Subsequent nucleic acid sequence storage device and method for storing subsequent nucleic acid sequence using same

Abstract

Provided is a subsequent nucleic acid sequence storage device. A subsequent nucleic acid sequence storage device according to an embodiment may comprise: a step for dividing a reference nucleic acid sequence into continuously fragmented fragments of a predetermined length, assigning a position identifier (PI) to each of the fragments, and assigning sequence identifiers (SIs) to nucleic acid sequences included in each of the fragments of the reference nucleic acid sequence; a step for aligning a subsequent nucleic acid sequence to the reference nucleic acid; a step for assigning PIs to fragments of the subsequent nucleic acid sequence respectively corresponding to the fragments of the reference nucleic acid sequence to which the PIs have been assigned, and assigning an SI to the nucleic acid sequence included in each of the fragments; and a step for storing the PIs and SIs for the fragments of the subsequent nucleic acid sequence in a nucleic acid sequence database.

Description

Subsequent nucleic acid sequence storage device and method for storing subsequent nucleic acid sequence using the same

[0001] The present invention relates to a subsequent nucleic acid sequence storage device and a method for storing subsequent nucleic acid sequences using the same.

[0002] Traditionally, nucleic acid sequences were stored and managed by downloading them from public databases. Public databases like NCBI or GISAID were often utilized.

[0003] However, because databases such as NCBI or GISAD contain a large number of nucleic acid sequences, downloading them from them requires considerable time, and storing them in a separate database also requires significant time and cost. Furthermore, when new nucleic acid sequences are added to NCBI or GISAD databases or existing stored nucleic acid sequences are modified, the difficulty of having to re-download all nucleic acid sequences within the database presents itself.

[0004] Conventional methods required a fresh download of all nucleic acid sequences, regardless of whether they contained overlapping sequences. For example, even if some of the newly added sequences were already stored in the database, all sequences had to be downloaded and stored anew, regardless of whether they were duplicates. Therefore, despite the redundant information, they were stored in the database in an overlapping fashion, resulting in an unnecessary increase in storage space.

[0005] In particular, in pandemic situations such as severe acute respiratory syndrome coronavirus (SARS-CoV-2), when the nucleic acid sequences of a species or similar species, such as NCBI or GISAD, increased explosively, there was a need to continuously update the nucleic acid sequences of the same or similar species. In this case, all updated nucleic acid sequences were newly downloaded, and even though some of the nucleic acid sequences were already stored, the entire nucleic acid sequence had to be downloaded again. In this case, the repeated storage of duplicate nucleic acid sequences to update the information of the explosively increasing nucleic acid sequences inevitably resulted in inefficient use of storage space. Furthermore, when re-extracting the nucleic acid sequences stored in the database and retrieving the required nucleic acid sequences, the duplicate nucleic acid sequences had to be searched again, which slowed down the processing speed of the nucleic acid sequence extraction operation.

[0006] (Prior art literature)

[0007] (Patent Document)

[0008] Korean Patent Publication No. 10-2015-0016572 (published on February 12, 2015)

[0009] The problem to be solved by this specification is to efficiently use storage space when storing subsequent nucleic acid sequences that partially overlap with already stored nucleic acid sequences in a database.

[0010] Another challenge addressed by the present disclosure is to facilitate the extraction of stored subsequent nucleic acid sequences, saving time and cost.

[0011] However, the problems to be solved described in this specification are not limited to the problems mentioned above, and other problems not mentioned can be clearly understood by those skilled in the art of the present invention from the description below.

[0012] A method for storing a subsequent nucleic acid sequence according to one embodiment may include the steps of dividing a reference nucleic acid sequence into consecutively fragmented fragments of a predetermined length, assigning a PI (position identifier) ​​to each of the fragments, and assigning an SI (sequence identifier) ​​to a nucleic acid sequence included in each of the fragments of the reference nucleic acid sequence, aligning the subsequent nucleic acid sequence to the reference nucleic acid sequence, assigning a PI to a fragment of the subsequent nucleic acid sequence corresponding to each of the fragments of the reference nucleic acid sequence to which the PI has been assigned, and assigning an SI to a nucleic acid sequence included in each of the fragments, and storing the PI and SI for the fragments of the subsequent nucleic acid sequence in the nucleic acid sequence database.

