Heterologous promoter for high-level protein expression in corynebacterium glutamicum and use thereof

Abstract

The present invention relates to a novel promoter derived from Corynebacterium and to a use of a variant thereof in the production of a protein or a rare sugar. In the present invention, a sod gene promoter derived from Corynebacterium ammoniagenes, which enables regulation of gene expression and exhibits significantly stronger activity compared to conventionally used promoters, was developed, promoter variants having various strengths were identified from the developed promoter, and by using the identified improved promoters, two enzymes capable of converting a common sugar into a rare sugar were highly expressed in a single vector system, thereby enabling production of a rare sugar via a one-pot reaction. Accordingly, the promoters can be utilized for the production of a target protein or a rare sugar.

Description

Heterologous promoter for high protein expression of Corynebacterium glutamicum and its use

[0001] The present invention relates to a novel promoter derived from Corynebacterium and its variants for use in producing proteins or rare sugars.

[0002] With the advancement of molecular biology, various mechanisms regulating gene expression have been discovered. Gene expression refers to the series of processes that occur within a cell, synthesizing proteins according to the code encoded in the gene through transcription and translation. Transcription, in particular, is the initial step of gene expression. It is initiated by RNA polymerase, with the assistance of various auxiliary factors, binding to the promoter sequence located upstream of the gene. Transcription factors (TFs) are known to bind directly to the promoter sequence, one of these auxiliary factors. In prokaryotes, gene expression regulation primarily occurs at the transcription stage, and researchers are continually discovering new transcription factors and promoters.

[0003] Meanwhile, as global consumer awareness of sugar reduction increases, the most important functional appeals of alternative sweeteners are focusing on 'naturalness' and 'calories'. Currently, erythritol, allulose, and allose have been industrialized as saccharide sweeteners (reduced sweeteners) with zero-calorie appeal. Erythritol is a sugar alcohol, while allulose and allose are sugars, making them saccharide sweeteners with zero-calorie appeal. Allulose (D-psicose) is a C-3 epimer of D-fructose, a monosaccharide that exists in very small quantities in nature. It is derived from the sugar portion of the glycoside psicofuranine, and small amounts are also found in coffee, table sauces, and figs. In particular, it has excellent sweetness and 70% of the sweetness of sugar, but it provides only 0.3% of the energy of sugar, which is one of its very important advantages. In addition, unlike sugar alcohols such as xylitol, mannitol, maltitol, and sorbitol, it does not cause side effects such as diarrhea due to excessive consumption (Food Sci Technol Res 12:137-143, 2006). Recently, interest in it is increasing because the technology related to mass production has not been developed compared to reports on the functionality of using it. In addition, D-allose, which is a 3-carbon epimer of glucose (D-glucose) and an isomer of psicose, is known as a rare monosaccharide. It is one of the rare natural carbohydrates that exists in very small quantities in nature, and it is a carbohydrate that has sweetness but very low calories compared to sugar, so it is expected to receive a lot of attention as an alternative sweetener in the future.

[0004] The production of rare sugars, including allulose, has been primarily based on chemical techniques. Bilik et al. (Chem Zvesti 28:106-109, 1973) produced allulose from fructose through the catalytic action of molybdate ions, McDonald (Carbohydr Res 5:106-108, 1967) produced allulose by converting 1,2:4,5-di-o-isopropylidene-beta-D-fructopyranose using a chemical technique, and Doner (Carbohydr Res 70:209-216, 1979) attempted to produce allulose by boiling fructose with ethanol and triethylamine. However, these chemical techniques incur high production and purification costs, and there have been issues with product safety. Therefore, biological methods, particularly production technologies utilizing enzyme catalysis, have been continuously studied. Ishida et al. (J Ferment Bioeng 83:529-534, 1997) confirmed the production of allulose using tagatose epimerase from Pseudomonas cichorii ST-24. Zhang et al. (Biotechnol Lett 31:857-862, 2009) reported the production of allulose using D-tagatose-3-epimerase from Rhodobacter sphaeroides, and Mu et al. (J Agric Food Chem 59:7785-7792, 2011) reported the characteristics of D-psicose-3-epimerase from Clostridium cellulolyticum strain H10 related to allulose production. However, these biological technologies have had problems with commercialization because they produce allulose using strains that do not have edible origins, raising concerns about safety in the body and resulting consumer resistance.

[0005] An object of the present invention is to provide a novel promoter or a variant thereof.

[0006] In addition, it is an object of the present invention to provide an expression cassette for producing a target protein.

[0007] In addition, it is an object of the present invention to provide a recombinant vector.

[0008] In addition, it is an object of the present invention to provide a transformant.

[0009] In addition, it is an object of the present invention to provide a composition for producing rare sugars.

[0010] In addition, it is an object of the present invention to provide a method for producing a target protein.

[0011] In addition, an object of the present invention is to provide a method for producing rare sugars.

[0012] To solve the above problem, the present invention provides a sod expression promoter derived from the genus Corynebacterium or a variant thereof.

[0013] In addition, the present invention provides an expression cassette for producing a target protein, comprising the promoter or a variant thereof and a polynucleotide encoding the target protein.

[0014] In addition, the present invention provides a recombinant vector comprising the above expression cassette.

[0015] In addition, the present invention provides a transformant transformed with the recombinant vector.

[0016] In addition, the present invention provides a composition for producing a rare sugar comprising the transformant, a lysate thereof, or a culture thereof.

[0017] Additionally, the present invention provides a method for producing an enemy protein.

[0018] In addition, the present invention provides a method for producing rare sugars.

[0019] In the present invention, a promoter capable of regulating gene expression and exhibiting stronger activity was developed, and promoter variants having various intensities were discovered from this, and by using the discovered improved promoter, two enzymes capable of converting common sugars into rare sugars were highly expressed in a single vector system, thereby producing rare sugars through a one-pot reaction, and thus, this can be utilized for the production of target proteins or for the production of rare sugars.

