Reagent for measuring Anti-gastric wall cell antibody, kit for measuring Anti-gastric wall cell antibody, and method for measuring Anti-gastric wall cell antibody in sample

Abstract

The present invention addresses the problem of providing: a reagent for measuring an anti-gastric wall cell antibody and a kit for measuring an anti-gastric wall cell antibody, in order to detect an anti-gastric wall cell antibody; and a method for measuring an anti-gastric wall cell antibody in a sample. The present invention provides: a reagent for measuring an anti-gastric wall cell antibody, the reagent containing a protein which has an N-linked sugar chain and which is any one of (1) to (3); and (1) a protein containing at least the amino acid sequence of SEQ ID NO: 1; Provided is: (2) a protein containing at least an amino acid sequence which has 90% or more sequence identity with SEQ ID NO: 1, and containing an amino acid sequence that is capable of binding to the anti-gastric wall cell antibody; or (3) a protein containing at least the amino acid sequence of SEQ ID NO: 1 with one to several amino acids substituted, deleted, added and / or inserted, and containing an amino acid sequence that is capable of binding to the anti-gastric wall cell antibody.

Description

Reagent for measuring anti-gastric parietal cell antibodies, kit for measuring anti-gastric parietal cell antibodies, and method for measuring anti-gastric parietal cell antibodies in a sample

[0001] The present invention relates to a reagent and a kit for measuring anti-gastric parietal cell antibodies. The present invention further relates to a method for measuring anti-gastric parietal cell antibodies in a sample using the reagent or kit for measuring anti-gastric parietal cell antibodies.

[0002] Autoimmune gastritis (AIG) is a disease caused by the destruction and disappearance of parietal cells in the gastric mucosa due to autoimmune abnormalities. The pathology of AIG is chronic atrophic gastritis (gastrium fundus and body), which is a high risk factor for gastric cancer and requires endoscopic follow-up.

[0003] Anti-gastric parietal cell antibodies are autoantibodies against proton pumps present on the surface of gastric parietal cells, and are known to appear in approximately 80% of AIG patients. Anti-gastric parietal cell antibodies are essential for the definitive diagnosis of autoimmune gastritis.

[0004] Anti-gastric parietal cell antibodies are currently measured using rat stomach sections as antigens and visual detection using a fluorescence microscope.

[0005] On the other hand, Non-Patent Document 1 describes that the H+ / K+ ATPase β subunit (ATP4B) from which N-glycosylation has been removed does not react with autoantibodies. Non-Patent Document 2 also shows that, of the α and β subunits that are components of the proton pump, anti-gastric parietal cell antibodies react more with the β subunit. Furthermore, Non-Patent Document 3 describes the identification of an epitope of ATP4B that induces autoimmune gastritis in mice using synthetic peptides.

[0006] Autoimmunity 16:289-295, 1993 Scand J Fastroenterol 3(3): 288-293, 2002 Immunology 96(1): 145-151, 1999

[0007] Conventional methods for measuring anti-gastric parietal cell antibodies (i.e., methods using rat stomach sections as antigens and visually detecting them under a fluorescence microscope) have had problems such as complicated procedures and frequent non-specific detection. Furthermore, Non-Patent Documents 1 to 3 did not identify the amino acid sequence required for the reaction between human anti-gastric parietal cell antibodies and ATP4B.

[0008] An object of the present invention is to provide an anti-gastric parietal cell antibody measurement reagent and an anti-gastric parietal cell antibody measurement kit for detecting anti-gastric parietal cell antibodies. Another object of the present invention is to provide a method for measuring anti-gastric parietal cell antibodies in a sample using the above-mentioned anti-gastric parietal cell antibody measurement reagent or anti-gastric parietal cell antibody measurement kit.

[0009] As a result of extensive research to solve the above problems, the present inventors have completed the present invention by using a human-derived ATP4B recombinant antigen and identifying the amino acid sequence region of ATP4B required for the reaction with anti-gastric parietal cell antibodies. According to the present invention, the following inventions are provided:

[0010] <1> A reagent for measuring anti-gastric parietal cell antibodies, comprising a protein having an N-linked sugar chain, which is any one of the proteins (1) to (3) below: (1) a protein comprising at least the amino acid sequence of SEQ ID NO: 1; (2) a protein comprising at least an amino acid sequence having 90% or more sequence identity with SEQ ID NO: 1, and comprising an amino acid sequence capable of binding to anti-gastric parietal cell antibodies; or (3) a protein comprising at least an amino acid sequence in which one to several amino acids in SEQ ID NO: 1 have been substituted, deleted, added, and / or inserted, and comprising an amino acid sequence capable of binding to anti-gastric parietal cell antibodies. <2> The reagent for measuring anti-gastric parietal cell antibodies according to <1>, wherein the protein is any one of the proteins (4) to (6) below: (1) a protein comprising at least the amino acid sequence of SEQ ID NO: 2; (2) a protein comprising at least an amino acid sequence having 90% or more sequence identity with SEQ ID NO: 2 and comprising an amino acid sequence capable of binding to an anti-gastric parietal cell antibody; or (3) a protein comprising at least an amino acid sequence in which one to several amino acids have been substituted, deleted, added, and / or inserted in SEQ ID NO: 2 and comprising an amino acid sequence capable of binding to an anti-gastric parietal cell antibody. <3> The reagent for measuring anti-gastric parietal cell antibodies according to <1>, wherein an N-linked sugar chain is bound to the 27th amino acid residue in SEQ ID NO: 1. <4> The reagent for measuring anti-gastric parietal cell antibodies according to <1>, wherein N-linked sugar chains are bound to the 27th and 56th amino acid residues in SEQ ID NO: 1. <5> A kit for measuring anti-gastric parietal cell antibodies, comprising the reagent for measuring anti-gastric parietal cell antibodies according to any one of <1> to <4> and a labeled anti-gastric parietal cell antibody-binding substance. <6> A method for measuring anti-gastric parietal cell antibodies in a sample, comprising contacting the sample with the reagent for measuring anti-gastric parietal cell antibodies according to any one of <1> to <4>, which may be labeled. <7> The method according to <6>, in which anti-gastric parietal cell antibodies in the sample are measured by latex agglutination. <8> The method according to <6> or <7>, in which anti-gastric parietal cell antibodies in the sample are measured based on a label. <9> The method according to any one of <6> to <8>, in which the sample is whole blood, serum, plasma, or urine.

[0011] According to the present invention, false positives can be reduced in the detection of anti-gastric parietal cell antibodies.

