Antisense oligonucleotide probes for one-step and simultaneous detection of sexually transmitted diseases in clinical samples

Abstract

Embodiments relate to compositions, methods, and systems for screening and detecting sexually transmitted diseases. In particular, embodiments relate to absorbance-based assays and lateral flow-based assays configured to simultaneously detect the presence of one or more target gene sequences of sexually transmitted diseases of interest. Embodiments may utilize sensing probes designed specifically to bind in complementary fashion to a target gene sequence of a sexually transmitted disease of interest.

Description

ANTISENSE OLIGONUCLEOTIDE PROBES FOR ONE-STEP ANDSIMULTANEOUS DETECTION OF SEXUALLY TRANSMITTED DISEASES IN CLINICAL SAMPLESCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This patent application is related to and claims the benefit of priority of U.S. Provisional Application 63 / 583,373, filed on September 18, 2023, the entire contents of which is incorporated by reference.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH DEVELOPMENT

[0002] This invention was made with government support under Grant Nos. CBET2153091 and CBET2229986 awarded by the National Science Foundation, under Contract No. TP210376 awarded by the Department of Defense and under Grant No. 75D30122C15492 awarded by the Center for Disease Control / DHHS. The Government has certain rights in the invention.INCORPORATION BY REFERENCE STATEMENT REGARDING SEQUENCE LISTINGS

[0003] A Sequence Listing using exXtensible Markup Language (XML) compliant with World Intellectual Property Organization (WIPO) Standard ST.26 is provided herewith and the entirety of this sequence listing is incorporated by reference herein. The Sequence Listing that is incorporated by reference herein is provided via e-filing via ePCT as an XML file, named 0073605-000860. xml (13 KB in size, created on June 26 2024).FIELD

[0004] Embodiments relate to compositions, methods, and systems for screening and detecting sexually transmitted diseases. In particular, embodiments may relate to absorbance-based assaysand lateral flow-based assays configured to simultaneously detect the presence of one or more target gene sequences of sexually transmitted diseases of interest.BACKGROUND

[0005] Sexually transmitted diseases (STDs) are a leading source of microbial infection worldwide, resulting in a substantial economic and healthcare burden. With 127 million and 87 million new infections each year, respectively, Chlamydia trachomatis (CT) and Neisseria gonorrhoeae (NG) are two of the most prevalent sexually transmitted infectious microorganisms in the world. In the United States (U.S.), the Centers for Disease Control and Prevention (CDC) received reports of 1,644,416 chlamydia cases and 710,151 gonorrhea cases in 2021 alone, making these STDs an ongoing epidemic. Because many of these infections may exhibit no symptoms at all, the CDC has recommended universal annual chlamydia screening in women aged 25 years old and younger and those older than 25 years of age with risk factors. While treatments are readily available for sexually transmitted diseases, if a patient does not get tested or fails to follow up with treatment, these diseases can lead to long-term complications such as urethritis in men and infertility, pelvic inflammatory disease, ectopic pregnancy, and chronic pelvic pain in women. Furthermore, these diseases may develop antibiotic resistance over time. For example, in 2020, it was estimated that at least 50% of gonorrhea infections were resistant to at least one antibiotic. Therefore, sexually transmitted diseases pose a global public health issue.

[0006] Due to the high risk of transmission and the lack of rapid and reliable testing, sexually transmitted diseases are routinely treated presumptively, resulting in both overtreatment and undertreatment. In some studies, the rates of overtreatment in emergency departments have been shown to be as great as 86%. That is, 86% of those receiving treatment are negative for the diseases. Concurrently, often as much as 50% of those who eventually receive positive resultsare not provided treatment at the time of testing or first visit to the clinic which may lead to transmission of a disease to others before treatment is sought. Untreated cases may lead to longterm morbidity as well as multiple medical and chronic conditions. Unnecessary use of antibiotics can also cause adverse effects and lead to increased antibiotic resistance in the community. While it is possible to improve treatment rates with intense post-visit follow-up procedures, this can be both costly and time intensive. Therefore, the timely diagnosis of sexually transmitted diseases may be essential for implementation of effective infection control measures.SUMMARY

[0007] The current standard for diagnosing sexually transmitted diseases are the established nucleic acid amplification tests (NAATs) that amplify and detect specific DNA sequences of a disease of interest. Although these diagnostic approaches are excellent in terms of sensitivity and selectivity, they are expensive, time-consuming, and cannot be deployed in a point-of-care (POC) settings (e.g., a physician's office or emergency department), hindering rapid results during the patient's visit. Therefore, the development of an accurate POC test for rapid and simple detection of STDs is crucial, as it would enable timely treatment, prevent further spread, raise risk awareness, reduce costs, and advance healthcare in resource-limited areas.

[0008] We determined that there is an ongoing need for a POC diagnostic method based on nucleic acid detection that combines usability, cost-effectiveness, and the speed of isothermal amplification with high sensitivity and specificity. Additionally, since co-infection of more than one STD is common (e.g., CT and NG co-infection is commonly encountered, up to 50% of the time) and present with similar symptoms, simultaneous identification and detection of more than one pathogen from suspected patient specimens are more efficient and cost-effective. Currentlymost of the approved POC tests do not provide results for more than one STD on the same platform. Hence, the development of a rapid POC diagnostic assay capable of simultaneously detecting more than one STD is of utmost importance in addressing the current epidemic of these STDs.

[0009] In the development of a POC diagnostic test for rapid detection of STDs, a crucial step involves the identification of reliable sensing probes that offer selective and sensitive detection of specific genetic targets in the STDs. Single-stranded oligonucleotides (ssDNAs), which are fragments of nucleic acids, emerge as valuable tools in this process.

[0010] We have designed a series of oligonucleotide probes targeting different genetic segments of STDs, such as chlamydia, gonorrhea, syphilis, human papillomavirus (HPV), and human immunodeficiency virus (HIV), for use in both absorbance-based and lateral flow-based platforms. Absorbance-based systems may utilize probes conjugated onto the surface of nanoparticles, which may selectively aggregate as the probes bind to their target genes (DNA from one of any number of STDs of interest). Such aggregation may be detected to determine the presence of at least one sexually transmitted disease. Similarly, lateral flow-based systems may utilize probes functionalized with small molecules that allow for differentiation between positive and negative samples within a short timeframe after application of a sample onto a testing strip. The designed oligonucleotide probes offer several advantages over other molecular tests currently used for STD detection, including user-friendliness, affordability, and portability POC diagnostics. Overall, a diagnostic tool based on the designed probes for various STDs may not only combine the high accuracy, sensitivity, and specificity of nucleic acid based tests but will also be able to deliver results at the POC level during the patient's office or emergency room visit.

[0011] In an exemplary embodiment, apparatus for detecting at least one sexually transmitted disease in a sample comprises first sensing probes functionalized with a first small molecule at their first ends, wherein the first sensing probes have a sequence that is complementary of a first target gene sequence of a first sexually transmitted disease, second sensing probes functionalized with a second small molecule at their second ends, wherein the second sensing probes have a sequence that is complementary of a second target gene sequence of the first sexually transmitted disease; and third sensing probes functionalized with the first small molecule at their first ends, wherein the third sensing probes have a sequence that is complementary of a first target gene sequence of a second sexually transmitted disease, fourth sensing probes functionalized with the second small molecule at their second ends, wherein the fourth sensing probes have a sequence that is complementary of a second target gene sequence of the second sexually transmitted disease, wherein the first and second sexually transmitted diseases are two different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

[0012] In some embodiments, the first or second sexually transmitted disease is chlamydia, the first and second target gene sequences of chlamydia are SEQ ID NO 1 (CCAAGAGCAGCGCCUACAAC) and SEQ ID NO 2 (UCAACCUGCCCAACCAGACC), when the first or second sexually transmitted disease is gonorrhea, the first and second target gene sequences of gonorrhea are SEQ ID NO 3 (CGGCGAAGGCACCAAAAAAA) and SEQ ID NO 4 (ACCAAGUCUACAGCAUCCCG), when the first or second sexually transmitted disease is HPV, the first and second target gene sequences of HPV are SEQ ID NO 5 (UACUACAAGCAGGAUUGAAG) and SEQ ID NO 6 (AAACGAAAAGCUACACCCAC), when the first or second sexually transmitted disease is HIV, the first and second target gene sequences of HIV are SEQ ID NO 7 (AGACCCAACAACAAUACAAG) and SEQ ID NO 8(AGAGGACCAGGGAGAGCAUU), and when the first or second sexually transmitted disease is syphilis, the first and second target gene sequences of syphilis are selected from SEQ ID NO 9 (TCCGCTACGACTACTACGGT) and SEQ ID NO 10 (GAGACTCTGATGGATGCTGC), SEQ ID NO 11 (CACCTATGCGCTATACAAAA) and SEQ ID NO 12 (GAGCTACCTATCTAACCAAG), and SEQ ID NO 13 (TCTTCTCAATGCATTTCGAC) and SEQ ID NO 14 (TCTATAGACGATTTACAACC).

[0013] In some embodiments, the apparatus further comprises fifth sensing probes functionalized with the first small molecule at their first ends, wherein the fifth sensing probes have a sequence that is complementary of a first target gene sequence of a third sexually transmitted disease, and sixth sensing probes functionalized with the second small molecule at their second ends, wherein the sixth sensing probes have a sequence that is complementary of a second target gene sequence of the third sexually transmitted disease.

[0014] In some embodiments, the first, second, and third sexually transmitted diseases are three different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

[0015] In some embodiments, the apparatus further comprises seventh sensing probes functionalized with the first small molecule at their first ends, wherein the seventh sensing probes have a sequence that is complementary of a first target gene sequence of a fourth sexually transmitted disease, and eighth sensing probes functionalized with the second small molecule at their second ends, wherein the eighth sensing probes have a sequence that is complementary of a second target gene sequence of the fourth sexually transmitted disease.

[0016] In some embodiments, the first, second, third, and fourth sexually transmitted diseases are four different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

[0017] In some embodiments, the apparatus further comprises ninth sensing probes functionalized with the first small molecule at their first ends, wherein the ninth sensing probes have a sequence that is complementary of a first target gene sequence of a fifth sexually transmitted disease, and tenth sensing probes functionalized with the second small molecule at their second ends, wherein the tenth sensing probes have a sequence that is complementary of a second target gene sequence of the fifth sexually transmitted disease.

[0018] In some embodiments, the first, second, third, fourth, and fifth sexually transmitted diseases are five different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

[0019] In some embodiments, the first small molecule is biotin.

[0020] In some embodiments, the second small molecule is 6-carboxyfluorescein.

[0021] In some embodiments, the apparatus further comprises a testing strip comprising a sample application region, a control region, and a testing region positioned between the sample application region and the control region, wherein the sample application region is configured to receive the sample, which is configured flow through the testing strip towards the testing region and control region.

[0022] In some embodiments, the testing region has first capture compounds immobilized on the testing strip, wherein the first capture compounds are configured to capture the first small molecules of sensing probes.

[0023] In some embodiments, the first capture compounds comprise streptavidin.

[0024] In some embodiments, the testing strip has nanoparticles configured to flow through the testing strip, wherein some of the nanoparticles are configured to capture the second small molecules of the sensing probes.

[0025] In some embodiments, the nanoparticles are plasmonic nanoparticles.

[0026] In some embodiments, the nanoparticles are coupled to second capture compounds configured to bind to the second small molecules of the sensing probes.

[0027] In some embodiments, the control region has third capture compounds immobilized on the testing strip, wherein the third capture compounds are configured to capture some of the nanoparticles.

[0028] In an exemplary embodiment, a method for detecting at least one sexually transmitted disease comprises collecting a sample comprising nucleic acid from a subject and providing a sample solution. The sample solution comprises the collected sample; first sensing probes functionalized with a first small molecule at their first ends, wherein the first sensing probes have a sequence that is complementary of a first target gene sequence of a first sexually transmitted disease, second sensing probes functionalized with a second small molecule at their second ends, wherein the second sensing probes have a sequence that is complementary of a second target gene sequence of the first sexually transmitted disease; third sensing probes functionalized with the first small molecule at their first ends, wherein the third sensing probes have a sequence that is complementary of a first target gene sequence of a second sexually transmitted disease, fourth sensing probes functionalized with the second small molecule at their second ends, wherein the fourth sensing probes have a sequence that is complementary of a second target gene sequence of the second sexually transmitted disease. The method further comprises providing a testing strip comprising a sample application region, a control region, a testing region positioned between thesample application region and the control region; and applying the sample at the sample application region, wherein the first and second sexually transmitted diseases are two different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

[0029] In some embodiments, the sample solution is configured to flow through the testing strip towards the testing region and the control region after application.

[0030] In some embodiments, when the first or second sexually transmitted disease is chlamydia, the first and second target gene sequences of chlamydia are SEQ ID NO 1 and SEQ ID NO 2, when the first or second sexually transmitted disease is gonorrhea, the first and second target gene sequences of gonorrhea are SEQ ID NO 3 and SEQ ID NO 4, when the first or second sexually transmitted disease is HPV, the first and second target gene sequences of HPV are SEQ ID NO 5 and SEQ ID NO 6, when the first or second sexually transmitted disease is HIV, the first and second target gene sequences of HIV are SEQ ID NO 7 and SEQ ID NO 8, and when the first or second sexually transmitted disease is syphilis, the first and second target gene sequences of syphilis are selected from SEQ ID NO 9 and SEQ ID NO 10, SEQ ID NO 11 and SEQ ID NO 12, and SEQ ID NO 13 and SEQ ID NO 14.

[0031] In some embodiments, the sample solution further comprises fifth sensing probes functionalized with the first small molecule at their first ends, wherein the fifth sensing probes have a sequence that is complementary of a first target gene sequence of a third sexually transmitted disease, and sixth sensing probes functionalized with the second small molecule at their second ends, wherein the sixth sensing probes have a sequence that is complementary of a second target gene sequence of the third sexually transmitted disease.

[0032] In some embodiments, the first, second, and third sexually transmitted diseases are three different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

[0033] In some embodiments, the sample solution further comprises seventh sensing probes functionalized with the first small molecule at their first ends, wherein the seventh sensing probes have a sequence that is complementary of a first target gene sequence of a fourth sexually transmitted disease, and eighth sensing probes functionalized with the second small molecule at their second ends, wherein the eighth sensing probes have a sequence that is complementary of a second target gene sequence of the fourth sexually transmitted disease.

[0034] In some embodiments, the first, second, third, and fourth sexually transmitted diseases are four different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

[0035] In some embodiments, the sample solution further comprises ninth sensing probes functionalized with the first small molecule at their first ends, wherein the ninth sensing probes have a sequence that is complementary of a first target gene sequence of a fifth sexually transmitted disease, and tenth sensing probes functionalized with the second small molecule at their second ends, wherein the tenth sensing probes have a sequence that is complementary of a second target gene sequence of the fifth sexually transmitted disease.

[0036] In some embodiments, the first, second, third, fourth, and fifth sexually transmitted diseases are five different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

[0037] In some embodiments, the first small molecule is biotin.

[0038] In some embodiments, the second small molecule is 6-carboxyfluorescein.