[0020] Figure 1 is a diagram showing the construction process of a food-grade vector (pBFE22) system.

[0021] Figure 2 is a schematic diagram of a plasmid containing a sod gene promoter derived from various Corynebacteria species (Figure 2a) and a diagram showing the intensity of fluorescent protein expression thereof (Figure 2b).

[0022] Figure 3 is a diagram showing the deletion location (Figure 3a) of a region predicted to be the sod gene promoter of Corynebacterium ammoniagenes and the change in its fluorescence intensity (Figure 3b).

[0023] Figure 4 is a schematic diagram of a plasmid for constructing a promoter library (Figure 4a), the results of FACS screening of the promoter library (Figure 4b), the fluorescence intensity of the conventionally used promoter sod(G) and the sod gene promoter sod(A) of Corynebacterium ammoniagenes (Figure 4c), and the fluorescence intensity of the sod gene promoter sod(A) of Corynebacterium ammoniagenes and the secondarily sorted cells (Figure 4d).

[0024] Figure 5 is a schematic diagram showing the process of constructing a promoter library and sorting using FACS.

[0025] Figure 6 is a diagram showing the relative fluorescence intensity of 80 colonies selected using a promoter library.

[0026] Figure 7 is a diagram showing the sequence analysis results of the selected promoters:

[0027] Box marks: -10 and -35 regions of the promoter.

[0028] Figure 8 is a diagram showing the results of comparing the fluorescent protein expression levels of the selected promoters (Figure 8a) and the fluorescence intensity of the H93 promoter with conventional MFDS-approved promoters (Figure 8b).

[0029] Figure 9 shows the results of Coomassie blue staining after SDS-PAGE gel of purified recombinant Clostridium stercorarium DSM 8532 LRI (L-rhamnose isomerase) and recombinant Geobacillus sp. LRI (Figure 9a), the results of DSC analysis of Clostridium stercorarium DSM 8532 LRI (Figure 9b), and the results of DSC analysis of Geoobacillus sp. LRI (Figure 9c):

[0030] 1:Clostridium stercorariumDSM 8532 LRI; and

[0031] 2:Geobacillussp. LRI.

[0032] Figure 10 is a diagram analyzing the GS-LRI production activity of the sod gene promoter sod(A) and H93 promoter of Corynebacterium ammoniagenes (Figure 10a), and the optimal pH, temperature, and metal concentration conditions for its production (Figures 10b to 10d).

[0033] Figure 11 is a diagram showing the optimal temperature conditions for D-allose production in fixed recombinant Corynebacterium glutamicum cells transformed with a vector (pBFE22-PH93-GS-LRI) containing the H93 promoter:

[0034] Figure 11a: Expression analysis of GS-LRI of recombinant Corynebacterium glutamicum:

[0035] Line graph: Cell growth graph;

[0036] Bar graph: D-alose conversion rate;

[0037] Figure 11b: Results of a total of five re-uses of the immobilized recombinant Corynebacterium glutamicum under different temperature conditions at 12-hour intervals:

[0038] ■: 50℃;

[0039] ●: 55℃;

[0040] ▲: 60 ℃; and

[0041] ▼: 65℃.

[0042] Figure 12 is a diagram showing the production ratios of D-allulose and D-allose (Figure 12a) produced using three sets of purified DAE (D-allulose-3-epimerase) and LRI (L-rhamnose isomerase) with different mixed concentration ratios (Figure 12b).

[0043] Figure 13 shows the single vector system of AT-DAE and GS-LRI using promoters with three expression intensities (Figure 13a), conversion yields of D-allulose (gray bars) and D-allose (black bars) (Figure 13b), and SDS-PAGE and Coomassie blue staining results of co-expressed GS-LRI and AT-DAE (Figure 13c) (lane 1: wild-type control, lane 2: set C expression system, lane 3: set B expression system, and lane 4: set C expression system).

[0044] Hereinafter, the present invention will be described in detail with reference to the attached drawings and embodiments thereof. However, the following embodiments are provided as examples of the present invention. If a detailed description of a technology or configuration well known to those skilled in the art is judged to unnecessarily obscure the gist of the present invention, such detailed description may be omitted, and the present invention is not limited thereby. The present invention is capable of various modifications and applications within the scope of the following claims and equivalents interpreted therefrom.

[0045] Additionally, the terminology used in this specification is intended to appropriately express preferred embodiments of the present invention, and may vary depending on the intent of the user or operator, or the customs of the field to which the present invention pertains. Therefore, the definitions of these terms should be determined based on the contents throughout this specification. Throughout this specification, when a part is said to "include" a certain component, unless specifically stated otherwise, this does not mean that other components are excluded, but rather that other components may be included.

[0046] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice of testing the present invention, the preferred materials and methods are described herein. Furthermore, the contents of all publications cited herein by reference are incorporated herein by reference.

[0047] Throughout this specification, the conventional one-letter and three-letter codes for naturally occurring amino acids are used, as well as generally accepted three-letter codes for other amino acids, such as Aib (α-aminoisobutyric acid) and Sar (N-methylglycine). Furthermore, amino acids referred to herein by abbreviations are described according to the IUPAC-IUB nomenclature as follows:

[0048] Alanine: A, arginine: R, asparagine: N, aspartic acid: D, cysteine: C, glutamic acid: E, glutamine: Q, glycine: G, histidine: H, isoleucine: I, leucine: L, lysine: K, methionine: M, phenylalanine: F, proline: P, serine: S, threonine: T, tryptophan: W, tyrosine: Y, and valine: V.

[0049]

[0050] In one aspect, the present invention relates to a sod expression promoter derived from the genus Corynebacterium or a variant thereof.