[0012] FIG. 1 shows the results of confirming the expression of a target protein by CBB (Coomassie Brilliant Blue) staining and Western blotting using an anti-His-tag antibody. FIG. 2 shows the reaction principle of measuring anti-gastric parietal cell antibodies in blood samples using a recombinant antigen in Example 2. FIG. 3 shows the results of measuring anti-gastric parietal cell antibodies in blood samples using a recombinant antigen in Example 2. FIG. 4 shows a schematic diagram of the reaction process between a commercially available antibody and antigen-immobilized particles and the reaction with a sample. FIG. 5 shows the results of measuring anti-gastric parietal cell antibodies using a latex reagent. FIG. 6 shows the results of measuring the reactivity of a recombinant antigen with anti-gastric parietal cell antibodies in blood samples.

[0013] The present invention will be described in detail below. In this specification, the symbol "to" indicates a range that includes the numerical values ​​before and after it as the minimum and maximum values, respectively.

[0014] <Reagent for Measuring Anti-Gastric Parietal Cell Antibodies> The reagent for measuring anti-gastric parietal cell antibodies of the present invention comprises a protein having an N-linked glycan, which is any one of the following proteins (1) to (3): (1) a protein comprising at least the amino acid sequence of SEQ ID NO: 1; (2) a protein comprising at least an amino acid sequence having 90% or more (preferably 95% or more, more preferably 97% or more) sequence identity with SEQ ID NO: 1 and comprising an amino acid sequence capable of binding to an anti-gastric parietal cell antibody; or (3) a protein comprising at least an amino acid sequence in which one to several (e.g., 1 to 5, 1 to 4, or 1 to 3) amino acids in SEQ ID NO: 1 have been substituted, deleted, added, and / or inserted, and comprising an amino acid sequence capable of binding to an anti-gastric parietal cell antibody. The reagent for measuring anti-gastric parietal cell antibodies of the present invention may be supported on a carrier. The carrier is not particularly limited, and may be a plate (e.g., a plastic microtiter plate), latex particles, magnetic particles, etc. Examples of latex particles that can be used include polystyrene, styrene-methacrylic acid copolymer, styrene-glycidyl (meth)acrylate copolymer, styrene-styrene sulfonate copolymer, methacrylic acid polymer, acrylic acid polymer, acrylonitrile-butadiene-styrene copolymer, vinyl chloride-acrylic acid ester copolymer, polyvinyl acetate acrylate, etc. Examples of magnetic particles that can be used include magnetic silica particles.

[0015] In a preferred embodiment, the protein is any one of the following proteins (4) to (6): (4) a protein comprising at least the amino acid sequence of SEQ ID NO: 2; (5) a protein comprising at least an amino acid sequence having 90% or more (preferably 95% or more, more preferably 97% or more) sequence identity with SEQ ID NO: 2 and comprising an amino acid sequence capable of binding to an anti-gastric parietal cell antibody; or (6) a protein comprising at least an amino acid sequence in which one to several (e.g., 1 to 5, 1 to 4, or 1 to 3) amino acids in SEQ ID NO: 2 have been substituted, deleted, added, and / or inserted, and comprising an amino acid sequence capable of binding to an anti-gastric parietal cell antibody.

[0016] SEQ ID NO: 1: Amino acid residues 167 to 290 of the extracellular region of human H+ / K+-ATPase β subunit (sequence of 123 amino acids) DPNFGFEEGK PCFIIKMNRI VKFLPSNGSA PRVDCAFLDQ PRELGQPLQV KYYPPNGTFS LHYFPYYGKK AQPHYSNPLV AAKLLNIPRN AEVAIVCKVM AEHVTFNNPH DPYEGKVEFK LKIE

[0017] SEQ ID NO: 2: Amino acid residues 64 to 291 of the extracellular region of human H+ / K+-ATPase β subunit (sequence of 227 amino acids) QTVDPYTPDY QDQLRSPGVT LRPDVYGEKG LEIVYNVSDN RTWADLTQTL HAFLAGYSPA AQEDSINCTS EQYFFQESFR APNHTKFSCK FTADMLQNCS GLADPNFGFE EGKPCFIIKM NRIVKFLPSN GSAPRVDCAF LDQPRELGQP LQVKYYPPNG TFSLHYFPYY GKKAQPHYSN PLVAAKLLNI PRNAEVAIVC KVMAEHVTFN NPHDPYEGKV EFKLKIEK

[0018] SEQ ID NO: 3: Amino acid residues 1 to 291 of the extracellular region of human H+ / K+-ATPase β subunit MAALQEKKTC GQRMEEFQRY CWNPDTGQML GRTLSRWVWI SLYYVAFYVV MTGLFALCLY VLMQTVDPYT PDYQDQLRSP GVTLRPDVYG EKGLEIVYNV SDNRTWADLT QTLHAFLAGY SPAAQEDSIN CTSEQYFFQE SFRAPNHTKF SCKFTADMLQ NCSGLADPNF GFEEGKPCFI IKMNRIVKFL PSNGSAPRVD CAFLDQPREL GQPLQVKYYP PNGTFSLHYF PYYGKKAQPH YSNPLVAAKL LNIPRNAEVA IVCKVMAEHV TFNNPHDPYE GKVEFKLKIE K

[0019] The above-described proteins of the present invention have N-linked sugar chains. In N-linked sugar chains, sugar chains are bound to the amide nitrogen atom in the side chain of asparagine (Asn). More preferably, the N-linked sugar chain is bound to the 27th amino acid residue in SEQ ID NO: 1, and even more preferably to the 27th and 56th amino acid residues in SEQ ID NO: 1. Examples of N-linked sugar chains include high-mannose, complex, and hybrid types. Known high-mannose sugar chains are N-linked sugar chains having mannose or mannose 6-phosphate at their termini, and include high-mannose sugar chains represented by Man3, Man5, Man6, Man8, Man9, etc. depending on the number of mannose residues.

[0020] <Production of a reagent for measuring anti-gastric parietal cell antibodies> The protein of the present invention can be obtained by constructing an expression vector containing a nucleic acid encoding the protein of the present invention, introducing the expression vector into a suitable host, and recovering and purifying it from a culture of the host.

[0021] In the Examples described below, the amino acid sequence of the extracellular domain of human H / K-ATPase β subunit (amino acid residues 64-291: SEQ ID NO: 2) was expressed using a nucleic acid having the nucleotide sequence of SEQ ID NO: 4, which encodes the amino acid sequence of the extracellular domain of human H / K-ATPase β subunit (amino acid residues 64-291: SEQ ID NO: 2).

