System and method for screening sgrna scaffold activity mutants
Through the system and method of screening sgRNA skeleton active mutants, the problems of lack and instability of sgRNA skeleton sequences were solved, multi-target gene editing and multi-gene transcription regulation were achieved, and the application and efficiency of the CRISPR gene editing system was expanded.
Patent Information
- Application Number
- PCT/CN2024/090733
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-17
- Filing Date
- 2024-04-30
- Publication Date
- 2025-08-07
AI Technical Summary
In the existing CRISPR/Cas9 system, the lack of sgRNA skeleton sequences, tandem repeated expression is prone to deletion and unstable, which limits the application scope and efficiency of gene editing.
A system and method for screening active mutants of sgRNA skeleton are provided. Using Cas protein expression vector and sgRNA skeleton mutant screening vector, the active sgRNA skeleton sequence mutants are screened through homologous recombination and resistance screening tags.
Multi-target gene editing and multi-gene transcription regulation have been achieved, the application field and editing efficiency of the CRISPR gene editing system have been expanded, and the stability of sgRNA skeleton sequences and the success rate of multi-target editing have been improved.
Smart Images

Figure CN2024090733_07082025_PF_FP_ABST
Abstract
Description
A system and method for screening sgRNA backbone active mutants
[0001] This application claims priority to a prior application filed with the State Intellectual Property Office of China on February 2, 2024, with patent application number 2024101504822, entitled “A System and Method for Screening Active sgRNA Backbone Mutants.” It also claims priority to a prior application filed with the State Intellectual Property Office of China on April 17, 2024, with patent application number 2024104633897, entitled “A System and Method for High-Throughput Screening of Active sgRNA Backbone Mutants.” The entire contents of both applications are incorporated herein by reference. Technical field:
[0002] The present invention provides a system and method for screening sgRNA scaffold active mutant sequences, belonging to the field of bioengineering technology. Background technology:
[0003] Gene editing technology based on the CRISPR system is one of the most cutting-edge technologies in the life sciences. Within life science research, this technology has been widely used in the development of biotechnology and medical research. In industrial technology, it is often applied to modify the genome of basal cells, reshape metabolic flows, eliminate byproducts, and increase the yield of target products.
[0004] The CRISPR / Cas9 system consists of two key components: the Cas9 protein and the sgRNA scaffold (sgRNA backbone). The original CRISPR / Cas9 system consisted of two RNA sequences: crRNA, which is linked to N20, and tracrRNA, which can complementarily pair with crRNA. In 2012, Doudna et al. optimized crRNA and tracrRNA, transforming the two RNA sequences into a long sgRNA backbone. The sgRNA backbone is currently one of the most important components of the CRISPR / Cas9 system. This component, together with the N20 sequence complementary to the target, forms an active guide RNA (sgRNA), which guides the Cas9 protein to a specific DNA sequence, forming a ternary complex that enables the CRISPR system to recognize and cut specific genes, thereby generating DNA double-strand breaks (DSBs). There are two endogenous DNA repair systems in cells. One is the non-homologous end joining (NHEJ) system that produces random insertions or deletions in DNA sequences and inactivates genes. The other is the homologous recombination repair system (HDR) that relies on homologous sequences to achieve precise replacement or knock-in of DNA fragments at the target site.
[0005] The CRISPR / Cas9-based gene editing system is a powerful genetic manipulation tool whose DNA recognition and cleavage rely on the activity of guide RNA (sgRNA). Using the CRISPR / Cas9 system to simultaneously target multiple sites can further expand the efficiency and application of the gene editing system, reducing time and labor costs. Theoretically, by expressing multiple identical sgRNA backbones in tandem, it is possible to target different genes and inactivate multiple genes simultaneously. However, during vector construction, homologous recombination can occur between identical sgRNA backbone sequences, leading to vector construction failure. Even if construction is successful, these sequences are difficult to stably express simultaneously in cells, significantly limiting the application of CRISPR genome editing tools. To avoid the loss of sgRNA sequences during construction, various methods for assembling repetitive fragments have been developed, but these methods still do not fundamentally address this issue. Therefore, providing a diverse set of sgRNA backbone sequences will help expand CRISPR genome editing components and tools, and promote the improvement of important technical approaches such as multi-gene knockout / insertion and multi-gene transcriptional regulation.
[0006] Summary of the invention:
[0007] To address the shortcomings of sgRNA scaffold sequence deficiency, easy deletion of tandem repeat expression, and instability, the present invention provides a system and method for screening active mutant sequences of sgRNA scaffolds. The system utilizes the cleavage ability of Cas proteins and the recombination ability of bacterial strains to screen for active sgRNA scaffold sequence mutants. The system and method can be applied to the screening of sgRNA scaffold elements in CRISPR gene editing systems. Using this method, sgRNA scaffolds with diverse sequences can be obtained, which can be applied to fields such as multi-target gene editing and strain library construction, expanding the application areas and editing efficiency of CRISPR gene editing systems.
[0008] In order to achieve the above object, the present invention provides the following technical solutions:
[0009] One of the technical solutions provided by the present invention is a sgRNA backbone active mutant screening system, which comprises a Cas protein expression vector and an sgRNA backbone mutant screening vector;
[0010] The Cas protein expression vector comprises the following expression elements: a Cas protein encoding gene, a plasmid replicon, and a first resistance screening tag expression cassette; the sgRNA backbone mutant screening vector comprises the following expression elements: a plasmid replicon, a second resistance screening tag expression cassette, a third screening tag expression cassette, a promoter and a terminator for expressing the sgRNA backbone sequence;
[0011] Furthermore, on the Cas protein expression vector, the Cas protein encoding gene may be a gene encoding a wild-type Cas9 (spCas9) or a gene encoding a spCas9 variant, such as spG, spRY, superFI-Cas9, etc.; preferably, the Cas protein encoding gene is spCas9 shown in SEQ ID NO.1;
[0012] Furthermore, on the Cas protein expression vector, the plasmid replicon is used to regulate the replication of the Cas protein expression vector in the cell. Any replicon having the above function can be used in the present invention, including but not limited to pBR322, pUC, p15A, ColEI, pMB1, pSC101 and other replicons. In the present invention, the p15A replicon shown in SEQ ID NO. 2 is preferred;
[0013] Furthermore, on the Cas protein expression vector, the first resistance screening tag expression cassette comprises a first resistance screening tag, and the first resistance screening tag can be any resistance gene, including but not limited to ampicillin, spectinomycin, chloramphenicol, kanamycin, tetracycline and other resistance genes, etc., and in the present invention, the chloramphenicol resistance gene is preferred; the first resistance screening tag expression cassette further comprises a promoter, terminator and other elements for expressing the first resistance screening tag; the first resistance screening tag expression cassette is used for screening during the construction of the Cas protein expression vector and for screening cells containing the vector;
[0014] Preferably, a Cas protein expression vector pvCas-pre comprising a p15A replicon, the spCas9 encoding gene shown in SEQ ID NO.1, and a chloramphenicol resistance (CmR) encoding gene is constructed, and the nucleotide sequence is shown in SEQ ID NO.3;
[0015] Furthermore, on the sgRNA backbone mutant screening vector, the replicon is used to regulate the replication of the sgRNA backbone mutant screening vector in cells. Any replicon having the above function can be used in the present invention, including but not limited to pBR322, pUC, p15A, ColEI, pMB1, pSC101 and other replicons; the replicon is compatible with the replicon in the Cas protein expression vector; in the present invention, the pBR322 replicon shown in SEQ ID NO.4 is preferred;
[0016] Furthermore, on the sgRNA backbone mutant screening vector, the second resistance screening tag expression cassette comprises a second resistance screening tag, which can be any resistance gene different from the first resistance screening tag in the Cas protein expression vector. The second resistance screening tag expression cassette is used for screening during the construction of the sgRNA backbone mutant screening vector and for screening cells containing the vector.
[0017] Furthermore, on the sgRNA backbone mutant screening vector, the third screening tag expression cassette comprises a third screening marker gene, and the third screening marker gene is selected from a resistance gene or a non-resistance gene; the resistance gene can be any resistance gene different from the first resistance screening tag and the second resistance screening tag, including but not limited to ampicillin, spectinomycin, chloramphenicol, kanamycin, tetracycline and other resistance genes; the non-resistance gene includes but is not limited to a fluorescent signal marker, a color signal marker, etc.;
[0018] Furthermore, the fluorescent signal markers include but are not limited to: green fluorescent signal markers, red fluorescent signal markers, blue fluorescent signal markers, yellow fluorescent signal markers, cyan fluorescent signal markers, etc.; flow cytometry and micro droplet sorting instruments can be used for detection and sorting;
[0019] Furthermore, the color signal markers include but are not limited to: meffRed, eforRed, asPink, spisPink, scOrange, fwYellow, amilGFP, amajLime, cjBlue, meffBlue, aeBlue, amilCP, tsPurple, gfasPurple, etc., which can be detected and sorted by color comparison under visible light;
[0020] Furthermore, fluorescent signal labeling was used to achieve high-throughput screening of sgRNA backbone mutants;
[0021] Furthermore, the second resistance screening tag expression cassette further comprises a promoter, terminator and other elements for expressing the second resistance screening tag; the third screening tag expression cassette further comprises a promoter, terminator and other elements for expressing the third screening marker gene;
[0022] Furthermore, an insertion sequence is added to the third screening marker gene to inactivate it, wherein the insertion sequence comprises a recognizable 23bp exogenous sequence and a homologous sequence upstream of the third screening marker insertion site; the insertion site refers to the insertion site of the 23bp exogenous sequence on the third screening marker gene, which can be any site that can inactivate the third screening marker gene after insertion; the 23bp exogenous sequence comprises a 20bp recognition sequence and a 3bp PAM, and the recognition sequence can be any exogenous sequence that is efficiently recognized by CRISPR / Cas9; the PAM is a protospacer adjacent motif, which is a conserved sequence adjacent to the 5' end or 3' end of the protospacer sequence, such as NGG, and the "N" can be any one of A, T, C, and G;
[0023] Furthermore, on the sgRNA backbone mutant screening vector, the promoter and terminator for expressing the sgRNA backbone sequence can be any commonly used promoters and terminators in the art, including but not limited to J23119, J23110, J23101, J23100, J23102; T1, T2, Tf, TtrpA, etc. In the present invention, the promoter J23119 shown in SEQ ID NO.5 and the terminator T1 shown in SEQ ID NO.6 or NO.10 are preferred.
[0024] The second technical solution provided by the present invention is a method for constructing an sgRNA backbone mutation library, using the sgRNA backbone mutant screening vector described in the first technical solution as a template, and introducing a 61nt sgRNA backbone mutant sequence and an N20 sequence into the template by designing mutation primers, thereby constructing a mutation library, wherein the sgRNA backbone mutant sequence can be a sequence in which a mutation occurs at any position on the DNA sequence of the 61nt wild-type sgRNA backbone sequence shown in SEQ ID NO. 8; the N20 sequence is consistent with the 20bp recognition sequence inserted into the third screening marker gene;
[0025] Furthermore, the mutation primer contains a 61nt sgRNA backbone mutant sequence and an N20 sequence that has been introduced into the mutation site;
[0026] Furthermore, the mutation primer contains a homologous sequence to the sgRNA backbone mutant screening vector, which is used to introduce the sgRNA backbone mutant sequence and N20 sequence into the screening vector by homologous recombination;
[0027] Furthermore, the 61nt sgRNA backbone mutant sequence is based on the DNA sequence of the wild-type sgRNA backbone sequence, and the base of the mutation region is set to N, and the N can be any one of A, T, C, and G. The region that does not need to be mutated is the same as the DNA sequence encoding the wild-type sgRNA backbone sequence;
[0028] Furthermore, the 61nt sgRNA backbone was divided into 6 regions, and at least one of the 6 regions was mutated to construct a mutation library; wherein,
[0029] Region 1 is the 1-6nt and 25-30nt parts of the sgRNA backbone;
[0030] Region 2 is the 9-12nt and 17-20nt parts of the sgRNA scaffold;
[0031] Region 3 is the 7-8nt, 13-14nt, and 21-24nt parts of the sgRNA scaffold;
[0032] Region 4 is the 42-48nt and 53-56nt parts of the sgRNA scaffold;
[0033] Region 5 is the 32-41 nt portion of the sgRNA scaffold;
[0034] Region 6 is the 49-52nt and 57-60nt parts of the sgRNA scaffold;
[0035] Furthermore, the mutants obtained by mutating the above 6 regions separately are combined to obtain a mutant library in which 2, 3, 4, 5 or 6 regions are mutated simultaneously.
[0036] Furthermore, the 61nt sgRNA backbone was divided into four regions, and at least one of the four regions was mutated to construct a mutation library; wherein,
[0037] Region 1 is the 1-6nt, 9-12nt, 17-20n and 25-30nt parts of the sgRNA backbone;
[0038] Region 2 is the 7-8nt, 13-16nt, and 21-24nt parts of the sgRNA backbone;
[0039] Region 3 is the 33-41nt and 49-60nt parts of the sgRNA backbone;
[0040] Region 4 is the 31-32nt, 42-48nt, and 61nt parts of the sgRNA backbone;
[0041] Furthermore, the mutants obtained by mutating the above four regions separately are combined to obtain a mutant library in which two, three or four regions are mutated simultaneously.
[0042] The third technical solution provided by the present invention is an sgRNA backbone mutation library constructed by the method described in the second technical solution.
[0043] The fourth technical solution provided by the present invention is a method for screening sgRNA backbone active mutants;
[0044] Furthermore, when the third screening marker is a resistance gene, the method is to transform the Cas protein expression vector constructed in the first technical solution and the sgRNA backbone mutation library constructed in the third technical solution into Escherichia coli respectively, and culture them on a screening medium containing the third resistance screening label. The sgRNA backbone mutant sequence contained in the normally growing strain is the active sgRNA backbone mutant; preferably, the screening medium is an LB plate containing the third resistance screening label;
[0045] Furthermore, when the third screening marker is a non-resistance gene, the method is to transform the Cas protein expression vector constructed by the first technical solution and the sgRNA backbone mutation library constructed by the third technical solution into Escherichia coli respectively, and the cells screened by the third screening marker signal characteristic are revived, and the sorted cells are cultured on a medium containing a second resistance screening label. The sgRNA backbone mutant sequence contained in the strain that grows normally and has the corresponding third screening marker signal characteristic is the active sgRNA backbone mutant;
[0046] Furthermore, the Cas protein expression vector constructed in the first technical solution and the sgRNA backbone mutation library constructed in the third technical solution are respectively transformed into Escherichia coli. After cells with fluorescent signals are sorted by FACS or microdroplet sorting, the sorted cells are revived and cultured in a medium containing a second resistance selection label. The sgRNA backbone mutant sequences contained in the strains that grow normally and can produce relative fluorescence are active sgRNA backbone mutants; thereby achieving high-throughput screening;
[0047] Furthermore, the Cas protein expression vector constructed by technical solution one and the sgRNA backbone mutation library constructed by technical solution three were respectively transformed into Escherichia coli. After color comparison under visible light, cells with color signals were sorted out. After recovery, the sorted cells were cultured on a culture medium containing a second resistance screening label. The sgRNA backbone mutant sequences contained in the colonies that grew normally and had corresponding colors were active sgRNA backbone mutants.
[0048] The fifth technical solution provided by the present invention is an sgRNA backbone mutant screened by the method described in the fourth technical solution;
[0049] Furthermore, the DNA sequence of the sgRNA backbone mutant includes but is not limited to the following sequence:
[0050] The sixth technical solution provided by the present invention is the application of the sgRNA backbone mutant described in the fifth technical solution;
[0051] Furthermore, it is the application in the CRISPR / Cas9 gene editing system, and further, includes but is not limited to applications in base editing, single gene target editing, multi-gene target editing, such as lead editing, base knockout, base substitution, base insertion, single gene knockout / insertion, multi-gene knockout / insertion, single gene expression gradient regulation, multi-gene transcriptional regulation, etc. Beneficial effects:
[0052] The present invention addresses the shortcomings of sgRNA backbone sequence deficiency, easy deletion of tandem repeat expression, and instability. It provides a system and method for high-throughput screening of sgRNA backbone active mutant sequences. The system utilizes the cleavage ability of Cas proteins and the recombination ability of bacterial strains to screen for active sgRNA backbone sequence mutants. The system and method can be applied to the screening of sgRNA backbone elements in CRISPR gene editing systems. Using this method, sgRNA backbones with diverse sequences can be obtained, which can be applied to multi-target gene editing, multi-gene transcriptional regulation, strain library construction, protein mutation library construction, and other fields, expanding the application areas and editing efficiency of CRISPR gene editing systems.