[0039] In an exemplary embodiment, a composition for detecting at least one sexually transmitted disease in a sample comprises first sensing probes functionalized with a moiety at their first ends, wherein the first sensing probes have a sequence that is complementary of a first target gene sequence of a first sexually transmitted disease; second sensing probes functionalized with a moiety at their second ends, wherein the second sensing probes have a sequence that is complementary of a second target gene sequence of the first sexually transmitted disease; third sensing probes functionalized with a moiety at their first ends, wherein the third sensing probes have a sequence that is complementary of a first target gene sequence of a second sexually transmitted disease; fourth sensing probes functionalized with a moiety at their second ends, wherein the fourth sensing probes have a sequence that is complementary of a second target gene sequence of the second sexually transmitted disease; and a plurality of nanoparticles bound to the moieties of the first, second, third, and fourth sensing probes, wherein upon the first and second sensing probes binding to the first and second target gene sequences of the first sexually transmitted disease respectively, the nanoparticles are brought within proximity of one another and agglomerate, wherein upon the third and fourth sensing probes binding to the first and second target gene sequences of the second sexually transmitted disease respectively, the nanoparticles are brought within proximity of one another and agglomerate, and wherein the first and second sexually transmitted diseases are two different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

[0040] In some embodiments, when the first or second sexually transmitted disease is chlamydia, the first and second target gene sequences of chlamydia are SEQ ID NO 1 and SEQ ID NO 2, when the first or second sexually transmitted disease is gonorrhea, the first and second target gene sequences of gonorrhea are SEQ ID NO 3 and SEQ ID NO 4, when the first or secondsexually transmitted disease is HPV, the first and second target gene sequences of HPV are SEQ ID NO 5 and SEQ ID NO 6, when the first or second sexually transmitted disease is HIV, the first and second target gene sequences of HIV are SEQ ID NO 7 and SEQ ID NO 8, and when the first or second sexually transmitted disease is syphilis, the first and second target gene sequences of syphilis are selected from SEQ ID NO 9 and SEQ ID NO 10, SEQ ID NO 11 and SEQ ID NO 12, and SEQ ID NO 13 and SEQ ID NO 14.

[0041] In some embodiments, the composition further comprises fifth sensing probes functionalized with a moiety at their first ends, wherein the fifth sensing probes have a sequence that is complementary of a first target gene sequence of a third sexually transmitted disease; sixth sensing probes functionalized with a moiety at their second ends, wherein the sixth sensing probes have a sequence that is complementary of a second target gene sequence of the third sexually transmitted disease; and a plurality of nanoparticles bound to the moieties of the fifth and sixth sensing probes, wherein upon the fifth and sixth sensing probes binding to the first and second target gene sequences of the third sexually transmitted disease respectively, the nanoparticles are brought within proximity of one another and agglomerate.

[0042] In some embodiments, the first, second, and third sexually transmitted diseases are three different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

[0043] In some embodiments, the composition further comprises seventh sensing probes functionalized with a moiety at their first ends, wherein the seventh sensing probes have a sequence that is complementary of a first target gene sequence of a fourth sexually transmitted disease; eighth sensing probes functionalized with a moiety at their second ends, wherein the eighth sensing probes have a sequence that is complementary of a second target gene sequenceof the fourth sexually transmitted disease; and a plurality of nanoparticles bound to the moieties of the seventh and eighth sensing probes, wherein upon the seventh and eighth sensing probes binding to the first and second target gene sequences of the fourth sexually transmitted disease respectively, the nanoparticles are brought within proximity of one another and agglomerate.

[0044] In some embodiments, the first, second, third, and fourth sexually transmitted diseases are four different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

[0045] In some embodiments, the composition further comprises ninth sensing probes functionalized with a moiety at their first ends, wherein the ninth sensing probes have a sequence that is complementary of a first target gene sequence of a fifth sexually transmitted disease; tenth sensing probes functionalized with a moiety at their second ends, wherein the tenth sensing probes have a sequence that is complementary of a second target gene sequence of the fifth sexually transmitted disease; and a plurality of nanoparticles bound to the moieties of the ninth and tenth sensing probes, wherein upon the ninth and tenth sensing probes binding to the first and second target gene sequences of the fifth sexually transmitted disease respectively, the nanoparticles are brought within proximity of one another and agglomerate.

[0046] In some embodiments, the first, second, third, fourth, and fifth sexually transmitted diseases are five different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

[0047] In an exemplary embodiment, a method for detecting at least one sexually transmitted disease comprises collecting a sample comprising nucleic acid from a subject and mixing the sample with a composition. The composition comprises first sensing probes functionalized with a moiety at their first ends, wherein the first sensing probes have a sequence that iscomplementary of a first target gene sequence of a first sexually transmitted disease; second sensing probes functionalized with a moiety at their second ends, wherein the second sensing probes have a sequence that is complementary of a second target gene sequence of the first sexually transmitted disease; third sensing probes functionalized with a moiety at their first ends, wherein the third sensing probes have a sequence that is complementary of a first target gene sequence of a second sexually transmitted disease; fourth sensing probes functionalized with a moiety at their second ends, wherein the fourth sensing probes have a sequence that is complementary of a second target gene sequence of the second sexually transmitted disease; and a plurality of nanoparticles bound to the moieties of the first, second, third, and fourth sensing probes, wherein upon the first and second sensing probes binding to the first and second target gene sequences of the first sexually transmitted disease respectively, the nanoparticles are brought within proximity of one another and agglomerate, wherein upon the third and fourth sensing probes binding to the first and second target gene sequences of the second sexually transmitted disease respectively, the nanoparticles are brought within proximity of one another and agglomerate, and wherein the first and second sexually transmitted diseases are two different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

[0048] In some embodiments, when the first or second sexually transmitted disease is chlamydia, the first and second target gene sequences of chlamydia are SEQ ID NO 1 and SEQ ID NO 2, when the first or second sexually transmitted disease is gonorrhea, the first and second target gene sequences of gonorrhea are SEQ ID NO 3 and SEQ ID NO 4, when the first or second sexually transmitted disease is HPV, the first and second target gene sequences of HPV are SEQ ID NO 5 and SEQ ID NO 6, when the first or second sexually transmitted disease is HIV, the first and second target gene sequences of HIV are SEQ ID NO 7 and SEQ ID NO 8, and whenthe first or second sexually transmitted disease is syphilis, the first and second target gene sequences of syphilis are selected from SEQ ID NO 9 and SEQ ID NO 10, SEQ ID NO 11 and SEQ ID NO 12, and SEQ ID NO 13 and SEQ ID NO 14.

[0049] In some embodiments, the composition further comprises fifth sensing probes functionalized with a moiety at their first ends, wherein the fifth sensing probes have a sequence that is complementary of a first target gene sequence of a third sexually transmitted disease; sixth sensing probes functionalized with a moiety at their second ends, wherein the sixth sensing probes have a sequence that is complementary of a second target gene sequence of the third sexually transmitted disease; and a plurality of nanoparticles bound to the moieties of the fifth and sixth sensing probes, wherein upon the fifth and sixth sensing probes binding to the first and second target gene sequences of the third sexually transmitted disease respectively, the nanoparticles are brought within proximity of one another and agglomerate.

[0050] In some embodiments, the first, second, and third sexually transmitted diseases are three different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

[0051] In some embodiments, the composition further comprises seventh sensing probes functionalized with a moiety at their first ends, wherein the seventh sensing probes have a sequence that is complementary of a first target gene sequence of a fourth sexually transmitted disease; eighth sensing probes functionalized with a moiety at their second ends, wherein the eighth sensing probes have a sequence that is complementary of a second target gene sequence of the fourth sexually transmitted disease; and a plurality of nanoparticles bound to the moieties of the seventh and eighth sensing probes, wherein upon the seventh and eighth sensing probesbinding to the first and second target gene sequences of the fourth sexually transmitted disease respectively, the nanoparticles are brought within proximity of one another and agglomerate.

[0052] In some embodiments, the first, second, third, and fourth sexually transmitted diseases are four different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

[0053] In some embodiments, the composition further comprises ninth sensing probes functionalized with a moiety at their first ends, wherein the ninth sensing probes have a sequence that is complementary of a first target gene sequence of a fifth sexually transmitted disease; tenth sensing probes functionalized with a moiety at their second ends, wherein the tenth sensing probes have a sequence that is complementary of a second target gene sequence of the fifth sexually transmitted disease; and a plurality of nanoparticles bound to the moieties of the ninth and tenth sensing probes, wherein upon the ninth and tenth sensing probes binding to the first and second target gene sequences of the fifth sexually transmitted disease respectively, the nanoparticles are brought within proximity of one another and agglomerate.

[0054] In some embodiments, the first, second, third, fourth, and fifth sexually transmitted diseases are five different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.BRIEF DESCRIPTION OF THE DRAWINGS

[0055] The above and other objects, aspects, features, advantages, and possible applications of embodiments of the present innovation will be more apparent from the following more particular description thereof, presented in conjunction with the following drawings. Like reference numbers used in the drawings may identify like components.

[0056] FIG. l is a schematic illustration showing an exemplary absorbance-based method and system for screening and detecting sexually transmitted diseases. While chlamydia and gonorrhea are shown as exemplary sexually transmitted diseases in the illustration, the absorbance-based method and system may be used for screening and detection of any sexually transmitted disease.

[0057] FIG. 2 is a schematic illustration of an exemplary lateral flow system for screening and detecting sexually transmitted diseases, including representative lateral flow strips tested with a negative sample, a gonorrhea positive sample, and a chlamydia positive sample. The test line appears only in presence of a target gene sequence. While chlamydia and gonorrhea are shown as exemplary sexually transmitted diseases in the illustration, the absorbance-based method and system may be used for screening and detection of any sexually transmitted disease.

[0058] FIG. 3 is a schematic illustration showing an exemplary lateral flow-based method and system for screening and detecting sexually transmitted diseases. The presence of a target gene sequence may be indicated by a prominent test (T) line along with a control (C) line. While chlamydia and gonorrhea are shown as exemplary sexually transmitted diseases in the illustration, the absorbance-based method and system may be used for screening and detection of any sexually transmitted disease.

[0059] FIG. 4A is a schematic illustration of identified genetic targets in chlamydia and gonorrhea.

[0060] FIG. 4B is a table including identified target sequences and complimentary antisense oligonucleotide (ASO) sequences for chlamydia and gonorrhoeae.

[0061] FIG. 4C is a table including identified target sequences and complimentary ASO sequences for HPV, HIV, and syphilis.

[0062] FIG. 5 shows transmission electron microscopy (TEM) images for sensing probes targeting chlamydia (top) and gonorrhea (bottom). The images shows probes are individually dispersed with no visible aggregation in absence of target gene sequences.

[0063] FIG. 6 shows dynamic light scattering graphs for sensing probes targeting chlamydia (top) and gonorrhea (bottom). The graphs show comparative changes in average hydrodynamic diameter of the probes targeted towards either chlamydia or gonorrhea (1 . nanoparticle; 2. ssDNA capped nanoparticle targeted towards chlamydia (or gonorrhea); 3. ssDNA capped nanoparticle targeted towards chlamydia in presence of gonorrhea (or gonorrhea in the presence of chlamydia); and 4. ssDNA capped nanoparticles targeted towards chlamydia in presence of chlamydia (or gonorrhea in the presence of gonorrhea)). Error bars indicate the measurements of the hydrodynamic diameter from three such independent experiments.

[0064] FIG. 7 shows UV-Visible absorbance spectra of gold nanoparticles conjugated with (A) chlamydia -ssDNAi and chlamydia -SSDNA2; (B) gonorrhea -ssDNAn and gonorrhea -SSDNA12 compared to the citrate stabilized no-DNA conjugated nanoparticles.

[0065] FIG. 8 shows 'H-NMR spectra of gold nanoparticles conjugated with chlamyida-ssDNAi.

[0066] FIG. 9 shows 'H-NMR spectra of gold nanoparticles conjugated with gonorrhea- SSDNAH.

[0067] FIG. 10 shows Raman spectroscopy data for sensing probes targeting chlamydia (left) and gonorrhea (right).

[0068] FIG. 11 shows the normalized absorbance at 523 nm for gold nanoparticles conjugated with chlamydia targeted ssDNAs in presence DNA extracted from chlamydia positive, chlamydia and gonorrhea positive and control negative samples. Working concentration of the ssDNA conjugated with AuNPs was 0.5 pM.

[0069] FIG. 12 shows the normalized absorbance at 523 nm for gold nanoparticles conjugated with gonorrhea targeted ssDNAs. Working concentration of the ssDNA conjugated with AuNPs was 0.5 pM.

[0070] FIG. 13 shows the normalized absorbance at 523 nm for gold nanoparticles conjugated with newly designed gonorrhea targeted ssDNAs. Working concentration of the ssDNA conjugated with AuNPs was 0.5 pM.

[0071] FIG. 14 shows the normalized absorbance at 523 nm for gold nanoparticles conjugated with chlamydia targeted ssDNAs. The working concentration of the ssDNAs was optimized at three different concentrations. SSDNAI+2 at 0.5 pM concentration showed the best response.

[0072] FIG. 15 shows the normalized absorbance at 523 nm for gold nanoparticles conjugated with chlamydia targeted ssDNAs at three different temperatures. The optimized working concentration of the ssDNAs as 0.5 pM was used for the study. It was observed that the AuNP- chlamydia targeted ssDNAs showed optimum response at 37 °C.

[0073] FIG. 16 shows the normalized absorbance at 523 nm for gold nanoparticles conjugated with gonorrhea targeted ssDNAs at three different temperatures. The optimized working concentration of the ssDNAs as 0.5 pM was used for the study. It was observed that the AuNP- gonorrhea targeted ssDNAs showed optimum response at 37 °C.

[0074] FIG. 17 shows TEM images for sensing probes targeting chlamydia (top) and gonorrhea (bottom). The images shows visible aggregation of probes in the presence of chlamydia genomic DNA (0.5 ng / pL) and gonorrhea genomic DNA (0.5 ng / pL).

[0075] FIG. 18 shows TEM images of the agglomeration of sensing probes in the presence of bacterial DNA. (A-D) Gonorrhea targeted sensing probes. (E-H) Chlamydia targeted sensing probes. (A) Gonorrhea targeted sensing probes in presence of control sample (water). Noagglomeration was observed. (B) Gonorrhea targeted sensing probes in presence of gonorrhea positive sample. Agglomeration was observed in the presence of target gonorrhea DNA. (C) Gonorrhea targeted sensing probes in presence of gonorrhea + chlamydia positive sample. Agglomeration was observed. (D) Gonorrhea targeted sensing probes in presence of gonorrhea negative but chlamydia positive sample. No agglomeration was observed in the absence of target gonorrhea DNA. (E) Chlamydia targeted sensing probes in presence of control sample (water). No agglomeration was observed. (F) chlamydia targeted sensing probes in presence of chlamydia positive sample. Agglomeration was observed in the presence of target chlamydia DNA. (G) Chlamydia targeted sensing probes in presence of gonorrhea + chlamydia positive sample. Agglomeration was observed. (H) Chlamydia targeted sensing probes in presence of chlamydia negative but gonorrhea positive sample. No agglomeration was observed in the absence of target chlamydia DNA.