[0022] Accession number 4: CCATGGCTTACCGTATGCAGCTGCTGAGCTGCATCGCTCTGAGCCTCGCTCTGGTCACCAATTCCGCTGAGCAGCACCACCATCACCACCACGGCGTGGCTATGCCCGGTGCTGAGGATGACGTCGTGCAGACCGTGGATCCTTACACCCCCGACTACCAAGACCAACTGCGCTCCCCCGGTGTCACTCTGCGTCCCGACGTGTACGGCGAGAAGGGTCTGGAAATCGTCTACAACGTGTCCGACAACCGCACTTGGGCTGATCTGACCCAGACTCTGCACGCCTTTCTGGCTGGTTACTCCCCCGCTGCTCAAGAGGACTCCATCAATTGCACCTCCGAGCAGTACTTCTTCCAAGAGTCCTTCCGCGCTCCCAACCACACCAAGTTCAGCTGCAAGTTCACCGCCGACATGCTGCAAAATTGCTCCGGTCTGGCTGATCCCAACTTCGGCTTCGAGGAGGGCAAGCCTTGCTTCATCATCAAGATGAACCGCATTGTCAAATTCCTCCCCTCCAACGGTTCCGCCCCTCGTGTGGATTGCGCCTTCCTCGACCAACCTCGCGAGCTGGGTCAGCCTCTGCAAGTCAAGTACTATCCCCCTAACGGCACCTTCTCTCTGCACTACTTCCCCTACTACGGTAAGAAGGCCCAGCCTCACTACTCCAACCCTCTGGTCGCTGCTAAGCTGCTGAACATCCCTCGTAACGCTGAGGTGGCTATCGTGTGTAAGGTGATGGCTGAGCACGTGACCTTCAACAACCCTCACGACCCCTACGAGGGCAAGGTGGAGTTCAAGCTGAAGATCGAAAAATAACTCGAG 5' NcoI highlighted 3' XhoI highlighted

[0023] Combinations of expression vectors and hosts are known to those skilled in the art. Expression vectors that can be used are those that are capable of autonomous replication in host cells or can be integrated into chromosomes and contain a promoter at a position where the nucleic acid of interest can be transcribed. Phages or plasmids, for example, can be used as expression vectors.

[0024] Examples of hosts include bacteria, yeast, animal cells, insect cells, and plant cells. Examples of bacteria that can be used include bacteria from the genus Escherichia and Bacillus. Examples of animal cells that can be used include COS1 cells, COS7 cells, and CHO cells. Examples of insect cells that can be used include Sf9 cells and Sf21 cells. Examples of plant cells that can be used include cells from the genus Nicotiana, such as Nicotiana tabacum. Among the above, eukaryotic cells are preferred in the present invention, and animal or insect cells are more preferred, from the viewpoint of being able to express proteins having sugar chains.

[0025] Methods for introducing a recombinant expression vector into a host include, for example, the calcium phosphate method, electroporation, protoplast method, spheroblast method, lithium acetate method, lipofection method, and viral vector method, and various commercially available transfection reagents can also be used.

[0026] After culturing the transformant, if the recombinant protein is produced intracellularly, the recombinant protein can be recovered by disrupting the cells. If the recombinant protein is produced extracellularly, the culture medium can be used directly, or the cells can be removed by centrifugation or other methods. The recombinant protein can then be isolated and purified using standard protein isolation and purification methods, such as solvent extraction, salting out with ammonium sulfate or the like, desalting, precipitation with organic solvents, anion exchange chromatography using diethylaminoethyl (DEAE) Sepharose or the like, cation exchange chromatography using resins such as S-Sepharose FF (Pharmacia), hydrophobic chromatography using resins such as butyl Sepharose or phenyl Sepharose, gel filtration using molecular sieves, affinity chromatography, chromatofocusing, and electrophoresis such as isoelectric focusing, either alone or in combination.

[0027] <Kit for measuring anti-gastric parietal cell antibodies> The kit for measuring anti-gastric parietal cell antibodies of the present invention comprises the above-mentioned reagent for measuring anti-gastric parietal cell antibodies of the present invention and a labeled anti-gastric parietal cell antibody binding substance. The reagent for measuring anti-gastric parietal cell antibodies of the present invention and the labeled anti-gastric parietal cell antibody binding substance can be included in the kit of the present invention as separate reagents. The labeled anti-gastric parietal cell antibody binding substance will also be explained below in <Method for measuring anti-gastric parietal cell antibodies in a sample>.

[0028] The reagent for measuring anti-gastric parietal cell antibodies of the present invention in the kit for measuring anti-gastric parietal cell antibodies may be supported on a carrier or may not be supported on a carrier. When the kit for measuring anti-gastric parietal cell antibodies includes the reagent for measuring anti-gastric parietal cell antibodies of the present invention that is not supported on a carrier, the kit for measuring anti-gastric parietal cell antibodies may further include a carrier in addition to the reagent for measuring anti-gastric parietal cell antibodies of the present invention and a labeled anti-gastric parietal cell antibody-binding substance.

[0029] The carrier is not particularly limited, and may be a plate (for example, a plastic microtiter plate), latex particles, magnetic particles, etc. Examples of latex particles that can be used include latex particles made of polystyrene, styrene-methacrylic acid copolymer, styrene-glycidyl (meth)acrylate copolymer, styrene-styrene sulfonate copolymer, methacrylic acid polymer, acrylic acid polymer, acrylonitrile-butadiene-styrene copolymer, vinyl chloride-acrylic acid ester copolymer, and polyvinyl acetate acrylate. Examples of magnetic particles that can be used include magnetic silica particles.

[0030] The label in the labeled anti-gastric parietal cell antibody-binding substance is preferably an enzyme used in, for example, enzyme immunoassay (EIA). Examples of the enzyme include alkaline phosphatase, β-galactosidase, horseradish peroxidase (HRP), peroxidase such as microperoxidase, glucose oxidase, glucose-6-phosphate dehydrogenase, malate dehydrogenase, luciferase, tyrosinase, and acid phosphatase. Among the above, alkaline phosphatase, peroxidase, and glucose oxidase are more preferred, and peroxidase is particularly preferred.

[0031] The anti-gastric parietal cell antibody binding substance may be any substance that binds to anti-gastric parietal cell antibodies, and for example, anti-human IgG can be used.