[0051] In one embodiment, the genus Corynebacterium can be Corynebacterium ammoniagenes, Corynebacterium casei, Corynebacterium efficiens or Corynebacterium stationis, more preferably Corynebacterium ammoniagenes.

[0052] In one embodiment, the sod expression promoter may comprise the base sequence of SEQ ID NO: 1.

[0053] In one embodiment, the promoter may be a constitutive promoter.

[0054] In one embodiment, a mutant of a promoter can improve the function of the promoter to suit the purpose by having a promoter activity that is increased compared to the wild-type promoter before the mutation. The mutation can be made by various methods, and examples thereof include site-directed mutagenesis, error-prone PCR, and DNA shuffling.

[0055] In one embodiment, the variant of the promoter may comprise any one selected from the group consisting of base sequences of SEQ ID NOs: 2 to 10.

[0056] In one embodiment, the variant of the promoter of the present invention may be H93 comprising the base sequence of SEQ ID NO: 2.

[0057] In one embodiment, the variant of the promoter of the present invention may be L24 comprising the base sequence of SEQ ID NO: 3.

[0058] In one embodiment, the variant of the promoter of the present invention may be L3 comprising the base sequence of SEQ ID NO: 4.

[0059] In one embodiment, the variant of the promoter of the present invention may be L9 comprising the base sequence of SEQ ID NO: 5.

[0060] In one embodiment, the variant of the promoter of the present invention may be I6 comprising the base sequence of SEQ ID NO: 6.

[0061] In one embodiment, the variant of the promoter of the present invention may be I18 comprising the base sequence of SEQ ID NO: 7.

[0062] In one embodiment, the variant of the promoter of the present invention may be I92 comprising the base sequence of SEQ ID NO: 8.

[0063] In one embodiment, the variant of the promoter of the present invention may be H6 comprising the base sequence of SEQ ID NO: 9.

[0064] In one embodiment, the variant of the promoter of the present invention may be H92 comprising the base sequence of SEQ ID NO: 10.

[0065] The homology range of the promoter variant according to one embodiment of the present invention includes a sequence having substantial identity to the base sequence of SEQ ID NO: 1. The substantial identity means that the base sequence of SEQ ID NO: 1 and any other sequence are aligned to the greatest extent possible, the sequences are analyzed, and the any other sequence has a sequence homology of 70% or more, 90% or more, or 98% or more to the base sequence of SEQ ID NO: 1. Those skilled in the art will readily understand that a polynucleotide having the same or similar activity can be produced within the range of substantial homology by substituting, adding, or deleting one or more bases in the base sequence of the novel promoter variant using a genetic recombination technique known in the art. This comparison of homology can be performed by calculating the homology between two or more sequences as a percentage (%) using a commercially available computer program. Accordingly, the homology range of the promoter variant according to one embodiment of the present invention may include a base sequence having 70% or more, 80% or more, 90% or more, 95% or more, or 99% or more homology with the base sequence of SEQ ID NO: 1 within a range in which the function of constantly high-expressing the target protein is maintained.

[0066] The term "transcriptional regulatory sequence" as used in the present invention refers to a nucleic acid sequence of a transcriptional regulatory region capable of controlling the initiation of transcription from the promoter of the sod gene derived from Corynebacterium ammoniagenes. In bacteria, such sequences are generally located upstream from the promoter, but may not always be located there. Therefore, the transcriptional regulatory sequence used in the present invention is preferably a transcriptional regulatory sequence located upstream from the promoter of a specific gene, but is not limited thereto.

[0067] The term "promoter" as used herein refers to the minimum nucleic acid sequence necessary for the specific initiation of transcription. In addition, the promoter may include promoter structures sufficient to cause the expression of a regulatable promoter-dependent gene induced by cell type-specific or external signals or agents, and such structures may be located at the 5' or 3' portion of the gene. The promoter includes both conserved promoters and inducible promoters. A promoter in prokaryotes is usually defined as a binding site immediately adjacent to the transcription start site where RNA polymerase binds, and generally in prokaryotes, promoters have a consensus sequence at the -35 and -10 positions.

[0068] The term "variant" of a promoter as used in the present invention is defined as a promoter having a target protein expression activity that is different from or improved from the basic promoter by deleting, adding or substituting some nucleotides in the nucleic acid sequence of the basic promoter, and includes one or more amino acid differences (substitutions, insertions or deletions) compared to the reference sequence.

[0069] In one aspect, the present invention relates to an expression cassette for producing a target protein, comprising a promoter of the present invention or a variant thereof, and a polynucleotide encoding the target protein.

[0070] In one embodiment, the promoter or variant thereof can be operably linked to a sequence encoding a protein of interest.

[0071] In one embodiment, the polynucleotide encoding the target protein may comprise the base sequence of SEQ ID NO: 11 or 12.

[0072] In one embodiment, the target protein may be an enzyme, and may be a sugar isomerase, D-allulose 3-epimerase, D-tagatose 3-epimerase, (1→4)-alpha-D-glucan 1-alpha-D-glucosylmutase, 4-alpha-D-{(1→4)-alpha-D-glucano}trehalose trehalohydrolase, L-ribulose 3-epimerase, It can be selected from L-arabinose isomerase, L-fucose isomerase, mannose 6-phosphate isomerase, glucose 6-phosphate isomerase, L-rhamnose isomerase, D-ribose-5-phosphate isomerase (RPI), fructose-6-phosphate-3-epimerase, D-galactose-6-phosphate isomerase (GPI), etc., and L-rhamnose isomerase, D-allulose-3-epimerase, or L-rhamnose isomerase and D-allulose-3-epimerase are more preferred.

[0073] In one embodiment, the enzyme may be an enzyme derived from Agrobacterium tumefaciens, Pseudomonas stutzeri, Bacillus pallidus Y25, Thermoanaerobacterium, saccharolyticum, Caldicellulosiruptor, saccharolyticus, Bacillus subtilis WB600, Clostridium stercorarium or Geobacillus sp. BPUD.