[0053] The multiple sgRNA backbone sequences selected by this method achieve high editing efficiencies for multi-target gene editing. For example, knockout efficiencies for the Escherichia coli genes trkA, poxB, endA, and maeA were 70%, 80%, 70%, and 80%, respectively, with a 30% efficiency for simultaneous knockout of all four sites. Furthermore, when editing adenine bases at multiple sites across the trkA, poxB, endA, and maeA genes, simultaneous editing of all four sites was possible. For example, the knockout efficiency for the E. coli lac gene reached a maximum of 100%, enabling editing of adenine bases in E. coli. Description of the drawings:
[0054] Figure 1 Schematic diagram of the pvCas-pre vector.
[0055] Figure 2 Schematic diagram of the psBAKn-RW vector.
[0056] Fig. 3 Schematic diagram of sgRNA backbone sequence partitioning-(1).
[0057] Figure 4. sgRNA backbone mutant resistance plate screening process (the third screening marker is the resistance gene).
[0058] Figure 5 shows the gene editing results of the sgRNA mutants in Example 5.
[0059] Figure 6 shows the results of multi-site gene editing of sgRNA mutants in Example 6.
[0060] Figure 7 shows the results of multi-site base editing of sgRNA mutants in Example 7.
[0061] Figure 8 Schematic diagram of psBAGn-RW vector.
[0062] Figure 9 Schematic diagram of sgRNA backbone sequence partitioning-(2).
[0063] Figure 10 High-throughput screening process of sgRNA backbone mutants (the third screening marker is a non-resistance gene).
[0064] Figure 11 shows the FACS sorting results of high-throughput screening of sgRNA backbone mutants in Example 10.
[0065] Figure 12 shows the gene editing results of the sgRNA backbone mutants in Example 11. Specific implementation method:
[0066] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing specific embodiments rather than for limiting the scope of protection of the present invention.
[0067] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt conventional molecular biology, biochemistry, cell biology, recombinant DNA technology and related fields in the field of this technology, which have been fully described in existing literature.
[0068] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.
[0069] The following examples are detailed descriptions and explanations of the technical solutions of the present invention and are not intended to limit the present invention.
[0070] The CRISPR / Cas9 system consists of two key components: the Cas9 protein and the sgRNA scaffold. In the original CRISPR / Cas9 system, the sgRNA scaffold consisted of two RNA sequences: crRNA, which is linked to N20, and tracrRNA, which can complement and pair with the crRNA. In 2012, Doudna et al. optimized the crRNA and tracrRNA, transforming the two RNA sequences into a long sgRNA scaffold. The sgRNA scaffold, together with the N20 sequence complementary to the target, forms an active guide RNA (sgRNA). The sgRNA can guide the Cas9 protein to target specific DNA sequences, forming a ternary complex that enables the CRISPR system to recognize and cut specific genes, generating DNA double-strand breaks (DSBs). Obtaining a diverse sgRNA scaffold can greatly expand the CRISPR genome editing components and tools.
[0071] The present invention first provides a sgRNA backbone active mutant screening system, which comprises a Cas protein expression vector and an sgRNA backbone mutant screening vector.
[0072] 1. Cas protein expression vector
[0073] The Cas protein expression vector is used to stably express the Cas protein in cells; the Cas protein expression vector comprises the following expression elements: a Cas protein encoding gene, a plasmid replicon, and a first resistance screening tag expression cassette;
[0074] Furthermore, the Cas protein encoding gene may be a gene encoding a wild-type Cas9 (spCas9), or a variant of spCas9, such as spG, spRY, superFI-Cas9, etc.; preferably, the Cas protein encoding gene is spCas9 as shown in SEQ ID NO.1;
[0075] Furthermore, the plasmid replicon is used to regulate the replication of the Cas protein expression vector in cells. Any replicon having the above function can be used in the present invention, such as pBR322, pUC, p15A, ColEI, pMB1, pSC101 and other replicons commonly used in the art. In the present invention, the p15A replicon shown in SEQ ID NO. 2 is preferred;
[0076] Furthermore, the first resistance screening tag expression cassette comprises a first resistance screening tag, and the first resistance screening tag expression cassette is used for screening during the construction of the Cas protein expression vector and for screening cells containing the vector; the first resistance screening tag can be any resistance gene, such as ampicillin, spectinomycin, chloramphenicol, kanamycin, tetracycline and other resistance genes commonly used in the art, and the chloramphenicol resistance gene is preferred in the present invention; the first resistance screening tag expression cassette also comprises a promoter, terminator and other elements for expressing the first resistance screening tag;
[0077] Preferably, a Cas protein expression vector pvCas-pre comprising a p15A replicon, the spCas9 encoding gene shown in SEQ ID NO.1, and a chloramphenicol resistance (CmR) encoding gene is constructed. The vector structure is shown in Figure 1, and the nucleotide sequence is shown in SEQ ID NO.3.
[0078] 2. sgRNA scaffold mutant screening vector
[0079] The sgRNA backbone mutant screening vector comprises the following expression elements: a plasmid replicon, a second resistance screening tag expression cassette, a third screening tag expression cassette, a promoter and a terminator for expressing the sgRNA backbone sequence;
[0080] Furthermore, the replicon is used to regulate the replication of the sgRNA backbone mutant screening vector in the cell. Any replicon having the above function can be used in the present invention, such as pBR322, pUC, p15A, ColEI, pMB1, pSC101 and other replicons commonly used in the art. However, it is necessary to ensure that the replicon is compatible with the replicon in the Cas protein expression vector, that is, they can stably exist in the same cell at the same time; in the present invention, the pBR322 replicon shown in SEQ ID NO.4 is preferred;
[0081] Furthermore, the second resistance screening tag expression cassette comprises a second resistance screening tag, which may be any resistance gene different from the first resistance screening tag in the Cas protein expression vector;
[0082] Furthermore, the third screening marker expression cassette comprises a third screening marker gene, and the third screening marker gene is selected from a resistance gene or a non-resistance gene; the resistance gene can be any resistance gene different from the first resistance screening marker and the second resistance screening marker, including but not limited to resistance genes such as ampicillin, spectinomycin, chloramphenicol, kanamycin, and tetracycline; the non-resistance gene includes but is not limited to a fluorescent signal marker, a color signal marker, and the like;
[0083] When the third screening marker is a non-resistance gene, the selection includes but is not limited to fluorescent signal markers and color protein screening markers; the selection of the fluorescent signal markers includes but is not limited to green fluorescent signal markers, red fluorescent signal markers, blue fluorescent signal markers, yellow fluorescent signal markers, cyan fluorescent signal markers, etc.; flow cytometry and micro droplet sorting can be used for detection and sorting; the selection of the color signal markers includes but is not limited to meffRed, eforRed, asPink, spisPink, scOrange, fwYellow, amilGFP, amajLime, cjBlue, meffBlue, aeBlue, amilCP, tsPurple, gfasPurple, etc. (the above color signal markers have been disclosed in the following literature: Liljeruhm J, Funk SK, Tietscher S, Edlund AD, Jamal S, Wistrand-Yuen P, Dyrhage K, A,Ivermark K, J, V, Virtanen A, Lundin ER, Wistrand-Yuen E, Forster AC. Engineering a palette of eukaryotic chromoproteins for bacterial synthetic biology. J Biol Eng. 2018 May 10; 12: 8. doi: 10.1186 / s13036-018-0100-0. PMID: 29760772; PMCID: PMC5946454), which can be detected and sorted by color comparison under visible light;
[0084] The second resistance screening tag expression cassette further comprises a promoter, terminator and other elements for expressing the second resistance screening tag; the third screening tag expression cassette further comprises a promoter, terminator and other elements for expressing the third screening marker gene;
[0085] Among them, the second resistance screening tag is used for screening during the construction of the sgRNA backbone mutant screening vector and for screening cells containing the vector;
[0086] Among them, an insertion sequence is added to the third screening marker gene to inactivate it for subsequent screening of sgRNA backbone active mutant sequences, the insertion sequence comprises a recognizable 23bp exogenous sequence and a homologous sequence upstream of the third screening marker insertion site, the insertion site refers to the insertion site of the 23bp exogenous sequence on the third screening marker gene, which can be any site that can inactivate the third screening marker gene after insertion; the 23bp exogenous sequence comprises a 20bp recognition sequence and a 3bp PAM, the recognition sequence can be any exogenous sequence that is efficiently recognized by CRISPR / Cas9, the PAM is a protospacer adjacent motif, which is a conserved sequence adjacent to the 5' end or 3' end of the protospacer sequence, such as NGG, and the "N" can be any one of A, T, C, and G;
[0087] The promoter and terminator for expressing the sgRNA backbone sequence can be any commonly used promoter and terminator in the art, such as J23119, J23110, J23101, J23100, J23102; T1, T2, Tf, TtrpA, etc. In the present invention, the promoter J23119 shown in SEQ ID NO. 5 and the terminator T1 shown in SEQ ID NO. 6 or 10 are preferred.
[0088] In the present invention, the 61nt wild-type sgRNA backbone sequence was mutated to obtain the sgRNA backbone mutant sequence, wherein the DNA sequence of the wild-type sgRNA backbone sequence is: GTTTTAGGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAG TG;
[0089] In certain embodiments of the present invention, a 61nt sgRNA backbone mutant sequence and an N20 sequence are designed on a mutation primer, and the mutation primer is introduced into the above-mentioned sgRNA backbone mutant screening vector by homologous recombination, thereby constructing an sgRNA backbone mutant screening vector library. The mutation primer contains a homologous sequence to the above-mentioned sgRNA backbone mutant screening vector, which is used to introduce the sgRNA backbone mutant sequence and the N20 sequence into the screening vector by homologous recombination; the mutation primer contains a 61nt sgRNA backbone sequence with a mutation site introduced, the bases in the region to be mutated are set to N, and the region not to be mutated is the same as the DNA sequence of the wild-type sgRNA backbone sequence; the mutation primer contains an N20 sequence, which is consistent with the 20bp recognition sequence inserted in the third screening marker, so that the RNA sequence formed after transcription can be complementary to the 20bp recognition sequence, thereby guiding the Cas9 protein to the target site.
[0090] In certain embodiments of the present invention, the 61nt sgRNA backbone is divided into 6 regions (regional division is shown in FIG3 ), and at least one of the 6 regions is mutated to construct a sgRNA backbone mutation library.
[0091] Region 1 is the 1-6nt and 25-30nt parts of the sgRNA backbone;
[0092] Region 2 is the 9-12nt and 17-20nt parts of the sgRNA scaffold;
[0093] Region 3 is the 7-8nt, 13-14nt, and 21-24nt parts of the sgRNA scaffold;
[0094] Region 4 is the 42-48nt and 53-56nt parts of the sgRNA scaffold;
[0095] Region 5 is the 32-41 nt portion of the sgRNA scaffold;
[0096] Region 6 is the 49-52nt and 57-60nt parts of the sgRNA scaffold.
[0097] Among them, the mutants obtained by mutation of a single region are shown in Table 2.
[0098] In certain embodiments of the present invention, the mutants obtained by mutating the above-mentioned six regions separately are combined to obtain a mutant library in which 2, 3, 4, 5 or 6 regions are mutated simultaneously; among them, the mutants obtained based on the combination of single-region mutants are shown in Table 3.
[0099] In certain embodiments of the present invention, the 61nt sgRNA backbone is divided into four regions (regional division is shown in FIG9 ), and at least one of the four regions is mutated to construct a sgRNA backbone mutation library.
[0100] Region 1 is the 1-6nt, 9-12nt, 17-20n and 25-30nt parts of the sgRNA backbone;
[0101] Region 2 is the 7-8nt, 13-16nt, and 21-24nt parts of the sgRNA backbone;
[0102] Region 3 is the 33-41nt and 49-60nt parts of the sgRNA backbone;
[0103] Region 4 is the 31-32nt, 42-48nt, and 61nt parts of the sgRNA backbone;
[0104] Among them, the mutants obtained by mutation of a single region are shown in Table 4.
[0105] In certain embodiments of the present invention, mutants obtained by mutation of the above four regions are combined to obtain a mutant library in which two, three or four regions are mutated simultaneously.
[0106] The present invention also provides a method for screening sgRNA backbone active mutants;
[0107] Furthermore, when the third screening marker is a resistance gene, the method is to transform the above-constructed Cas protein expression vector and the sgRNA backbone mutation library into Escherichia coli respectively, and culture them on a screening medium containing the third resistance screening tag. The sgRNA backbone mutant sequence contained in the normally growing strain is the active sgRNA backbone mutant; preferably, the screening medium is an LB plate containing the third resistance screening tag;
[0108] Furthermore, when the third screening marker is a non-resistance gene, the method is to transform the above-constructed Cas protein expression vector and sgRNA backbone mutation library into Escherichia coli respectively, resuscitate the cells after screening by the third screening marker signal characteristic, and culture the sorted cells on a culture medium containing a second resistance screening label. The sgRNA backbone mutant sequence contained in the strain that grows normally and has the corresponding third screening marker signal characteristic is an active sgRNA backbone mutant.
[0109] The principle of this screening method is as follows: an active sgRNA backbone mutant can guide the Cas protein to bind to the recognition site, forming a ternary complex with the DNA sequence and activating the Cas9 protein nuclease activity. An exogenous 23bp sequence recognized by the Cas9-sgRNA complex is pre-inserted into the third selection marker gene sequence and included as part of the vector containing the sgRNA backbone mutant library. When the active sgRNA complex forms with Cas9, it guides the Cas9 protein to cleave the 23bp target sequence, thereby creating double-strand breaks in the DNA of the third selection marker gene sequence. Escherichia coli possesses an endogenous recBCD-dependent gene repair system. When double-strand breaks are generated in the bacterium, repair by homologous sequences restores the activity of the broken third selection marker gene. However, an inactive sgRNA backbone sequence cannot allow Cas9 to bind to the target sequence, resulting in no double-strand break. Therefore, the third selection marker gene coding sequence cannot be repaired, and thus the function of the third selection marker gene cannot be restored.
[0110] On this basis, (1) when the third screening marker is a resistance gene, strains containing active sgRNA backbone mutation sequences can grow on the third resistance plate, while strains containing inactive sgRNA backbone mutation sequences cannot grow on the plate. (2) When the third screening marker is a non-resistance gene, after the cells are fluorescently sorted by FACS or microdroplet sorter (or after color comparison under visible light), after recovery, the cells are plated on a plate containing the second resistance for growth. Strains containing active sgRNA backbone mutation sequences can grow normally and show the characteristics of the screening marker gene, such as producing fluorescence or the cells themselves having the corresponding color, while strains containing inactive sgRNA backbone mutation sequences cannot show the characteristics of the screening marker gene.
[0111] The present invention also provides applications of the sgRNA backbone mutants screened by the above screening method, in particular, applications in the CRISPR / Cas9 gene editing system, including but not limited to base editing, single gene target editing, multi-gene target editing, such as lead editing, base knockout, base substitution, base insertion, single gene knockout / insertion, multi-gene knockout / insertion, single gene expression gradient regulation, multi-gene transcriptional regulation, etc.
[0112] The present invention will be further explained below with reference to specific embodiments.
[0113] Table 1-1 Some primers and sequences involved in Examples 1-7 of the present invention
[0114] Table 1-2 Some primers and sequences involved in Examples 8-11 of the present invention
[0115] The present invention will be further explained below by means of specific examples.
[0116] Example 1: Construction of Cas protein expression vector pvCas-pre
[0117] In this example, the pAC-crRNA-CmR plasmid (addgene, #158711) was used as a vector, and the Cas9 protein encoding gene (SEQ ID NO: 1) was connected to the vector to construct a Cas9 expression vector pvCas-pre (SEQ ID NO: 3), which contains a plasmid replicon (p15A replicon, SEQ ID NO: 2), a resistance selection tag (CmR) encoding gene, and a Cas9 protein coding sequence.