[0032] The anti-gastric parietal cell antibody measurement kit may further contain a chromogenic substrate. Examples of chromogenic substrates include 3',3',5',5'-tetramethylbenzidine (TMB), 4-chloro-1-naphthol (4-CN), and 3,3'-diaminobenzidine (DAB). The luminescent substrate is preferably a nitrogen-containing heterocyclic compound having an amino group or a salt thereof, such as luminol, isoluminol, N-aminohexyl-N-ethylisoluminol (AHEI), N-aminobutyl-N-ethylisoluminol (ABEI), and metal salts thereof (e.g., alkali metal salts), and 8-amino-5-chloro-7-phenylpyrido[3,4-d]pyridazine-1,4(2H,3H)-dione or a salt thereof. The anti-gastric parietal cell antibody measurement kit may further contain stabilizers, aggregation promoters, surfactants, buffer solutions, and the like, which are used in the method for measuring anti-gastric parietal cell antibodies in a sample, as described below.

[0033] <Method for measuring anti-gastric parietal cell antibodies in a sample> A method for measuring anti-gastric parietal cell antibodies in a sample according to the present invention comprises contacting the sample with the reagent for measuring anti-gastric parietal cell antibodies of the present invention, which may have a label.

[0034] The sample is not particularly limited, but whole blood, serum, plasma, or urine can be used.

[0035] As an example of the present invention, anti-gastric parietal cell antibodies in a sample can be measured based on the label. Measurement of anti-gastric parietal cell antibodies may be performed according to methods commonly used in the art, such as the sandwich method and competitive method described in literature [e.g., Enzyme Immunoassay, 2nd Edition (edited by Ishikawa Eiji et al., Igaku Shoin), 1982], and the method described in Japanese Patent Laid-Open No. 6-130063.

[0036] In the sandwich method, the anti-gastric parietal cell antibody assay reagent of the present invention is immobilized on the surface of a solid-phase carrier such as magnetic silica particles. A sample, the solid-phase carrier, and a labeled anti-gastric parietal cell antibody-binding substance (a substance that binds to anti-gastric parietal cell antibodies, e.g., anti-human IgG) are mixed, and the immobilized anti-gastric parietal cell antibody assay reagent is contacted with the anti-gastric parietal cell antibody in the sample and the labeled anti-gastric parietal cell antibody-binding substance. This allows the formation of a labeled complex, which is a complex of the immobilized anti-gastric parietal cell antibody assay reagent, the anti-gastric parietal cell antibody in the sample, and the labeled anti-gastric parietal cell antibody-binding substance. The solid-phase carrier carrying the labeled complex is then subjected to B / F separation to measure the amount of label in the labeled complex, and the amount of anti-gastric parietal cell antibody in the sample is determined based on the amount of label in the labeled complex. Any support (especially an insoluble support) used in conventional immunoassays can be used as the solid-phase carrier. Examples include organic materials such as polystyrene, polyacrylic acid, polymethacrylic acid, polymethyl methacrylate, polyacrylamide, polyglycidyl methacrylate, polypropylene, polyolefin, polyimide, polyurethane, polyester, polyvinyl chloride, polyethylene, polychlorocarbonate, silicone resin, silicone rubber, agarose, dextran, and ethylene-maleic anhydride copolymer; inorganic materials such as glass, silicon oxide, diatomaceous earth, porous glass, ground glass, alumina, silica gel, and metal oxides; magnetic materials such as iron, cobalt, nickel, magnetite, and chromite; and materials prepared using alloys of these magnetic materials. Immobilization can be performed on a solid phase (e.g., any surface, such as beads, magnetic beads, membranes, and plates). Various commercially available magnetic beads can be used. For example, the beads disclosed in WO 2012 / 173002A may be used as the magnetic beads. In a sandwich assay, the immobilized anti-gastric parietal cell antibody measurement reagent and the labeled anti-gastric parietal cell antibody-binding substance usually do not compete with each other for binding to the anti-gastric parietal cell antibody, but bind to the target component simultaneously.

[0037] Specifically, for example, an anti-gastric parietal cell antibody in a sample is contacted with an anti-gastric parietal cell antibody assay reagent immobilized on the surface of a solid-phase carrier such as magnetic silica particles to form a complex between the anti-gastric parietal cell antibody assay reagent immobilized on the surface of the solid-phase carrier and the anti-gastric parietal cell antibody in the sample. Next, a labeled anti-gastric parietal cell antibody-binding substance is contacted with the complex to form a complex (labeled complex) between the anti-gastric parietal cell antibody assay reagent immobilized on the solid-phase carrier, the anti-gastric parietal cell antibody in the sample, and the labeled anti-gastric parietal cell antibody-binding substance. The labeled complex is then subjected to B / F separation to measure the amount of label in the labeled complex, and the amount of anti-gastric parietal cell antibody in the sample can be determined based on the amount of label in the labeled complex.

[0038] In the above-described method, the anti-gastric parietal cell antibody in the sample is reacted with the immobilized anti-gastric parietal cell antibody measurement reagent, and then the labeled anti-gastric parietal cell antibody binding substance is reacted therewith. However, the labeled anti-gastric parietal cell antibody binding substance may be reacted with the anti-gastric parietal cell antibody in the sample, and then the immobilized anti-gastric parietal cell antibody measurement reagent may be reacted therewith, or these three may be reacted simultaneously.

[0039] Bound / Free separation (B / F separation) in the sandwich method refers to the separation of a substance supported on a solid phase carrier from other substances.

[0040] That is, it means separation of the labeled complex from the labeled anti-gastric parietal cell antibody-binding substance that was not involved in the formation of the labeled complex. Specifically, it means separation of the anti-gastric parietal cell antibody measurement reagent immobilized on a solid phase carrier, the complex between the anti-gastric parietal cell antibody measurement reagent immobilized on a solid phase carrier and the anti-gastric parietal cell antibody in the sample, and the above-mentioned labeled complex from other components (components other than the anti-gastric parietal cell antibody in the sample, labeled anti-gastric parietal cell antibody-binding substance that was not involved in the formation of the labeled complex, etc.).

[0041] Furthermore, although the B / F separation step is an essential step after the formation of the labeled complex, it may also be performed after the formation of a complex between the anti-gastric parietal cell antibody and the reagent for measuring the anti-gastric parietal cell antibody immobilized on the surface of the solid phase carrier.