[0074] The term "target protein" used in the present invention means a foreign protein that cannot normally exist in a transformed strain (or host cell) expressing the protein.

[0075] The term "polynucleotide" as used herein refers to any polyribonucleotide (RNA) or polydeoxyribonucleotide (DNA), whether unmodified or modified. The polynucleotide includes, but is not limited to, single- or double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, RNA that is a mixture of single- and double-stranded regions, or hybrid molecules thereof.

[0076] The term "operably linked" as used herein is defined as a state in which a promoter sequence and a nucleotide sequence encoding a target protein are functionally linked so that the promoter can control the expression of the target protein. For example, if a promoter can control the expression of a coding sequence (i.e., if the coding sequence is under the transcriptional control of the promoter), the promoter is operably linked to the coding sequence, or if a ribosome binding site is positioned so as to promote translation, the ribosome binding site is operably linked to the coding sequence. The coding sequence can be operably linked to a regulatory sequence in either the sense or antisense direction.

[0077] The term "expression cassette" as used herein refers to a unit cassette that includes a promoter and a target protein and can express the target protein for production. The expression cassette may contain various factors that can facilitate efficient production of the target protein. More specifically, the expression cassette may include a promoter, a polynucleotide encoding the target protein, and a poly A sequence.

[0078] In one aspect, the present invention relates to a recombinant vector comprising the promoter of the present invention or a variant thereof.

[0079] In one embodiment, the recombinant vector may comprise an expression cassette for producing the target protein of the present invention.

[0080] In one embodiment, the recombinant vector may comprise the base sequence of SEQ ID NO: 13.

[0081] In one embodiment, the recombinant vector may comprise a kanamycin resistance gene.

[0082] In one embodiment, the recombinant vector may be used for transformation of bacteria of the genus Corynebacterium.

[0083] In one embodiment, the recombinant vector may further comprise a promoter other than the promoter of the present invention or a variant thereof, and the further comprised promoter may be a low-expression promoter compared to the promoter of the present invention or a variant thereof.

[0084] In one embodiment, the recombinant vector may comprise a first expression cassette comprising a first promoter and D-allulose-3-epimerase operably linked thereto; and a second expression cassette comprising a second promoter and L-rhamnose isomerase operably linked thereto, wherein the first promoter and the second promoter may be a promoter of the present invention or a variant thereof.

[0085] In one embodiment, the recombinant vector may comprise a first expression cassette comprising a first promoter and D-allulose-3-epimerase operably linked thereto; and a second expression cassette comprising a second promoter and L-rhamnose isomerase operably linked thereto, wherein the first promoter may be a low-expression promoter compared to the second promoter.

[0086] In one embodiment, the recombinant vector may comprise a first expression cassette comprising a first promoter and D-allulose-3-epimerase operably linked thereto; and a second expression cassette comprising a second promoter and L-rhamnose isomerase operably linked thereto, wherein the first promoter and the second promoter may be the promoter of the present invention or a variant thereof, and the first promoter may be a low-expression promoter compared to the second promoter.

[0087] In one embodiment, the first expression cassette and the second expression cassette may be arranged in the same direction of transcription.

[0088] The term "recombinant vector" used in the present invention refers to a vector capable of expressing a target protein or target RNA in a suitable host cell, and refers to a genetic construct that includes essential regulatory elements operably linked to enable expression of the gene insert. The term "operably linked" as used herein refers to a functional linkage between a nucleic acid expression regulatory sequence and a nucleic acid sequence encoding a target protein or RNA so as to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein or RNA may be operably linked to affect the expression of the encoding nucleic acid sequence. The operably linked vector can be produced using genetic recombination techniques well known in the art, and site-specific DNA cleavage and ligation can be performed using enzymes generally known in the art.

[0089] In one aspect, the present invention relates to a transformant transformed with the recombinant vector of the present invention.

[0090] In one embodiment, the transformant may be a bacterium of the genus Corynebacterium, and may be Corynebacterium glutamicum.

[0091] In one embodiment, the transformant is capable of producing L-rhamnose isomerase, D-allulose-3-epimerase, or L-rhamnose isomerase and D-allulose-3-epimerase.

[0092] In one embodiment, the transformant is capable of converting a monosaccharide to D-Allulose, D-allose, or both D-allulose and D-allose.

[0093] In one embodiment, the monosaccharide may be a D-type or L-type monosaccharide, and may be fructose (Fructose, Fru), pseudose (Psi), tagatose (Tag), galactose (Gal), rhamose (Rha), mannose (Man), allose (All), gulose (Gul), glucose (Glc), altrose (Alt), talose (Tal), sorbose (Sor), or idose (Ido).

[0094] In one embodiment, the transformant can be fixed (immobilized) on a support, and the support can be a food grade hydrogel, and can be a bead-shaped hydrogel support containing the transformant, and the hydrogel can be Matrigel, Fibrin, Gelatin, Hyaluronic acid, Alginate, Agarose, Chitosan, Dextran, Methacrylated Gelatin (GelMA), Cellulose, Pectin, Chondroitin Sulfate, or Collagen.

[0095] The term "transformant" as used herein refers to a cell in which a vector has transformed a host cell, thereby exerting various genetic or molecular effects within the host cell. Furthermore, the term "transformation" refers to the introduction of DNA into a host cell, thereby rendering the DNA replicable as an extrachromosomal element or by insertion into the chromosome.

[0096] The term "recombinant strain" used in the present invention refers to a cell transformed by introducing a polynucleotide encoding one or more target proteins or an expression vector having the same into a host cell. Methods for producing a transformant by introducing the expression vector into a host cell include, but are not limited to, transient transfection, microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE dextran-mediated transfection, polybrene-mediated transfection, electroporation, electroinjection, chemical treatment methods such as PEG, methods using a gene gun, etc., and heat shock.