[0076] FIG. 19A shows UV-Visible absorbance spectra of gold nanoparticles conjugated with chlamydia-ssDNAs. Absorption spectra of gold nanoparticles conjugated with chlamydia - ssDNAs when tested for chlamydia DNA directly from cervical swab samples. Clear agglomeration at 630 nm can be observed for chlamydia positive and both chlamydia + gonorrhea positive samples. No agglomeration is observed when tested with negative samples.

[0077] FIG. 19B shows UV-Visible absorbance spectra of gold nanoparticles conjugated with chlamydia-ssDNAs. Absorption spectra of gold nanoparticles conjugated with chlamydia- ssDNAs when tested for chlamydia DNA directly isolated from urine samples using CHAI buffer. Increase in agglomeration was observed for chlamydia positive sample with an increase in absorbance at 630 nm. No agglomeration is observed when tested with negative samples.

[0078] FIG. 19C shows UV-Visible absorbance spectra of gold nanoparticles conjugated with gonorrhea-ssDNAs. Absorbance spectra of gold nanoparticles conjugated with gonorrhea - ssDNAs when tested for gonorrhea DNA directly isolated from cervical swab samples using CHAI buffer. Clear shift in wavelength maxima can be observed for gonorrhea positive and both chlamydia + gonorrhea positive samples. No agglomeration is observed when tested with negative samples.

[0079] FIG. 19D shows UV-Visible absorbance spectra of gold nanoparticles conjugated with gonorrhea-ssDNAs. Absorbance spectra of gold nanoparticles conjugated with gonorrhea- ssDNAs when tested for gonorrhea DNA directly from urine samples. Increase in absorbance at 630 nm can be observed indicative of increase in agglomeration in presence for gonorrhea positive and both chlamydia + gonorrhea positive samples. No agglomeration is observed when tested with negative samples.

[0080] FIG. 20 shows chlamydia detection from 60 deidentified clinical samples. (A) Confusion matrix obtained from the demonstrated chlamydia DNA targeting ssDNA conjugated AuNP based test. Results were benchmarked with the gold standard technique qPCR for the 60 deidentified clinical samples. (B) Chlamydia DNA targeting ssDNA conjugated AuNP based test parameters indicating the sensitivity, specificity, PPV, NPV and accuracy. (C) Graphical representation of normalized % absorbance change at 630 nm for the chlamydia DNA targeted ssDNA conjugated AuNP based test. 1 is chlamydia + sample (n=15); 2 is both chlamydia + gonorrhea + sample (n=15); 3 is gonorrhea + sample(n=15) and 4 is both chlamydia-gonorrhea- samples (n=15).

[0081] FIG. 21 shows agarose gel-electrophoresis results for PCR validated and amplified samples using gonorrhea DNA targeted probes. (A) 15 gonorrhea positive samples (1-15) alongwith lOObp ladder, control sample (water) and gonorrhea negative sample were run on a 2% agarose gel. (B) 15 both gonorrhea positive chlamydia positive samples (1-15) along with lOObp ladder, control sample (water) and gonorrhea negative sample were run on a 2% agarose gel. Clear band was observed in most of the 15 gonorrhea positive samples but was found to be absent in the negative cases. Faint band was observed in a few of the positive cases indicative of lower DNA concentration (higher Ct value) in those samples even after PCR amplification. Sample 13 in (A) along with samples 6 and 11 in (B) are such samples with Ct values higher than 33.

[0082] FIG. 22 shows agarose gel-electrophoresis results for PCR validated and amplified samples using chlamydia DNA targeted probes. (A) 15 chlamydia positive samples (1-15) along with 100 bp ladder, control sample (water), chlamydia negative sample and gonorrhea positive sample were run on a 2% agarose gel. (B) 15 both gonorrhea + chlamydia positive samples (1- 15) along with 100 bp ladder, control sample (water), chlamydia negative and gonorrhea positive sample were run on a 2% agarose gel. Clear band was observed in most of the 15 chlamydia positive samples on the gel but was found to be absent in other cases. Faint band was observed in a few of the positive cases indicative of lower DNA concentration (higher Ct value) in those samples even after PCR amplification. Samples 10 and 13 in (A) and sample 11 in (B) are such samples with Ct values higher than 33.

[0083] FIG. 23 shows gonorrhea detection from 60 deidentified clinical samples. (A) Confusion matrix obtained from the gonorrhea DNA targeting ssDNA conjugated AuNP based test. Results were benchmarked with the gold standard technique qPCR from 60 deidentified clinical samples. (B) Gonorrhea DNA targeted ssDNA conjugated AuNP based test parameters indicating the sensitivity, specificity, PPV, NPV and accuracy. (C) Graphical representation of normalized %absorbance change at 630 nm for gonorrhea DNA targeting ssDNA conjugated AuNP based test. 1 is gonorrhea + sample (n=15); 2 is both chlamydia + gonorrhea + sample (n=15); 3 is chlamydia + sample (n=l 5) and 4 is both chlamydia-gonorrhea- samples (n=15). The one-way ANOVA showed that the assay response was significantly different between positives and negatives.

[0084] FIG. 24 shows chlamydia detection from 40 deidentified clinical samples using CHAI buffer without any added purification steps. (A) Confusion matrix obtained from the studied ssDNA-AuNPs targeting chlamydia DNA. Results from 40 deidentified clinical samples were validated with the gold standard technique qPCR. (B) Graphical representation of normalized % absorbance change at 630 nm with chlamydia targeted ssDNA-AuNPs for 1. Control water sample; 2. chlamydia positive sample (n=l 0); 3. both chlamydia positive and gonorrhea positive sample (n=l 0); 4. gonorrhea positive sample (n=10) and 5. both chlamydia and gonorrhea negative sample (n=10).

[0085] FIG. 25 shows gonorrhea detection from 40 deidentified clinical samples using CHAI buffer without any added purification steps. (A) Confusion matrix obtained from the studied ssDNA-AuNPs targeting gonorrhea DNA. Results from 40 deidentified clinical samples were validated with the gold standard qPCR. (B) Graphical representation of normalized % absorbance change at 630 nm with gonorrhea targeted ssDNA-AuNPs for 1. Control water sample, 2. gonorrhea positive sample (n=10), 3. both chlamydia positive and gonorrhea positive sample (n=10), 4. chlamydia positive sample (n=10) and 5. both chlamydia and gonorrhea negative sample (n=10).

[0086] FIG. 26 shows graphs indicating the results of a specificity study of chlamydia targeting sensing probes (left) and gonorrhea targeting sensing probes (right) in the presence of 1.chlamydia (Ct = 25) (or gonorrhea (Ct = 27) for right graph), 2. chlamydia and gonorrhea (Ct = 30), 3. Staphylococcus aureus, 4. Acinetobacter baumannii, 5. Escherichia coli, 6. Bacillus subtilis, 7. Streptococcus mutans and 8. negative control sample (water).DETAILED DESCRIPTION

[0087] The following description is of exemplary embodiments and methods of use that are presently contemplated for carrying out the present invention. This description is not to be taken in a limiting sense, but is made merely for the purpose of describing the general principles and features of various aspects of the present invention. The scope of the present invention is not limited by this description.

[0088] Embodiments generally relate to compositions, methods, and systems configured to accurately screen and detect sexually transmitted diseases. Exemplary compositions may comprise sensing probes configured to selectively detect a target gene sequence of a sexually transmitted disease of interest.Absorbance-Based Assay

[0089] Embodiments may relate to an absorbance-based system and method configured to receive and analyze a sample to determine if the sample comprises at least one target gene sequence related to at least one sexually transmitted disease of interest. The absorbance-based system and method can be used as a point-of-care (POC) test, for example as a rapid lab test, for screening and detection of sexually transmitted diseases.

[0090] In exemplary embodiments, the system comprises sensing probes. In particular, antisense oligonucleotides (ASOs) may be configured as sensing probes to detect one or more sexually transmitted diseases present in the sample (see FIG. 1). The ASOs are single-strandedDNA (ssDNA) probes designed specifically to bind in complementary fashion to a target genesequence of a sexually transmitted disease of interest. For example, ASOs have nucleotide sequences that complement the nucleotide sequence of a target gene (e.g., adenine (A) in an ASO sequence may complement and bind to uracil (U) or thymine (T) in a target gene sequence, cytosine (C) in an ASO sequence may complement and bind to guanine (G) in a target gene sequence, thymine (T) or uracil (U) in an ASO sequence may complement and bind to adenine (A) in a target gene sequence, and guanine (G) in an ASO sequence may complement and bind to cytosine (C) in a target gene sequence). It is contemplated that the terms anti-sense oligonucleotides, single-stranded DNA, and sensing probes may be used interchangeably herein.

[0091] The sensing probes may be used to form capped nanoparticles. It is contemplated that a “capped” nanoparticle means a nanoparticle that is covalently bound to another molecule, such as to a sensing probe. The sensing probes may be functionalized with a moiety at either their first end or their second end such that their first end or second end may bind to the surface of a nanoparticle. It is contemplated that the first end can be a five prime end (5’ end) and the second end can be a three prime (3’ end). In some embodiments, the sensing probes are functionalized with an amine moiety (-NH2) or a thiol moiety (-SH) either at their first end or their second end, and the amine moiety or thiol moiety may then be used to cap the nanoparticles. As the amine and thiol moieties are coupled to both the sensing probes and the nanoparticles, when the sensing probes bind to a target gene sequence, the nanoparticles are also necessarily present at the target gene sequence. In preferred embodiments, the nanoparticles are plasmonic nanoparticles. Plasmonic nanoparticles may include gold nanoshells, gold core-silver shell-gold shell (coreshell-shell) nanoparticles, etc. or are nanoparticulates that include gold, silver, etc. Other embodiments can utilize other types of suitable particulates.

[0092] In exemplary embodiments, sensing probes may be chosen in pairs and may be configured to bind to two closely spaced regions of a target gene sequence. It is contemplated that each sensing probe of a pair may be differentially functionalized (e.g., the first sensing probe functionalized at its first end and the second sensing probe functionalized at its second end) such that the functionalized ends of each sensing probe are in close proximity to each other when the sensing probes are bound to their respective regions of the target gene sequence. For example, a first sensing probe functionalized at its first end may be complementary of a first region of a target gene sequence, and a second sensing probe functionalized at its second end may be complementary of a second region of a target gene sequence that is in close proximity to the first region. As the functionalized ends of the sensing probes may bind to nanoparticles, the nanoparticles necessarily come close to each other when the sensing probes binds to their respective regions of the target gene sequence. This results in an agglomeration of nanoparticles, which may be observed and detected as further described below, and the presence of the sexually transmitted disease corresponding to the target gene sequence may therefore be detected. It is contemplated that agglomeration among nanoparticles in sensing probe pairs may occur at an increased rate relative to nanoparticles coupled to sensing probes which are not chosen in pairs.

[0093] It is contemplated that when sensing probe pairs are not in the presence of their target gene sequence, the sensing probes may be individually dispersed and an agglomeration of nanoparticles may not be detected. However, when sensing probe pairs are in the presence of their target gene sequence, the nanoparticles may agglomerate to form large, detectable clusters, and the presence of the sexually transmitted disease corresponding to the target gene sequence may therefore be detected. Accordingly, the sensing probes exhibit selective aggregation in the presence of their target gene sequence.

[0094] It is contemplated that the sensing probes may be designed to target gene sequences that are less prone to mutation and / or antibiotic resistance. In some embodiments, the sensing probes may be designed to target cryptic plasmid and / or chromosomal DNA of a sexually transmitted disease, which may be conserved among different strains of a sexually transmitted disease and less prone to antibiotic resistance. By targeting conserved regions, sensing probes may be used universally for diagnostic purposes, ensuring consistent and reliable results regardless of genetic variations among strains.

[0095] In some embodiments, the system may comprise multiple sensing probe pairs configured to complement and bind to multiple regions of a single target gene sequence. An advantage of using multiple sensing probe pairs is to ensure recognition of at least one region of the target gene sequence even if other regions of the target gene sequence undergo or are subject to mutations.

[0096] A composition may comprise any number of sensing probe pairs. A composition may comprise at least a first sensing probe pair configured to complement and bind to a first target gene sequence, a second sensing probe pair configured to complement and bind to a second target gene sequence, a third sensing probe pair configured to complement and bind to a third target gene sequence, a fourth sensing probe pair configured to complement and bind to a fourth target gene sequence, a fifth sensing probe pair configured to complement and bind to a fifth target gene sequence, etc. It is contemplated that the different target gene sequences may correspond to different gene sequences of the same sexually transmitted disease. It is further contemplated that the different target gene sequences may correspond to gene sequences of different sexually transmitted diseases. For example, the first target gene sequence may correspond to a first sexually transmitted disease, the second target gene sequence maycorrespond to a second sexually transmitted disease, the third target gene sequence may correspond to a third sexually transmitted disease, the fourth target gene sequence may correspond to a fourth sexually transmitted disease, the fifth target gene sequence may correspond to a fifth sexually transmitted disease, etc. Accordingly, a single system may be used for screening and detection of various sexually transmitted diseases.

[0097] It is contemplated that the system can be configured to detect at least one or more sexually transmitted diseases, including but not limited to, chlamydia, gonorrhea, syphilis, human papillomavirus (HPV), and human immunodeficiency virus (HIV). Accordingly, the system can include sensing probes configured to complement and bind to a target gene sequence corresponding to chlamydia, and / or sensing probes configured to complement and bind to a target gene sequence corresponding to gonorrhea, and / or sensing probes configured to complement and bind to a target gene sequence corresponding to syphilis, and / or sensing probes configured to complement and bind to a target gene sequence corresponding to HPV, and / or sensing probes configured to complement and bind to a target gene sequence corresponding to HIV.

[0098] In some embodiments, the system is configured to detect the presence of one or both of two predetermined sexually transmitted diseases. For example, the system may be configured to detect one or both of chlamydia and gonorrhea, one or both of chlamydia and syphilis, one or both of chlamydia and HPV, one or both of chlamydia and HIV, one or both of gonorrhea and syphilis, one or both of gonorrhea and HPV, one or both of gonorrhea and HIV, one or both of syphilis and HPV, one or both of syphilis and HIV, or one or both of HPV and HIV. Examples of such systems can be configured so that the detection of multiple predetermined sexuallytransmitted diseases can be detected via the same detection system having different sensing probe pairs.

[0099] In some embodiments, the system is configured to detect the presence of one, two, or all of three predetermined sexually transmitted diseases. For example, the system may be configured to detect one, two, or all of chlamydia, gonorrhea, and syphilis one, two, or all of chlamydia, gonorrhea, and HPV, one, two, or all of chlamydia, gonorrhea, and HIV, one, two, or all of chlamydia, syphilis, and HPV, one, two, or all of chlamydia, syphilis, and HIV, one, two, or all of chlamydia, HPV, and HIV, one, two, or all of gonorrhea, syphilis, and HPV, one, two, or all of gonorrhea, syphilis, and HIV, one, two, or all of gonorrhea, HPV, and HIV, or one, two, or all of syphilis, HPV, and HIV. Examples of such systems can be configured so that the detection of multiple predetermined sexually transmitted diseases can be detected via the same detection system having different sensing probe pairs.