[0042] The sandwich method can also be performed using a microfluidic chip (micro-total analysis systems; μTAS). The microfluidic chip includes a flow channel, and the flow channel has a sample inlet. For example, at the sample inlet, a reagent for measuring anti-gastric parietal cell antibodies bound to a polycation or polyanion (e.g., DNA) is brought into contact with the anti-gastric parietal cell antibody in the sample to form a complex between the reagent for measuring anti-gastric parietal cell antibodies and the anti-gastric parietal cell antibody. An electric field is applied to move the complex, and when the complex comes into contact with a labeled anti-gastric parietal cell antibody-binding substance present in the flow channel, a complex is formed between the reagent for measuring anti-gastric parietal cell antibodies, the anti-gastric parietal cell antibody, and the labeled anti-gastric parietal cell antibody-binding substance. The electric field further moves the complex through the flow channel, and the labeled complex is subjected to B / F separation until it reaches a detection unit on the flow channel, where the amount of label in the labeled complex is measured. The amount of anti-gastric parietal cell antibody in the sample can be measured based on the amount of label in the labeled complex.

[0043] The competitive method refers to a method for measuring the amount of anti-gastric parietal cell antibody in a sample by, for example, making the anti-gastric parietal cell antibody in the sample compete with a substance identical to the anti-gastric parietal cell antibody, or by making the anti-gastric parietal cell antibody in the sample compete with a substance similar to the anti-gastric parietal cell antibody, against a reagent for measuring the anti-gastric parietal cell antibody that specifically binds to the anti-gastric parietal cell antibody.

[0044] In one example of a competitive method, a reagent for measuring anti-gastric parietal cell antibodies of the present invention is immobilized on the surface of a solid support, and a sample, the solid support, and a labeled anti-gastric parietal cell antibody or an analog thereof are mixed together. This allows the anti-gastric parietal cell antibody in the sample to compete with the labeled anti-gastric parietal cell antibody or an analog thereof, and then the sample is brought into contact with the immobilized reagent for measuring anti-gastric parietal cell antibodies to form a labeled complex, which is a complex containing the labeled anti-gastric parietal cell antibody or an analog thereof and the immobilized reagent for measuring anti-gastric parietal cell antibodies. The solid support carrying the labeled complex is then subjected to B / F separation to measure the amount of label in the labeled complex, and the amount of anti-gastric parietal cell antibody in the sample can be determined based on the amount of label in the labeled complex.

[0045] Specifically, for example, anti-gastric parietal cell antibodies in a sample are first allowed to compete with labeled anti-gastric parietal cell antibodies or analogs thereof, and then brought into contact with an immobilized reagent for measuring anti-gastric parietal cell antibodies to form a labeled complex containing the labeled anti-gastric parietal cell antibodies or analogs thereof and the immobilized reagent for measuring anti-gastric parietal cell antibodies. Next, the solid phase carrier carrying the labeled complex is subjected to B / F separation to measure the amount of label in the labeled complex, and the amount of anti-gastric parietal cell antibodies in the sample can be measured based on the amount of label in the labeled complex.

[0046] In this method, the anti-gastric parietal cell antibody in the sample, the immobilized anti-gastric parietal cell antibody measurement reagent, and the labeled anti-gastric parietal cell antibody or an analogue thereof are simultaneously subjected to a competitive reaction; however, the anti-gastric parietal cell antibody in the sample may be added to the immobilized anti-gastric parietal cell antibody measurement reagent, and then the labeled anti-gastric parietal cell antibody or an analogue thereof may be added to cause a competitive reaction.

[0047] The B / F separation in the competitive assay refers to the separation of a substance supported on a solid phase carrier from other substances, specifically, the separation of a labeled complex containing a labeled anti-gastric parietal cell antibody or an analog thereof and an immobilized reagent for measuring anti-gastric parietal cell antibody from other components (components in a sample other than the anti-gastric parietal cell antibody).

[0048] The method for contacting the anti-gastric parietal cell antibody in the sample, the reagent for measuring the anti-gastric parietal cell antibody, the labeled anti-gastric parietal cell antibody-binding substance, the anti-gastric parietal cell antibody or an analog thereof, etc. may be carried out by a conventional treatment such as stirring, mixing, etc. The reaction time may be appropriately set depending on the sandwich method, competitive method, etc., but is usually 1 minute to 24 hours, preferably 1 minute to 1 hour, more preferably 1 to 10 minutes, and particularly preferably 1 to 5 minutes.

[0049] B / F separation can be performed, for example, by utilizing the magnetic properties of the solid carriers, by collecting the solid carriers with a magnet or the like from the outside of the reaction vessel, discharging the reaction solution, adding a washing solution, removing the magnet, mixing and dispersing the solid carriers, and washing them. The above procedure may be repeated 1 to 3 times. The washing solution is not particularly limited as long as it is one commonly used in this field.

[0050] The label is preferably an enzyme used in, for example, enzyme immunoassay (EIA). Examples of the enzyme include alkaline phosphatase, β-galactosidase, horseradish peroxidase (HRP), peroxidase such as microperoxidase, glucose oxidase, glucose-6-phosphate dehydrogenase, malate dehydrogenase, luciferase, tyrosinase, and acid phosphatase. Among the above, alkaline phosphatase, peroxidase, and glucose oxidase are more preferred, and peroxidase is particularly preferred.

[0051] In the present invention, it is preferable to use an enzyme as a label and carry out an enzymatic reaction, as described above. A preferred example of the enzymatic reaction is a reaction with peroxidase carried out in the presence of hydrogen peroxide.

[0052] The above-mentioned labels can be bound to anti-gastric parietal cell antibody-binding substances, anti-gastric parietal cell antibodies, or analogs thereof by methods commonly used in this field [e.g., Medical Chemistry Experiment Lectures, Vol. 8, edited by Yamamura Yuichi, 1st Edition, Nakayama Shoten, 1971; Illustrated Fluorescent Antibodies, by Kawao Akira, 1st Edition, Soft Science Co., Ltd., 1983; Enzyme Immunoassay, edited by Ishikawa Eiji, Kawai Tadashi, and Miyai Kiyoshi, 2nd Edition, Igaku Shoin, 1982, etc.].

[0053] The amount of label used can be appropriately determined depending on the type of label used, and when peroxidase is used as a label, for example, the anti-gastric parietal cell antibody-binding substance and label are preferably used at a molar ratio of, for example, typically 1:1 to 20, preferably 1:1 to 10, and more preferably 1:2 to 6. Furthermore, the peroxidase-labeled anti-gastric parietal cell antibody-binding substance may be used by incorporating it into a buffer solution commonly used in this field, such as Tris buffer, phosphate buffer, veronal buffer, borate buffer, or Good's buffer (e.g., MES (2-morpholinoethanesulfonic acid) buffer).