[0097] In one aspect, the present invention relates to a composition for producing a rare sugar comprising a transformant of the present invention, a lysate thereof, or a culture thereof.

[0098] In one embodiment, the rare sugar can be D-allulose or D-allose.

[0099] In one embodiment, the composition may further comprise a sugar.

[0100] The term "rare sugar" used in the present invention refers to a monosaccharide that exists only in very small amounts in nature, and according to the definition of the International Rare Sugar Society, a rare sugar is defined as a sugar that rarely exists in nature.

[0101] The term "D-Allulose" used in the present invention refers to a rare sugar found only in small amounts in natural plants such as grapes and figs, which is attracting attention as an alternative sweetener with a sweetness very similar to sugar but low in calories. Specifically, allulose is a monosaccharide containing six carbon atoms and is a ketose with a ketone group, and its chemical formula is C6H 12 It is O6 and is also called psicose. In the present invention, the allulose is produced through enzymatic conversion from a monosaccharide.

[0102] The term "D-allose" used in the present invention is a monosaccharide containing 6 carbon atoms, an aldose having an aldehyde group, and the chemical formula is C6H 12 O6. Allose is a rare monosaccharide produced from 6-O-cinnamyl glycoside in the leaves of the African shrub Protea rubropilosa. In the present invention, allose is produced through enzymatic conversion from allulose.

[0103] The term "enzyme" used in the present invention refers to a protein catalyst that promotes a reaction by lowering activation energy by binding to a specific reactant, and the "enzyme" is L-rhamnose isomerase or D-allulose-3-epimerase.

[0104] In one aspect, the present invention relates to a method for producing a target protein, comprising the step of culturing a transformant of the present invention.

[0105] In one embodiment, the transformant may be Corynebacterium glutamicum, and may be cultured under temperature conditions of 60 to 70°C, pH conditions of 6.5 to 7.5, and metal ion concentration conditions of 0.5 to 1.5 mM.

[0106] In one embodiment, the target protein may be present within the cells of the recombinant strain after expression or may be secreted outside the cells of the recombinant strain, depending on its type.

[0107] When the target protein is present within the cells of the recombinant strain, the transformant cells used for protein expression can be disrupted by various physical or chemical means, such as repeated freeze-thaw cycles, sonication, mechanical disruption, or cell lysing agents, and can be isolated or purified by conventional biochemical separation techniques (Sambrook et al., Molecular Cloning: A laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, 1989; Deuscher, M., Guide to Protein Purification Methods Enzymology, Vol. 182. Academic Press. Inc., San Diego, CA, 1990). For example, methods for isolating or purifying proteins expressed by host cells include, but are not limited to, electrophoresis, centrifugation, gel filtration, precipitation, dialysis, chromatography (ion exchange chromatography, affinity chromatography, immunosorbent affinity chromatography, reversed phase HPLC, gel permeation HPLC), isoelectric focusing, and various variations or combinations thereof.

[0108] In one embodiment, the target protein can be isolated from a culture medium or a cell lysate of a transformant cell by affinity chromatography using a peptide tag. Various known tags can be used as the peptide tag, such as an HA tag, a FLAG tag, a His tag, a BCCP (biotin carboxyl carrier protein), a c-myc tag, a V5 tag, glutathione-S-transferase (GST), or a MBP (maltose binding protein), and a His tag is preferred. The His-tagged protein can be specifically trapped on a column of a Ni-NTA (nickel-nitrilotriacetic acid) resin and eluted with EDTA or imidazole.

[0109] In one aspect, the present invention relates to a method for producing a rare sugar, comprising the steps of culturing a transformant of the present invention in a culture medium containing a monosaccharide; and recovering the rare sugar from the culture medium or culture supernatant.

[0110]

[0111] The present invention is described in more detail through the following examples. However, the following examples are intended only to concretize the content of the present invention and are not intended to limit the present invention.

[0112]

[0113] Example 1. Construction of a recombinant expression vector for recombinant protein production

[0114] 1-1. Construction of a food-grade vector system for Corynebacterium glutamicum

[0115] To establish a system capable of producing recombinant proteins without problems at the industrialization stage, the antibiotic marker was replaced from the existing chloramphenicol resistance marker to a kanamycin resistance marker by overlapping PCR using NPTII-F, NPTII-R, Vec-F and Vec-R primers (Table 1), and the ampicillin promoter, LacI, originally present in the vector PXMJ19 q promoter, tac promoter and LacI q Genes AmpPDel-F, AmpPDel-R, Lacl q PDel-F, Lacl qSite-directed mutagenesis was performed using primers PDel-R, TacPDel-F, TacPDel-R, LacDEL-F, and LacDEL-R to remove these deletions, and the final constructed vector was named pBFE22 (Fig. 1). Subsequently, ORF (Open Reading Frame) analysis using the ORF Finder tool provided by NCBI (https: / www.ncbi.nlm.nih.gov / orffinder / ) revealed that only the target gene coding sequence and the kanamycin resistance gene coding sequence were present in the exogenous transcription termination gene region (Table 2), confirming that this was a food-grade vector system.