[0013] In one embodiment, the reference nucleic acid sequence may be a nucleic acid sequence of an animal, plant, fungi, protozoa, bacteria, or virus.

[0014] In one embodiment, the reference nucleic acid sequence may be a respiratory virus selected from the group consisting of an influenza virus nucleic acid sequence, a respiratory syncytial virus (RSV) nucleic acid sequence, an adenovirus nucleic acid sequence, an enterovirus nucleic acid sequence, a parainfluenza virus nucleic acid sequence, a metapneumovirus (MPV) nucleic acid sequence, a bocavirus nucleic acid sequence, a rhinovirus nucleic acid sequence, and / or a coronavirus nucleic acid sequence.

[0015] In one embodiment, the predetermined length to which the reference nucleic acid sequence is fragmented may be the same or different depending on the species to which the reference nucleic acid sequence belongs.

[0016] In one embodiment, the SI assigned to each of the fragments of the subsequent nucleic acid sequence may be assigned in such a way that if the nucleic acid sequence of the fragment of the subsequent nucleic acid sequence is identical to the nucleic acid sequence of the fragment of the reference nucleic acid sequence, the identifier of the SI assigned to the fragment of the reference nucleic acid sequence is assigned, and if they are different, a new identifier is assigned.

[0017] In one embodiment, the SI assigned to each of the fragments of the reference nucleic acid sequence and the SI assigned to each of the fragments of the subsequent nucleic acid sequence can be stored in a reference database by matching their nucleic acid sequences.

[0018] In one embodiment, the nucleic acid sequences matching the SI of each of the reference nucleic acid sequence and the subsequent nucleic acid sequence stored in the reference database may be different from each other.

[0019] In one embodiment, the SI assigned with the novel identifier is stored in a reference database together with a nucleic acid sequence matching the SI, and the reference database can store data assigned with identifiers for different nucleic acid sequences.

[0020] In one embodiment, the nucleic acid sequence database may include SI matching the PI of each of the reference nucleic acid sequence and the subsequent nucleic acid sequence.

[0021] In one embodiment, the step of aligning the subsequent nucleic acid sequence to the reference nucleic acid sequence may align the subsequent nucleic acid sequence to correspond to a fragment of the reference nucleic acid sequence by reflecting a region in which an insertion mutation or a deletion mutation occurred in the subsequent nucleic acid sequence.

[0022] In one embodiment, when the subsequent nucleic acid sequence comprises an insertion or deletion mutation, a fragment of the subsequent nucleic acid sequence corresponding to the PI comprising the insertion or deletion mutation may have a different length from a fragment of the reference nucleic acid sequence.

[0023] In one embodiment, the method further includes the steps of aligning an additional subsequent nucleic acid sequence obtained after the subsequent nucleic acid sequence to the reference nucleic acid sequence, assigning a PI to a fragment of the additional subsequent nucleic acid sequence corresponding to each of the fragments of the reference nucleic acid sequence to which the PI is assigned, and assigning SI to a nucleic acid sequence included in each of the fragments of the additional subsequent nucleic acid sequence, wherein the SI assigned to each of the fragments of the additional subsequent nucleic acid sequence may be an identifier indicating whether the previously stored subsequent nucleic acid sequence and the reference nucleic acid sequence are the same or different from the additional subsequent nucleic acid sequence before the additional subsequent nucleic acid sequence is stored.

[0024] In one embodiment, the method may further include obtaining subsequent nucleic acid sequences from the nucleic acid sequence database and the reference database.

[0025] In one embodiment, the step of obtaining a subsequent nucleic acid sequence from the nucleic acid sequence database and the reference database includes the step of generating a query including at least one of genetic information and nucleic acid sequence section information for the subsequent nucleic acid sequence, and reconstructing nucleic acid sequence information corresponding to the query using the nucleic acid sequence database and the reference database.

[0026] In one embodiment, the step of reconstructing the nucleic acid sequence information into nucleic acid sequence information corresponding to the query may include, when the query is genetic information of a nucleic acid sequence, a step of designating PIs corresponding to the genetic information of the query among the subsequent nucleic acid sequences, a step of continuously connecting the nucleic acid sequences of the SI assigned to the nucleic acid sequences included in the designated PIs, and a step of trimming both ends of the continuously connected nucleic acid sequences to a region corresponding to the genetic information of the query.