[0054] The pH of the buffer solution may be within a range that does not inhibit the antigen-antibody reaction, and is typically 5 to 9. Such a buffer solution may also contain stabilizers such as albumin, globulin, water-soluble gelatin, and polyethylene glycol, surfactants, sugars, etc., as long as they do not inhibit the antigen-antibody reaction. In this specification, pH refers to the value measured in accordance with JIS K0400-12-10:2000 (measurement temperature: 25°C).

[0055] Methods for measuring the label include colorimetric or chemiluminescent immunoassays (ECLIA, CLIA and CLEIA).

[0056] Examples of the color-developing substrate include 3',3',5',5'-tetramethylbenzidine (TMB), 4-chloro-1-naphthol (4-CN), and 3,3'-diaminobenzidine (DAB).

[0057] The luminescent substrate is preferably a nitrogen-containing heterocyclic compound having an amino group or a salt thereof, and examples thereof include luminol, isoluminol, N-aminohexyl-N-ethylisoluminol (AHEI), N-aminobutyl-N-ethylisoluminol (ABEI), and metal salts thereof (such as alkali metal salts), 8-amino-5-chloro-7-phenylpyrido[3,4-d]pyridazine-1,4(2H,3H)-dione, and a salt thereof.

[0058] Measurement methods using antigen-antibody reactions include label-free methods, i.e., label-free methods, such as immunodiffusion using precipitation reactions, immunoturbidimetry, immunonephelometry, and latex agglutination. Label-free methods, such as latex agglutination, do not require labeling procedures and can quantify the target component by photometry at specific wavelengths in the ultraviolet, visible, and near-infrared regions. Therefore, all that is required is a general-purpose, compact spectroscopic device, making them easy to implement in small-scale medical facilities and the field of point-of-care testing (POCT). In particular, latex agglutination is a method that is relatively simple to prepare during reagent manufacturing. Furthermore, users simply add a sample to the latex reagent to initiate the measurement, and then measure at specific wavelengths in the ultraviolet, visible, and near-infrared regions for a set period of time. Measurement is typically completed within a few minutes to several tens of minutes, making it a rapid, simple, and versatile method. Preferably, in the present invention, anti-gastric parietal cell antibodies in a sample can be measured by an agglutination method, and more preferably, anti-gastric parietal cell antibodies in a sample can be measured by latex agglutination.

[0059] The carrier used in the agglutination method can be any known carrier material used in the field of immune agglutination reactions, without any particular limitations. Examples of such materials include synthetic polymer powders such as polystyrene, styrene-methacrylic acid copolymer, styrene-glycidyl (meth)acrylate copolymer, styrene-styrene sulfonate copolymer, methacrylic acid polymer, acrylic acid polymer, acrylonitrile-butadiene-styrene copolymer, vinyl chloride-acrylic acid ester copolymer, and polyvinyl acetate acrylate, and preferably latex, a uniform suspension of these. Other examples include other organic polymer powders, inorganic powders, microorganisms, blood cells, cell membrane fragments, and plastic microtiter plates. Examples of inorganic powders include metal pieces such as gold, titanium, and nickel, as well as silica and alumina.

[0060] The particle size of the carrier is usually 0.01 to 1.0 μm, more preferably 0.05 to 0.7 μm.

[0061] The reagent for measuring anti-gastric parietal cell antibodies of the present invention can be supported on a carrier by either physical adsorption or chemical bonding using covalent bonds. After the reagent for measuring anti-gastric parietal cell antibodies of the present invention is supported on a carrier, known substances such as BSA (bovine serum albumin), Block Ace, skim milk, and casein can be used as a blocking agent to cover the surface of the carrier that is not coated with the reagent for measuring anti-gastric parietal cell antibodies. The blocking agent may be subjected to pretreatment such as partial denaturation with heat, acid, alkali, etc., as needed.

[0062] In agglutination assays, a carrier dispersion carrying a reagent for measuring anti-gastric parietal cell antibodies is contacted with a sample containing anti-gastric parietal cell antibodies to initiate a reaction, and the formation of aggregates associated with the antigen-antibody reaction is quantified by measurement at specific wavelengths in the ultraviolet, visible, and near-infrared regions over a set period of time. Measurements are typically completed within a few minutes to a few hours. The reaction may be initiated using two liquids: the carrier dispersion and the sample. Alternatively, a solution containing a stabilizer or agglutination promoter may be separately prepared, and the reaction may be carried out using three liquids. The stabilizer or agglutination promoter may be contained in the carrier dispersion or the sample; these substances can be added as needed.

[0063] The stabilizer is not particularly limited as long as it stabilizes the various reagents and components during the reaction, or the progress of the reaction itself, and may include, for example, buffer solutions such as Good's buffer, synthetic or natural polymers such as polyethylene glycol and polysaccharides, surfactants, etc. The same applies when these substances act not only as stabilizers but also as promoters of the agglutination reaction. The various reagents and components during the reaction include, for example, a reagent for measuring anti-gastric parietal cell antibodies bound to a carrier, or an anti-gastric parietal cell antibody, and sugars or amino acids may be added to stabilize proteins such as antibodies and enzymes.

[0064] Examples of the aggregation promoter include synthetic or natural polymers such as polyethylene glycol, polyglycosyl methacrylate, polyvinylpyrrolidone, carboxymethylcellulose, dextran, pullulan, etc. Examples of surfactants having a similar effect include polyethylene glycol fatty acid monoester derivatives.

[0065] Any buffer solution that can be used has buffering capacity under the pH conditions under which a typical antigen-antibody reaction is carried out, and pH values ​​of 5 to 11, preferably 6 to 10, are used. Examples of buffer solutions that have buffering capacity under these pH conditions include phosphate buffer, Tris buffer, MES (2-morpholinoethanesulfonic acid) buffer, MOPS (3-morpholinopropane-1-sulfonic acid) buffer, HEPES (2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid) buffer, glycine buffer, citrate buffer, and Good's buffer. Any buffer solution that can be used in typical biochemical experiments, including Good's buffer, can be used. Furthermore, for liquids involved in agglutination reactions, such as dispersions of carriers carrying reagents for measuring anti-gastric parietal cell antibodies and samples containing anti-gastric parietal cell antibodies, surfactants, synthetic or natural polymers, organic and inorganic reagents, and the like can be added as needed. For example, surfactants known for immune agglutination reactions, such as nonionic, anionic, and cationic surfactants, can be used.