[0116] sod(A) -ATDAE_FGAAAGGAATGACTCGATGAAACACGGCATCTATTATTCTpBFE22-P sod(A) -ATDAE_RATGGTGATGGTGATGGCCACCAAGAACGAAGCGpBFE22-P sod(A) -GSLRI_FaatgactcgatggtccgtpBFE22-P sod(A) -GSLRI_RtcaGTGATGGTGATGGTGpBFE22-P sod(A) -ATDAE-GSLRI_FGATTCGATGGTGTCAAATGAGCGAGCGCTGGCCpBFE22-P sod(A) -ATDAE-GSLRI_RCTCGCTCATTCGAAGTCAGTGATGGTGATGGTGATGGpBFE22- P H93 -GSLRI_V_FCGATGGTCCGTGACCAATTTGATGAAGCAApBFE22- P H93 -GSLRI_V_RCGAAGGCGAAGCGGCATTTACGTTGACpBFE22-P H93 -GSLRI_FGCCGCTTCGCCTTCGTTGTGGTGCGGGAGCAAApBFE22-P H93 -GSLRI_RGGTCACGGACCATCGAGTCATTCCTTTCGTTAGGGGT

[0117] FrameStartEndLength(bp)FunctionLength(aa)E-value+246735467795Kan(r) [Cloning vector pFNK-202-qsc119]〉gb|AWV91929.1|2640+1273740651329No hits found442--154764982495No hits found164--360265691336No hits found111--236337327No hits found108--240743769306No hits found101-+121221847276No hits found91--158665624243No hits found80--341074319213No hits found70--224632272192No hits found63--143634184180No hits found59--328612688174No hits found57--218541696159No hits found52-+321652007759No hits found264-

[0118]

[0119] 1-2. 다양한 종의 SOD 유전자 프로모터 분석

[0120] To establish a new constitutive vector system, we investigated promoters of the superoxide dismutase (SOD) gene that are superior to Psod(G) from Corynebacterium glutamicum, which is conventionally used as a promoter in the industry. To this end, sfGFP as a reporter protein was inserted into pBFE22 through Infusion Cloning (Takara Bio) (pBFE22-sfGFP), and the genome information of six species of the genus Corynebacterium, Corynebacterium ammoniagenes (DSM 20306), Corynebacterium casei, Corynebacterium diphtheriae, Corynebacterium efficiens, Corynebacterium glutamicum, and Corynebacterium stationis, was obtained from NCBI. Since the promoter sequence and transcription regulatory regions of the six species were not specified, a region upstream of the start codon of the sod gene was arbitrarily selected and synthesized, and each primer set ((Psod(G)-F, Psod(G)-R, Psod(A)-F, Psod(A)-R, Psod(S)-F, Psod(S)_R, The plasmids Psod(E)-F, Psod(E)-R, Psod(D)-F, Psod(D)-R, Psod(C)-F, Psod(C)-R) were inserted into the beginning of the sfGFP gene upstream of the sfGFP gene in pBFE22-sfGFP by inverse PCR (Fig. 2a). After constructing the plasmids in E. coliDH5a, they were purified and electroporated into Corynebacterium glutamicum, and the fluorescence intensity of sfGFP, a reporter protein produced by each promoter, was analyzed.

[0121] As a result, among the six candidates, the sod promoter derived from Corynebacterium ammoniagenes showed the strongest fluorescence intensity (Fig. 2b) and showed an improvement effect of approximately 900% compared to the conventional Psod(G) (Fig. 4c).

[0122]

[0123] 1-3. Analysis of the promoter region of the sod gene derived from Corynebacterium ammoniagenes

[0124] Since the sod promoter region derived from C. ammoniagenes was unknown, the promoter location was predicted using the promoter prediction program SAPPHIRE.CNN (https: / sapphire.biw.kuleuven.be / index.php). Three locations were found, and some of the three locations were selectively removed to identify the region that most significantly affects the expression level (fluorescence intensity) of the reporter gene.

[0125] As a result, when the -35 box or -10 box among the three positions was removed, the fluorescence intensity was found to decrease significantly (Figs. 3a and 3b), confirming that Site 3 among the three positions had the greatest effect on protein expression regulation.

[0126]

[0127] 1-4. Engineering of the SOD gene promoter derived from Corynebacterium ammoniagenes

[0128] In order to further engineer the sod promoter (SEQ ID NO: 1) derived from C. ammoniagenes DSM 20306 selected in the above example to synthesize a more powerful promoter, a promoter library was constructed by fixing the promoter regions (-35 box and -10 box) predicted in the above examples 1-3 and randomizing the spacer sequences between them (Fig. 4a). The constructed promoter library was transformed into E. coli XL1-Blue, purified with Nucleo Bond® Xtra Midi Plus EF (Macherey-Nagel GmbH & Co. KG, Düren, Germany), and then transformed into wild-type C. glutamicum, followed by cultivation on RG agar supplemented with kanamycin at 30°C for 24 h to obtain individual colonies. C. The promoter library of glutamicum was inoculated into BHI medium containing kanamycin (50 ug / mL) and cultured at 30°C for 8 hours with shaking at 200 rpm. The activated cells were diluted in PBS, and the fGFP emission spectrum was detected using FACS. The top 1% group of cells with the highest fluorescence intensity in the library population was sorted. This process was repeated three times (Fig. 4b). As a result, sufficiently strong promoters were selected from the second sorted population (Fig. 4d). To individually analyze the selected top 1% cells, they were cultured on RG agar plates in 96-well plates, and GFP fluorescence and optical density (OD600) were measured using a microplate reader (Fig. 5). Through this, 80 individual cell colonies with the highest fluorescence intensity were isolated (Fig. 6), and the sequences of 11 individual cell populations were analyzed (Fig. 8a), and it was found that all but 3 of them had conserved genetic sequences in the -10 and -35 regions of the promoter (Fig. 7).In particular, among these, the H93 promoter was found to have a higher fluorescence intensity than promoters previously approved by the Korean Ministry of Food and Drug Safety (MFDS) (Fig. 8b).

[0129]

[0130] Example 2. Production of rare sugars using a recombinant expression vector containing an improved promoter.