[0100] In some embodiments, the system is configured to detect the presence of one, two, three, or all of four predetermined sexually transmitted diseases. For example, the system may be configured to detect one, two, three, or all of chlamydia, gonorrhea, syphilis, and HPV, one, two, three, or all of chlamydia, gonorrhea, syphilis, and HIV, one, two, three, or all of chlamydia, syphilis, HPV, and HIV, one, two, three, or all of chlamydia, syphilis, HPV, and HIV, or one, two, three, or all of gonorrhea, syphilis, HPV, and HIV. Examples of such systems can be configured so that the detection of multiple predetermined sexually transmitted diseases can be detected via the same detection system having different sensing probe pairs.

[0101] In some embodiments, the system is configured to detect the presence of one, two, three, four, or all of five predetermined sexually transmitted diseases. For example, the system may be configured to detect one, two, three, four, or all of chlamydia, gonorrhea, syphilis, HPV,and HIV. Examples of such systems can be configured so that the detection multiple predetermined sexually transmitted diseases can be detected via the same detection mechanism having the different sensing probe pairs.

[0102] Exemplary methods and systems for screening and detecting sexually transmitted diseases may comprise collecting a sample (e.g., an RNA / DNA sample) from a subject. It is contemplated that the sample may be collected using any suitable means, including but not limited to, an oral swab, a nasal swab, a cervical swab, a blood collecting swab, urine collection, or any other suitable means for collecting nucleic acid from the subject. It is further contemplated that the sample may be collected using any suitable instrument, including but not limited to, a cotton swab or any other suitable instrument for collecting nucleic acid from the subject.

[0103] The collected sample may then be introduced to a sensing solution to form an aqueous mixture. The sensing solution may comprise a plurality of sensing probe pairs (e.g., targeting a plurality of different gene sequences, as described above). For example, the sensing solution may comprise a first sensing probe pair configured to target a first target gene sequence of a first sexually transmitted disease, a second sensing probe pair configured to target a second target gene sequence of a second sexually transmitted disease, a third sensing probe pair configured to target a third target gene sequence of a third sexually transmitted disease, a fourth sensing probe pair configured to target a fourth target gene sequence of a fourth sexually transmitted disease, a fifth sensing probe pair configured to target a fifth target gene sequence of a fifth sexually transmitted disease, etc. It is contemplated that when the collected sample comprises at least one of the target gene sequence corresponding to at least one of the sexually transmitted diseases of interest, the sensing probes may bind to their complementary target genesequences. However, when the collected sample does not comprise a target gene sequence, the sensing probes may not bind to the nucleic acid of the sample.

[0104] In some embodiments, the sensing solution may further comprise a nucleic acid extraction buffer configured to extract nucleic acids from the collected sample. In alternative embodiments, nucleic acids may not be extracted from the collected sample prior to detection of a target gene sequence. Extraction of nucleic acid and amplification of nucleic acid may be performed but are not requirements for using the absorbance-based system, thus allowing sensing of a target gene sequence directly from the collected sample.

[0105] After formation of the aqueous mixture, the mixture may be observed to determine the presence of at least one sexually transmitted disease. As described above, the presence of at least one sexually transmitted diseases may be determined by detecting an aggregation or agglomeration of nanoparticles.

[0106] In some embodiments, the aqueous mixture may be incubated prior to observation to determine the presence of at least one sexually transmitted diseases. Incubation may include maintaining the aqueous mixture for a period of time under predetermined conditions. For example, the aqueous mixture may be incubated for at least 5 minutes at or near room temperature.

[0107] An aggregation of nanoparticles may be confirmed using various techniques. For example, in one embodiment, aggregation of nanoparticles may be confirmed by a change in optical properties, such as surface plasmon resonance. In one embodiment, the nanoparticles may be confirmed from the comparative increase in absorbance at particular wavelengths (e.g., 523 nm or 630 nm) or from a wavelength shift from a first wavelength to a second wavelength (e.g., 523 nm to 630 nm). In one embodiment, aggregation of nanoparticles may be confirmed fromincrease in hydrodynamic diameter of the nanoparticles. In one embodiment, aggregation of nanoparticles may be confirmed from increase in average size of aggregated nanoparticles, as measured by transmission electron microscopy (TEM).

[0108] In one embodiment, the aggregation of nanoparticles may be observed by a visible color change in the aqueous mixture, wherein a negative test (e.g., a sample with no sexually transmitted diseases of interest) may result in a first color or colorless solution (e.g. a clear solution) and a positive test (e.g., a sample with at least one sexually transmitted disease of interest) may result in a second color or colored solution (e.g. a green color, red color, blue color, yellow color, etc.). It is contemplated that a visible color change may occur because of a plasmonic effect of the nanoparticles. In particular, the aggregation of nanoparticles may lead to larger size aggregates and lead to a shift in their surface plasmon resonance, which ultimately effectuates a color change of the solution.

[0109] In embodiments in which different diseases can be detected via the same platform having the different sensing probes, embodiments can identify the different detected disease via different colors, so each disease is indicated via a different respective color, or a colored indication appearing in a pre-selected location associated with each disease.

[0110] As can be appreciated by the above, the absorbance-based system may be configured to detect the presence of at least one of various sexually transmitted diseases in a collected sample. The system may therefore serve as a one step, simultaneous detection method for various sexually transmitted diseases in a POC setting. Some embodiments can permit one step, simultaneous detection method for various sexually transmitted diseases in a POC setting so that a single collected sample can be evaluated for multiple different diseases at the same time.

[0111] As there is an ongoing and immediate need to develop approaches that are lowcost, rapid, do not require the use of advanced equipment, and can be used as a screening tool for the diagnosis of sexually transmitted diseases at POC, it is contemplated that embodiments described herein may provide one or more advantages over currently available screening and detecting techniques. For example, embodiments described herein: (i) do not need prior RNA extraction; (ii) do not demand the use of advanced equipment (e g., centrifuge, thermocycler, etc.); (iii) do not use conventional pH sensitive dyes; and / or (iv) has a short turnaround time.Lateral Flow-Based Assay

[0112] Embodiments may relate to a lateral flow system and method configured to receive and analyze a sample to determine if the sample comprises at least one target gene sequence related to at least one sexually transmitted disease of interest. The lateral flow system and method can be used as a point-of-care (POC) test, for example as a rapid lab test, for screening and detection of sexually transmitted diseases.

[0113] As seen in FIG. 2, lateral flow system 200 may comprise a testing strip 202. The testing strip 202 may comprise a sample application region 204, a testing region 206, and control region 208. It is contemplated that a sample collected from a subject, or a solution comprising a sample collected from a subject, may be placed on or at the sample application region 204 and flow through the testing strip 202 (e.g., across the length of the testing strip 202) thereafter. The sample application region 204 may therefore be designated as the beginning of the test strip 202. It is contemplated that the testing region 206 may be positioned in between the sample application region 204 and the control region 208 such that the sample may flow from the sample application region 204, then to the testing region 206, then to the control region 208.

[0114] In exemplary embodiments, the lateral flow system 200 may further comprise sensing probes. In particular, anti-sense oligonucleotides may be configured as sensing probes to detect one or more sexually transmitted diseases present in the sample. The ASOs are singlestranded DNA (ssDNA) probes designed specifically to bind in complementary fashion to a target gene sequence of a sexually transmitted disease of interest. It is contemplated that the terms anti-sense oligonucleotides, single-stranded DNA, and sensing probes may be used interchangeably herein.

[0115] The sensing probes may be functionalized at either their first ends (5’ ends) or their second ends (3’ ends) with a small molecule. In some embodiments, the sensing probes may be functionalized with a moiety at either their first end or second end such that their first end or their second end may then bind to a small molecule. In some embodiments, the sensing probes are functionalized with an amine (-NH2) moiety or a thiol (-SH) moiety at either their first end or their second end, and the amine moiety or thiol moiety may then be used to couple to a small molecule. As the small molecules are bound to the sensing probes, when the sensing probes bind to their target gene sequences, the small molecules are also necessarily present at the target gene sequences.

[0116] In some embodiments, the sensing probes may be functionalized at their first ends with first small molecules. In preferred embodiments, the first small molecule may be biotin, 6- carboxyfluorescein (6-FAM) , fluorescein isothiocyanate (FITC), digoxigenin (DIG), nanoparticles (e.g., plasmonic nanoparticles), or any other suitable small molecule.

[0117] In some embodiments, the sensing probes may be functionalized at their second ends with second small molecules. In preferred embodiments, the second small molecule may bebiotin, 6-carboxyfluorescein (6-FAM) , fluorescein isothiocyanate (FITC), digoxigenin (DIG), nanoparticles (e.g., plasmonic nanoparticles), or any other suitable small molecule.

[0118] In exemplary embodiments, sensing probes may be chosen in pairs and may be configured to bind to two closely spaced regions of a target gene sequence. It is contemplated that each sensing probe of a pair may be differentially functionalized (e.g., the first sensing probe functionalized at its first end and the second sensing probe functionalized at its second end) such that the functionalized ends of each sensing probe are in close proximity to each other when the sensing probes are bound to their respective regions of the target gene sequence. For example, a first sensing probe functionalized at its first end may be complementary of a first region of a target gene sequence, and a second sensing probe functionalized at its second end may be complementary of a second region of a target gene sequence that is in close proximity to the first region. It is contemplated that sensing probe pairs may ensure that screening and detection will not fail even if one region of a target gene sequence undergoes mutation. It is contemplated that the sensing probes may be designed to target gene sequences that are less prone to mutation and / or antibiotic resistance. In some embodiments, the sensing probes may be designed to target cryptic plasmid and / or chromosomal DNA of a sexually transmitted disease, which may be conserved among different strains of a sexually transmitted disease and less prone to antibiotic resistance. By targeting conserved regions, sensing probes may be used universally for diagnostic purposes, ensuring consistent and reliable results regardless of genetic variations among strains.

[0119] In some embodiments, the lateral flow system 200 may comprise any number of sensing probe pairs. The system may comprise at least a first sensing probe pair configured to complement and bind to a first target gene sequence, a second sensing probe pair configured tocomplement and bind to a second target gene sequence, a third sensing probe pair configured to complement and bind to a third target gene sequence, a fourth sensing probe pair configured to complement and bind to a fourth target gene sequence, a fifth sensing probe pair configured to complement and bind to a fifth target gene sequence, etc. It is contemplated that the different target gene sequences described above may correspond to different gene sequences of the same sexually transmitted disease. It is further contemplated that the different target gene sequences described above may correspond to gene sequences of different sexually transmitted diseases. For example, the first target gene sequence may correspond to a first sexually transmitted disease, the second target gene sequence may correspond to a second sexually transmitted disease, the third target gene sequence may correspond to a third sexually transmitted disease, the fourth target gene sequence may correspond to a fourth sexually transmitted disease, the fifth target gene sequence may correspond to a fifth sexually transmitted disease, etc. Accordingly, a single lateral flow system 200 may be used for screening and detection of different sexually transmitted diseases.

[0120] It is contemplated that the lateral flow system 200 may be configured to detect one or more sexually transmitted diseases, including but not limited to, chlamydia, gonorrhea, syphilis, human papillomavirus (HPV), and human immunodeficiency virus (HIV). Accordingly, the lateral flow system 200 may comprise sensing probes configured to complement and bind to a target gene sequence corresponding to chlamydia, and / or sensing probes configured to complement and bind to a target gene sequence corresponding to gonorrhea, and / or sensing probes configured to complement and bind to a target gene sequence corresponding to syphilis, and / or sensing probes configured to complement and bind to a target gene sequencecorresponding to HPV, and / or sensing probes configured to complement and bind to a target gene sequence corresponding to HIV.

[0121] In some embodiments, the lateral flow system 200 is configured to detect the presence of one or both of two predetermined sexually transmitted diseases. For example, the lateral flow system 200 may be configured to detect at least one or both of chlamydia and gonorrhea, one or both of chlamydia and syphilis, one or both of chlamydia and HPV, one or both of chlamydia and HIV, one or both of gonorrhea and syphilis, one or both of gonorrhea and HPV, one or both of gonorrhea and HIV, one or both of syphilis and HPV, one or both of syphilis and HIV, or one or both of HPV and HIV. Examples of such systems can be configured so that the detection of multiple predetermined sexually transmitted diseases can be detected via the same detection system having different sensing probe pairs.

[0122] In some embodiments, the lateral flow system 200 is configured to detect the presence of one, two, or all of three predetermined sexually transmitted diseases. For example, the lateral flow system 200 may be configured to detect one, two, or all of chlamydia, gonorrhea, and syphilis, one, two, or all of chlamydia, gonorrhea, and HPV, one, two, or all of chlamydia, gonorrhea, and HIV, one, two, or all of chlamydia, syphilis, and HPV, one, two, or all of chlamydia, syphilis, and HIV, one, two, or all of chlamydia, HPV, and HIV, one, two, or all of gonorrhea, syphilis, and HPV, one, two, or all of gonorrhea, syphilis, and HIV, one, two, or all of gonorrhea, HPV, and HIV, or one, two, or all of syphilis, HPV, and HIV. Examples of such systems can be configured so that the detection of multiple predetermined sexually transmitted diseases can be detected via the same detection system having different sensing probe pairs.

[0123] In some embodiments, the system is configured to detect the presence of one, two, three, or all of four predetermined sexually transmitted diseases. For example, the system may beconfigured to detect at least one, two, three, or all of chlamydia, gonorrhea, syphilis, and HPV, one, two, three, or all of chlamydia, gonorrhea, syphilis, and HIV, one, two, three, or all of chlamydia, syphilis, HPV, and HIV, one, two, three, or all of chlamydia, syphilis, HPV, and HIV, or one, two, three, or all of gonorrhea, syphilis, HPV, and HIV. Examples of such systems can be configured so that the detection of multiple predetermined sexually transmitted diseases can be detected via the same detection system having different sensing probe pairs.

[0124] In some embodiments, the system is configured to detect the presence of one, two, three, four, or all of five predetermined sexually transmitted diseases. For example, the system may be configured to detect one, two, three, four, or all of chlamydia, gonorrhea, syphilis, HPV, and HIV. Examples of such systems can be configured so that the detection of multiple predetermined sexually transmitted diseases can be detected via the same detection mechanism having the different sensing probe pairs.

[0125] Exemplary methods and systems for screening and detecting sexually transmitted diseases may comprise collecting a sample (e.g., an RNA / DNA sample) from a subject. It is contemplated that the sample may be collected using any suitable means, including but not limited to, an oral swab, a nasal swab, a cervical swab, a blood collecting swab, urine collection, or any other suitable means for collecting nucleic acid from the subject. It is further contemplated that the sample may be collected using any suitable instrument, including but not limited to, a cotton swab or any other suitable instrument for collecting nucleic acid from the subject.

[0126] The collected sample may then be introduced to a sensing solution to form an aqueous mixture. The sensing solution may comprise a plurality of sensing probe pairs (e.g., targeting a plurality of different gene sequences, as described above). For example, the sensingsolution may comprise a first sensing probe pair configured to target a first target gene sequence of a first sexually transmitted disease, a second sensing probe pair configured to target a second target gene sequence of a second sexually transmitted disease, a third sensing probe pair configured to target a third target gene sequence of a third sexually transmitted disease, a fourth sensing probe pair configured to target a fourth target gene sequence of a fourth sexually transmitted disease, a fifth sensing probe pair configured to target a fifth target gene sequence of a fifth sexually transmitted disease, etc. It is contemplated that when the collected sample comprises at least one of the target gene sequence corresponding to a sexually transmitted disease of interest, the sensing probes may bind to their complementary target gene sequences. However, when the collected sample does not comprise a target gene sequence, the sensing probes may not bind to the nucleic acid of the sample.