[0066] When an agglutination reaction accompanying an antigen-antibody reaction is carried out, the degree of agglutination can be measured by visual inspection, videography, etc., as well as spectroscopic methods. Spectroscopic measurement can be carried out by a known method using a reaction solution in which a dispersion of a carrier carrying a reagent for measuring anti-gastric parietal cell antibodies is brought into contact with a sample containing anti-gastric parietal cell antibodies, and for example, changes (increases or decreases) in scattered light intensity, absorbance, or transmitted light over the particle size, concentration, and reaction time of the carrier are measured.

[0067] Next, the present invention will be described with reference to examples, but the present invention is not limited to these examples.

[0068] Example 1 Preparation of Recombinant Antigen (1) Preparation of Recombinant Baculovirus A nucleic acid (SEQ ID NO: 4) encoding the amino acid sequence of the extracellular domain of human H / K-ATPase β subunit (amino acid residues 64-291: SEQ ID NO: 2) was synthesized and introduced into an insect cell expression vector pIEx-4 DNA Novagen (manufactured by Merck) to prepare an expression vector.

[0069] 25cm２ 2.0 x 10 in a flask ６ Sf9 cells were seeded onto the medium. 100 μL of PSFM-J1 medium (Fujifilm Wako Pure Chemical Industries, Ltd.) containing 2 μg of the vector DNA, 90 ng of baculovirus (AcNPV; Takara Bio Inc.) DNA, and 3 μL of ScreenFect Plus (Fujifilm Wako Pure Chemical Industries, Ltd.) was added. After culturing at 27°C for 7 days, the entire culture supernatant (cotransfection solution) was collected.

[0070] (2) Culture 1.5×10 ６ To 1 L of Sf9 cells diluted with PSFM-J1 medium to give a concentration of 1000 cells / mL, 1 / 200 the volume of the culture medium of the recombinant baculovirus solution (AcNPV) transfected with the target gene prepared in (1) was added, and the cells were cultured with shaking for 3 days at 27°C. After the predetermined time, the culture medium was recovered and centrifuged at 5000 x g for 30 minutes at 4°C, and the culture supernatant and precipitate were separated after centrifugation.

[0071] (3) Confirmation of Expression Using a portion of the sample collected from the culture medium, expression of the target protein was confirmed by CBB (Coomassie Brilliant Blue) staining and Western blotting using an anti-His-tag antibody. The results are shown in Figure 1. Each lane in Figure 1 indicates the following: M: Wide-View ＴＭ　 Prestained Protein Size Marker III 1: Cell fraction infected with recombinant human ATP4β protein-expressing virus 2: Culture supernatant infected with recombinant human ATP4β protein-expressing virus 3: Cell fraction infected with WAKO-BEVS (negative control) virus 4: Culture supernatant infected with WAKO-BEVS (negative control) virus

[0072] (4) Purification The culture supernatant of the insect cells obtained in (3) above was filtered through a 0.45 μm filter and purified by Ni Sepharose Excel. ＴＭThe sample before purification was added to a resin (Cytiva) and applied to an open column. The flow-through fraction was collected, and the target protein was eluted after washing the column. The target protein was detected in the purified fractions using CBB staining. Fractions containing a high concentration of the target product were pooled to obtain the recombinant antigen.

[0073] Example 2: Measurement of anti-gastric parietal cell antibodies in blood samples using recombinant antigen. 100 μL of the antigen solution (concentration 0.4 μg / well) obtained in Example 1 was added to an ELISA plate (Thermo scientific cat. 468867) and left to stand overnight at 6°C to immobilize the antigen on the plate. After washing with PBS-T, 300 μL of blocking solution (MES buffer 50 mmol / L, pH 6.0, 1% blocking polymer) was added to the plate, and blocking was carried out overnight at 6°C. 100 μL of a blood sample diluted 100-fold with PBS-T was added to the antigen-immobilized plate prepared above, and the plate was allowed to react for 1 hour at room temperature. After washing with PBS-T, 100 μL of peroxidase (POD)-labeled anti-human antibody (in-house product, 10 nmol / L) was added and the plate was allowed to react for 1 hour at room temperature. The cells were further washed with PBS-T, and 100 μL of a color reagent (3',3',5',5'-tetramethylbenzidine (TMB) solution; Fujifilm Wako Pure Chemical Industries, Ltd.) was added. After reacting at room temperature for 30 minutes, 100 μL of a stop solution (0.1 mol / L sulfuric acid) was added, and the OD (optical density) at 450 nm was measured. The reaction principle is shown in Figure 2. The OD measurement results at 450 nm are shown in Figure 3. As shown in Figure 3, a significant difference in OD was observed between patients with autoimmune gastritis (AIG) and the non-disease group (non-AIG).

[0074] Example 3: Estimation of antigen epitopes using commercially available antibodies. The antigen obtained in Example 1 was immobilized to magnetic particles (MagLapid) at a concentration of 3 μg per 1 mg. Next, 10 μg of a rabbit polyclonal antibody (anti-Hydrogen Potassium ATPase Beta / ATP4B antibody, product number ab176992, manufactured by ABCAM) prepared using the amino acid sequence (167-290 aa) of the extracellular domain of the human H+ / K+-ATPase β subunit as an antigen was added to 25 μg of the antigen-immobilized magnetic particles and allowed to react at room temperature for 1 hour. The magnetic particles were then dispensed into a cartridge, and a sample containing anti-gastric parietal cell antibodies was assayed using the Accuraseed automated chemiluminescent enzyme immunoassay system (solid phase and color reagents were separate) similar to that used in Example 2. As a result, the luminescence signal for particles reacted with the commercial antibody (bottom of Figure 4) was reduced to approximately 17-19.6% compared to when the commercial antibody was not reacted (top of Figure 4), as shown in the table below. This indicates that reaction inhibition occurs due to a competitive reaction between the commercial antibody and the antibody in the sample, and that there is a high possibility that the recognition sites of both antibodies overlap.