[0027] In one embodiment, the step of reconstructing the nucleic acid sequence information into nucleic acid sequence information corresponding to the query may include, when the query is nucleic acid sequence section information, a step of designating PIs corresponding to the section information of the query among the subsequent nucleic acid sequences, a step of continuously connecting the SI nucleic acid sequences assigned to the nucleic acid sequences included in the designated PIs, and a step of trimming both ends of the continuously connected nucleic acid sequences to a region corresponding to the section information of the query.

[0028] According to another embodiment, a subsequent nucleic acid sequence storage device is a device for storing a subsequent nucleic acid sequence using a reference nucleic acid sequence including continuously fragmented fragments of a predetermined length, the device including a memory storing at least one command, a network, and a processor, wherein the processor executes the at least one command to divide the reference nucleic acid sequence into continuously fragmented fragments of a predetermined length, assign a PI (position identifier) ​​to each of the fragments, and assign an SI (sequence identifier) ​​to a nucleic acid sequence included in each of the fragments of the reference nucleic acid sequence, a step of aligning the subsequent nucleic acid sequence to the reference nucleic acid sequence, an instruction for assigning a PI to a fragment of the subsequent nucleic acid sequence corresponding to each of the fragments of the reference nucleic acid sequence to which the PI has been assigned, and assigning an SI to a nucleic acid sequence included in each of the fragments, the PI assigned to each of the fragments of the subsequent nucleic acid sequence is an identifier corresponding to the PI of the reference nucleic acid sequence, and each of the fragments of the subsequent nucleic acid sequence is an identifier corresponding to the PI of the reference nucleic acid sequence. The assigned SI is an identifier representing whether a fragment of the reference nucleic acid sequence corresponding to the PI of the subsequent nucleic acid sequence is the same as or different from a fragment of the subsequent nucleic acid sequence, and may include instructions for obtaining a nucleic acid sequence database including PI and SI for fragments of the subsequent nucleic acid sequence.

[0029] According to another embodiment, a computer-readable recording medium is provided, which is a computer-readable recording medium storing a computer program, wherein the computer program comprises: a step of dividing a reference nucleic acid sequence including continuously fragmented fragments of a predetermined length into continuously fragmented fragments of a predetermined length, assigning a PI (position identifier) ​​to each of the fragments, and assigning an SI (sequence identifier) ​​to a nucleic acid sequence included in each of the fragments of the reference nucleic acid sequence; a step of aligning the subsequent nucleic acid sequence to the reference nucleic acid sequence; a step of assigning a PI to a fragment of the subsequent nucleic acid sequence corresponding to each of the fragments of the reference nucleic acid sequence to which the PI has been assigned, and assigning an SI to a nucleic acid sequence included in each of the fragments; the PI assigned to each of the fragments of the subsequent nucleic acid sequence is an identifier corresponding to the PI of the reference nucleic acid sequence, and the SI assigned to each of the fragments of the subsequent nucleic acid sequence determines whether a fragment of the reference nucleic acid sequence corresponding to the PI of the subsequent nucleic acid sequence is the same as or different from a fragment of the subsequent nucleic acid sequence. The method may be programmed to perform the steps of: obtaining a nucleic acid sequence database including PI and SI for fragments of the subsequent nucleic acid sequence, wherein the identifier is an identifier representing the nucleic acid sequence;

[0030] According to another embodiment, a computer program stored in a computer-readable recording medium, the computer program comprising: a step of dividing a reference nucleic acid sequence including continuously fragmented fragments of a predetermined length into continuously fragmented fragments of a predetermined length, assigning a PI (position identifier) ​​to each of the fragments, and assigning an SI (sequence identifier) ​​to a nucleic acid sequence included in each of the fragments of the reference nucleic acid sequence; a step of aligning the subsequent nucleic acid sequence to the reference nucleic acid sequence; a step of assigning a PI to a fragment of the subsequent nucleic acid sequence corresponding to each of the fragments of the reference nucleic acid sequence to which the PI has been assigned, and assigning an SI to a nucleic acid sequence included in each of the fragments; the PI assigned to each of the fragments of the subsequent nucleic acid sequence is an identifier corresponding to the PI of the reference nucleic acid sequence, and the SI assigned to each of the fragments of the subsequent nucleic acid sequence is an identifier representing whether a fragment of the reference nucleic acid sequence corresponding to the PI of the subsequent nucleic acid sequence is the same as or different from a fragment of the subsequent nucleic acid sequence; and It can be programmed to perform a step including obtaining a nucleic acid sequence database including PI and SI for fragments of the above subsequent nucleic acid sequence.