[0127] In some embodiments, the sensing solution may further comprise a nucleic acid extraction buffer configured to extract nucleic acids from the collected sample. In alternative embodiments, nucleic acids may not be extracted from the collected sample prior to detection of a target gene sequence. Extraction of nucleic acid and amplification of nucleic acid may be performed but are not requirements for using the lateral flow system, thus allowing sensing of a target gene sequence directly from the collected sample.[00128J In some embodiments, the aqueous mixture may be incubated prior to application to the testing strip 202. Incubation may include maintaining the aqueous mixture for a period of time under predetermined conditions. For example, the aqueous mixture may be incubated for at least 5 minutes at or near room temperature.

[0129] After formation of the aqueous mixture, the aqueous mixture may be placed at or near the sample application region 204. The aqueous mixture may then flow via capillary actionthrough the test strip 202 in a flow direction and towards the testing and control regions 206,208. The speed of the flow may be affected by a number of factors, such as the types, quality and size of the flow strip used.

[0130] The testing region 206 may comprise first capture compounds. The first capture compounds may be immobilized at the testing region 206 such that the first capture compounds may not flow with the aqueous mixture as it flows through the testing strip 202. The first capture compounds are configured to capture the first small molecules functionalized on the sensing probes. Accordingly, in embodiments wherein the aqueous mixture has target gene sequences and sensing probes coupled to the target gene sequences, the first capture compounds may bind to the first small molecules / sensing probes, thereby immobilizing the sensing probes at the testing region 206.

[0131] For example, in embodiments wherein the first small molecule is biotin, the first capture compounds may be streptavidin.

[0132] The testing strip 202 may further comprise nanoparticles temporarily immobilized on the testing strip 202. The nanoparticles may only mobilize / flow as the aqueous mixture flows through the testing strip 202. For example, the nanoparticles may be dehydrated on the testing strip 202 and may only mobilize / flow after being rehydrated by the aqueous mixture.

[0133] The nanoparticles may be configured to couple to the second small molecules of the sensing probe pairs. As the sensing probes may be immobilized by the first capture compounds at the testing region 206, it is contemplated that at least some of the nanoparticles may also be immobilized at the testing region 206. It is further contemplated that at least some of the nanoparticles may not bind to the sensing probes and flow with the aqueous mixture as it flows through the testing strip 202 past the testing region 206 (e.g., towards the control region208). In embodiments wherein the aqueous mixture does not have target gene sequences, the nanoparticles may flow freely with the aqueous mixture as it flows through the testing strip 202 past the testing region 206 (e.g., towards the control region 208).

[0134] The nanoparticles may further be configured to effectuate a color change when reacted and immobilized at a region. In some embodiments, when the nanoparticles are immobilized at testing region 206 due to the presence of a target gene sequence in the sample, the nanoparticles may effectuate a color change at the testing region 206. In some embodiments, the color change may appear as a visible line or mark at the testing region 206. It is therefore contemplated that the presence of a line or mark at the testing region 206 signals the presence of at least one sexually transmitted disease of interest in the sample. However, no line or mark at the testing region 206 signals the absence of all sexually transmitted diseases of interest in the sample.

[0135] In order to couple to the second small molecules, it is contemplated that the nanoparticles may be bound to second capture compounds. The second capture compounds are configured to capture the second small molecules functionalized on the sensing probes and thereby effectuate the nanoparticles coupling to the second small molecules. For example, in embodiments wherein the second small molecule is FAM, the second capture compounds may be anti-FAM antibodies.

[0136] The control region 208 may comprise third capture compounds. The third capture compounds may be immobilized at the control region 208 such that the third capture compounds may not flow with the aqueous mixture as it flows through the testing strip 202. The third capture compounds are configured to capture the nanoparticles flowing through the testing strip 202. As described above, in embodiments wherein the aqueous mixture has target gene sequences andsensing probes coupled to the target gene sequences, at least some of the nanoparticles may nevertheless not bind to the sensing probes and flow with the aqueous mixture as it flows through the testing strip 202 past the testing region 206. These remaining nanoparticles may be captured by the third capture compounds and be immobilized at the control region 208.Similarly, in embodiments wherein the aqueous mixture does not have target gene sequences, the nanoparticles may flow with the aqueous mixture as it flows through the testing strip 202 and may be captured by the third capture compounds and immobilized at the control region 208.

[0137] It is contemplated that the second small molecule and the third capture compounds may be the same or substantially similar molecule / compound, as each of these components are configured to couple to the nanoparticles.

[0138] As the nanoparticles may be configured to effectuate a color change when reacted and immobilized at a region, when the nanoparticles are immobilized at the control region 208, the nanoparticles may effectuate a color change at the control region 208. In some embodiments, the color change may appear as a visible line or mark at the control region 208. It is contemplated that all proper tests and samples should result in a line or mark at the control region 208, such that the control region 208 ensures the system 100 is working properly.

[0139] As seen in FIG. 2, a negative test (e.g., a sample with no sexually transmitted diseases of interest) may result in a line or mark only at the control region 208 (designated by a “C”). However, a positive test (e.g., a sample with at least one sexually transmitted disease of interest) may result in both a line or mark at the testing region 206 (designated by a “T”) and a line or mark only at the control region 208.

[0140] As can be appreciated by the above, the lateral flow system 200 may be configured to detect the presence of at least one of various sexually transmitted diseases in acollected sample. The lateral flow system 200 may therefore serve as a one step, simultaneous detection method for various sexually transmitted diseases in a POC setting.

[0141] As there is an ongoing and immediate need to develop approaches that are low- cost, rapid, do not require the use of advanced equipment, and can be used as a screening tool for the diagnosis of sexually transmitted diseases at POC, it is contemplated that embodiments described herein may provide one or more advantages over currently available screening and detecting techniques. For example, embodiments described herein: (i) do not need prior RNA extraction; (ii) do not demand the use of advanced equipment (e.g., centrifuge, thermocycler, etc.); (iii) do not use conventional pH sensitive dyes; and / or (iv) has a short turnaround time. In some embodiments, the presently described system provides for rapid turnaround time for detection of at least one sexually transmitted disease. The detection of a sexually transmitted disease of interest may be performed within about 5, 10, 15, 20, 25, or 30 minutes. In one embodiment, detection may be completed within about 10 minutes.Sexually Transmited Diseases and Design of Sensing Probes

[0142] Embodiments may be configured to detect one or more sexually transmitted diseases, including but not limited to, chlamydia, gonorrhea, syphilis, HPV, and HIV. In particular, embodiments of both the absorbance-based assay and the lateral flow-based assay may utilize sensing probes to detect the presence one or more sexually transmitted diseases present in the sample. The sensing probes are designed specifically to bind in complementary fashion to a target gene sequence of a sexually transmitted disease of interest.

[0143] To detect chlamydia, at least one target gene sequence correlating to chlamydia must first be identified such that sensing probes can be designed to complement and bind to the sequence. In some embodiments, a target gene sequence correlating to chlamydia may be chosenfrom SEQ ID NO 1 (CCAAGAGCAGCGCCUACAAC) and SEQ ID NO 2 (UCAACCUGCCCAACCAGACC). It is contemplated that SEQ ID NO 1 and SEQ ID NO 2 represent two closely spaced apart regions of a target sequence. It is contemplated that these sequences may correlate to the ORF6 / pgp4 (from the plasmid) gene which is not responsible for antibiotic resistance and remains conserved across the strains of chlamydia. Apart from the highly conserved chromosome (>98% of similarity among strains), it is contemplated that chlamydia harbors a plasmid that is also highly conserved among strains and possesses eight open reading frames (ORFs 1-8) known to be transcribed and translated. It is further contemplated that ORF6 may be advantageous over other ORFs for chlamydia because ORF6 / pgp4 (transcriptional regulator 68 of virulence associated genes) may present the highest mean expression among all chlamydia strains.

[0144] ASOs may then be designed to bind in complementary fashion to target gene sequences of chlamydia. In some embodiments, ASOs may have sequences chosen from a sequence complementary to and configured to bind to SEQ ID NO 1, and a sequence complementary to and configured to bind to SEQ ID NO 2.

[0145] To detect gonorrhea, at least one target gene sequence correlating to gonorrhea must first be identified such that sensing probes can be designed to complement and bind to the sequence. In some embodiments, a target gene sequence correlating to gonorrhea may be chosen from SEQ ID NO 3 (CGGCGAAGGCACCAAAAAAA) and SEQ ID NO 4 (ACCAAGUCUACAGCAUCCCG). It is contemplated that SEQ ID NO 3 and SEQ ID NO 4 represent two closely spaced apart regions of a target sequence. It is contemplated that these sequences may have critical antimicrobial resistance. In addition to its function as an outer membrane pore, the major outer membrane porin (PorB) expressed gonorrhea may play multipleessential roles during infection and its associated microbial resistance. Besides being the most prevalent protein on the outer membrane, PorB of gonorrhea is responsible to increase attachment, is then transported to the mitochondria of the host cell, and reduces the capacity of phagocytes to eradicate the bacterium. Resisting the effects of complement factors, controlling apoptosis, invading host cells, and involvement in antimicrobial resistance are further significant traits of porB. Hence, to detect gonorrhea strain, chromosomal proteome of major outer membrane protein may be targeted. Cryptic plasmid may also be utilized as a target gene sequence for gonorrhea.

[0146] ASOs may then be designed to bind in complementary fashion to target gene sequences of gonorrhea. In some embodiments, ASOs may have sequences chosen from a sequence complementary to and configured to bind to SEQ ID NO 3, and a sequence complementary to and configured to bind to SEQ ID NO 4.

[0147] To detect HPV, at least one target gene sequence correlating to HPV must first be identified such that sensing probes can be designed to complement and bind to the sequence. In some embodiments, a target gene sequence correlating to HPV may be chosen from SEQ ID NO 5 (UACUACAAGCAGGAUUGAAG) and SEQ ID NO 6 (AAACGAAAAGCUACACCCAC). It is contemplated that SEQ ID NO 5 and SEQ ID NO 6 represent two closely spaced apart regions of a target sequence.

[0148] ASOs may then be designed to bind in complementary fashion to target gene sequences of HPV. In some embodiments, ASOs may have sequences chosen from a sequence complementary to and configured to bind to SEQ ID NO 5, and a sequence complementary to and configured to bind to SEQ ID NO 6.

[0149] To detect HIV, at least one target gene sequence correlating to HIV must first be identified such that sensing probes can be designed to complement and bind to the sequence. In some embodiments, a target gene sequence correlating to HIV may be chosen from SEQ ID NO 7 (AGACCCAACAACAAUACAAG) and SEQ ID NO 8 (AGAGGACCAGGGAGAGCAUU). It is contemplated that SEQ ID NO 7 and SEQ ID NO 8 represent two closely spaced apart regions of a target sequence.

[0150] ASOs may then be designed to bind in complementary fashion to target gene sequences of HIV. In some embodiments, ASOs may have sequences chosen from a sequence complementary to and configured to bind to SEQ ID NO 7, and a sequence complementary to and configured to bind to SEQ ID NO 8.

[0151] To detect syphilis, at least one target gene sequence correlating to syphilis must first be identified such that sensing probes can be designed to complement and bind to the sequence. In some embodiments, a target gene sequence correlating to syphilis may be chosen from SEQ ID NO 9 (TCCGCTACGACTACTACGGT), SEQ ID NO 10 (GAGACTCTGATGGATGCTGC), SEQ ID NO 11 (CACCTATGCGCTATACAAAA), SEQ ID NO 12 (GAGCTACCTATCTAACCAAG), SEQ ID NO 13(TCTTCTCAATGCATTTCGAC), and SEQ ID NO 14 (TCTATAGACGATTTACAACC). It is contemplated that SEQ ID NO 9 and SEQ ID NO 10 represent two closely spaced apart regions of a target sequence, SEQ ID NO 11 and SEQ ID NO 12 represent two closely spaced apart regions of a target sequence, and SEQ ID NO 13 and SEQ ID NO 14 represent two closely spaced apart regions of a target sequence.

[0152] ASOs may then be designed to bind in complementary fashion to target gene sequences of HPV. In some embodiments, ASOs may have sequences chosen from a sequencecomplementary to and configured to bind to SEQ ID NO 9, a sequence complementary to and configured to bind to SEQ ID NO 10, a sequence complementary to and configured to bind to SEQ ID NO 11, a sequence complementary to and configured to bind to SEQ ID NO 12, a sequence complementary to and configured to bind to SEQ ID NO 13, and a sequence complementary to and configured to bind to SEQ ID NO 14.EXAMPLES

[0153] Below are examples of specific embodiments for carrying out the present invention. The examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), but some experimental error and deviation should, of course, be allowed for.

[0154] EXAMPLE 1 : Design and Synthesis of Gold Nanoparticles Capped with Designed Oligonucleotides

[0155] In the present study, we designed four sensing probes for chlamydia (or CT) (1 pair of sensing probes targeting ompA gene and another pair of sensing probes targeting ORF6 gene) and a total of fourteen sensing probes for gonorrhea (or NG) (4 pairs of sensing probes each targeting major outer membrane protein and 3 pairs of sensing probes each targeting cryptic plasmid). These sensing probes were then differentially functionalized with thiol moiety. While the first probe of each pair was functionalized at the 5' end, the other probe from that pair was functionalized at the 3' end to increase their propensity of agglomeration in presence of their target gene (see FIG. 1). These differentially functionalized sensing probes were then used to cap standard citrate stabilized gold nanoparticles prepared from chloroauric acid and sodium citrate.The formation of the ssDNA-conjugated AuNPs were confirmed using various characterizationtools such as UV-visible absorbance spectroscopy (UV-Vis), transmission electron microscopy (TEM), and nuclear magnetic resonance spectroscopy (NMR). TEM images showed that the sensing probes are individually dispersed with no visible aggregation (FIG. 5). FIG. 6 shows the average hydrodynamic sizes of the individual sensing probes, which were found to be < 32 nm. Additionally, the surface plasmon bands of the sensing probes (A^ax at 523 nm) confirmed their formation (FIG. 7). The UV-Vis band at 523 nm demonstrated that the nanoparticles maintained their properties after the conjugation process. NMR spectroscopy, on the other hand, showed the presence of aromatic protons, corresponding to guanosine and adenosine, in the sensing probes proving the successful conjugation of thiolated ASOs on the nanoparticle surface (FIGS. 8-9). The sensing probes were further characterized with Raman spectroscopy. FIG. 10 shows the Raman spectrum obtained from a fresh batch of sensing probes. The peak around 1380 cm'1may be assigned to the aromatic ring stretching modes, while the other intense peak at -1580 cm1can be assigned to the C=O stretching mode of both the carbonyls present in the structure and to the aromatic ring stretching vibrations of the nucleotides. It is contemplated that these peaks are the combined features coming from different nitrogenous bases present in the ssDNA sequences where the major contributions may come from adenine and guanine, less significantly from thymine and the cytosine features may probably be hidden by the other (overall) signals.[00156J EXAMPLE 2: Standardization of ssDNA Capped Gold Nanoparticles for Selective and Sensitive Detection of CT and NG

[0157] Once the formation of ssDNA-conjugated thiol stabilized AuNPs were confirmed, a variety of parameters were optimized for sensitive and selective detection of CT and NG. To determine the ideal sensing probe pairs, DNA extracted from deidentified cervical swab samples was first utilized as the input target sequence.