[0118] 1. The experimental reagents used are:
[0119] ① Primers were synthesized according to conventional methods, and primer sequences were ordered from Suzhou Jinweizhi Biotechnology Co., Ltd.;
[0120] ② High-fidelity DNA polymerase was purchased from Vazyme;
[0121] ③ The vector recombination kit Clone was purchased from Vazyme;
[0122] ④DNA recovery kit was purchased from MEGA;
[0123] ⑤ Competent cell preparation reagents were purchased from Thermo Fisher;
[0124] ⑥DNA sequencing services are provided by Suzhou Genewise Biotechnology Co., Ltd.;
[0125] ⑦SOC culture medium formula: 2% Tryptone, 0.5% Yeast extract, 10mM NaCl, 2.5mM KCl, 10mM MgCl2, 20mM Glucose.
[0126] 2. The experimental strains used are:
[0127] The JM109 strain was used as a molecular cloning host and cultured in LB medium.
[0128] 3. The specific method for constructing the expression vector pvCas-pre is as follows:
[0129] (1) Using the pCas9cur vector (from Addgene) as a template, primers 1 and 2 were used to amplify the Cas9 protein coding gene sequence by PCR. The total PCR reaction system was 50 μL, including 25 μL primestar high-fidelity enzyme, 20 μL ddH2O, 2 μL primer 1, 2 μL primer 2, and 1 μL template pCas9cur plasmid. The PCR program was: 98°C for 1 min, 56°C for 15 s, and 72°C for 50 s, with 35 cycles to obtain the DNA fragment Cas9-Fragment containing the Cas9 protein coding sequence.
[0130] (2) Using the pAC-crRNA-CmR vector as a template, primers 3 and 4 were used to amplify the p15A replicon and the CmR resistance gene by PCR. The total PCR reaction system was 50 μL, including 25 μL primestar high-fidelity enzyme, 20 μL ddH2O, 2 μL primer 3, 2 μL primer 4 and 1 μL template pAC-crRNA-Cm. The PCR program was: 98°C for 1 min, 56°C for 15 s, and 72°C for 30 s. 35 cycles were set to obtain the DNA fragment Fragment-p15A containing the p15A replicon and the CmR resistance gene.
[0131] (3) The DNA fragments obtained in step (1) and step (2) are run on a gel to verify whether the bands are correct, and the correct bands are recovered using a DNA purification kit.
[0132] Then Cas9-Fragment and Fragment-p15A were connected. The connection system was generally prepared into 10 μL, with a specific ratio of 1.5 μL Cas9-Fragment and 3.5 μL Fragment-p15A, 5 μL Gibson Master Mix, mix well and place in a 50℃ water bath for ligation for 30 minutes. Transform the ligation product into 100μL of commercial Escherichia coli JM109 competent cells, place on ice for 20 minutes, heat shock at 42℃ for 45s, immediately place on ice for 2 minutes, then immediately add 700μL SOC medium and resuscitate in a shaker at 37℃ and 200rpm for 45 minutes. After centrifugation at 4000rpm for 2 minutes, remove 500μL of supernatant and evenly spread the remaining bacterial liquid on a plate containing chloramphenicol. Place the plate at 37℃, culture overnight, pick out a single clone, and extract the vector for sequencing verification. If there is no mutation in the Cas9 protein sequence, the correct Cas gene expression vector pvCas-pre is obtained (the vector structure is shown in Figure 1, and the nucleotide sequence is shown in SEQ ID NO.3).
[0133] Example 2: Construction of sgRNA scaffold mutant screening vector (the third screening tag is a resistance gene)
[0134] This example is used to construct an sgRNA backbone mutant screening vector, which can achieve efficient screening of active sgRNA backbone mutants. The specific construction method is as follows:
[0135] (1) Using the vector pBR322-TIMER (Addgene, #103056) as a template, primers 5 and 6 were used to amplify the replicon pBR322 (SEQ ID NO: 4) and the gene coding sequence of the antibiotic ampicillin (AmpR). The total PCR reaction system was 50 μL, including 25 μL primestar high-fidelity enzyme, 20 μL ddH2O, 2 μL primer 5, 2 μL primer 6, and 1 μL template pBR322-TIMER. The PCR program was as follows: 98°C for 1 min, 56°C for 15 s, and 72°C for 50 s, with 35 cycles to obtain the DNA fragment pBR322-AmpR-Fragment.
[0136] (2) Using the vector pUC57-Kan (Addgene, #121347) as a template, primers 7 and 8 were used to amplify the gene sequence of the antibiotic kanamycin (Kan). The total PCR reaction system was 50 μL, including 25 μL Primestar high-fidelity enzyme, 20 μL ddH2O, 2 μL Primer 7, 2 μL Primer 8, and 1 μL template pUC57-Kan. The PCR program was as follows: 98°C for 1 min, 56°C for 15 s, and 72°C for 20 s, with 35 cycles to obtain the DNA fragment KanR-Fragment.
[0137] (3) Run the DNA fragments obtained in step (1) and step (2) on a gel to verify whether the bands are correct, and use a DNA purification kit to recover the correct bands. Then, connect pBR322-AmpR-Fragment and KanR-Fragment. The connection system is generally prepared into 10 μL, with a specific ratio of 1.5 μL fragment KanR-Fragment and 3.5 μL fragment BR322-AmpR-Fragment, 5 μL Gibson Master Mix, mix well and place in a 50°C water bath for 30 minutes. Transform the ligation product into 100 μL of commercial Escherichia coli JM109 competent cells, place on ice for 20 minutes, heat shock at 42°C for 45 seconds, immediately place on ice for 2 minutes, then immediately add 700 μL of SOC medium and recover in a shaker at 37°C and 200 rpm for 45 minutes. After centrifugation at 4000 rpm for 2 minutes, remove 500 μL of supernatant and evenly spread the remaining bacterial liquid on an ampicillin-resistant plate. Incubate at 37°C overnight, pick a single clone, extract the vector and perform sequencing verification. If the verification is correct, the expression vector psBAK containing the replication origin pBR322, the antibiotic ampicillin (AmpR) and the antibiotic kanamycin (Kan) gene sequence is successfully constructed.
[0138] (4) Introducing a recognizable 23 bp exogenous sequence and a homologous sequence upstream of the insertion site into the kan coding sequence (wherein, the 23 bp exogenous sequence includes a 20 bp N20 sequence (the N20 sequence can be any exogenous sequence that can be efficiently recognized by CRISPR / Cas9) and a 3 bp PAM sequence; the insertion site refers to the insertion site of the 23 bp exogenous sequence on the kan gene, which can be any site that can inactivate the kan gene after insertion; the length of the homologous sequence upstream of the insertion site is not limited, as long as it can cause homologous recombination). The specific steps are as follows:
[0139] A 23-bp exogenous sequence (CCATCTAGCGATACACACCGAGG) and a homologous sequence upstream of the insertion site (TGTTTCGCTTGGTGG) were designed into primers 9 and 10. PCR amplification was performed using primers 9 and 10 with the psBAK vector as a template. The total PCR reaction volume was 50 μL, including 25 μL of Primestar high-fidelity enzyme, 20 μL of ddH2O, 2 μL of primer 9, 2 μL of primer 10, and 1 μL of the psBAK template. The PCR program was as follows: 98°C for 1 minute, 56°C for 15 seconds, and 72°C for 1 minute and 10 seconds, with 35 cycles to generate the psBAK-Fragment DNA fragment.
[0140] (5) The DNA fragment obtained in step (4) was run on a gel to verify whether the band was correct, and the correct band was recovered using a DNA purification kit. The purified DNA fragment was transformed into 100 μL of commercial competent cells of Escherichia coli JM109, ice-bathed for 20 minutes, heat-shocked at 42°C for 45 seconds, and immediately placed on ice for 2 minutes. Then, 700 μL of SOC medium was immediately added and the cells were revived in a shaker at 37°C and 200 rpm for 45 minutes. After centrifugation at 4000 rpm for 2 minutes, 500 μL of supernatant was removed, and the remaining bacterial liquid was evenly spread on an ampicillin-resistant plate and cultured at 37°C overnight. Since there are homologous sequences at both ends of psBAK-Fragment, the fragment can achieve self-conjugation in the cell. Single clones on the plate were picked, and the vector was extracted for sequencing verification. If the sequencing was correct, the expression vector psBAKn was successfully constructed.
[0141] (6) Using the vector psBAKn as a template, primers 11 and 12 were used for PCR amplification to introduce the upstream promoter J23119 (SEQ ID NO: 5) and T1 terminator (SEQ ID NO: 6) of the sgRNA backbone expression frame. The total PCR reaction system was 50 μL, including 25 μL primestar high-fidelity enzyme, 20 μL ddH2O, 2 μL primer 11, 2 μL primer 12, and 1 μL template psBAKn. The PCR program was: 98°C for 1 min, 56°C for 15 s, and 72°C for 1 min 10 s, with 35 cycles to obtain the DNA fragment psBAKn-Fragment.
[0142] (7) Run the DNA fragment obtained in step (6) on a gel to verify whether the band is correct. The correct band is recovered using a DNA purification kit. The purified DNA fragment is then transformed into 100 μL of commercial competent cells of Escherichia coli JM109, ice-bathed for 20 minutes, heat-shocked at 42°C for 45 seconds, immediately placed on ice for 2 minutes, and then immediately added with 700 μL of SOC medium and revived in a shaker at 37°C and 200 rpm for 45 minutes. After centrifugation at 4000 rpm for 2 min, 500 μL of supernatant was removed and the remaining bacterial liquid was evenly spread on an ampicillin-resistant plate and cultured at 37°C overnight. A single clone was picked and the vector was extracted for sequencing verification. If the sequencing was correct, the expression vector psBAKn-RW (SEQ ID NO. 7) was successfully constructed. The expression vector contains the pBR322 replicon, the Amp resistance gene, the inactivated kan gene, and the promoter J23119 and terminator T1 for expressing the sgRNA backbone sequence mutant (Figure 2).
[0143] Example 3: Construction of sgRNA backbone mutation library (the third screening tag is a resistance gene)
[0144] This example is mainly used to illustrate the method of constructing an sgRNA backbone mutation library.
[0145] The commonly used 61nt sgRNA backbone sequence in the prior art is as follows: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGTCCGUUAUCAACUUGAAA AAGUG. In this example, we mutated the six regions of the above sgRNA backbone (regional division is shown in Figure 3) to construct a mutation library. Among them,
[0146] Region 1 is the 1-6nt and 25-30nt parts of the sgRNA backbone;
[0147] Region 2 is the 9-12nt and 17-20nt parts of the sgRNA scaffold;
[0148] Region 3 is the 7-8nt, 13-14nt, and 21-24nt parts of the sgRNA scaffold;
[0149] Region 4 is the 42-48nt and 53-56nt parts of the sgRNA scaffold;
[0150] Region 5 is the 32-41 nt portion of the sgRNA scaffold;
[0151] Region 6 is the 49-52nt and 57-60nt parts of the sgRNA scaffold.
[0152] (1) Based on the DNA sequence of the above-mentioned 61nt sgRNA backbone sequence (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTG, SEQ ID NO.8), a degenerate primer was designed. The degenerate primer includes three parts: a sequence that can undergo homologous recombination with the sequence between the promoter J23119 and the terminator T1 on the expression vector psBAKn-RW, an N20 sequence, and an sgRNA backbone sequence that randomly introduces mutations at different sites. The mutation type of each site is N, including four nucleotide mutations of A / T / C / G. Among them, the upstream primer is bound to the vector through the homologous sequence, and the homologous sequence is followed by the introduced N20 sequence. The base of the region where the sgRNA backbone needs to be mutated is set to N, and the region where no mutation is required is the same as the DNA sequence of the original sgRNA backbone sequence. The downstream primer is bound to the vector through the homologous sequence, and the base of the region where the mutation is required is set to N, and the region where no mutation is required is the same as the DNA sequence of the original sgRNA backbone sequence. Degenerate primers introduce nucleotide mutations in the sgRNA backbone sequence and bind to the vector through homologous sequences. The capacity of the designed sgRNA scaffold mutation library is approximately 2×10 7 .
[0153] Specifically, using the vector psBAKn-RW as a template, random mutagenesis was performed in region 1 using degenerate primers 1 and 2, region 2 using degenerate primers 3 and 4, region 3 using degenerate primers 5 and 6, region 4 using degenerate primers 7 and 8, region 5 using degenerate primers 9 and 10, and region 6 using degenerate primers 11 and 12. Six PCR systems were constructed for PCR amplification, generating six sgRNA backbone sequence mutation libraries. The total PCR reaction volume was 50 μL, including 25 μL Primestar high-fidelity enzyme, 20 μL dd H2O, 2 μL degenerate primers 1 / 3 / 5 / 7 / 9 / 11, 2 μL degenerate primers 2 / 4 / 6 / 8 / 10 / 12, and 1 μL template psBAKn-RW. The PCR program was: 98°C for 1 min, 56°C for 15 s, and 72°C for 1 min 10 s, with 35 cycles. The following DNA fragment amplification products were obtained:
[0154] sgRNA backbone sequence with mutation in region 1: sgRNAL1-Fragment;
[0155] sgRNA backbone sequence with mutation in region 2: sgRNAL2-Fragment;
[0156] sgRNA backbone sequence with mutation in region 3: sgRNAL3-Fragment;
[0157] sgRNA backbone sequence with mutation in region 4: sgRNAL4-Fragment;
[0158] sgRNA backbone sequence with mutation in region 5: sgRNAL5-Fragment;
[0159] sgRNA backbone sequence with mutation in region 6: sgRNAL6-Fragment.
[0160] (2) Use a DNA purification kit to recover the DNA fragment obtained in step (1). Then, transform the purified DNA fragment into 100 μL of commercial competent cells of Escherichia coli JM109, place them in an ice bath for 20 minutes, heat shock them at 42°C for 45 seconds, and immediately place them on ice for 2 minutes. Then, immediately add 700 μL of SOC medium and resuscitate them in a shaker at 37°C and 200 rpm for 45 minutes. Then, transfer the bacterial solution to fresh LB medium containing Amp antibiotics, culture for 6 hours, extract the vector, and obtain the following mutant library:
[0161] sgRNA backbone sequence mutation library with mutations in region 1: psBAKn-RL1;
[0162] sgRNA backbone sequence mutation library with mutations in region 2: psBAKn-RL2;
[0163] sgRNA backbone sequence mutation library with mutations in region 3: psBAKn-RL3;
[0164] sgRNA backbone sequence mutation library with mutations in region 4: psBAKn-RL4;
[0165] sgRNA backbone sequence mutation library with mutations in region 5: psBAKn-RL5;
[0166] sgRNA backbone sequence mutation library with mutations in region 6: psBAKn-RL6.
[0167] Example 4: Screening of sgRNA backbone active mutants
[0168] This example is mainly used to illustrate the operation method of screening sgRNA backbone mutants.
[0169] This example screened the six sgRNA backbone mutation libraries constructed in Example 3. By transforming E. coli with the constitutive Cas9 expression vector pvCas-pre and the mutant libraries psBAKn-RL1 / 2 / 3 / 4 / 5 / 6 containing 61nt sgRNA backbones, the active sgRNA backbone mutants can guide the Cas protein to bind to the recognition site, forming a ternary complex with the DNA sequence to activate the Cas9 protein nuclease activity. An exogenous 23bp sequence recognized by the Cas9-sgRNA complex was pre-inserted into the Kan resistance gene sequence and included as part of the sgRNA backbone mutation library vector. When the active sgRNA forms a complex with Cas9, it guides the Cas9 protein to cleave the aforementioned 23bp target sequence, thereby generating double-strand breaks in the DNA of the Kan resistance gene sequence. Escherichia coli has an endogenous recBCD-dependent gene repair system. When a double-strand break in DNA occurs in the bacteria, the designed homologous region (i.e., the homologous sequence upstream of the insertion site introduced in the kan coding sequence) is repaired by the homologous sequence. The broken Kan resistance gene will be repaired, thereby restoring the Kan resistance activity of the strain. However, the inactive sgRNA backbone sequence cannot enable Cas9 to bind to the target sequence to produce a double-strand break, and therefore cannot repair the kan gene coding sequence. On this basis, strains containing active sgRNA backbone mutation sequences can grow on Kan-resistant LB plates, while strains containing inactive sgRNA backbone mutation sequences cannot grow on the plates (Figure 4).
[0170] Based on the above principles, this example screened the sgRNA backbone mutation library obtained in Example 3. The specific screening process is as follows:
[0171] (1) The pvCas-pre vector, which constitutively expresses the Cas9 protein, was transformed into competent cells of the JM109 strain. The cells were placed on ice for 20 minutes, heat-shocked at 42°C for 45 seconds, and immediately placed on ice for 2 minutes. Then, 700 μL of SOC medium was added and the cells were shaken at 37°C and 200 rpm for 45 minutes. After centrifugation at 4000 rpm for 2 minutes, 500 μL of the supernatant was removed and the remaining bacterial solution was evenly spread on a chloramphenicol-resistant plate and cultured at 37°C overnight.
