SBE and IE showed excellent fine dust protection effects and PDLSC differentiation promotion effects, and in particular, the effect of IE was confirmed to be 2.52 times higher than that of the control group.
[0167]
[0168] Example 7: Analysis of the macrophage phagocytosis activation effect of golden extract and induced exosomes.
[0169] To evaluate the antiviral phagocytosis activity of golden extract and derived exosomes, THP-1 cells (KCLB 40202, Seoul, South Korea) were cultured in RPMI 1640, and the cells were cultured in various conditioned media (con, PM10, SBEM, SBEM+PM10, IE, IE+PM10). The exposed cells were treated with a human papillomavirus peptide (synthetic FITC-conjugated HPV16 E7(83-97), LMGTLGIVCPICSQK, SEQ ID NO: 9). The treated cells were analyzed by flow cytometry (BD FACScalibur), FlowJo 10.6.1 (BD science), and Prism 7 (GraphPad, USA).
[0170] The results are shown in Figures 17 to 19.
[0171] As shown in Figures 17 to 19, the degree of phagocytosis activity of HPV 16 peptides in macrophages exposed to SBEM and IE was analyzed, and it was confirmed that phagocytosis activity was promoted 2.11 times in the case of SBEM and 4.14 times in the case of IE compared to the control group. In addition, fine dust reduced phagocytosis by 59%, and it was confirmed that SBEM and IE increased phagocytosis activity 1.41 times and 2.29 times, respectively, compared to the control group under fine dust stress.
[0172] Example 8: Analysis of the macrophage phagocytosis activation effect of golden extract and induced exosomes.
[0173] To evaluate the antiviral phagocytosis effects of golden extract and derived exosomes, THP-1 cells (KCLB 40202, Seoul, South Korea) were cultured in RPMI 1640 and incubated in various conditioned media (con, PM10, SBEM, SBEM+PM10, IE, IE+PM10). The exposed cells were treated with bacterial particles, BioParticles (Thermo Fisher Scientific, USA). The treated cells were analyzed using a flow cytometer (BD FACScalibur), FlowJo 10.6.1 (BD science), and Prism 7 (GraphPad, USA).
[0174] The results are shown in Figures 20 to 22.
[0175] As shown in Figures 20 to 22, the degree of phagocytosis activity of bacterial particles in macrophages exposed to SBEM and IE was analyzed, and it was confirmed that phagocytosis activity was promoted 1.36 times in the case of SBEM and 2.22 times in the case of IE compared to the control group. In addition, in the case of fine dust, phagocytosis was reduced by 70%, and it was confirmed that SBEM and IE increased phagocytosis activity 1.24 times and 1.63 times, respectively, compared to the control group under fine dust stress.
[0176]
[0177] In summary, we were able to confirm that golden extract and golden extract-induced exosomes have the effect of activating phagocytosis against viruses and bacteria.
[0178]
[0179] While specific aspects of the present invention have been described in detail above, it is clear to those skilled in the art that these specific descriptions are merely preferred implementation examples and that the scope of the present invention is not limited thereto.
Claims
1. A pharmaceutical composition for preventing or treating periodontal disease, comprising as an active ingredient i) an extract of Scutellaria baicalensis, ii) exosomes derived from gingival cells treated with an extract of Scutellaria baicalensis, or iii) a combination thereof.
2. A pharmaceutical composition for preventing or treating periodontal disease, wherein the golden extract in paragraph 1 is an extract of golden root.
3. A pharmaceutical composition for preventing or treating periodontal disease, wherein the extract is extracted with water, an alcohol having 1 to 4 carbon atoms, or a mixed solvent thereof in the first paragraph.
4. A pharmaceutical composition for preventing or treating periodontal disease, wherein the extract is extracted by distillation in the first paragraph.
5. A pharmaceutical composition for preventing or treating periodontal disease, wherein the periodontal disease in paragraph 1 is caused by fine dust.
6. A food composition for preventing or improving periodontal disease, comprising i) a Scutellaria baicalensis extract, ii) exosomes derived from gingival cells treated with a Scutellaria baicalensis extract, or iii) a combination thereof.
7. An oral hygiene composition comprising i) a Scutellaria baicalensis extract, ii) exosomes derived from gingival cells treated with a Scutellaria baicalensis extract, or iii) a combination thereof.
8. In the 7th paragraph, the oral hygiene composition is selected from the group consisting of toothpaste, oral cleanser, oral spray, oral ointment, and gum.
Citation Information
Patent Citations
Mouth spray composition comprising cypress extracts and medical herb extracts and manufacturing method thereof
KR101632910B1
Oral composition for halitosis suppression
KR1020150114312A
Composition for prevention or treatment of oral disease comprising Scutellaria baicalensis extract
KR1020180047704A
Chewing gum, confection, and other oral delivery vehicles containing a traditional chinese medicine or extract thereof
US20100104518A1
Semi-solid chewable compositions and methods of making and using thereof
WO2021225918A1