[0158] In the case of CT, SSDNAI+2, SSDNA3+4, and ssDNAi+2+3+4 pairs capped with gold nanoparticles at 0.5 pM of ssDNA concentration individually were utilized to determine the relative sensitivity toward the target CT DNA sequence. The relative increase in absorbance at 523 nm was monitored, and it was observed that the ssDNAi+2 (targeting ORF 6) showed the maximum sensitivity towards the CT DNA among the three pairs (FIG. 11). This confirms that the ssDNAs targeting cryptic plasmid ORF6 gene of CT has the optimal sensitivity behind its detection.

[0159] In the case of NG, ssDNAi+2, SSDNA3+4, ssDNAs+6, and ssDNA?+s pairs capped with gold nanoparticles at 0.5 pM of ssDNA concentration were utilized to determine the relative sensitivity toward the target NG DNA sequence. The relative increase in absorbance at 523 nm was monitored; however, none of the ssDNA sequences showed optimum sensitivity towards NG DNA (FIG. 12). Subsequently, we predicted another set of ssDNA sequences targeting the same genetic segment but at a different location. Among the new set of ssDNA sequences it was observed that ssDNAn+12 showed the maximum sensitivity towards the extracted NG DNA sequences (FIG. 13). This proves that the ssDNAs targeting major outer membrane protein of NG having the nucleotide gap of 13 between the pairs has the optimal sensitivity behind the NG detection.

[0160] Further to determine the optimum concentration of ssDNA conjugated to the AuNPs which may provide maximal sensitivity, the experiment with CT targeted ssDNAi+2 conjugated AuNPs was performed where the added ssDNA concentration was 0.2, 0.5 and 1 pM respectively. Two CT positive, negative and CT+NG positive samples were added to the suspensions and it was observed that the 0.5 pM concentration of ssDNAs showed the maximum sensitivity for both CT and NG (FIG. 14).

[0161] As the current sensing principle lies in the hybridization of the complementaryDNA sequences of ssDNA probes and bacterial DNA, the assay performance will be highly temperature dependent. Hence, to determine an optimum temperature for the assay, the ssDNA conjugated AuNPs were mixed their respective target DNAs and incubated either at room temperature (~23 °C), 37 °C or 65 °C before measuring their change in plasmon response (absorbance). It was observed that 37 °C may be the optimum temperature for CT targeted assay as it was providing higher change in absorbance for all the four positive samples tested herein compared to the assay where the AuNPs were incubated at room temperature. Although we found a higher change in absorbance at 65 °C for the positive samples, the relative higher change in absorbance for negative sample at this temperature led us to choose 37 °C as the preferred assay temperature (FIG. 15). Similar is the case for NG targeted assay where 37 °C provided higher change in absorbance for all the four positive samples with minimal change for negative sample (FIG. 16) led us to establish 37 °C as optimum assay temperature. Unfolding of separate DNA strands with increase in temperature from 23 to 37 °C might have led to better complementary binding of ssDNA probes with their target DNAs. However, increasing the temperature beyond an optimum value increased the non-specificity of the ssDNA probes. [001621 EXAMPLE 3 : Chlamydia and Gonorrhea Detection from Anonymized Clinical Samples

[0163] A commercially available kit was utilized to extract DNA from deidentified cervical swab and urine samples as the input target sequence. We analyzed 60 samples (including both urine and cervical swab samples) out of which 15 were CT positive, 15 were both NG and CT positive, 15 were NG positive and 15 were both CT and NG negative. The positivity of the samples was validated using gold standard quantitative polymerase chainreaction (qPCR) and native agarose gel electrophoresis. It was presumed that the absorbance of AuNPs will remain intact in absence of target DNA samples, however, it will be increased or shifted largely from 523 nm in presence of the target CT / NG DNA. The agglomeration of ssDNA-capped AuNPs in the presence of bacterial DNA was further studied by Raman spectroscopy, UV-visible absorbance spectroscopy (UV-Vis) and transmission electron microscopic (TEM) studies. As expected, AuNPs capped with ssDNAs agglomerated in presence of respective DNAs from CT positive, both CT+NG positive, and NG positive samples whereas no agglomeration was observed for both CT+NG negative samples under TEM (FIGS. 17-18). In absence of target DNA, well distributed pattern of AuNPs was observed (FIG. 18), while in presence of target CT / NG DNA, the AuNPs were found to be largely aggregated (FIG. 18). Moreover, the average hydrodynamic diameter of the ssDNA capped AuNPs increased largely with the addition of its target CT / NG DNA (FIG. 6). In absence of target CT / NG DNA, the AuNPs remain separated from each other. Due to this agglomeration of AuNPs in presence of target CT / NG DNA, either a bathochromic shift in absorbance from 523 nm to 630 nm or an increase in absorbance at 630 nm was observed (FIGS. 19A-19D). This is to be noted that when we added extracted DNA samples to the AuNP suspension, there is only increase in absorbance at 523 nm with minimal change in absorbance at 630 nm. However, the change in absorbance at 630 nm becomes prominent when the AuNP suspension was added with direct clinical samples in presence of enzymatic extraction buffer. Hence, for FIGS. 19A-19D, where we used direct samples to monitor the changes in absorbance, we followed the UV-Visible absorption at 630 nm. The possible reasoning behind this might lie in the increase in diameter of gold nanoparticles in presence of target DNA which introduced dramatic and continuous increase in the extinction co-efficient of the AuNPs leading to the increase in absorbance at 523 nm. However, with theaddition of direct samples, the presence of enzymatic extraction buffer, led to further agglomeration among the AuNPs in presence of target CT / NG DNA, leading to their shift in absorbance from 523 to 630 nm and an increase in absorbance at 630 nm (FIGS. 19A-19D). Both of this bathochromic shift and increase in absorbance at 630 nm is indicative of the formation of larger size gold nanoparticles only in presence of their respective target gene. Thus, UV-Visible spectroscopy corroborated the observation obtained from TEM. Further, when the ssDNA conjugated AuNPs were investigated under Raman spectroscopy, we found a red shift in the intense Raman band at 1580 cm'1in presence of their target gene only. However, there was no shift in Raman peak when a non-specific DNA segment (i.e., negative sample) was added to the ssDNA conjugated AuNPs. The phenomena were found to be valid both for CT and NG (FIG. 6) DNAs. This indicates successful hybridization between the target CT / NG DNA and their complementary ssDNAs. It may further be concluded that during hybridization event, the complementary nucleotides bind with each other via hydrogen bonding where carbonyl (C=O) stretching frequency participated the most and hence we can observe a distinct red shift in the intense Raman peak at 1580 cm'1by ~20 cm'1.

[0164] FIG. 20 shows the confusion matrix of the tested clinical samples (using CT targeted AuNP-ssDNAs) while the test results were benchmarked in the laboratory with the gold standard polymerase chain reaction (PCR) and quantitaive polymerase chain reaction (qPCR). The PCR results were also validated using native agarose gel electrophoresis (FIGS. 21-22). As mentioned above, a total number of 60 deidentified clinical samples have been tested using our platform, of which 29 were confirmed CT positive and 30 were confirmed negative cases. There was one case where a qPCR-confirmed negative sample was misclassified as positive using our test (using CT targeted ssDNA). FIG. 20 shows the accuracy, sensitivity, and specificity of ourtest as 98.3%, 100% and 96.77% respectively. FIG. 20 also shows the normalized percentage changes, plotting the mean and standard deviation in absorbance at 630 nm for CT positive samples (CT+); both CT+NG positive samples (CT+NG+); NG positive samples (NG+) and both negative samples (CT-NG-). The percentage change in absorbance was found to be higher for CT positive samples and both CT and NG positive samples in comparison to the negative samples when tested with CT targeted ssDNA conjugated AuNPs. A one-way ANOVA statistical test was performed between the group to evaluate the assays response towards the various sample groups under investigation. The one-way ANOVA showed that the groups showed a response that was significantly different with p<0.0001 for CT+ and CT+ NG+ when compared to negative samples (CT- and NG-). However, the assay response was not significant in case of NG+ when compared to negative samples.

[0165] Similarly, a total number of 60 deidentified clinical samples were tested using NG targeted ssDNA conjugated AuNPs, of which 28 were confirmed as NG positive and 30 were confirmed as negative cases (FIG. 23). There were two cases where qPCR-confirmed negative samples were misclassified as positive using our test (using NG targeted ssDNAs). FIG. 23 shows the accuracy, sensitivity, and specificity of our test as 96.6%, 100% and 93.75% respectively. FIG. 23 also shows the normalized percentage change, plotting the mean and standard deviation in absorbance at 630 nm for NG positive samples (NG+), both CT and NG positive samples (CT+NG+), CT positive samples (CT+) and both negative samples (CT-NG-). As expected, the percentage change in absorbance was higher for NG positive samples and both CT+NG positive samples in comparison to negative samples. A one-way ANOVA statistical test was performed between the group to evaluate the assays response towards the various sample groups under investigation. The one-way ANOVA showed that the groups showed a responsethat was significantly different with p<0.0001 for NG+ and CT+ NG+ when compared to negative samples (CT- and NG-). However, the assay response was not significant in case of CT+ when compared to negative samples. Moreover, the assays to detect CT and NG were also performed separately so that there is no confusion to selectively detect the target bacteria.

[0166] EXAMPLE 4: Direct Detection of CT and NG from Cervical Swabs and Urine Samples

[0167] Generally, the nucleic acid-based detection of bacterial species involves the isolation and purification of DNA which consists of multiple tedious steps. An ideal POC assay would be the one where the DNA targeting can be achieved in an easy and rapid manners. Towards this, we used the enzymatic DNA / RNA extraction buffer from CHAI added directly to the source media to detect CT and NG from the infected samples without any added purification steps. We analyzed 40 de-identified samples (including both urine and cervical swab samples, N=10 each for CT+, NG+, both CT and NG+, both CT and NG- (as validated using gold standard qPCR). FIG. 24 shows the confusion matrix of the tested clinical samples (using CT targeted ssDNA-AuNPs) by benchmarking our test results to the gold standard qPCR. As indicated from the matrix, among the 40 deidentified clinical samples, 20 samples were confirmed CT positive and 20 were confirmed negative cases. The test also showed accuracy, sensitivity, and specificity of 100%, 100% and 100% respectively. FIG. 24 shows the normalized percentage changes, plotting the mean and standard deviation in absorbance at 630 nm for control water sample, CT+, both CT+ and NG+, NG+ and both CT- NG- samples. It was the percentage absorbance change was higher for CT+ and both CT+ NG+ sample but not for others when tested against CT targeted ssDNA-AuNPs. A one-way ANOVA statistical test was performed between the group to evaluate the assay response. The one-way ANOVA showed thatthe groups showed a response that was significantly different with p<0.0001 for CT+ and CT+ NG+ when compared to negative samples (CT- and NG-). However, the assay response was not significant with p = 0.0567 in case of NG+ when compared to negative samples. Similarly, FIG. 25 shows the confusion matrix of the tested clinical samples (using NG targeted ssDNA-AuNPs) by benchmarking our test results to the gold standard qPCR. FIG. 25 validated the test results against gold standard qPCR and revealed good agreement with accuracy, sensitivity, and specificity of 100%, 100% and 100% respectively. FIG. 25 shows the normalized percentage changes, plotting the mean and standard deviation in absorbance at 630 nm for control water sample, NG+, both CT+ and NG+, CT+ samples and both CT- and NG- samples. It was observed that the percentage absorbance change was higher for NG+ and both CT+ and NG+ samples but not for others when tested with NG targeted ssDNA conjugated AuNPs. A one-way ANOVA statistical test was performed between the group to evaluate the assay response. The one-way ANOVA showed that the groups showed a response that was significantly different with p<0.0001 for NG+ and p = 0.001 for CT+ NG+ when compared to negative samples (CT- and NG-). However, the assay response was not significant with p = 0.7348 in case of CT+ when compared to negative samples. Further, it was observed from the UV-Vis spectra that shift in absorbance to 630 nm from 523 nm was maximum for cervical swab samples compared to the urine samples (FIGS. 19A-19D). This may entail the comparative less aggregation of the AuNPs in urine samples compared to the cervical swab samples.

[0168] EXAMPLE 5: Sensitivity and Specificity of the Demonstrated Absorbance-Based CT / NG assay

[0169] Encouraged by the positive results obtained above, we then tested the cross interference of the assay using a specific concentration of DNA obtained from fresh bacterialcultures (measured at OD600) of Staphylococcus aureus, Acinetobacter baumannii, Escherichia coll, Bacillus subtilis and Streptococcus mutans. As shown in FIG. 26, the normalized absorbance changes at 630 nm indicated that the designed ssDNA-AuNP assay is highly selective towards their target sequence (either CT or NG). Therefore, the results demonstrated that the developed ssDNA-AuNP assay had little to no cross-reactivity with genetic material obtained from other infectious pathogens. Next, to establish the sensitivity, we utilized NG genomic DNA (ATCC 700825DQ) and determined the analytical limit of detection (LOD) of the developed assay for gonorrhea. Briefly, the assay was tested using the genomic DNA with serial 10-fold dilutions with concentrations ranging from 105copies / pL to 10 copies / mL as shown in FIG. 21. 10 pL of serially diluted sample was added to 200 pL of ssDNAn+n targeting NG. It was observed that the test provided a detectable signal even when the NG genomic DNA concentration was as low as 10 copies / pL. However, the normalized absorbance change was stable up to 100 copies / mL. To calculate the analytical limit of detection of the NG assay, we sy used the equation LOD = 3.3 * (— ). The LOD was determined to be 5 copies / pL. It is worthwhile to mention that the LOD was calculated for the final sample (DNA mixed with the ssDNA labeled AuNP). Similarly, for chlamydia, we utilized the CT genomic DNA (ATCC VR- 901BD) to calculate the LOD which was found to be 7 copies / pL (FIG. 22).