[0172] (2) After 14 hours, transformants containing pvCas-pre were obtained on the resistance plate. The JM109 transformants containing the pvCas-pre vector were inoculated into LB liquid medium. After culturing for 12-16 hours, the seed liquid was transferred to fresh LB medium at a 1:100 inoculation volume. Competent cells were prepared according to the operating instructions of the competent preparation kit (Sangong, DP103). After the competent cells were prepared, the 61nt sgRNA backbone mutation vector library psBAKn-RL1, psBAKn-RL2, psBAKn-RL3, psBAKn-RL4, psBAKn-RL5, and psBAKn-RL6 were respectively transformed into JM109 competent cells containing the pvCas-pre vector, 1ml LB or SOC medium was added, and the cells were revived at 37℃ for 2h. The bacterial liquid was spread on LB plates containing Kan resistance and cultured at 37℃ overnight.
[0173] (3) Single colonies were selected from the LB plate containing Kan antibiotics, and colony PCR verification was performed using primers 13 and 14. The total PCR reaction system was 20 μL, including Taq enzyme (Vazyme, P131-01) from Novozymes, 20 μL ddH2O, 2 μL primer 13, 2 μL primer 14 and 1 μL diluted bacterial solution. The PCR program was: 95°C 3 min, 95°C 15 s, 56°C 15 s, 72°C 20 s, and 30 cycles were set. The colony PCR products were then sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for DNA sequencing, and the results were compared with the wild-type sgRNA backbone to obtain a variety of sgRNA backbone mutants. After sequencing and comparison, the following results were obtained (sequences are shown in Table 2):
[0174] Four mutants were screened from the sgRNA backbone mutation library psBAKn-RL1, namely sgRNAL1M1, sgRNAL1M2, sgRNAL1M3 and sgRNAL1M4;
[0175] Three mutants were screened from the sgRNA backbone mutation library psBAKn-RL2, namely sgRNAL2M1, sgRNAL2M2, and sgRNAL2M3;
[0176] Ten mutants were screened from the sgRNA backbone mutation library psBAKn-RL3, namely sgRNAL3M1, sgRNAL3M2, sgRNAL3M3, sgRNAL3M4, sgRNAL3M5, sgRNAL3M6, sgRNAL3M7, sgRNAL3M8, sgRNAL3M9, and sgRNAL3M10;
[0177] Ten mutants were screened from the sgRNA backbone mutation library psBAKn-RL4, namely sgRNAL4M1, sgRNAL4M2, sgRNAL4M3, sgRNAL4M4, sgRNAL4M5, sgRNAL4M6, sgRNAL4M7, sgRNAL4M8, sgRNAL4M9, and sgRNAL4M10;
[0178] Four mutants were screened from the sgRNA backbone mutation library psBAKn-RL5, namely sgRNAL5M1, sgRNAL5M2, sgRNAL5M3 and sgRNAL5M4;
[0179] Eight mutants were screened from the sgRNA backbone mutation library psBAKn-RL6, namely sgRNAL6M1, sgRNAL6M2, sgRNAL6M3, sgRNAL6M4, sgRNAL6M5, sgRNAL6M6, sgRNAL6M7 and sgRNAL6M8 (Table 2).
[0180] Table 2 sgRNA backbone mutant screening results
[0181] (4) Based on the single-region mutations screened in Table 2, the screened mutants were combined to screen out sgRNA backbone mutants with multi-region mutations.
[0182] Through random combination, we synthesized 23 sgRNA sequences with six region combination mutations (Table 3). Activity was verified. The specific screening process is as follows:
[0183] ① Using the vector psBAKn-RW as a template, 23 systems were constructed using upstream primers 88 / 90 / 92 / 94 / 96 / 98 / 100 / 102 / 104 / 106 / 108 / 110 / 112 / 114 / 116 / 118 / 120 / 122 / 124 / 126 / 128 / 130 / 132 and downstream primers 89 / 91 / 93 / 95 / 97 / 99 / 101 / 103 / 105 / 107 / 109 / 111 / 113 / 115 / 117 / 119 / 121 / 123 / 125 / 127 / 129 / 131 / 133 for PCR amplification to obtain 23 sgRNA backbone sequence fragments. The total PCR reaction system was 50 μL, including 25 μL primestar high-fidelity enzyme, 20 μL dd H2O, 2 μL upstream primer, 2 μL downstream primer, and 1 μL template psBAKn-RW. The PCR program was: 98°C for 1 min, 56°C for 15 s, and 72°C for 1 min 10 s, with 35 cycles. The following DNA fragment amplification products were obtained: sgRNA-syn1-Fragment, sgRNA-syn2-Fragment, sgRNA-syn3-Fragment, sgRNA-syn4-Fragment, sgRNA-syn5-Fragment, sgRNA-syn6-Fragment, sgRNA-syn7-Fragment, sgRNA-syn8-Fragment, sgRNA-syn9-Fragment, sgRNA-syn10-Fragment, sgRNA-syn11-Fragment, sgRNA-syn12-Fragment, sgRNA-syn13-Fragment, sgRNA-syn14-Fragment, sgRNA-syn15-Fragment, sgRNA-syn16-Fragment, sgRNA-syn17-Fragment, sgRNA-syn18-Fragment, sgRNA-syn1 ... NA-syn12-Fragment, sgRNA-syn13-Fragment, sgRNA-syn14-Fragment, sgRNA-syn15-Fragment, sgRNA-syn16-Fragment, sgRNA-syn17-Fragment, s gRNA-syn18-Fragment, sgRNA-syn19-Fragment, sgRNA-syn20-Fragment, sgRNA-syn21-Fragment, sgRNA-syn22-Fragment, sgRNA-syn23-Fragment.
[0184] ② Use a DNA purification kit to recover the DNA fragment obtained in step ①. Then, transform the purified DNA fragment into 100 μL of commercially competent E. coli JM109 cells. Incubate on ice for 20 minutes, heat shock at 42°C for 45 seconds, and immediately place on ice for 2 minutes. Immediately add 700 μL of SOC medium and resuspend the cells in a shaker at 37°C at 200 rpm for 45 minutes. Then, plate the culture onto LB plates containing the Amp antibiotic. After overnight culture, the single colony was transferred to LB culture containing Amp antibiotics, and the plasmid was extracted and sequenced to obtain the correctly sequenced plasmids: psgRNA-syn1, psgRNA-syn2, psgRNA-syn3, psgRNA-syn4, psgRNA-syn5, psgRNA-syn6, psgRNA-syn7, psgRNA-syn8, psgRNA-syn9, psgRNA-syn10, psgRNA-syn11, psgRNA-syn12, psgRNA-syn13, psgRNA-syn14, psgRNA-syn15, psgRNA-syn16, psgRNA-syn17, psgRNA-syn18, psgRNA-syn19, psgRNA-syn20, psgRNA-syn21, psgRNA-syn22, and psgRNA-syn23.
[0185] ③ Transform the Cas9 protein constitutive expression vector pvCas-pre into competent cells of the JM109 strain. Incubate on ice for 20 minutes, heat shock at 42°C for 45 seconds, and immediately place on ice for 2 minutes. Immediately add 700 μL of SOC medium and resuspend the cells in a shaker at 37°C at 200 rpm for 45 minutes. After centrifugation at 4000 rpm for 2 minutes, remove 500 μL of the supernatant and evenly spread the remaining culture onto chloramphenicol-resistant plates. Incubate at 37°C overnight.
[0186] ④ After 14 hours, transformants containing pvCas-pre were obtained on the plate. JM109 transformants containing the pvCas-pre vector were inoculated into LB liquid medium. After 12-16 hours of culture, the seed solution was transferred to fresh LB medium at a 1:100 inoculum ratio. Competent cells were prepared according to the instructions of the competence preparation kit (Sanggong, DP103). After the competent cells were prepared, psgRNA-syn1, psgRNA-syn2, psgRNA-syn3, psgRNA-syn4, psgRNA-syn5, psgRNA-syn6, psgRNA-syn7, psgRNA-syn8, psgRNA-syn9, psgRNA-syn10, psgRNA-syn11, psgRNA-syn12, psgRNA-syn13, psgRNA-syn14, psgRNA-syn15, psgRNA-syn16, psgRNA-syn17, psgRNA-syn18, psgRNA-syn19, psgRNA-syn20, psgRNA-syn21, psgRNA-syn22, and psgRNA-syn23 containing the artificially designed 61nt sgRNA backbone plasmid were transformed into the JM109 competent cells containing the pvCas-pre vector, and 1 ml was added. Resuscitate the cells in LB or SOC medium at 37°C for 2 h, spread the bacterial solution onto Kan-resistant LB plates, and culture at 37°C overnight.
[0187] ⑤ Colonies that can grow on Kan-resistant plates contain active sgRNA backbone mutants. The corresponding sgRNA backbone numbers are shown in Table 3.
[0188] Table 3 Combination sequences of sgRNA backbone mutants and their activities
[0189] Example 5: Application of sgRNA backbone mutants in single gene target editing
[0190] Using the screened sgRNA backbone mutants (sgRNAL1M1, sgRNAL1M2, sgRNAL1M3 and sgRNAL1M4), after interacting with the Cas9 protein, the genome is targeted at the 5'CAGTATCCCCGTTTACAGGG 3' position, and a 20bp exogenous sequence (ATGTACCCCTTCTGTGTTGC) is inserted into the Escherichia coli MG1655 genome. After the editing is completed, the inserted sequence is used as a verification primer and the editing is identified by colony PCR. If the sgRNA backbone mutant is active, the exogenous 20bp sequence can be successfully inserted into the genome, and the target band can be amplified using the verification primer; if the sgRNA backbone mutant is inactive, the exogenous sequence cannot be inserted into the genome, and therefore the target band cannot be amplified. The specific verification process is as follows:
[0191] (1) Construction of sgRNA expression vector
[0192] ① Using plasmid pJ23119-sgRNA (Addgene, #113654) as a template, PCR amplification was performed to introduce sgRNA L1M1 and N20 sequences (5'CAGTATCCCCGTTTACA3') using primers 15 and 16, sgRNA L1M2 and N20 sequences using primers 17 and 18, sgRNA L1M3 and N20 sequences using primers 19 and 20, and sgRNA L1M4 and N20 sequences using primers 21 and 22.
[0193] Each PCR reaction contained 50 μL of a 25 μL Primestar high-fidelity enzyme, 20 μL ddH₂O, 2 μL of the corresponding upstream primer, 2 μL of the corresponding downstream primer, and 1 μL of the pJ23119-sgRNA template. The PCR program was set to 98°C for 1 min, 56°C for 15 s, and 72°C for 30 s for 35 cycles. DNA fragments containing the sgRNA backbone mutant and the N20 sequence (sgRNA L1M1-N20-Fragment, sgRNA L1M2-N20-Fragment, sgRNA L1M3-N20-Fragment, and sgRNA L1M4-N20-Fragment) were generated.
[0194] ② Run the DNA fragment obtained in step ① on a gel to verify the correct bands. Correct bands were recovered using a DNA purification kit. The purified DNA fragments were then transformed into 100 μL of commercially competent E. coli JM109 cells. The cells were placed on ice for 20 minutes, heat-shocked at 42°C for 45 seconds, and immediately placed on ice for 2 minutes. Then, 700 μL of SOC medium was added and the cells were allowed to recover on a shaker at 37°C at 200 rpm for 45 minutes. After centrifugation at 4000 rpm for 2 minutes, 500 μL of the supernatant was removed and the remaining cell suspension was evenly spread on ampicillin-containing plates. The cells were incubated overnight at 37°C. Single colonies were selected, and the vectors were extracted and sequenced for verification. If the sequencing results were correct, the expression vectors psgRNA1-TS-A, psgRNA2-TS-A, psgRNA3-TS-A, and psgRNA4-TS-A containing the sgRNA backbone mutants and N20 were successfully constructed.
[0195] ③ Using psgRNA1-TS-A, psgRNA2-TS-A, psgRNA3-TS-A, and psgRNA4-TS-A obtained in step ② as templates, amplification was performed using primers 166 and 167. Each PCR reaction contained 50 μL of Primestar high-fidelity enzyme, 20 μL of ddH2O, 2 μL of primer 166, 2 μL of primer 167, and 1 μL of the corresponding template plasmid. The PCR program was set to 98°C for 1 min, 56°C for 15 s, and 72°C for 30 s for 35 cycles. This yielded DNA fragments containing the sgRNA backbone mutant and the N20 sequence: sgRNA L1M1-N20-Fragment-BB, sgRNA L1M2-N20-Fragment-BB, sgRNA L1M3-N20-Fragment-BB, and sgRNA L1M4-N20-Fragment-BB.
[0196] ④ Using strain MG1655 as a template, PCR amplification was performed using primers 168 and 169, and primers 170 and 171, respectively. Each PCR reaction volume consisted of 50 μL of Taq enzyme, 20 μL of ddH2O, 2 μL of the corresponding upstream primer, 2 μL of the corresponding downstream primer, and 1 μL of MG1655 bacterial culture. Primers 169 and 170 contained the 20-bp exogenous sequence to be inserted. The PCR program was: 95°C for 3 minutes, 95°C for 15 seconds, 56°C for 15 seconds, and 72°C for 20 seconds, for 30 cycles. The upstream and downstream homology repair sequences, 5-lacZ and 3-lacZ, were obtained for each site.
[0197] ⑤ Run the DNA fragments obtained in step ③ and step ④ on gel to verify whether the bands are correct, and recover the correct bands using a DNA purification kit. Then connect 5-lacZ, 3-lacZ with sgRNAL1M1-N20-Fragment-BB, sgRNAL1M2-N20-Fragment-BB, sgRNA L1M3-N20-Fragment-BB and sgRNA L1M4-N20-Fragment-BB. The connection system is generally prepared into 10μL, with a specific ratio of 1.5μL 5-lacZ fragment, 1.5μL 3-lacZ and 2μL corresponding backbone fragments sgRNAL1M1-N20-Fragment-BB, sgRNAL1M2-N20-Fragment-BB, sgRNA L1M3-N20-Fragment-BB or sgRNA L1M4-N20-Fragment-BB, 5μL Gibson Prepare the Master Mix, mix thoroughly, and ligate in a 50°C water bath for 30 minutes. Transform the ligation product into 100 μL of commercially competent E. coli JM109 cells, incubate on ice for 20 minutes, heat shock at 42°C for 45 seconds, and immediately place on ice for 2 minutes. Immediately add 700 μL of SOC medium and resuspend the cells in a shaker at 37°C at 200 rpm for 45 minutes. After centrifugation at 4000 rpm for 2 minutes, remove 500 μL of the supernatant and evenly spread the remaining bacterial solution on an ampicillin-resistant plate. Incubate at 37°C overnight. Pick a single colony, extract the vector, and perform sequencing verification. If the sequencing is correct, psgRNA1-TS, psgRNA2-TS, psgRNA3-TS, and psgRNA4-TS have been successfully constructed.
[0198] (2) Gene editing and editing activity identification using sgRNA backbone sequence mutants
[0199] ① The psgRNA1-TS, psgRNA2-TS, psgRNA3-TS, and psgRNA4-TS vectors were co-transformed with the pRED-Cas9 expression vector (Addgene, #71541) containing Cas9 and λRed into E. coli MG1655. The following steps were used: 5 μL of each vector was mixed and added to competent E. coli cells. Incubate on ice for 20 minutes, heat shock at 42 m for 45 seconds, and immediately place on ice for 2 minutes. Then, 700 μL of culture medium was added and the cells were shaken at 30°C and 200 rpm for 45 minutes. After centrifugation at 4000 rpm for 2 minutes, 500 μL of supernatant was removed and the remaining culture was evenly spread on plates containing ampicillin and spectinomycin. The cells were incubated overnight at 30°C.
[0200] ②Inoculate the single colony on the resistant plate to a plate containing ampicillin and spectinomycin. R ) in 5 mL LB medium and cultured overnight at 30°C and 200 rpm in a shaking incubator as seed solution.
[0201] ③ Transfer 1 mL of seed solution to 4 mL of fresh LB medium containing ampicillin, spectinomycin and 1 mM IPTG, and culture at 30°C, 200 rpm for 1 h. Add L-arabinose to a final concentration of 200 mM and culture at 30°C, 220 rpm for 3 h.