[0131] 2-1. Enzyme selection

[0132] The thermal stability of LRI (L-rhamnose isomerase) derived from Clostridium stercorarium DSM 8532, which is known to have excellent D-allose production activity, and recombinant Geobacillus LRI was comparatively analyzed by DSC (Differential Scanning Calorimetry, Microcal PEAQ-DSC, Malvern). Specifically, a single colony of E. coli BL21 (DE3), pBHA-CS-LRI or E. coli BL21 (DE3), pBHA-GS-LRI was selected and inoculated into 4 mL LB medium containing 50 μg mL-1 ampicillin, and then cultured overnight at 37°C and 200 rpm. When the OD600 of the culture medium reached 0.6-0.8, 0.5 mmol / L (final concentration) IPTG was added to induce protein expression, and the two batches of two recombinant cells were centrifuged at 4000x g for 20 min at 4℃ to collect the cells, which were then suspended in 50 mmol / L Tris-HCl (pH 7.0) buffer and sonicated for 5 min. The supernatant was separated by centrifugation at 8000x g for 30 min at 4℃ and loaded onto a Ni-NTA open-column chromatography column pre-equilibrated with 50 mmol / L Tris-HCl (pH 7.0) buffer, and the specifically bound protein was eluted with a buffer containing 200 mmol / L imidazole. The active protein fraction was collected, subjected to SDS-PAGE, and confirmed by Coomassie blue staining. The purified enzyme concentration was adjusted to 2 mg / mL, loaded into a 96-well plate, and a temperature scan was performed at a rate of 1°C / min over a range of 20°C to 100°C, and the data were analyzed using MicroCal PEAQ-DSC Analysis Software (Malvern Panalytical, Malvern, UK).The melting temperature (Tm) was determined from the peak of the heat capacity curve.

[0133] As a result, the denaturing temperature (Tm) of Geobacillus LRI was found to be about 2℃ higher than that of Clostridium stercorarium (Figs. 9a to 9c), and thus, a Geobacillus-derived LRI enzyme was selected.

[0134]

[0135] 3-2. Production of rare sugars using improved promoters and establishment of optimal conditions

[0136] A recombinant expression vector (pBFE22-P) containing the sod promoter derived from C. ammoniagenesDSM 20306 constructed in Example 2 containing Geobacillus-derived LRI enzyme (GS-LRI) sod(A) -GS-LRI) or a recombinant expression vector containing the H93 promoter (pBFE22-P H93-GS-LRI) were each inoculated into 5 mL seed medium (20 g Dextrose, 10 g Polypeptone, 5 g Yeast Extract, 0.5 g L-cysteine, 5 g (NH4)2SO4, 4 g KH2PO4, 0.5 g MgSO4·7H2O, 0.2 mg Biotin, 1.5 mg Thiamine·HCl, 2.0 mg Calcium Pantothenate, 3.0 mg Nicotinamide, and 50 mg / L kanamycin) and cultured overnight at 30°C and 200 rpm. Afterwards, 1 mL of cells were transferred to 100 mL of production medium (80 g Dextrose, 30 g Corn steep liquor, 10.6 g (NH4)2SO4, 1.2 g KH2PO4, 1.4 g MgSO4·7H2O, 0.846 mg Biotin, 8.281 mg Thiamine·HCl, 3.8 mg Calcium Pantothenate, 14.4 mg Nicotinamide, 14.8 mg MnSO4·6H2O, 5 mg ZnSO4·7H2O, 2.5 mg CuSO4·5H2O, 14.8 mg FeSO4·7H2O, 0.5 ml Antifoam) and cultured at 30°C and 400 rpm for 12 h. At this time, the culture was performed at various pH, metal ion, and temperature for optimization. The culture medium was filtered through a 0.22 μm PVDF syringe filter, and 20 μl of Pb 2+ Shodex Sugars SP0810 (Shodex, Kawasaki, Japan) was injected into an HPLC system (Agilent 1100 Series; Agilent, Santa Clara, CA, USA) equipped with a refractive index detector (Agilent G1362A RID, Agilent, Santa Clara, CA, USA), and the concentration of monosaccharides in the sample was analyzed at 80°C at a flow rate of 0.5 mL / min using deionized water as the mobile phase.

[0137] As a result, compared to the sod promoter derived from C. ammoniagenes DSM 20306, the H93 promoter showed a D-allose conversion rate that was approximately 1.4 times higher (Fig. 10a). In addition, as a result of determining the optimal temperature, pH, and metal concentration using free cells, the optimal temperature was 65°C, the optimal pH was 7.0, and the metal Mn 2+ The optimal concentration was found to be 1 mM (Fig. 10b to 10d).

[0138]

[0139] 3-3. Optimization of rare sugar production through cell immobilization

[0140] In order to produce rare sugars in large quantities and for a long period of time, recombinant cells transformed with the recombinant vector of the present invention were immobilized on a support, and the optimal culture temperature for D-allose production was determined. Specifically, a Corynebacterium glutamicum strain transformed with a recombinant vector designed to express LRI (L-rhamnose isomerase) derived from Geobacillus sp. using the H93 promoter of the present invention was cultured at 30°C, and the conversion rate of D-allose was analyzed to analyze the expression level of GS-LRI. Based on the conversion rate of D-allose, sufficient expression of GS-LRI was found after 18 hours of culture (Fig. 11a). After culturing at 30°C for 24 hours, this was isolated and suspended in 50 mM Tris-Hcl buffer (pH 7.0) at a concentration of 40%. This was mixed with a 4% sodium alginate solution in a 1:1 ratio to make a final mixture in which cells constitute 20% of the total volume and alginate constitutes 2%. This was then dropped into a 100 mM CaCl2 solution using a syringe using a vacuum pump to form a cell-alginate complex in which cells were trapped within sodium alginate beads, thereby immobilizing the recombinant cells on the support matrix. In order to determine the optimal culture temperature for producing D-allose using the immobilized cells, the cells were cultured five times at different temperatures every 12 hours. As a result, it was found that the production of D-allose was hardly reduced at 50°C, and this was selected as the optimal temperature (Fig. 11b).