[0170] EXAMPLE 6: Lateral Flow Assay Based Detection of CT and NG

[0171] It is fundamentally necessary to develop a point-of-care diagnostic test with reasonable specificity and sensitivity, which can be implemented immediately without the need for any supporting equipment. Thus, to make the ssDNA-AuNP assay an effective POC assay, we used commercially available lateral flow strips (Nanocomposix) to develop a functionallateral flow assay (LFA) for CT / NG detection. As the study confirmed the targeting capabilities of the novel ssDNA probes and provided us confidence in the development of lateral flow assays, we were able to move forward with the design of lateral flow assay as we had previously done for SARS-CoV-2 Accordingly, we modified the 5'- end of one of the optimized ssDNAs with biotin and 3'- end of the other with 6-carboxyfluorescein (6-FAM) and included them directly in the lateral flow assay. For our assay, total DNA was isolated using CHAI enzymatic DNA / RNA extraction buffer. 10X buffer was used for swab samples, whereas IX buffer was used for urine samples. As a proof-of-concept experiment, we utilized the total DNA isolated from random clinical sample. The sample used in this experiment had a Ct value of 17 for NG and a Ct value of 24 for CT as determined using gold standard qPCR. Briefly, 10 pL of the isolated DNA sample (either CT or NG) was incubated separately with 10 pL AuNP-ssDNAn+12 (in case of NG) and AuNP-ssDNAi+2 (in case of CT) at 37 °C. The incubation ensures unfolding of target DNA and optimum hybridization with the ssDNA strands. The resuting mixture (20 pL) along with running buffer (105 pL) was then added to the lateral flow strip. The result is availabe after -10-15 minutes and can be read with the naked eyes. As the sample flows through the test strips, in the presence of the target DNA, FAM / biotin labeled ssDNA probes bind to their complementary target sequence for either CT or NG bacterial DNA. The test line (T) immobilized with streptavidin, captures this sandwich assembly having the biotin labeled ssDNA. The anti-FAM antibody coated gold nanoshells are then attracted by the FAM-labeled ssDNA leading to the formation of a faint red T line (FIG. 2). The control species antibody present at the control line (C) captures the remaining unreacted anti-FAM antibody-coated gold nanoparticles, which confirms that the lateral flow system is working properly. The LFA results are represented in FIG. 2. However, in absence of the target DNA, the labeled ssDNAs cannotbind to any target and hence the bridged assembly will not form. Consecutively, anti-FAM antibody-coated gold nano shells will not stay on the test line and cannot show any test band (FIG. 2). Thus, the developed platform can differentiate between CT / NG positive and negative samples without the need for any DNA extraction or amplification.

[0172] Methods

[0173] Materials. All the chemicals were purchased from reputable commercial vendors and used without any further purification steps. Custom-made oligonucleotides (ssDNAs) functionalized with thiol moieties either at 5’- or 3’- ends were purchased from Sigma Aldrich (Saint Louis, MO). Custom-made oligonucleotides (ssDNAs) functionalized with biotin and FAM were purchased from Integrated DNA Technologies (Coralville, IA). Polymerase chain reaction (PCR) primers were also obtained from Sigma Aldrich (Saint Louis, MO). PCR and qPCR reagents were obtained from New England Biolabs (Ipswich, MA) unless otherwise mentioned. Lysis Buffer and DNA isolation kit (Purelink Microbiome DNA Purification kit) were ordered from Invitrogen (Carlsbad, CA). One step enzymatic DNA / RNA extraction buffer IX and 10X was ordered from CHAI (Santa Clara, CA). AmpliDetect - Nucleic Acid Lateral Flow Assay (NALFA) strips were custom ordered from nanoComposix (San Diego, CA). De- identified Chlamydia trachomatis and Neisseria gonorrhoeae samples (cervical / vaginal swabs (women) and urine (men)) were obtained from Boca Biolistics (Pompano Beach, FL) and Carle Foundation Hospital (Urbana, IL). Genomic DNA was obtained from American Type Culture Collection (ATCC - Manassas, VA) . Quantitative Genomic DNA from Chlamydia trachomatis LGV Serovar I strain 440 VR-901BD and Quantitative Genomic DNA from Neisseria gonorrhoeae 700825DQ.

[0174] Design of single-stranded Oligonucleotides (ssDNA) and Polymerase ChainReaction (PCR) primers. The single stranded oligonucleotides were designed based on the previously described approach using the SOligo software. The primer sequences used for PCR along with their melting temperatures (Tm°) are listed below in Table 1TABLE 1

[0175] Citrate-stabilized Gold Nanoparticle Synthesis. The citrate capped AuNP were synthesized according to our previously reported protocol. Briefly, 8.5 mg of tetra chloroauric (III) acid trihydrate (HAuCL 3H2O) was dissolved in 95 mL of deionized (DI) water. The resultant mixture was then transferred to a 200 mL round bottom flask with a reflux condenser submerged in an oil bath and heated to boiling while being magnetically stirred. 5.0 mL of sodium citrate solution (1%, w / v) was then quickly added to the flask and the solution was kept boiling and stirring for 30 minutes until its color turned wine red. The solution was cooled, and the final product was kept at room temperature and in the dark for future use.

[0176] Functionalization of Nanoparticle with ssDNA. 2 mL of citrate stabilized AuNPs were taken and treated with ssDNAs at different concentrations (0.2 pM, 0.5 pM & 1.0 pM).Additionally, 0.5 mM of tris(2-carboxy ethyl) phosphine (TCEP) was added to the solution. The resulting mixture was magnetically stirred at room temperature for 2 hours. The ssDNA- AuNP solution was stored at 4 °C until further use.

[0177] Storage and Handling of De-identified Patient Samples. The de-identified clinical samples were obtained from Boca Biolistics and Carle Foundation Hospital. Permission was obtained from the Institutional Review Board (IRB) for safe handling of these contagious samples as noted in the IRB submission number HP-00094565. 60 de-identified clinical (15 Chlamydia positive, 15 Neisseria positive, 15 both Chlamydia and Neisseria positive and 15 negative) vaginal / cervical swabs, urine samples confirmed using qPCR. The samples were stored at - 80 °C until further use.

[0178] Bacterial Culture. A. baumannii and 5. aureus were cultured in Tryptic Soy broth overnight at 37°C under aerobic conditions with shaking at 200 rpm. E. coli was grown in Luria- Bertani (LB) broth at 37°C under aerobic conditions. S. mutans was cultured in a solution containing brain heart infusion (BHI).

[0179] DNA Isolation using a Commercial DNA Extraction Kit. Total DNA was isolated from the 60 de-identified clinical samples using the PureLink™ Microbiome DNA purification kit’s (Invitrogen, cat. no. A29790) manufacturer's protocol.

[0180] One-step Enzymatic DNA Extraction. Total DNA was extracted from 40 deidentified clinical (10 Chlamydia positive, 10 Neisseria positive, 10 both Chlamydia and Neisseria positive and 10 both Chlamydia and Neisseria negative) vaginal / cervical swabs, urine samples using CHAI enzymatic DNA / RNA extraction buffer. 10X buffer was used for swab samples, whereas IX buffer was used for urine samples. Briefly, 20 pL of enzymatic DNA buffer was added to 180 pL of the liquid sample. The resulting mixture was then completely mixed by vortexing for 15 seconds and then incubated at room temperature for 15 minutes. The sample was then further incubated at 98 °C for additional 5 minutes. The resulting solution wasanalyzed using Thermo Scientific™ NanoDrop™ OneC Microvolume UV-Vis Spectrophotometer for amount of total DNA present.

[0181] Protocols for PCR. The Polymerase Chain Reaction was setup as per manufacturer’s (NEB - Taq 2X Master Mix M0270) protocol. Briefly, 1 pL each of 10 pM of forward and reverse primers, 5 pL of isolated / extracted DNA, 25 pL of Taq 2X master mix and 18 pL of nuclease-free water were added to a PCR tube. All of the liquid was collected at the bottom of the tube following a gentle mixing of the reaction and a quick spin. The PCR tubes were then transferred to a Applied Biosystems™ MiniAmp™ Thermal Cycler with block preheated to 95 °C. The following thermocycling conditions shown in Table 2 were used to amplify the DNA. The amplified products obtained were stored at - 20 °C until further use.Table 2

[0182] Protocols for qPCR. The quantitative polymerase chain reaction (qPCR) was set up as per manufacturer’s (NEB - Luna Universal qPCR Master Mix Protocol M3OO3) protocol. Briefly, 0.5 pL each of 10 pM of forward and reverse primers, 2 pL of isolated / extracted DNA, 10 pL of Luna universal qPCR master mix and 7 pL of nuclease-free water were added to a 96- well PCR plate. All of the liquid was collected at the bottom of the well following a gentle mixing of the reaction and a quick spin. The PCR plate was then transferred to an Azure CieloqPCR System. The following thermocycling conditions shown in Table 3 were used to amplify the DNA.Table 3

[0183] Agarose Gel Electrophoresis. The amplified products from PCR were also analyzed using a 2% agarose gel. Briefly, 2 grams of agarose were added to IX TBE buffer and heated in a microwave. 5 pL of ethidium bromide was added to the resulting mixture and thoroughly mixed. The mixture was then added on to a cassette and allowed to be solidified. 100 bp DNA ladder; 1 kb DNA ladder and amplified products were then loaded into different lanes. The gel was run at 80 kV for 60 mins and imaged with Biorad GelDoc.

[0184] UV-Vis Spectroscopy . For absorbance measurement, 10 pL of DNA sample was mixed with 200 pL of AuNPs conjugated with SSDNAI+2 targeting CT and AuNPs conjugated with SSDNAH+12 targeting NG. The total DNA concentration was determined using Thermo Scientific™ NanoDrop™ OneC Microvolume UV-Vis Spectrophotometer. The absorbance spectra for the assay with 96-well plates were recorded on Biotek Synergy Neo2Microplate Reader both for end point, kinetic, and spectral analyses. Each of the experiments were repeated at least three times and an average of these spectra were presented. To standardize the assays, two of the samples from each category were selected randomly. The absorbance spectra were then normalized. The highest absorbance value was chosen for each spectrum, and then wedivided the absorbance values by that number. The normalized data was then compared to standardize the assay parameters, regardless of the details of the experiment.

[0185] Measurement of Hydrodynamic Diameter using Dynamic Light Scattering(DLS). The average hydrodynamic diameter of the gold nanoparticles functionalized with the antisense oligonucleotides before and after the addition of DNA were monitored on a Malvern Nano-S Zetasizer. The particles were diluted to an optimum extent before each measurement and multiplied by the dilution factor to obtain the results.

[0186] Transmission Electron Microscopy . A 20 pL solution of the nanoparticles before and after the addition of target DNA was added on top of a carbon-coated copper grid (400 mesh). This was allowed to stay for about 10 minutes before being removed with a filter paper and imaged under a transmission electron microscope (FEI tecnai T12). The tungsten filament with 80 kV accelerating voltage was used for the investigations.

[0187] Raman Spectroscopy . Raman spectra were recorded with an inVia confocal Raman microscope (Renishaw) at a laser excitation wavelength of 532 nm (power 1%, grating 1200 1 / nm). A 50X objective lens was used for data collection with Raman shift ranging from 500 to 1800 cm'1. All the spectra were obtained by averaging at least 10 individual spectra obtained with an exposure time of 10 seconds. Renishaw 51P859 detector was used for these experiments.

[0188] Nuclear Magnetic Resonance Spectroscopy . TheJH NMR spectra were recorded on a Bruker 600 MHz spectrometer.

[0189] Details of AmpliDetect — Nucleic Acid Lateral Flow Kit (NALF) . The nanoComposix AmpliDetect-Nucleic Acid Lateral Flow Kit (ADLF-25T) was used in this work. The AmpliDetect assay from nanoComposix is a universal detection method for nucleic acidsequences and other molecules labeled with fluorescein (FITC / FAM) and biotin. The technology is based on lateral flow sandwich assay using the gold nanoshells for enhanced sensitivity. The reaction was performed using two ssDNAs: one labeled with 6-FAM, and another labeled with biotin. In presence of target DNA, once the DNA-DNA hybrid bridge is formed and the resulting mixture is added to the sample port along with the running buffer. On the conjugate pad, the anti- FAM / FITC-gold nanoshell conjugate captures the DNA-DNA hybrid. The conjugate- sample complex travels up the strip, and the streptavidin test line recognizes and captures the biotin. The control line of secondary antibody binds any residual conjugate and validates the assay.

[0190] It should be understood that modifications to the embodiments disclosed herein can be made to meet a particular set of design criteria. For instance, the number of or configuration of components or parameters may be used to meet a particular objective.

[0191] It will be apparent to those skilled in the art that numerous modifications and variations of the described examples and embodiments are possible in light of the above teachings of the disclosure. The disclosed examples and embodiments are presented for purposes of illustration only. Other alternative embodiments may include some or all of the features of the various embodiments disclosed herein. For instance, it is contemplated that a particular feature described, either individually or as part of an embodiment, can be combined with other individually described features, or parts of other embodiments. The elements and acts of the various embodiments described herein can therefore be combined to provide further embodiments.

[0192] It is the intent to cover all such modifications and alternative embodiments as may come within the true scope of this invention, which is to be given the full breadth thereof.Additionally, the disclosure of a range of values is a disclosure of every numerical value withinthat range, including the end points. Thus, while certain exemplary embodiments of the apparatus and process and / or utilization and methods of making and using the same have been discussed and illustrated herein, it is to be distinctly understood that the invention is not limited thereto but may be otherwise variously embodied and practiced within the scope of the following claims.

Claims

What is claimed is:

1. An apparatus for detecting at least one sexually transmitted disease in a sample, the apparatus comprising: first sensing probes functionalized with a first small molecule at their first ends, wherein the first sensing probes have a sequence that is complementary of a first target gene sequence of a first sexually transmitted disease; second sensing probes functionalized with a second small molecule at their second ends, wherein the second sensing probes have a sequence that is complementary of a second target gene sequence of the first sexually transmitted disease; third sensing probes functionalized with the first small molecule at their first ends, wherein the third sensing probes have a sequence that is complementary of a first target gene sequence of a second sexually transmitted disease; and fourth sensing probes functionalized with the second small molecule at their second ends, wherein the fourth sensing probes have a sequence that is complementary of a second target gene sequence of the second sexually transmitted disease, wherein the first and second sexually transmitted diseases are two different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

2. The apparatus of claim 1, wherein when the first or second sexually transmitted disease is chlamydia, the first and second target gene sequences of chlamydia are CCAAGAGCAGCGCCUACAAC and UCAACCUGCCCAACCAGACC,wherein when the first or second sexually transmitted disease is gonorrhea, the first and second target gene sequences of gonorrhea are CGGCGAAGGCACCAAAAAAA and ACCAAGUCUACAGCAUCCCG, wherein when the first or second sexually transmitted disease is HPV, the first and second target gene sequences of HPV are UACUACAAGCAGGAUUGAAG and AAACGAAAAGCUACACCCAC, wherein when the first or second sexually transmitted disease is HIV, the first and second target gene sequences of HIV are AGACCCAACAACAAUACAAG and AGAGGACCAGGGAGAGCAUU, and wherein when the first or second sexually transmitted disease is syphilis, the first and second target gene sequences of syphilis are selected from:TCCGCTACGACTACTACGGT and GAGACTCTGATGGATGCTGC,CACCTATGCGCTATACAAAA and GAGCTACCTATCTAACCAAG, andTCTTCTCAATGCATTTCGAC and TCTATAGACGATTTACAACC.

3. The apparatus of claim 1, further comprising: fifth sensing probes functionalized with the first small molecule at their first ends, wherein the fifth sensing probes have a sequence that is complementary of a first target gene sequence of a third sexually transmitted disease, and sixth sensing probes functionalized with the second small molecule at their second ends, wherein the sixth sensing probes have a sequence that is complementary of a second target gene sequence of the third sexually transmitted disease.

4. The apparatus of claim 3, wherein the first, second, and third sexually transmitted diseases are three different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

5. The apparatus of claim 3, further comprising: seventh sensing probes functionalized with the first small molecule at their first ends, wherein the seventh sensing probes have a sequence that is complementary of a first target gene sequence of a fourth sexually transmitted disease, and eighth sensing probes functionalized with the second small molecule at their second ends, wherein the eighth sensing probes have a sequence that is complementary of a second target gene sequence of the fourth sexually transmitted disease.