[0202] ④ Take 1 μL of the above bacterial solution and dilute it 100-fold with sterile water. Then spread the solution onto a solid medium containing ampicillin, spectinomycin, and 200 mM L-arabinose. Place the plate in a 30°C incubator and invert it to incubate overnight.
[0203] ⑤ To verify the successful insertion of the 20-bp exogenous gene into the genome, 10 single colonies were selected on LB plates containing Amp and Spec antibiotics and verified by colony PCR using primers 23 and 24. The total PCR reaction volume was 50 μL, including 25 μL of Novozymes Taq enzyme (Vazyme, P131-01), 20 μL of ddH2O, 2 μL of primer 23, 2 μL of primer 24, and 1 μL of diluted bacterial solution. The PCR program was: 95°C for 3 min, 95°C for 15 s, 56°C for 15 s, and 72°C for 20 s, for 30 cycles.
[0204] ⑥ The DNA fragment obtained in step ⑤ was run on agarose gel for verification. The results are shown in Figure 5. The target band size is 619 bp. The control is the wild-type MG1655 genome. Due to the lack of the 20 bp insertion, no band can be amplified. After statistics, all four sgRNA backbone mutants have gene editing activity. Among them, after using the sgRNA L1M1 mutant, 8 out of 10 colonies could successfully amplify the target band, so the editing efficiency of the sgRNA L1M1 mutant was 80%; after using the sgRNA L1M2 mutant, all 10 colonies could successfully amplify the target band, so the editing efficiency of sgRNA L1M2 was 100%; after using the sgRNA L1M3 mutant, 6 out of 10 colonies could successfully amplify the target band, so the editing efficiency of sgRNA L1M3 was 60%; after using the sgRNA L1M4 mutant, all 10 colonies could successfully amplify the target band, so the editing efficiency of sgRNA L1M4 was 100%. In summary, the method of the present invention can effectively screen active sgRNA mutants (Figure 5).
[0205] Example 6 Multi-target gene editing applications of sgRNA backbone mutants
[0206] This example is mainly used to illustrate that the screened sgRNA backbone mutants can be applied to the simultaneous editing of multiple gene sites.
[0207] In this example, the sgRNA backbone mutants sgRNA-syn1, sgRNA-syn3, sgRNA-syn20, and sgRNA-syn23 screened by the present invention were used to construct a CRISPR / Cas9 multi-target gene editing system to simultaneously knock out the four genes poxB, endA, maeA, and trkA on the Escherichia coli MG1655 genome.
[0208] This multi-target editing system contains three plasmids: pRED-Cas9, a vector expressing the CRISPR / Cas9 and λRed systems; psgRNA-Targets, a vector expressing multiple sgRNAs; and pDonors, a vector expressing multiple repair sequences. The four genes targeted by this system are poxB, endA, maeA, and trkA. After editing, specific primers are used for identification. The specific verification process is as follows:
[0209] (1) Construction of the sgRNA expression vector pJ23119-sgRNA-SecI
[0210] To construct the expression vector pJ23119-sgRNA-SecI containing the endonuclease Sec-I, PCR amplification of the replication origin pBR322 and the coding sequence for the antibiotic ampicillin (AmpR) was performed using the plasmid pJ23119-sgRNA (Addgene, #113654) as a template using primers 25 and 26. The total PCR reaction volume was 50 μL, including 25 μL of Primestar high-fidelity enzyme, 20 μL of ddH2O, 2 μL of primer 25, 2 μL of primer 26, and 1 μL of the template pJ23119-sgRNA. The PCR program was as follows: 98°C for 1 min, 56°C for 15 s, and 72°C for 50 s, with 35 cycles to obtain the DNA fragment J23119-sgRNA-Fragment.
[0211] ② Using the vector pBAD-I-SecI (Addgene, #60960) as a template, PCR amplification of the endonuclease SecI gene sequence was performed using primers 27 and 28. The total PCR reaction volume was 50 μL, including 25 μL of Primestar high-fidelity enzyme, 20 μL of ddH2O, 2 μL of primer 27, 2 μL of primer 28, and 1 μL of the template pBAD-I-SecI. The PCR program was as follows: 98°C for 1 min, 56°C for 15 s, and 72°C for 20 s, for 35 cycles to obtain the SecI-Fragment DNA fragment.
[0212] ③ Run the DNA fragments obtained in step ① and step ② on a gel to verify whether the bands are correct and recover the correct bands using a DNA purification kit. Then connect J23119-sgRNA-Fragment and SecI-Fragment. The connection system is generally prepared in 10μL, with a specific ratio of 1.5μL SecI-Fragment and 3.5μL J23119-sgRNA-Fragment, 5μL Gibson Master Mix, mix well and place in a 50°C water bath for 30 minutes. Transform the ligation product into 100 μL of commercial competent cells of Escherichia coli JM109, place on ice for 20 minutes, heat shock at 42°C for 45 seconds, immediately place on ice for 2 minutes, then immediately add 700 μL of SOC medium and recover in a shaker at 37°C and 200 rpm for 45 minutes. After centrifugation at 4000 rpm for 2 minutes, remove 500 μL of supernatant and evenly spread the remaining bacterial liquid on a resistance plate containing ampicillin. Place it at 37°C for overnight culture, pick a single clone, extract the vector for sequencing verification, and if the sequencing is correct, the expression vector pJ23119-sgRNA-SecI containing the replication start site pBR322, the antibiotic ampicillin (AmpR) and the nuclease endonuclease SecI gene sequence is successfully constructed.
[0213] (2) Construction of multiple sgRNA backbone expression vectors
[0214] ① Using pJ23119-sgRNA-SecI as a template, construct multiple sgRNA backbone expression vectors. PCR amplify the replication origin pBR322, the gene coding sequence for the antibiotic ampicillin (AmpR), and the SecI gene coding sequence using primers 29 and 30 to obtain the DNA fragment sgRNA-SecI-Fragment.
[0215] ② Gene synthesis of a sequence for the serial expression of four sgRNA backbone mutants, including sgRNA expression cassettes targeting four genes, each of which includes a promoter, an N20 sequence for targeting the target gene, an sgRNA backbone mutant sequence, and a terminator (i.e., Promter1-N20 poxB -sgRNA-syn1-Terminator1, Promter2-N20 endA -sgRNA-syn3-Terminator2, Promoter3-N20 maeA -sgRNA-syn20-Terminator3, Promoter4-N20 trkA -tandem sequence of sgRNA-syn23-Terminator4).
[0216] First, 4 μL of each of primers 31 to 58 was mixed to create a primer mix. This mixture was used to introduce the sgRNA backbone mutant sequence and the genomic targeting N20 sequences: poxB (N20 sequence: gtggcgatggagatgaaagc), endA (N20 sequence: cgacatgttcccactctacg), maeA (N20 sequence: cgatgacattcagggcactg), and trkA (N20 sequence: gtaattcactcatcaccgcg). The total PCR reaction volume for gene synthesis was 50 μL, consisting of 25 μL of Primestar high-fidelity enzyme, 21 μL of ddH2O, and 4 μL of the primer mix. The PCR program was as follows: 98°C for 1 min, 56°C for 15 s, and 72°C for 50 s, with 20 cycles to obtain the first-round PCR reaction solution. The second-round PCR reaction mixture consisted of 50 μL of Primestar high-fidelity enzyme, 19 μL of ddH₂O, 2 μL of primer 31, 2 μL of primer 58, and 2 μL of the first-round PCR reaction solution. The PCR program was as follows: 98°C for 1 min, 56°C for 15 s, and 72°C for 50 s, with 35 cycles to generate sgRNA fragments.
[0217] ③ Run the DNA fragments obtained in step ① and step ② on a gel to verify whether the bands are correct and use a DNA purification kit to recover the correct bands. Then connect the sgRNA-SecI-Fragment and sgRNAs-Fragment. The connection system is generally prepared in 10μL, with a specific ratio of 1.5μL fragment sgRNA-SecI-Fragment and 3.5μL fragment sgRNAs-Fragment, 5μL Gibson Master Mix, mix well and place in a 50℃ water bath for 30 minutes. Transform the ligation product into 100μL of commercial competent cells of Escherichia coli JM109, place on ice for 20 minutes, heat shock at 42℃ for 45 seconds, immediately place on ice for 2 minutes, then immediately add 700μL of SOC medium and recover in a shaker at 37℃ and 200rpm for 45 minutes. After centrifugation at 4000rpm for 2 minutes, remove 500μL of supernatant and evenly spread the remaining bacterial liquid on an ampicillin-resistant plate. Culture at 37℃ overnight, pick a single clone, extract the vector and perform sequencing verification. If the verification is correct, the expression vector psgRNAs-SecI containing the replication start site BR322, the antibiotic ampicillin (AmpR), the nuclease SecI gene sequence, multiple sgRNA backbones and N20 is successfully constructed.
[0218] (3) Construction of homologous sequence expression vector pDonors
[0219] ① Using pGL0_114 (Addgene, #199014) as a template, construct the homologous sequence expression vector pDonors. PCR amplification of the replication origin p15A and the gene coding sequence for the antibiotic chloramphenicol (CmR) was performed using primers 59 and 60 to generate the DNA fragment pDonors-Fragment.
[0220] ② Use a DNA purification kit to recover the DNA fragment obtained in step ①. Then, transform the purified DNA fragment into 100 μL of commercially competent E. coli JM109 cells. Place the cells on ice for 20 minutes, heat shock them at 42°C for 45 seconds, and immediately place them on ice for 2 minutes. Immediately add 700 μL of SOC medium and resuspend them in a shaker at 37°C at 200 rpm for 45 minutes. Transfer the bacterial suspension to fresh LB medium containing CmR antibiotics and, after 6 hours of incubation, extract the vector to obtain pDonors-BB.
[0221] ③ Amplify the upstream and downstream homologous sequences of each target.
[0222] PCR amplification was performed using strain MG1655 as a template using primers 63 and 65, primers 62 and 64, primers 66 and 67, primers 68 and 69, primers 70 and 71, primers 72 and 73, primers 74 and 75, and primers 76 and 77. Each PCR reaction contained 50 μL of Taq enzyme, 20 μL of ddH₂O, 2 μL of the corresponding upstream primer, 2 μL of the corresponding downstream primer, and 1 μL of MG1655 bacterial suspension. The PCR program was: 95°C for 3 min, 95°C for 15 s, 56°C for 15 s, and 72°C for 20 s, for 30 cycles. The upstream and downstream homologous repair sequences of each site were obtained: 5-trkA, 3-trkA, 5-poxB, 3-poxB, 5-endA, 3-endA, 5-maeA, 3-maeA.
[0223] ④ Run the DNA fragments obtained in step ③ on a gel to verify the correct bands. Once the correct bands are obtained, use primers 63 and 64, primers 66 and 69, primers 70 and 73, and primers 74 and 77, respectively, to ligate the upstream and downstream homology arms of the corresponding loci. Each PCR reaction volume is 50 μL, including 25 μL Taq enzyme, 17 μL ddH2O, 2 μL of the corresponding upstream primer, 2 μL of the corresponding downstream primer, 2 μL of the upstream fragment, and 2 μL of the downstream fragment. The PCR program is: 95°C for 3 min, 95°C for 15 s, 56°C for 15 s, and 72°C for 20 s, for 30 cycles. The homology repair sequences trkA-HA, poxB-HA, endA-HA, and maeA-HA for each locus are obtained.
[0224] ⑤ Run the DNA fragments obtained in step ④ on a gel to verify whether the bands are correct. After obtaining the correct bands, use primers 63 and 69, and primers 70 and 77, respectively, to connect the homologous repair sequences in pairs. The total system for each PCR reaction is 50μL, including 25μL Taq enzyme, 17μL ddH2O, 2μL corresponding upstream primer, 2μL corresponding downstream primer, 2μL upstream fragment and 2μL downstream fragment. The PCR program is: 95℃ 3min, 95℃ 15s, 56℃ 15s, 72℃ 20s, and 30 cycles are set. The homologous repair sequences trkA-poxB-HA and endA-maeA-HA at each site are obtained.
[0225] ⑥ To obtain the backbone fragment of the expression vector containing multiple homology repair sequences, PCR amplification was performed using primers 59 and 61, using pDonors-BB as the template. The total PCR reaction volume was 50 μL, including 25 μL of Primestar high-fidelity enzyme, 20 μL of ddH2O, 2 μL of primer 59, 2 μL of primer 61, and 1 μL of the pDonors-BB template. The PCR program was as follows: 98°C for 1 min, 56°C for 15 s, and 72°C for 50 s, for 35 cycles, to obtain the DNA fragment pDonors-BB-Fragment.
[0226] ⑦ Run the DNA fragments obtained in steps ⑤ and ⑥ on a gel to verify whether the bands are correct, and use a DNA purification kit to recover the correct bands. Then connect pDonors-BB-Fragment, trkA-poxB-HA and endA-maeA-HA. The connection system is generally prepared into 10μL, with the specific ratio of 1μL pDonors-BB-Fragment and 2μL trkA-poxB-HA, 2μL endA-maeA-HA, and 5μL Gibson Prepare the Master Mix, mix thoroughly, and ligate in a 50°C water bath for 30 minutes. Transform the ligation product into 100 μL of commercial competent E. coli JM109 cells, place on ice for 20 minutes, heat shock at 42°C for 45 seconds, and immediately place on ice for 2 minutes. Immediately add 700 μL of SOC medium and resuspend in a shaker at 37°C and 200 rpm for 45 minutes. After centrifugation at 4000 rpm for 2 minutes, remove 500 μL of the supernatant and evenly spread the remaining bacterial liquid on a chloramphenicol-resistant plate. Incubate at 37°C overnight, pick a single colony, extract the vector, and perform sequencing verification. If the verification is correct, the expression vector pDonors-TS4 containing the replication origin p15A, the antibiotic chloramphenicol, and multiple homologous repair sequences has been successfully constructed.
[0227] (4) Simultaneous knockout of four target genes
[0228] ① Transform the expression vectors psgRNAs-SecI, Cas9, and λRed expression vector pRED-Cas9 (Addgene, #71541) containing multiple sgRNA backbone sequences, as well as pDonors-TS4, into E. coli GM1655. The specific steps are as follows: 5 μL each of the sgRNA backbone expression vectors psgRNAs-SecI, Cas9, λRed expression vector pRED-Cas9, and pDonors-TS4 vectors were taken, mixed, and added to competent E. coli cells. The cells were incubated on ice for 20 minutes, heat-shocked at 42°C for 45 seconds, and immediately placed on ice for 2 minutes. Then, 700 μL of culture medium was added and the cells were shaken at 30°C and 200 rpm for 45 minutes. After centrifugation at 4000 rpm for 2 minutes, 500 μL of supernatant was removed and the remaining culture was evenly spread on plates containing ampicillin, spectinomycin, and chloramphenicol, and incubated overnight at 30°C.
[0229] ② Inoculate a single colony from the resistance plate into 5 mL of LB medium containing ampicillin, spectinomycin, and chloramphenicol, and culture overnight in a shaker at 30°C and 200 rpm as the seed solution.
[0230] ③ Transfer 1 mL of seed solution to 4 mL of fresh LB medium containing ampicillin, spectinomycin, chloramphenicol and 1 mM IPTG, culture at 30°C, 200 rpm for 1 h, add L-arabinose to a final concentration of 200 mM, and culture at 30°C, 220 rpm for 3 h.
[0231] ④ Take 1 μL of the bacterial solution and dilute it 10-fold with sterile water. Then spread the solution onto a solid medium containing ampicillin, spectinomycin, chloramphenicol, and a final concentration of 200 mM L-arabinose. Place the plate in a 30°C incubator and incubate overnight.
[0232] ⑤ To verify successful genome editing, single colonies grown on LB plates were selected and verified by colony PCR using primers 78 and 79, primers 80 and 81, primers 82 and 83, and primers 84 and 85. The total PCR reaction volume was 50 μL, including 25 μL of Novozymes Taq enzyme (Vazyme, P131-01), 20 μL of ddH2O, 2 μL of upstream primer, 2 μL of downstream primer, and 1 μL of diluted bacterial solution. The PCR program was: 95°C for 3 min, 95°C for 15 s, 56°C for 15 s, and 72°C for 20 s, with 30 cycles.