[0141]

[0142] 3-4. Analysis of enzyme ratios for rare sugar production

[0143] D-allose requires two enzymes for production, D-allulose-3-epimerase (DAE) (D-psicose 3-epimerase, DPE) and L-rhamnose isomerase (LRI). If a microorganism expressing both of these enzymes is cultured, there is no need to culture each enzyme separately, and since one vector system is used, there is an advantage in that only one type of antibiotic can be used as a selection marker. In particular, considering that the only selection marker for a genetically modified microorganism currently approved by the Korea Food and Drug Administration is kanamycin, the advantage of a vector utilizing one type of antibiotic is very significant. Therefore, in the single vector system (pBFE22) of the present invention, the DAE (D-allulose-3-epimerase) mutant (I33L S213C) (AT-DAE) (or AT-DPE (D-psicose 3-epimerase)) from Agrobacterium tumefaciens and the LRI from Geobacillus sp. When co-expressing AT-DAE and GS-LRI, the optimal combination of enzyme contents for the production of D-allulose and / or D-allulose was analyzed when producing D-fructose from D-allulose and D-allulose from D-allulose. To this end, three sets with different ratios of the two purified enzymes were randomly constructed and reacted at 60°C for 1 h (Fig. 12b). As a result, while a small amount of AT-DAE was sufficient for the reaction, GS-LRI showed a significant difference in D-allulose production depending on the concentration (Fig. 12a).

[0144]

[0145] 3-5. Optimal promoter combination for rare sugar production

[0146] To efficiently produce the desired type of rare sugar using a single vector system, GS-LRI was expressed using the promoter with the strongest expression induction effect, and AT-DAE, co-expressed with the enzyme, was used using a promoter of the same family to maintain a consistent expression ratio even under various culture conditions. However, considering that they share the same transcriptional regulator, it was expected that the AT-DAE promoter would affect the GS-LRI promoter. Therefore, GS-LRI used the H93 promoter with a high expression effect, and for AT-DAE, the promoter L24 with a low expression intensity, the promoter I18 with an intermediate expression intensity, and the promoter H93 with a high expression intensity were combined (Fig. 13a), and the respective production yields of D-allulose and D-allose were analyzed.

[0147] As a result, the production of D-allulose was highest when the expression promoter of AT-DAE was a high-expression promoter, and was lowest when a low-expression promoter was used, but the expression intensity of AT-DAE did not appear to have a significant effect on D-allulose production (Fig. 13b).

Claims

1. A sod expression promoter derived from the genus Corynebacterium or a variant thereof.

2. A promoter or a variant thereof in claim 1, wherein the genus Corynebacterium is Corynebacterium ammoniagenes, Corynebacterium casei, Corynebacterium efficiens or Corynebacterium stationis.

3. In the first paragraph, the sod expression promoter is a promoter or a variant thereof comprising the base sequence of SEQ ID NO:

1.

4. A promoter or a variant thereof according to claim 1, wherein the variant comprises any one selected from the group consisting of base sequences of SEQ ID NOs: 2 to 10.

5. An expression cassette for producing a target protein, comprising the promoter of paragraph 1 or a variant thereof and a polynucleotide encoding the target protein.

6. An expression cassette for producing a target protein, wherein the promoter or a variant thereof is operably linked to a sequence encoding the target protein in the fifth paragraph.

7. In the fifth paragraph, the target protein is D-allulose 3-epimerase, D-tagatose 3-epimerase, (1→4)-alpha-D-glucan 1-alpha-D-glucosylmutase, 4-alpha-D-{(1→4)-alpha-D-glucano}trehalose trehalohydrolase, L-rhamnose isomerase, D-ribose-5-phosphate isomerase, An expression cassette for producing a target protein, which is fructose-6-phosphate-3-epimerase or D-galactose-6-phosphate isomerase.

8. A recombinant vector comprising an expression cassette for producing the target protein of Article 5.

9. A recombinant vector comprising a kanamycin resistance gene according to claim 8.

10. A recombinant vector for transformation of a bacterium of the genus Corynebacterium according to claim 8.

11. In the 8th paragraph, a first expression cassette comprising a first promoter and D-allulose-3-epimerase operably linked thereto; and A second expression cassette comprising a second promoter and L-rhamnose isomerase operably linked thereto, A recombinant vector wherein the first promoter and the second promoter are the promoter of claim 1 or a variant thereof.

12. In the 8th paragraph, a first expression cassette comprising a first promoter and D-allulose-3-epimerase operably linked thereto; and A second expression cassette comprising a second promoter and L-rhamnose isomerase operably linked thereto, A recombinant vector wherein the first promoter and the second promoter are the promoter of claim 1 or a variant thereof, and the first promoter is a low-expression promoter compared to the second promoter.

13. A transformant transformed with the recombinant vector of Article 8.

14. A transformant according to claim 13, which is a bacterium of the genus Corynebacterium.

15. A transformant producing L-rhamnose isomerase, D-allulose-3-epimerase, or L-rhamnose isomerase and D-allulose-3-epimerase in claim 13.

16. A transformant according to claim 13, which converts a monosaccharide into D-allulose, D-allose, or D-allulose and D-allose.

17. A composition for producing a rare sugar comprising the transformant of Article 13, a fragment thereof, or a culture thereof.

18. A composition according to claim 17, wherein the rare sugar is D-allulose or D-allose.

19. A composition according to claim 17, further comprising saccharide.

20. A method for producing a target protein, comprising a step of culturing the transformant of claim 13. 21.1) A step of culturing the transformant of clause 13 in a culture medium containing monosaccharides; and 2) A method for producing a rare sugar, comprising a step of recovering a rare sugar from a culture or culture supernatant.

Images