6. The apparatus of claim 5, wherein the first, second, third, and fourth sexually transmitted diseases are four different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

7. The apparatus of claim 5, further comprising: ninth sensing probes functionalized with the first small molecule at their first ends, wherein the ninth sensing probes have a sequence that is complementary of a first target gene sequence of a fifth sexually transmitted disease, and tenth sensing probes functionalized with the second small molecule at their second ends, wherein the tenth sensing probes have a sequence that is complementary of a second target gene sequence of the fifth sexually transmitted disease.

8. The apparatus of claim 7, wherein the first, second, third, fourth, and fifth sexually transmitted diseases are five different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

9. The apparatus of claim 1, wherein the first small molecule is biotin.

10. The apparatus of claim 1, wherein the second small molecule is 6-carboxyfluorescein.

11. The apparatus of claim 1, further comprising: a testing strip comprising a sample application region, a control region, and a testing region positioned between the sample application region and the control region, wherein the sample application region is configured to receive the sample, which is configured flow through the testing strip towards the testing region and control region.

12. The apparatus of claim 11, wherein the testing region has first capture compounds immobilized on the testing strip, wherein the first capture compounds are configured to capture the first small molecules of sensing probes.

13. The apparatus of claim 12, wherein the first capture compounds comprise streptavidin.

14. The apparatus of claim 12, wherein the testing strip has nanoparticles configured to flow through the testing strip, wherein some of the nanoparticles are configured to capture the second small molecules of the sensing probes.

15. The apparatus of claim 14, wherein the nanoparticles are plasmonic nanoparticles.

16. The apparatus of claim 14, wherein the nanoparticles are coupled to second capture compounds configured to bind to the second small molecules of the sensing probes.

17. The apparatus of claim 11, wherein the control region has third capture compounds immobilized on the testing strip, wherein the third capture compounds are configured to capture some of the nanoparticles.

18. A method for detecting at least one sexually transmitted disease, the method comprising: collecting a sample comprising nucleic acid from a subject; providing a sample solution comprising: the collected sample, first sensing probes functionalized with a first small molecule at their first ends, wherein the first sensing probes have a sequence that is complementary of a first target gene sequence of a first sexually transmitted disease, second sensing probes functionalized with a second small molecule at their second ends, wherein the second sensing probes have a sequence that is complementary of a second target gene sequence of the first sexually transmitted disease,third sensing probes functionalized with the first small molecule at their first ends, wherein the third sensing probes have a sequence that is complementary of a first target gene sequence of a second sexually transmitted disease, and fourth sensing probes functionalized with the second small molecule at their second ends, wherein the fourth sensing probes have a sequence that is complementary of a second target gene sequence of the second sexually transmitted disease; providing a testing strip comprising a sample application region, a control region, a testing region positioned between the sample application region and the control region; and applying the sample at the sample application region, wherein the first and second sexually transmitted diseases are two different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

19. The method of claim 18, wherein the sample solution is configured to flow through the testing strip towards the testing region and the control region after application.

20. The method of claim 18, wherein when the first or second sexually transmitted disease is chlamydia, the first and second target gene sequences of chlamydia areCCAAGAGCAGCGCCUACAAC and UCAACCUGCCCAACCAGACC, wherein when the first or second sexually transmitted disease is gonorrhea, the first and second target gene sequences of gonorrhea are CGGCGAAGGCACCAAAAAAA andACCAAGUCUACAGCAUCCCG,wherein when the first or second sexually transmitted disease is HPV, the first and second target gene sequences of HPV are UACUACAAGCAGGAUUGAAG and AAACGAAAAGCUACACCCAC, wherein when the first or second sexually transmitted disease is HIV, the first and second target gene sequences of HIV are AGACCCAACAACAAUACAAG and AGAGGACCAGGGAGAGCAUU, and wherein when the first or second sexually transmitted disease is syphilis, the first and second target gene sequences of syphilis are selected from:TCCGCTACGACTACTACGGT and GAGACTCTGATGGATGCTGC,CACCTATGCGCTATACAAAA and GAGCTACCTATCTAACCAAG, andTCTTCTCAATGCATTTCGAC and TCTATAGACGATTTACAACC.

21. The method of claim 18, the sample solution further comprising: fifth sensing probes functionalized with the first small molecule at their first ends, wherein the fifth sensing probes have a sequence that is complementary of a first target gene sequence of a third sexually transmitted disease, and sixth sensing probes functionalized with the second small molecule at their second ends, wherein the sixth sensing probes have a sequence that is complementary of a second target gene sequence of the third sexually transmitted disease.

22. The method of claim 21, wherein the first, second, and third sexually transmitted diseases are three different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis,HPV, and HIV.

23. The method of claim 21, the sample solution further comprising: seventh sensing probes functionalized with the first small molecule at their first ends, wherein the seventh sensing probes have a sequence that is complementary of a first target gene sequence of a fourth sexually transmitted disease, and eighth sensing probes functionalized with the second small molecule at their second ends, wherein the eighth sensing probes have a sequence that is complementary of a second target gene sequence of the fourth sexually transmitted disease.

24. The method of claim 23, wherein the first, second, third, and fourth sexually transmitted diseases are four different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

25. The method of claim 23, the sample solution further comprising: ninth sensing probes functionalized with the first small molecule at their first ends, wherein the ninth sensing probes have a sequence that is complementary of a first target gene sequence of a fifth sexually transmitted disease, and tenth sensing probes functionalized with the second small molecule at their second ends, wherein the tenth sensing probes have a sequence that is complementary of a second target gene sequence of the fifth sexually transmitted disease.

26. The method of claim 25, wherein the first, second, third, fourth, and fifth sexually transmitted diseases are five different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

27. The method of claim 18, wherein the first small molecule is biotin.

28. The method of claim 18, wherein the second small molecule is 6-carboxyfluorescein.

29. A composition for detecting at least one sexually transmitted disease in a sample, the composition comprising: first sensing probes functionalized with a moiety at their first ends, wherein the first sensing probes have a sequence that is complementary of a first target gene sequence of a first sexually transmitted disease; second sensing probes functionalized with a moiety at their second ends, wherein the second sensing probes have a sequence that is complementary of a second target gene sequence of the first sexually transmitted disease; third sensing probes functionalized with a moiety at their first ends, wherein the third sensing probes have a sequence that is complementary of a first target gene sequence of a second sexually transmitted disease; fourth sensing probes functionalized with a moiety at their second ends, wherein the fourth sensing probes have a sequence that is complementary of a second target gene sequence of the second sexually transmitted disease; anda plurality of nanoparticles bound to the moieties of the first, second, third, and fourth sensing probes, wherein upon the first and second sensing probes binding to the first and second target gene sequences of the first sexually transmitted disease respectively, the nanoparticles are brought within proximity of one another and agglomerate, wherein upon the third and fourth sensing probes binding to the first and second target gene sequences of the second sexually transmitted disease respectively, the nanoparticles are brought within proximity of one another and agglomerate, and wherein the first and second sexually transmitted diseases are two different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

30. The composition of claim 29, wherein when the first or second sexually transmitted disease is chlamydia, the first and second target gene sequences of chlamydia are CCAAGAGCAGCGCCUACAAC and UCAACCUGCCCAACCAGACC, wherein when the first or second sexually transmitted disease is gonorrhea, the first and second target gene sequences of gonorrhea are CGGCGAAGGCACCAAAAAAA and ACCAAGUCUACAGCAUCCCG, wherein when the first or second sexually transmitted disease is HPV, the first and second target gene sequences of HPV are UACUACAAGCAGGAUUGAAG and AAACGAAAAGCUACACCCAC, wherein when the first or second sexually transmitted disease is HIV, the first and second target gene sequences of HIV are AGACCCAACAACAAUACAAG and AGAGGACCAGGGAGAGCAUU, andwherein when the first or second sexually transmitted disease is syphilis, the first and second target gene sequences of syphilis are selected from:TCCGCTACGACTACTACGGT and GAGACTCTGATGGATGCTGC, CACCTATGCGCTATACAAAA and GAGCTACCTATCTAACCAAG, and TCTTCTCAATGCATTTCGAC and TCTATAGACGATTTACAACC.

31. The composition of claim 29, further comprising: fifth sensing probes functionalized with a moiety at their first ends, wherein the fifth sensing probes have a sequence that is complementary of a first target gene sequence of a third sexually transmitted disease; sixth sensing probes functionalized with a moiety at their second ends, wherein the sixth sensing probes have a sequence that is complementary of a second target gene sequence of the third sexually transmitted disease; and a plurality of nanoparticles bound to the moieties of the fifth and sixth sensing probes, wherein upon the fifth and sixth sensing probes binding to the first and second target gene sequences of the third sexually transmitted disease respectively, the nanoparticles are brought within proximity of one another and agglomerate.

32. The composition of claim 31, wherein the first, second, and third sexually transmitted diseases are three different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

33. The composition of claim 31, further comprising:seventh sensing probes functionalized with a moiety at their first ends, wherein the seventh sensing probes have a sequence that is complementary of a first target gene sequence of a fourth sexually transmitted disease; eighth sensing probes functionalized with a moiety at their second ends, wherein the eighth sensing probes have a sequence that is complementary of a second target gene sequence of the fourth sexually transmitted disease; and a plurality of nanoparticles bound to the moieties of the seventh and eighth sensing probes, wherein upon the seventh and eighth sensing probes binding to the first and second target gene sequences of the fourth sexually transmitted disease respectively, the nanoparticles are brought within proximity of one another and agglomerate.

34. The composition of claim 33, wherein the first, second, third, and fourth sexually transmitted diseases are four different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

35. The composition of claim 33, further comprising: ninth sensing probes functionalized with a moiety at their first ends, wherein the ninth sensing probes have a sequence that is complementary of a first target gene sequence of a fifth sexually transmitted disease; tenth sensing probes functionalized with a moiety at their second ends, wherein the tenth sensing probes have a sequence that is complementary of a second target gene sequence of the fifth sexually transmitted disease; anda plurality of nanoparticles bound to the moieties of the ninth and tenth sensing probes, wherein upon the ninth and tenth sensing probes binding to the first and second target gene sequences of the fifth sexually transmitted disease respectively, the nanoparticles are brought within proximity of one another and agglomerate.

36. The composition of claim 35, wherein the first, second, third, fourth, and fifth sexually transmitted diseases are five different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

37. A method for detecting at least one sexually transmitted disease, the method comprising: collecting a sample comprising nucleic acid from a subject; mixing the sample with a composition comprising: first sensing probes functionalized with a moiety at their first ends, wherein the first sensing probes have a sequence that is complementary of a first target gene sequence of a first sexually transmitted disease; second sensing probes functionalized with a moiety at their second ends, wherein the second sensing probes have a sequence that is complementary of a second target gene sequence of the first sexually transmitted disease; third sensing probes functionalized with a moiety at their first ends, wherein the third sensing probes have a sequence that is complementary of a first target gene sequence of a second sexually transmitted disease;fourth sensing probes functionalized with a moiety at their second ends, wherein the fourth sensing probes have a sequence that is complementary of a second target gene sequence of the second sexually transmitted disease; and a plurality of nanoparticles bound to the moieties of the first, second, third, and fourth sensing probes, wherein upon the first and second sensing probes binding to the first and second target gene sequences of the first sexually transmitted disease respectively, the nanoparticles are brought within proximity of one another and agglomerate, wherein upon the third and fourth sensing probes binding to the first and second target gene sequences of the second sexually transmitted disease respectively, the nanoparticles are brought within proximity of one another and agglomerate, and wherein the first and second sexually transmitted diseases are two different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

38. The method of claim 37, wherein when the first or second sexually transmitted disease is chlamydia, the first and second target gene sequences of chlamydia areCCAAGAGCAGCGCCUACAAC and UCAACCUGCCCAACCAGACC, wherein when the first or second sexually transmitted disease is gonorrhea, the first and second target gene sequences of gonorrhea are CGGCGAAGGCACCAAAAAAA and ACCAAGUCUACAGCAUCCCG, wherein when the first or second sexually transmitted disease is HPV, the first and second target gene sequences of HPV are UACUACAAGCAGGAUUGAAG andAAACGAAAAGCUACACCCAC,wherein when the first or second sexually transmitted disease is HIV, the first and second target gene sequences of HIV are AGACCCAACAACAAUACAAG and AGAGGACCAGGGAGAGCAUU, and wherein when the first or second sexually transmitted disease is syphilis, the first and second target gene sequences of syphilis are selected from:TCCGCTACGACTACTACGGT and GAGACTCTGATGGATGCTGC, CACCTATGCGCTATACAAAA and GAGCTACCTATCTAACCAAG, and TCTTCTCAATGCATTTCGAC and TCTATAGACGATTTACAACC.

39. The method of claim 37, wherein the composition further comprises fifth sensing probes functionalized with a moiety at their first ends, wherein the fifth sensing probes have a sequence that is complementary of a first target gene sequence of a third sexually transmitted disease; sixth sensing probes functionalized with a moiety at their second ends, wherein the sixth sensing probes have a sequence that is complementary of a second target gene sequence of the third sexually transmitted disease; and a plurality of nanoparticles bound to the moieties of the fifth and sixth sensing probes, wherein upon the fifth and sixth sensing probes binding to the first and second target gene sequences of the third sexually transmitted disease respectively, the nanoparticles are brought within proximity of one another and agglomerate.

40. The method of claim 39, wherein the first, second, and third sexually transmitted diseases are three different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

41. The method of claim 39, wherein the composition further comprises seventh sensing probes functionalized with a moiety at their first ends, wherein the seventh sensing probes have a sequence that is complementary of a first target gene sequence of a fourth sexually transmitted disease; eighth sensing probes functionalized with a moiety at their second ends, wherein the eighth sensing probes have a sequence that is complementary of a second target gene sequence of the fourth sexually transmitted disease; and a plurality of nanoparticles bound to the moieties of the seventh and eighth sensing probes, wherein upon the seventh and eighth sensing probes binding to the first and second target gene sequences of the fourth sexually transmitted disease respectively, the nanoparticles are brought within proximity of one another and agglomerate.

42. The method of claim 41, wherein the first, second, third, and fourth sexually transmitted diseases are four different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

43. The method of claim 41, wherein the composition further comprisesninth sensing probes functionalized with a moiety at their first ends, wherein the ninth sensing probes have a sequence that is complementary of a first target gene sequence of a fifth sexually transmitted disease; tenth sensing probes functionalized with a moiety at their second ends, wherein the tenth sensing probes have a sequence that is complementary of a second target gene sequence of the fifth sexually transmitted disease; and a plurality of nanoparticles bound to the moieties of the ninth and tenth sensing probes, wherein upon the ninth and tenth sensing probes binding to the first and second target gene sequences of the fifth sexually transmitted disease respectively, the nanoparticles are brought within proximity of one another and agglomerate.

44. The method of claim 43, wherein the first, second, third, fourth, and fifth sexually transmitted diseases are five different diseases selected from the group consisting of chlamydia, gonorrhea, syphilis, HPV, and HIV.

Images