[0233] ⑥ Run the DNA fragments obtained in step ⑤ on a gel to verify the correct banding. Using the wild-type strain as a control, if the DNA band of the target strain is shorter than that of the wild-type strain, the gene knockout is successful. As shown in Figure 6, after gel run verification, the knockout efficiencies of the four genes trkA, poxB, endA, and maeA were 70%, 80%, 70%, and 80%, respectively. The efficiency of simultaneous knockout of all four loci was 30%.
[0234] In summary, the sgRNA backbone mutants screened in the present invention can be used for efficient simultaneous editing of multiple sites. When the wild-type sgRNA backbone was used to simultaneously knock out the above four genes, gene editing failed due to the difficulty in constructing the vector.
[0235] Example 7 Multi-target base editing application of sgRNA backbone
[0236] This example is mainly used to illustrate that the mutants obtained by screening the sgRNA backbone of the present invention can be applied to multi-site adenine base editing mediated by nCas9 (D10A). This multi-target editing system contains two plasmids, namely the vector pnCas9-ABE expressing nCas9 and adenine deaminase, and the vector psgRNA-Targets expressing multiple sgRNA backbone mutants. The four genes targeted by this system are poxB, endA, maeA, and trkA. The editing target is to change the A at the poxB target site to G, the T at the endA target site to C, the T at the maeA target site to C, and the T at the trkA target site to C.
[0237] (1) Construction of ABE base editing vector
[0238] To obtain the backbone fragment of the ABE base editor, PCR amplification was performed using primers 59 and 61, using pDonors-BB as the template. The total PCR reaction volume was 50 μL, including 25 μL of Primestar high-fidelity enzyme, 20 μL of ddH2O, 2 μL of primer 59, 2 μL of primer 61, and 1 μL of the pDonors-BB template. The PCR program was as follows: 98°C for 1 min, 56°C for 15 s, and 72°C for 50 s, with 35 cycles to obtain the DNA fragment pABE-BB.
[0239] To obtain the sequence of the adenine base editing system, PCR amplification of the adenine deaminase and Cas9 protein-encoding genes was performed using primers 86 and 87, using ABE8e (TadA-8e V82G) (Addgene, #138494) as a template. The total PCR reaction volume was 50 μL, including 25 μL of Primestar high-fidelity enzyme, 20 μL of ddH2O, 2 μL of primer 86, 2 μL of primer 87, and 1 μL of template ABE8e. The PCR program was as follows: 98°C for 1 min, 56°C for 15 s, and 72°C for 50 s, with 35 cycles to obtain the DNA fragment ABE-Fragment.
[0240] ③ Run the DNA fragments obtained in step ① and step ② on a gel to verify whether the bands are correct. Use a DNA purification kit to recover the correct bands. Then connect pABE-BB and ABE-Fragment. The connection system is generally prepared in 10μL, with a specific ratio of 1.5μL pABE-BB, 3.5μL ABE-Fragment, and 5μL Gibson Master Mix, mix thoroughly, and ligate in a 50°C water bath for 30 minutes. Transform the ligation product into 100 μL of commercial competent E. coli JM109 cells, place on ice for 20 minutes, heat shock at 42°C for 45 seconds, and immediately place on ice for 2 minutes. Then, immediately add 700 μL of SOC medium and resuspend in a shaker at 37°C and 200 rpm for 45 minutes. After centrifugation at 4000 rpm for 2 minutes, remove 500 μL of supernatant and evenly spread the remaining bacterial liquid on a chloramphenicol-resistant plate. Incubate at 37°C overnight, pick a single colony, extract the plasmid, and perform sequencing verification. If the sequencing is correct, the expression vector pnCas9-ABE containing the replication initiation site p15A, the chloramphenicol resistance gene, the Cas9 protein, and the adenine deaminase is successfully constructed.
[0241] (2) Construction of multiple sgRNA backbone expression vectors
[0242] ① Construct multiple sgRNA scaffold expression vectors using pJ23119-sgRNA as a template. PCR amplification of the replication origin BR322, the gene coding for the antibiotic ampicillin (AmpR), and the SecI gene coding sequence was performed using primers 29 and 30. The total PCR reaction volume was 50 μL, including 25 μL of Primestar high-fidelity enzyme, 20 μL of ddH2O, 2 μL of primer 25, 2 μL of primer 26, and 1 μL of template pJ23119-sgRNA. The PCR program was as follows: 98°C for 1 min, 56°C for 15 s, and 72°C for 50 s, with 35 cycles to obtain the DNA fragment sgRNA-Fragment.
[0243] ② Design a sequence for the tandem expression of four sgRNA backbones targeting poxB, endA, maeA, and trkA genes. The sequence includes sgRNA backbone expression cassettes targeting four genes, each of which includes a promoter, the N20 sequence of the targeted gene, an sgRNA backbone mutant sequence, and a terminator.
[0244] First, 4 μL of each primer from primer 134 to primer 165 was mixed to create a primer mix. Gene synthesis was used to generate the sgRNA mutants and the N20 sequences of the four target genes poxB, endA, maeA, and trkA. The N20 sequences were poxB (gtggcgatggagatgaaagc), endA (cgacatgttcccactctacg), maeA (cgatgacattcagggcactg), and trkA (gtaattcactcatcaccgcg), respectively. The total PCR reaction volume for gene synthesis was 50 μL, consisting of 25 μL Primestar high-fidelity enzyme, 21 μL ddH2O, and 4 μL of the primer mix. The PCR program was as follows: 98°C for 1 min, 56°C for 15 s, and 72°C for 50 s, with 20 cycles to generate the first-round PCR reaction solution. The second-round PCR reaction mixture consisted of 50 μL of Primestar high-fidelity enzyme, 19 μL of ddH₂O, 2 μL of primer 31, 2 μL of primer 58, and 2 μL of the first-round PCR reaction solution. The PCR program was as follows: 98°C for 1 min, 56°C for 15 s, and 72°C for 50 s, with 35 cycles to generate sgRNA fragments.
[0245] ③ Run the DNA fragments obtained in step ① and step ② on a gel to verify whether the bands are correct and use a DNA purification kit to recover the correct bands. Then connect the sgRNA-Fragment and sgRNAs-Fragment. The connection system is generally prepared into 10μL, with a specific ratio of 1.5μL fragment sgRNA-Fragment and 3.5μL fragment sgRNAs-Fragment, 5μL Gibson Master Mix, mix well and place in a 50°C water bath for 30 minutes. Transform the ligation product into 100 μL of commercial competent cells of Escherichia coli JM109, place on ice for 20 minutes, heat shock at 42°C for 45 seconds, immediately place on ice for 2 minutes, then immediately add 700 μL of SOC medium and recover in a shaker at 37°C and 200 rpm for 45 minutes. After centrifugation at 4000 rpm for 2 minutes, remove 500 μL of supernatant and evenly spread the remaining bacterial liquid on an ampicillin-resistant plate. Culture at 37°C overnight, pick a single clone, extract the plasmid for sequencing verification, and if the verification is correct, the expression vector psgRNA-Targets containing the replication start site pBR322, ampicillin resistance gene (AmpR), and multiple sgRNA backbones and N20 is successfully constructed.
[0246] (3) Multi-site base editing
[0247] ① Transform the psgRNA-Targets expression vector, which contains multiple sgRNA backbones, and the pnCas9-ABE base editing vector into E. coli MG1655. The specific steps are as follows: 5 μL of each vector was mixed and added to the competent E. coli cells. Incubate on ice for 20 minutes, heat shock at 42 m for 45 seconds, and immediately place on ice for 2 minutes. Then, immediately add 700 μL of culture medium and resuspend on a shaker at 30°C and 200 rpm for 45 minutes. After centrifugation at 4000 rpm for 2 minutes, remove 500 μL of the supernatant and evenly spread the remaining culture on a plate containing ampicillin and chloramphenicol. Incubate at 30°C overnight.
[0248] ② To determine whether adenine base editing has been successfully achieved in single colonies on the resistance plate, single colonies grown on LB plates were selected and verified by colony PCR using primers 78 and 79, primers 80 and 81, primers 82 and 83, and primers 84 and 85. The total PCR reaction system was 20 μL, including Novozymes Taq enzyme (Vazyme, P131-01), 20 μL ddH2O, 2 μL upstream primer, 2 μL downstream primer, and 1 μL diluted bacterial solution. The PCR program was: 95°C for 3 min, 95°C for 15 s, 56°C for 15 s, and 72°C for 20 s, with 30 cycles.
[0249] ③ The DNA fragment obtained in step ② was sequenced for verification. If the sequencing results showed that the A at the poxB target site was changed to a G, the T at the endA target site was changed to a C, the T at the maeA target site was changed to a C, and the T at the trkA target site was changed to a C, then the base editing was successful. The results are shown in Figure 7, indicating that adenine base editing was achieved at all four sites.
[0250] In summary, the sgRNA backbone mutants screened in this invention can effectively perform base editing at multiple sites. When the wild-type sgRNA backbone was used to perform base editing of four genes simultaneously, multi-site base editing failed due to the difficulty in constructing the vector.
[0251] Example 8: Construction of sgRNA scaffold mutant screening vector (the third screening tag is a non-resistance gene)
[0252] This example is used to construct an sgRNA backbone mutant screening vector, which can achieve efficient screening of active sgRNA backbone mutants. The specific construction method is as follows:
[0253] (1) Using the vector pBR322-TIMER (Addgene, #103056) as a template, PCR amplification of the replicon pBR322 (SEQ ID NO: 4) and the gene coding sequence for the antibiotic ampicillin (AmpR) was performed using primers 5' and 6'. The total PCR reaction system was 50 μL, including 25 μL Primestar high-fidelity enzyme, 20 μL ddH2O, 2 μL primer 5', 2 μL primer 6', and 1 μL template pBR322-TIMER. The PCR program was as follows: 98°C for 1 min, 56°C for 15 s, and 72°C for 50 s, with 35 cycles. The DNA fragment pBR322-AmpR-Fragment was obtained.
[0254] (2) Using the vector pUC-BB-eGFP (Addgene, #32548) as a template, the eGFP gene sequence was amplified by PCR using primers 7' and 8'. The total PCR reaction system was 50 μL, including 25 μL Primestar high-fidelity enzyme, 20 μL ddH2O, 2 μL primer 7', 2 μL primer 8', and 1 μL template pUC57-BB-eGFP. The PCR program was as follows: 98°C for 1 min, 56°C for 15 s, and 72°C for 20 s, with 35 cycles to obtain the eGFP-fragment DNA fragment.
[0255] (3) Run the DNA fragments obtained in step (1) and step (2) on a gel to verify whether the bands are correct, and use a DNA purification kit to recover the correct bands. Then connect pBR322-AmpR-Fragment and eGFP-Fragment. The connection system is generally prepared into 10 μL, with a specific ratio of 1.5 μL eGFP-Fragment and 3.5 μL pBR322-AmpR-Fragment, 5 μL Gibson Master Mix, mix thoroughly, and ligate in a 50°C water bath for 30 minutes. Transform the ligation product into 100 μL of commercial E. coli JM109 competent cells, incubate on ice for 20 minutes, heat shock at 42°C for 45 seconds, and immediately place on ice for 2 minutes. Then, immediately add 700 μL of SOC medium and resuspend in a shaker at 37°C at 200 rpm for 45 minutes. After centrifugation at 4000 rpm for 2 minutes, remove 500 μL of the supernatant and evenly spread the remaining bacterial liquid on ampicillin-resistant plates. Incubate at 37°C overnight, pick a single colony, extract the vector, and sequence it for verification. If the verification is correct, the expression vector psBAG containing the replication origin pBR322, the antibiotic ampicillin (AmpR), and the gene sequence for green fluorescent protein (egfp) has been successfully constructed.
[0256] (4) Introducing a recognizable 23 bp exogenous sequence and a homologous sequence upstream of the insertion site into the egfp coding sequence (wherein, the 23 bp exogenous sequence includes a 20 bp N20 sequence (the N20 sequence can be any exogenous sequence that can be efficiently recognized by CRISPR / Cas9) and a 3 bp PAM sequence; the insertion site refers to the insertion site of the 23 bp exogenous sequence on the egfp gene, which can be any site that can inactivate the egfp gene after insertion; the length of the homologous sequence upstream of the insertion site is not limited, as long as it can cause homologous recombination). The specific steps are as follows:
[0257] A 23-bp exogenous sequence (CCATCTAGCGATACACACCGAGG) and a homologous sequence upstream of the insertion site (tgtttcgcttggtgg) were designed into primers 9' and 10'. PCR amplification was performed using primers 9' and 10' with the psBAG vector as a template. The total PCR reaction volume was 50 μL, including 25 μL of Primestar high-fidelity enzyme, 20 μL of ddH2O, 2 μL of primer 9', 2 μL of primer 10', and 1 μL of the psBAG template. The PCR program was as follows: 98°C for 1 minute, 56°C for 15 seconds, and 72°C for 1 minute and 10 seconds, with 35 cycles to generate the psBAG-Fragment DNA fragment.
[0258] (5) Run the DNA fragment obtained in step (4) on a gel to verify whether the band is correct, and use a DNA purification kit to recover the correct band. The purified DNA fragment was transformed into 100 μL of commercial competent cells of Escherichia coli JM109, ice-bathed for 20 minutes, heat-shocked at 42°C for 45 seconds, immediately placed on ice for 2 minutes, and then immediately added with 700 μL of SOC medium and revived in a shaker at 37°C and 200 rpm for 45 minutes. After centrifugation at 4000 rpm for 2 minutes, 500 μL of supernatant was removed, and the remaining bacterial liquid was evenly spread on an ampicillin-resistant plate and cultured at 37°C overnight. Since there are homologous sequences at both ends of the psBAG-Fragment, the fragment can achieve self-concatenation in the cell. Pick the single clone on the plate, extract the vector for sequencing verification, and if the sequencing is correct, the expression vector psBAGn is successfully constructed.
[0259] (6) Using the vector psBAGn as a template, primers 11' and 12' were used for PCR amplification to introduce the upstream promoter J23119 (SEQ ID NO: 5) and T1 terminator (SEQ ID NO: 10) of the sgRNA backbone expression frame. The total PCR reaction system was 50 μL, including 25 μL primestar high-fidelity enzyme, 20 μL ddH2O, 2 μL primer 11', 2 μL primer 12' and 1 μL template psBAGn. The PCR program was: 98°C for 1 min, 56°C for 15 s, and 72°C for 1 min 10 s, with 35 cycles to obtain the DNA fragment psBAGn-Fragment.
[0260] (7) Run the DNA fragment obtained in step (6) on a gel to verify whether the band is correct. The correct band is recovered using a DNA purification kit. The purified DNA fragment is then transformed into 100 μL of commercial competent cells of Escherichia coli JM109, ice-bathed for 20 minutes, heat-shocked at 42°C for 45 seconds, immediately placed on ice for 2 minutes, and then immediately added with 700 μL of SOC medium and revived in a shaker at 37°C and 200 rpm for 45 minutes. After centrifugation at 4000 rpm for 2 min, 500 μL of supernatant was removed and the remaining bacterial liquid was evenly spread on an ampicillin-resistant plate and cultured at 37°C overnight. A single clone was picked and the vector was extracted for sequencing verification. If the sequencing was correct, the expression vector psBAGn-RW (SEQ ID NO: 9) was successfully constructed. The expression vector contains the pBR322 replicon, the Amp resistance gene, the inactivated egfp gene, and the promoter J23119 and terminator T1 for expressing the sgRNA backbone sequence mutant (Figure 8).
[0261] Example 9: Construction of sgRNA backbone mutation library (the third screening tag is a non-resistance gene)
[0262] This example is mainly used to illustrate the method of constructing an sgRNA backbone mutation library.