[0075]

[0076] Example 4 Measurement of Anti-Gastric Parietal Cell Antibodies Using a Latex Reagent (1) Recombinant Human H+ / K+-ATPase β Subunit-Sensitized Latex Reagent 0.5 ml of 5 mmol / L MES buffer (pH 5.5) containing 0.4 mg of the antigen obtained in Example 1 (a recombinant of the amino acid sequence of the extracellular domain of human H+ / K+-ATPase β subunit (amino acid residues 64-291: SEQ ID NO: 2)), 1% (W / V) polystyrene latex (average particle size 0.32 μm, manufactured by Nihon Kohden Corporation), and 5 mmol / L 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide Hydrochloride (WSC) (manufactured by Dojindo Laboratories) containing 0.2% (W / V) The mixture was mixed with 0.5 ml of MES buffer (pH 5.5) and incubated at 7°C for 18 hours. The latex was then separated by centrifugation and suspended in a 2.5% (W / V) aqueous solution of BSA (manufactured by WAKO CHEMICALS USA, INC.) to a latex concentration of 1% (W / V). The incubation was continued for 2 hours at room temperature. The latex was then separated by centrifugation and suspended in 20 mmol / L MOPS buffer (pH 7.0) containing 0.5% (W / V) BSA to a latex concentration of 1% (W / V). This was designated the human H / K-ATPase β subunit antigen-sensitized latex reagent solution [1].

[0077] (2) Preparation of measurement reagent solution A 20 mmol / L HEPES buffer solution (pH 7.0) containing 0.1% (W / V) BSA was used as reagent [2]. This reagent [2] and the human H / K-ATPase β subunit antigen-sensitized latex reagent solution [1] prepared in Example 4(1) above were used.

[0078] (3) Measurement Samples Four plasma samples purchased from Busicom Japan Co., Ltd. and six serum samples purchased from Trina Bioreactives AG were measured by the same ELISA method as in Example 2. OD values ​​of 0.5 or less were considered antibody-negative, and OD values ​​of 1.0 or more were considered antibody-positive. Five negative samples and five positive samples were used.

[0079] (4) Measurement of anti-gastric parietal cell antibodies (endpoint analysis: EPA method) The following measurement was performed using a JCA-BM9130 (manufactured by JEOL Ltd.). 1.5 μL of the measurement sample (3) above was mixed with 45 μL of reagent [2] and then incubated at 37°C for 5 minutes. Then, 15 μL of the human H / K-ATPase β subunit antigen-sensitized latex reagent [1] (1) above was mixed and incubated at 37°C for 5 minutes. The change in absorbance at 805 nm was measured from 30 seconds to 5 minutes after the addition of latex reagent [1].

[0080] (5) Results The measurement results are shown in Figure 5. As shown in Figure 5, a significant difference in OD x 10,000 was observed.

[0081] Example 5 Reactivity of Recombinant Antigens with Anti-Gastric Parietal Cell Antibodies in Blood Samples Using the same method as in Example 1, [1] a recombinant antigen of SEQ ID NO: 1 (amino acid residues 167-290) and [2] a recombinant antigen lacking the N-glycan at position 56 of SEQ ID NO: 1 by substituting N (asparagine) with A (alanine) at position 56 were prepared. Furthermore, [3] a human H+ / K+-ATPase β subunit antigen (MY BioSource) derived from Escherichia coli and lacking glycosylation was obtained. The above samples [1] to [3] were mixed with sample buffer (Fujifilm Wako Pure Chemical Corporation) at a ratio of 3:1. The mixture was heated at 98°C for 5 minutes, applied to a polyacrylamide gel, and electrophoresed at 200 V for 60 minutes, followed by SDS-PAGE. After electrophoresis, proteins were transferred to the membrane using a protein transfer device (Transblot Turbo: manufactured by BIORAD). The membrane was blocked with a 4% (w / v) solution of Block Ace Hunmatsu UK-B500 (Megmilk Snow Brand) at room temperature for 1 hour. The membrane was then reacted with plasma samples (3 positive and 3 negative) purchased from TRINA BIOREACTIVES AG at room temperature for 1 hour, and then reacted with a POD-labeled anti-human IgG antibody (self-made product). Chemiluminescence was then detected using ImmunoStar® Zeta (Fujifilm Wako Pure Chemical Industries).

[0082] The results are shown in Figure 6. As shown in Figure 6, no bands were observed in any of the series [1] to [3] in the negative specimen, while specific signals were observed in [1] and [2] in the positive specimen, indicating a reaction with the specimen.

Claims

1. A reagent for measuring anti-gastric parietal cell antibodies, comprising a protein having an N-linked glycan, which is any of the proteins (1) to (3) below: (1) a protein comprising at least the amino acid sequence of SEQ ID NO: 1; (2) a protein comprising at least an amino acid sequence having 90% or more sequence identity with SEQ ID NO: 1, and comprising an amino acid sequence capable of binding to anti-gastric parietal cell antibodies; or (3) a protein comprising at least an amino acid sequence in SEQ ID NO: 1 with one to several amino acids substituted, deleted, added, and / or inserted, and comprising an amino acid sequence capable of binding to anti-gastric parietal cell antibodies.

2. The reagent for measuring anti-gastric parietal cell antibodies according to claim 1, wherein the protein is any one of the proteins (4) to (6) below: (4) a protein comprising at least the amino acid sequence of SEQ ID NO: 2; (5) a protein comprising at least an amino acid sequence having 90% or more sequence identity with SEQ ID NO: 2 and comprising an amino acid sequence capable of binding to anti-gastric parietal cell antibodies; or (6) a protein comprising at least an amino acid sequence in SEQ ID NO: 2 with one to several amino acids substituted, deleted, added and / or inserted, and comprising an amino acid sequence capable of binding to anti-gastric parietal cell antibodies.

3. The reagent for measuring anti-gastric parietal cell antibodies according to claim 1, wherein the N-linked sugar chain is bound to the 27th amino acid residue in SEQ ID NO:

1.

4. The reagent for measuring anti-gastric parietal cell antibodies according to claim 1, wherein the N-linked sugar chains are bound to the 27th and 56th amino acid residues in SEQ ID NO:

1.

5. A kit for measuring anti-gastric parietal cell antibodies, comprising the reagent for measuring anti-gastric parietal cell antibodies according to claim 1 or 2, and a labeled anti-gastric parietal cell antibody binding substance.

6. A method for measuring anti-gastric parietal cell antibodies in a sample, which comprises contacting the sample with the reagent for measuring anti-gastric parietal cell antibodies according to claim 1 or 2, which may have a label.

7. The method according to claim 6, wherein anti-gastric parietal cell antibodies in a sample are measured by latex agglutination.

8. The method according to claim 6, wherein anti-gastric parietal cell antibodies in a sample are measured based on the label.

9. The method of claim 6, wherein the sample is whole blood, serum, plasma, or urine.

Images