[0263] The commonly used 61nt sgRNA backbone sequence in the prior art is as follows: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGTCCGUUAUCAACUUGAAAAAGUG. In this example, we mutated two of the four regions of the sgRNA backbone (region division is shown in Figure 9) to construct a mutation library. Among them,
[0264] Region 1 is the 1-6nt, 9-12nt, 17-20n and 25-30nt parts of the sgRNA backbone;
[0265] Region 2 is the 7-8nt, 13-16nt, and 21-24nt parts of the sgRNA backbone;
[0266] Region 3 is the 33-41nt and 49-60nt parts of the sgRNA backbone;
[0267] Region 4 is the 31-32nt, 42-48nt, and 61nt parts of the sgRNA backbone;
[0268] (1) Based on the DNA sequence of the above-mentioned 61nt sgRNA backbone sequence (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTG, SEQ ID NO.8), a degenerate primer was designed. The degenerate primer includes three parts: a sequence that can undergo homologous recombination with the sequence between the promoter J23119 and the terminator T1 on the expression vector psBAGn-RW, an N20 sequence, and an sgRNA backbone sequence that randomly introduces mutations at different sites. The mutation type of each site is N, including four nucleotide mutations of A / T / C / G. Among them, the upstream primer is bound to the vector through the homologous sequence, and the homologous sequence is followed by the introduced N20 sequence. The base of the region where the sgRNA backbone needs to be mutated is set to N, and the region where no mutation is required is the same as the DNA sequence of the original sgRNA backbone sequence. The downstream primer is bound to the vector through the homologous sequence, and the base of the region where the mutation is required is set to N, and the region where no mutation is required is the same as the DNA sequence of the original sgRNA backbone sequence. Degenerate primers introduce nucleotide mutations in the sgRNA backbone sequence and bind to the vector through homologous sequences. The capacity of the designed sgRNA backbone mutation library is approximately 2×10 7 .
[0269] Specifically, using the vector psBAGn-RW as a template, random mutations were performed on region 2 using degenerate primers 1' and 2', and random mutations were performed on region 4 using degenerate primers 3' and 4'. Two systems were constructed for PCR amplification to obtain two sgRNA backbone sequence mutation libraries. The total PCR reaction system was 50 μL, including 25 μL primestar high-fidelity enzyme, 20 μL dd H2O, 2 μL degenerate primers 1' / 3', 2 μL degenerate primers 2' / 4' and 1 μL template psBAGn-RW. The PCR program was: 98°C for 1 min, 56°C for 15 s, 72°C for 1 min 10 s, and 35 cycles were set to obtain the following DNA fragment amplification products:
[0270] sgRNA backbone sequence with mutation in region 2: sgRNAL2-Fragment;
[0271] sgRNA backbone sequence with mutation in region 4: sgRNAL4-Fragment.
[0272] (2) Use a DNA purification kit to recover the DNA fragment obtained in step (1). Then, transform the purified DNA fragment into 100 μL of commercial competent cells of Escherichia coli JM109, place them in an ice bath for 20 minutes, heat shock them at 42°C for 45 seconds, and immediately place them on ice for 2 minutes. Then, immediately add 700 μL of SOC medium and resuscitate them in a shaker at 37°C and 200 rpm for 45 minutes. Then, transfer the bacterial solution to fresh LB medium containing Amp antibiotics, culture for 6 hours, extract the vector, and obtain the following mutant library:
[0273] sgRNA backbone sequence mutation library with mutations in region 2: psBAGn-RL2;
[0274] sgRNA backbone sequence mutation library with mutations in region 4: psBAGn-RL4.
[0275] Example 10: Screening of sgRNA backbone active mutants
[0276] This example is mainly used to illustrate the operation method of screening sgRNA backbone mutants.
[0277] This example screened the two sgRNA backbone mutation libraries constructed in Example 9. By transforming the Cas9 constitutive expression vector pvCas-pre constructed in Example 1 and the mutant library psBAKGn-RL2 / 4 containing a 61nt sgRNA backbone constructed in Example 9 into Escherichia coli, the active sgRNA backbone mutants were able to guide the Cas protein to bind to the recognition site, forming a ternary complex with the DNA sequence and activating the Cas9 protein nuclease activity. An exogenous 23bp sequence recognized by the Cas9-sgRNA complex was pre-inserted into the eGFP fluorescent protein sequence and included as part of the sgRNA backbone mutation library vector. When the active sgRNA formed a complex with Cas9, it guided the Cas9 protein to cleave the 23bp target sequence, thereby creating double-strand breaks in the DNA of the eGFP fluorescent protein sequence. E. coli has an endogenous recBCD-dependent gene repair system. When double-strand breaks occur within the bacteria, repair by homologous sequences in the designed homologous region (i.e., the homologous sequence upstream of the insertion site introduced into the egfp coding sequence) repairs the broken egfp gene, restoring fluorescence expression in the strain. However, the inactive sgRNA backbone sequence prevents Cas9 from binding to the target sequence to generate double-strand breaks, and therefore cannot repair the egfp gene coding sequence. Based on this, the revived bacterial solution is detected and sorted by FACS, and strains containing active sgRNA can be detected and sorted (Figure 10).
[0278] Based on the above principles, this example screened the sgRNA backbone mutation library obtained in Example 9. The specific screening process is as follows:
[0279] (1) The pvCas-pre vector, which constitutively expresses the Cas9 protein, was transformed into competent cells of the JM109 strain. The cells were placed on ice for 20 minutes, heat-shocked at 42°C for 45 seconds, and immediately placed on ice for 2 minutes. Then, 700 μL of SOC medium was added and the cells were shaken at 37°C and 200 rpm for 45 minutes. After centrifugation at 4000 rpm for 2 minutes, 500 μL of the supernatant was removed and the remaining bacterial solution was evenly spread on a chloramphenicol-resistant plate and cultured at 37°C overnight.
[0280] (2) After 14 hours, transformants containing pvCas-pre were obtained on the resistance plate. The JM109 transformants containing the pvCas-pre vector were inoculated into LB liquid medium. After culturing for 12-16 hours, the seed liquid was transferred to fresh LB medium at a 1:100 inoculation volume. Competent cells were prepared according to the operating instructions of the competent preparation kit (Sanggong, DP103). After the competent cells were prepared, the 61nt sgRNA backbone mutation vector libraries psBAGn-RL2 and psBAGn-RL4 were respectively transformed into JM109 competent cells containing the pvCas-pre vector, 1ml LB or SOC medium was added, and the cells were revived at 37°C for 6h. After that, fluorescent cell sorting was performed by flow cytometry (see Figure 11 for the sorting results). After the sorted cells were revived for 1h, they were spread onto LB plates containing Amp resistance and cultured at 37°C overnight.
[0281] (3) Single colonies with fluorescence expression were selected on LB plates containing Amp antibiotics, and colony PCR verification was performed using primers 13' and 14'. The total PCR reaction system was 20 μL, including Taq enzyme (Vazyme, P131-01) from Novozymes, 20 μL ddH2O, 2 μL primer 13', 2 μL primer 14' and 1 μL diluted bacterial solution. The PCR program was: 95°C 3 min, 95°C 15 s, 56°C 15 s, 72°C 20 s, and 30 cycles were set. The colony PCR products were then sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for DNA sequencing, and the results were compared with the wild-type sgRNA backbone to obtain a variety of sgRNA backbone mutants. After sequencing and comparison, the following results were obtained (sequences are shown in Table 4):
[0282] Eight mutants were screened from the sgRNA backbone mutation library psBAGn-RL2, namely sgRNAM2-1, sgRNAM2-2, sgRNAM2-3, sgRNAM2-4, sgRNAM2-5, sgRNAM2-6, sgRNAM2-7, and sgRNAM2-8;
[0283] Eight mutants were screened from the sgRNA backbone mutation library psBAGn-RL4, namely sgRNAM4-1, sgRNAM4-2, sgRNAM4-3, sgRNAM4-4, sgRNAM4-5, sgRNAM4-6, sgRNAM4-7, and sgRNAM4-8.
[0284] Table 4 sgRNA backbone mutant screening results
[0285] Example 11: Gene Editing Applications of sgRNA Backbone Mutants
[0286] Using the screened sgRNA backbone mutants (sgRNAM2-1, sgRNAM2-2, sgRNAM2-3 and sgRNAM2-4), after interacting with the Cas9 protein, the genome is targeted at the 5'CAGTATCCCCGTTTACAGGG 3' position, and a 20bp exogenous sequence (ATGTACCCCTTCTGTGTTGC) is inserted into the Escherichia coli MG1655 genome. After the editing is completed, the inserted sequence is used as a verification primer and the editing is identified by colony PCR. If the sgRNA backbone mutant is active, the exogenous 20bp sequence can be successfully inserted into the genome, and the target band can be amplified using the verification primer; if the sgRNA backbone mutant is inactive, the exogenous sequence cannot be inserted into the genome, and therefore the target band cannot be amplified. The specific verification process is as follows:
[0287] (1) Construction of sgRNA expression vector
[0288] ① Using plasmid pJ23119-sgRNA (addgene, #113654) as a template, PCR amplification was performed to introduce sgRNALM2-1 and N20 sequences (5'CAGTATCCCCGTTTACA3') using primers 15' and 16', sgRNAM2-2 and N20 sequences using primers 17' and 18', sgRNAM2-3 and N20 sequences using primers 19' and 20', and sgRNAM2-4 and N20 sequences using primers 21' and 22'.
[0289] Each PCR reaction contained 50 μL of a 25 μL Primestar high-fidelity enzyme, 20 μL ddH₂O, 2 μL of the corresponding upstream primer, 2 μL of the corresponding downstream primer, and 1 μL of the pJ23119-sgRNA template. The PCR program was set to 98°C for 1 min, 56°C for 15 s, and 72°C for 30 s for 35 cycles. DNA fragments containing the sgRNA backbone mutants and the N20 sequence, sgRNAM2-1-N20-Fragment, sgRNAM2-2-N20-Fragment, sgRNAM2-3-N20-Fragment, and sgRNAM2-4-N20-Fragment, were generated.
[0290] ② Run the DNA fragment obtained in step 1 on a gel to verify the correct bands. Correct bands were recovered using a DNA purification kit. The purified DNA fragments were then transformed into 100 μL of commercially competent E. coli JM109 cells. The cells were placed on ice for 20 minutes, heat-shocked at 42°C for 45 seconds, and immediately placed on ice for 2 minutes. The cells were then immediately added to 700 μL of SOC medium and allowed to recover on a shaker at 37°C at 200 rpm for 45 minutes. After centrifugation at 4000 rpm for 2 minutes, 500 μL of the supernatant was removed and the remaining culture was evenly spread on an Amp-resistant plate. The cells were cultured overnight at 37°C. Single colonies were selected, and the vectors were extracted and sequenced for verification. If the sequencing results were correct, the expression vectors psgRNA1-TS-A, psgRNA2-TS-A, psgRNA3-TS-A, and psgRNA4-TS-A containing the sgRNA backbone mutants and N20 were successfully constructed.
[0291] ③ Using psgRNA1-TS-A, psgRNA2-TS-A, psgRNA3-TS-A, and psgRNA4-TS-A obtained in step ② as templates, amplify using primers 23' and 24'. Each PCR reaction contained 50 μL of Primestar high-fidelity enzyme, 20 μL of ddH2O, 2 μL of primer 23', 2 μL of primer 24', and 1 μL of the corresponding template plasmid. The PCR program was as follows: 98°C for 1 min, 56°C for 15 s, and 72°C for 30 s, for 35 cycles. This yielded DNA fragments containing the sgRNA backbone mutant and the N20 sequence: sgRNAM2-1-N20-Fragment-BB, sgRNAM2-2-N20-Fragment-BB, sgRNAM2-3-N20-Fragment-BB, and sgRNAM2-4-N20-Fragment-BB.
[0292] ④ Using the MG1655 strain as a template, perform PCR amplification using primers 25' and 26', and primers 27' and 28', respectively. Each PCR reaction volume consists of 50 μL, including 25 μL Taq enzyme, 20 μL ddH2O, 2 μL of the corresponding upstream primer, 2 μL of the corresponding downstream primer, and 1 μL of MG1655 bacterial culture. Primers 26' and 27' contain the 20-bp exogenous sequence to be inserted. The PCR program is: 95°C for 3 minutes, 95°C for 15 seconds, 56°C for 15 seconds, and 72°C for 20 seconds, for 30 cycles. This yields the upstream and downstream homology repair sequences 5-lacZ and 3-lacZ, corresponding to the insertion site.
[0293] ⑤ Run the DNA fragments obtained in step ③ and step ④ on gel to verify whether the bands are correct, and recover the correct bands using a DNA purification kit. Then connect 5-lacZ, 3-lacZ with sgRNAM2-1-N20-Fragment-BB, sgRNAM2-2-N20-Fragment-BB, sgRNAM2-3-N20-Fragment-BB or sgRNAM2-4-N20-Fragment-BB. The connection system is generally prepared into 10μL, with a specific ratio of 1.5μL 5-lacZ fragment, 1.5μL 3-lacZ and 2μL corresponding backbone fragments sgRNAM2-1-N20-Fragment-BB, sgRNAM2-2-N20-Fragment-BB, sgRNAM2-3-N20-Fragment-BB or sgRNAM2-4-N20-Fragment-BB, 5μL Gibson Master Mix, mix thoroughly, and place in a 50°C water bath for 30 minutes. Transform the ligation product into 100 μL of commercial competent E. coli JM109 cells, place on ice for 20 minutes, heat shock at 42°C for 45 seconds, and immediately place on ice for 2 minutes. Then, immediately add 700 μL of SOC medium and resuscitate on a shaker at 37°C and 200 rpm for 45 minutes. After centrifugation at 4000 rpm for 2 minutes, remove 500 μL of the supernatant and evenly spread the remaining bacterial liquid on an ampicillin-resistant plate. Incubate at 37°C overnight, pick a single colony, extract the vector, and sequence it for verification. If the sequencing is correct, psgRNA1-TS, psgRNA2-TS, psgRNA3-TS, and psgRNA4-TS are successfully constructed.
[0294] (2) Gene editing and editing activity identification using sgRNA backbone sequence mutants
[0295] ① The psgRNA1-TS, psgRNA2-TS, psgRNA3-TS, and psgRNA4-TS vectors were co-transformed with the pRED-Cas9 expression vector (Addgene, #71541) containing Cas9 and λRed into E. coli MG1655. The specific steps were as follows: 5 μL of each vector was mixed and added to competent E. coli cells. Incubate on ice for 20 minutes, heat shock at 42°C for 45 seconds, and immediately place on ice for 2 minutes. Then, 700 μL of culture medium was added and the cells were shaken at 30°C and 200 rpm for 45 minutes. After centrifugation at 4000 rpm for 2 minutes, 500 μL of supernatant was removed and the remaining culture was evenly spread on a plate containing ampicillin and spectinomycin. The cells were incubated overnight at 30°C.
[0296] ②Inoculate the single colony on the resistant plate to a plate containing ampicillin and spectinomycin. R ) in 5 mL LB medium and cultured overnight at 30°C and 200 rpm in a shaking incubator as seed solution.
[0297] ③ Transfer 1 mL of seed solution to 4 mL of fresh LB medium containing ampicillin, spectinomycin and 1 mM IPTG, and culture at 30°C, 200 rpm for 1 h. Add L-arabinose to a final concentration of 200 mM and culture at 30°C, 220 rpm for 3 h.
[0298] ④ Take 1 μL of the above bacterial solution and dilute it 100-fold with sterile water. Then spread the solution onto a solid medium containing ampicillin, spectinomycin, and 200 mM L-arabinose. Place the plate in a 30°C incubator and invert it to incubate overnight.
[0299] ⑤ To verify the successful insertion of the 20-bp exogenous gene into the genome, ten single colonies were selected on LB plates containing Amp and Spec antibiotics and verified by colony PCR using primers 29' and 30'. The total PCR reaction volume was 20 μL, consisting of Novozymes Taq enzyme (Vazyme, P131-01), 20 μL ddH2O, 2 μL primer 29', 2 μL primer 30', and 1 μL diluted bacterial suspension. The PCR program was: 95°C for 3 min, 95°C for 15 s, 56°C for 15 s, and 72°C for 20 s, for 30 cycles.
[0300] ⑥ The DNA fragment obtained in step ⑤ was run on agarose gel for verification. The results are shown in Figure 12. The target band size is 619 bp. The control is the wild-type MG1655 genome. Due to the lack of the 20 bp insertion, no band could be amplified. After statistics, all four sgRNA backbone mutants have gene editing activity. Among them, after using the sgRNAM2-1 mutant, 9 out of 10 colonies could successfully amplify the target band, so the editing efficiency of the sgRNAM2-1 mutant was 90%; after using the sgRNAM2-2 mutant, 9 out of 10 colonies could successfully amplify the target band, so the editing efficiency of sgRNAM2-2 was 90%; after using the sgRNAM2-3 mutant, 10 out of 10 colonies could successfully amplify the target band, so the editing efficiency of sgRNAM2-3 was 100%; after using the sgRNAM2-4 mutant, 7 out of 10 colonies could successfully amplify the target band, so the editing efficiency of sgRNAM2-4 was 90%. In summary, the method of the present invention can effectively screen active sgRNA mutants (Figure 12).
[0301] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art may make various changes, modifications, substitutions and variations in form and details to these embodiments without departing from the spirit and principles of the present invention. The scope of the present invention is defined by the claims and their equivalents.
Claims
1. A screening system for sgRNA backbone active mutants, characterized in that: The system comprises a Cas protein expression vector and an sgRNA backbone mutant screening vector; The Cas protein expression vector comprises the following expression elements: a Cas protein encoding gene, a plasmid replicon, and a first resistance screening tag expression cassette; the sgRNA backbone mutant screening vector comprises the following expression elements: a plasmid replicon, a second resistance screening tag expression cassette, a third screening tag expression cassette, a promoter and a terminator for expressing the sgRNA backbone sequence; The first resistance screening tag expression cassette comprises a first resistance screening tag, which is a resistance gene, including but not limited to ampicillin, spectinomycin, chloramphenicol, kanamycin, or tetracycline resistance genes; The second resistance screening tag expression cassette comprises a second resistance screening tag, and the second resistance screening tag is any resistance gene different from the first resistance gene in the Cas protein expression vector; The third screening tag expression cassette comprises a third screening marker gene, and the third screening marker gene is selected from a resistance gene or a non-resistance gene; the resistance gene can be any resistance gene different from the first resistance screening tag and the second resistance screening tag, including but not limited to resistance genes such as ampicillin, spectinomycin, chloramphenicol, kanamycin, and tetracycline; the non-resistance gene includes but is not limited to a fluorescent signal marker and a color signal marker; An insertion sequence is added to the third screening marker gene to inactivate it, wherein the insertion sequence comprises a recognizable 23bp exogenous sequence and a homologous sequence upstream of the third screening tag insertion site; the insertion site refers to the insertion site of the 23bp exogenous sequence on the third screening marker gene, which is any site that can inactivate the third screening marker gene after insertion; the 23bp exogenous sequence comprises a 20bp recognition sequence and a 3bp PAM, wherein the recognition sequence is any exogenous sequence that is efficiently recognized by CRISPR / Cas9; and the PAM is a protospacer adjacent motif.
2. The sgRNA backbone active mutant screening system according to claim 1, characterized in that: In the Cas protein expression vector, the Cas protein encoding gene is the encoding gene of the wild-type Cas9, i.e., spCas9, or the encoding gene of a spCas9 variant, including the encoding gene of spG, spRY, or superFI-Cas9; On the Cas protein expression vector, the plasmid replicon is used to regulate the replication of the Cas protein expression vector in the cell, and any replicon having the above function can be used, including but not limited to pBR322, pUC, p15A, ColEI, pMB1, and pSC101 replicons; On the sgRNA backbone mutant screening vector, the replicon is used to regulate the replication of the sgRNA backbone mutant screening vector in cells, and any replicon having the above function can be used, including but not limited to pBR322, pUC, p15A, ColEI, pMB1, and pSC101 replicons; the replicon is compatible with the replicon in the Cas protein expression vector; The fluorescent signal marker includes but is not limited to: a green fluorescent signal marker, a red fluorescent signal marker, a blue fluorescent signal marker, a yellow fluorescent signal marker, and a cyan fluorescent signal marker; The color signal markers include but are not limited to: meffRed, eforRed, asPink, spisPink, scOrange, fwYellow, amilGFP, amajLime, cjBlue, meffBlue, aeBlue, amilCP, tsPurple, and gfasPurple.
3. The sgRNA backbone active mutant screening system according to claim 2, characterized in that: A Cas protein expression vector pvCas-pre containing the p15A replicon, the spCas9 encoding gene shown in SEQ ID NO.1, and the chloramphenicol resistance encoding gene was constructed, and the nucleotide sequence is shown in SEQ ID NO.
3.
4. A method for constructing an sgRNA backbone mutation library, characterized in that: Using the sgRNA backbone mutant screening vector according to claim 1 as a template, a 61nt sgRNA backbone mutant sequence and an N20 sequence are introduced into the template by designing mutation primers to construct a mutation library; the sgRNA backbone mutant sequence is a sequence in which a mutation occurs at any site on the DNA sequence of the 61nt wild-type sgRNA backbone sequence shown in SEQ ID NO. 8; the N20 sequence is consistent with the 20bp recognition sequence inserted in the third screening marker gene.
5. The method for constructing an sgRNA backbone mutation library according to claim 4, wherein: The mutation primer contains a 61nt sgRNA backbone mutant sequence and an N20 sequence that has been introduced into the mutation site; The mutation primer also contains a homologous sequence to the sgRNA backbone mutant screening vector.
6. The method for constructing an sgRNA backbone mutation library according to claim 5, wherein: The 61nt sgRNA backbone was divided into 6 regions, and at least one of the 6 regions was mutated to construct a mutation library; wherein, Region 1 is the 1-6nt and 25-30nt parts of the sgRNA backbone; Region 2 is the 9-12nt and 17-20nt parts of the sgRNA scaffold; Region 3 is the 7-8nt, 13-14nt, and 21-24nt parts of the sgRNA scaffold; Region 4 is the 42-48nt and 53-56nt parts of the sgRNA scaffold; Region 5 is the 32-41 nt portion of the sgRNA scaffold; Region 6 is the 49-52nt and 57-60nt parts of the sgRNA scaffold.
7. The method for constructing an sgRNA backbone mutation library according to claim 5, wherein: The 61nt sgRNA backbone was divided into four regions, and at least one of the four regions was mutated to construct a mutation library; wherein, Region 1 is the 1-6nt, 9-12nt, 17-20n and 25-30nt parts of the sgRNA backbone; Region 2 is the 7-8nt, 13-16nt, and 21-24nt parts of the sgRNA backbone; Region 3 is the 33-41nt and 49-60nt parts of the sgRNA backbone; Region 4 is the 31-32nt, 42-48nt and 61nt parts of the sgRNA backbone.
8. The method for constructing an sgRNA backbone mutation library according to claim 6 or 7, wherein: Combining mutants obtained by mutation of the above six regions separately to obtain a mutant library in which two, three, four, five or six regions are mutated simultaneously; or The mutants obtained by mutating the above four regions separately are combined to obtain a mutant library in which two, three or four regions are mutated simultaneously.
9. An sgRNA backbone mutation library constructed by the method of any one of claims 4 to 8.
10. A method for screening sgRNA backbone active mutants, characterized in that: The method comprises the following steps: transforming the Cas protein expression vector according to claim 1 and the sgRNA backbone mutation library according to claim 9 into Escherichia coli respectively; when the third screening marker is a resistance gene, culturing is performed on a screening medium containing the third resistance screening marker, and the sgRNA backbone mutant sequence contained in the normally growing strain is an active sgRNA backbone mutant; when the third screening marker is a non-resistance gene, resuscitating the cells screened by the third screening marker signal characteristic, and culturing the sorted cells on a medium containing a second resistance screening marker; the sgRNA backbone mutant sequence contained in the strain that grows normally and has the corresponding third screening marker signal characteristic is an active sgRNA backbone mutant.
11. The method for screening sgRNA backbone active mutants according to claim 10, wherein: The Cas protein expression vector of claim 1 and the sgRNA backbone mutation library of claim 9 are respectively transformed into Escherichia coli, and cells with fluorescent signals are sorted by FACS or microdroplet sorter. After recovery, the sorted cells are cultured in a medium containing a second resistance selection label. The sgRNA backbone mutant sequence contained in the strain that grows normally and can produce relative fluorescence is the active sgRNA backbone mutant; or, The Cas protein expression vector described in claim 1 and the sgRNA backbone mutation library described in claim 9 are respectively transformed into Escherichia coli. After color comparison under visible light, cells with color signals are sorted out. After recovery, the sorted cells are cultured on a culture medium containing a second resistance screening label. The sgRNA backbone mutant sequence contained in the colonies that grow normally and have the corresponding color is the active sgRNA backbone mutant.
12. sgRNA backbone mutants screened by the method of claim 10.
13. The sgRNA backbone mutant according to claim 12, wherein The DNA sequences of the sgRNA backbone mutants include, but are not limited to, the following sequences: sgRNAL1M1: TAAGCAGAGCTAGAAATAGCAAGTACCTGCAAGGCTAGTCCGTTATC AACTTGAAAAAGTG; sgRNAL1M2: AAAGTGGAGCTAGAAATAGCAAGTAACTGGAAGGCTAGTCCGTTAT CAACTTGAAAAAGTG; sgRNAL1M3: CCAACGAGGCTAGAAATAGCAAGTCTATATAAGGCTAGTCCGTTATC AACTTGAAAAAGTG; sgRNAL1M4: AGAGGAGAGCTAGAAATAGCAAGTTATCACAAGGCTAGTCCGTTAT CAAGTTGAAAAAGTG; sgRNAL2M1: GTTTTAGAGATAGAAAGACTAAGTTAAAATAAGGCTAGTCCGTTATC AACTTGAAAAAGTG; sgRNAL2M2: GTTTTAGAAATTGAAATACCAAGTTAAAATAAGGCTAGTCCGTTATC AACTTGAAAAAGTG; sgRNAL2M3: GTTTTAGAAAAAGAAAAAAGAAGTTAAAATAAGGCTAGTCCGTTAT CAACTTGAAAAAGTG; sgRNAL3M1: GTTTTAGGGCTAGCGCTAGCTTACTAAAATAAGGCTAGTCCGTTATCA ACTTGAAAAAGTG; sgRNAL3M2: GTTTTACAGCTAAACATAGCCATCTAAAATAAGGCTAGTCCGTTATCA ACTTGAAAAAGTG; sgRNAL3M3: GTTTTAATGCTAACTTTAGCGTTTTAAAATAAGGCTAGTCCGTTATCA ACTTGAAAAAGTG; sgRNAL3M4: GTTTTATTGCTAATATTAGCAACATAAAATAAGGCTAGTCCGTTATCA ACTTGAAAAAGTG; sgRNAL3M5: GTTTTACCGCTACTCCTAGCGTCGTAAAATAAGGCTAGTCCGTTATCA ACTTGAAAAAGTG; sgRNAL3M6: GTTTTACGGCTATTCCTAGCGGAATAAAATAAGGCTAGTCCGTTATCA ACTTGAAAAAGTG;sgRNAL3M7:GTTTTATAGCTAAATATAGCAGTCTAAAATAAGGCTAGTCCGTTATCA ACTTGAAAAAGTG; sgRNAL3M8:GTTTTAAGGCTACAATTAGCTCCTTAAAATAAGGCTAGTCCGTTATCA ACTTGAAAAAGTG; sgRNAL3M9:GTTTTAAAGCTAAGCCTAGCTTCATAAAATAAGGCTAGTCCCGTTATCA ACTTGAAAAAGTG; sgRNAL3M10:GTTTTAACGCTATCACTAGCTCCGTAAAATAAGGCTAGTCCGTTATC AACTTGAAAAAGTG; sgRNAL4M1:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCCCCTCA GACTTTTATAAGTG; sgRNAL4M2:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTAATG CACTTCCAGAAGTG; sgRNAL4M3:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGCAGTT TACTTACGCAAGTG; sgRNAL4M4:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCTAATTC GACTTCGTCAAGTG; sgRNAL4M5:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCAGATTA CACTTTGTTAAGTG; sgRNAL4M6:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTAGCA CACTTATACAAGTG; sgRNAL4M7:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCTGTGTT GACTTACTGAAGTG; sgRNAL4M8:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGAATGT GACTTAACAAAGTG; sgRNAL4M9:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGGTGCT AACTTGCATAAGTG;sgRNAL4M10:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCTCGAG GCACTTGAACAAGTG; sgRNAL5M1:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAACTCTACGGCGTTATC AACTTGAAAAAGTG; sgRNAL5M2:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAATAGTCTAGGTTATC AACTTGAAAAAGTG; sgRNAL5M3:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAATTTTTAAACGTTATCA ACTTGAAAAAGTG; sgRNAL5M4:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAACCGATCCGGGTTATC AACTTGAAAAAGTG; sgRNAL6M1:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATC ACTGTGAAACTGAG; sgRNAL6M2:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATC ATATAGAAAAGCGG; sgRNAL6M3:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATC AGAGGGAAAAATAG; sgRNAL6M4:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATC AACCAGAAAATCAG; sgRNAL6M5:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATC AGGTTGAAAGTCGG; sgRNAL6M6:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATC ATGTAGAAAGGCAG; sgRNAL6M7:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATC AATAGAAAGCAGG; sgRNAL6M8:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATC ATCCTGAAAGCGCG;SgRNAsyn1:TAAGCACCGATACTCCGACTGTCGACCTGCAAATAGTCTAGCCCTCA GTCCTTTATGGCCG;SgRNAsyn2:AAAGTGCGAATTTTCCTACCGGAAACTGGAATTTAAACCAAACT CGAGGTCGCAATAG; SgRNAsyn3:CCAACGCCAAAACTCCAAAGGTCGCTATAACTCTACGGCAGACGT ATCCTTCAGGCGCG; SgRNAsyn8:TAAGCACCAATTCTCCTACCGTCGACCTGCAATAGTCTAGGGTTTGT TATACACTAGCGG; SgRNAsyn13:AAAGTGATAATTTCAATCAATCAATCAACTGGAACCGATCCGGTAATTC GAATACGTCGCAGG; SgRNAsyn17:CCAACGCGGATATTCCGACTGGAACTATAACCGATCCGGTAATTC GGAGGCGTCAATAG;SgRNAsyn18:CCAACGAGAATTCAATTACCTCCTATAACTCTACGGGATTAC ACCATGTTATCAG: SgRNAsyn20:AGAGGACAGATAATAGGACTAAAGTATCACAATTTTTAAACTGTGTT GTGTAACTGGGCAG; SgRNAsyn23:AGAGGAAGGATACAATGACTTCCTTATCACAAATAGTCTAGTCGAGG CATAGAACGCAGG:sgRNAM2-1:GTTTTAAAGCTACAACTAGCGATGTAAAATAAGGCTAGTCCGTTATCA ACTTGAAAAAGTG sgRNAM2-2:GTTTTAGAGCTAGAGGTAGCGTTGTAAAATAAGGCTAGTCCGTTATCA ACTTGAAAAAGTG; sgRNAM2-3:GTTTTACAGCTAATAGTAGCAAAGTAAAATAAGGCTAGTCCGTTATCA ACTTGAAAAAGTG; sgRNAM2-4:GTTTTATAGCTACGAATAGCTATATAAAATAAGGCTAGTCCGTTATCAA CTTGAAAAAGTG; sgRNAM2-5:GTTTTAGGGCTACTACTAGCTTCCTAAAATAAGGCTAGTCCGTTATCA ACTTGAAAAAGTG; sgRNAM2-6:GTTTTACGGCTAGCGTAGCCAAGTAAAATAAGGCTAGTCCGTTATCA ACTTGAAAAAGTG; sgRNAM2-7:GTTTTATCGCTATGAATAGCTGGTTAAAATAAGGCTAGTCCGTTATCA ACTTGAAAAAGTG; sgRNAM2-8:GTTTTAATGCTATCAATAGCAATCTAAAATAAGGCTAGTCCGTTATCA ACTTGAAAAAGTG; sgRNAM4-1:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCTCTCGG AACTTCACTAAGTG; sgRNAM4-2:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGCTATTA ACTTTTTGAAGTG; sgRNAM4-3:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGGTTTG TACTTCACTAAGTG; sgRNAM4-4:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGATTAG AACTTATGGAAGTG; sgRNAM4-5:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCAGACGT AACTTTCAGAAGTG;sgRNAM4-6:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCTTCT ACTTTAATAAGTG; sgRNAM4-7:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCCAAACT CACTTTCGCAAGTG; sgRNAM4-8:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCTAGATG CACTTCTTGAAGTG。; 14. Use of the sgRNA backbone mutant according to claim 13.
15. The use according to claim 14, characterized in that It is used in the CRISPR / Cas9 gene editing system.
16. The use according to claim 15, characterized in that Applications in base editing, single gene target editing, and multi-gene target editing include but are not limited to lead editing, base knockout, base substitution, base insertion, single gene knockout / insertion, multi-gene knockout / insertion, single gene expression gradient regulation, and multi-gene transcriptional regulation.
Citation Information
Patent Citations
Double-plasmid system and application thereof
CN110423771A
CRISPR-Cas9 gene editing vector for bacteria and application of CRISPR-Cas9 gene editing vector
CN114107302A
Cas protein, use thereof and method therefor
WO2023165598A1