[0031] According to one embodiment, when storing subsequent nucleic acid sequences in a database, there is an advantage of using less database storage space than before by storing them using identifiers.

[0032] According to one embodiment, even when the number of nucleic acid sequences of the same species or similar species increases explosively, it is possible to save time and cost for extracting nucleic acid sequences from a database without repeatedly storing nucleic acid sequences that overlap with already stored nucleic acid sequences.

[0033] FIG. 1 is a diagram conceptually illustrating an operation of a nucleic acid sequence storage device according to one embodiment of the present invention to obtain a nucleic acid sequence from a public database.

[0034] FIG. 2 is a flowchart illustrating steps of a method for storing a subsequent nucleic acid sequence according to one embodiment.

[0035] Figure 3 is a drawing showing an example of alignment of an acquired reference nucleic acid sequence and a subsequent nucleic acid sequence.

[0036] FIG. 4 is a diagram showing an example of dividing a reference nucleic acid sequence and a subsequent nucleic acid sequence into consecutively fragmented fragments of a predetermined length and assigning a PI (position identifier) ​​to each of the fragments.

[0037] Figure 5 is a drawing showing an example of aligning a subsequent nucleic acid sequence to a reference nucleic acid sequence by taking into account a deletion mutation that occurred in the subsequent nucleic acid sequence.

[0038] Figure 6 is a diagram showing an example in which a PI is assigned to each of the consecutively fragmented fragments of a predetermined length in the subsequent nucleic acid sequence of Figure 5.

[0039] Figure 7 is a drawing showing an example of aligning a subsequent nucleic acid sequence to a reference nucleic acid sequence by taking into account insertion mutations that occurred in the subsequent nucleic acid sequence.

[0040] Figure 8 is a diagram showing an example in which a PI is assigned to each of the consecutively fragmented fragments of a predetermined length in the subsequent nucleic acid sequence of Figure 7.

[0041] Figure 9 is a diagram showing the process of assigning PI to a reference nucleic acid sequence and providing a sequence identifier (SI).

[0042] Figure 10 is a diagram showing a process of assigning PI and granting SI to additional subsequent nucleic acid sequences stored after Figure 9.

[0043] FIG. 11 is a diagram showing an example of a reference database to which SI is assigned through the process of FIGS. 9 and 10.

[0044] Figure 12 is a drawing showing an example of the obtained nucleic acid sequence database.

[0045] Figure 13 is a diagram conceptually illustrating an operation of obtaining a subsequent nucleic acid sequence from a nucleic acid sequence database.

[0046] Figure 14 is a diagram showing an example of specifying a fragment corresponding to a query using PI and SI stored in a database.

[0047] Figure 15 is a diagram showing an example of interval information of a query of a nucleic acid sequence.

[0048] Figure 16 is a hardware configuration diagram of a nucleic acid sequence storage device according to one embodiment.

[0049] The advantages and features of the present invention, and the methods for achieving them, will become clearer with reference to the embodiments described in detail below together with the accompanying drawings. However, the present invention is not limited to the embodiments disclosed below and may be implemented in various different forms. Only one embodiment is provided to ensure that the disclosure of the present invention is complete and to fully inform those skilled in the art of the scope of the invention, and the present invention is defined solely by the scope of the claims.

[0050] When describing embodiments of the present invention, detailed descriptions of known functions or configurations will be omitted if they are deemed to unnecessarily obscure the gist of the invention. Furthermore, the terms described below are defined in light of their functions in the embodiments of the present invention and may vary depending on the intent or custom of the user or operator. Therefore, their definitions should be based on the overall content of this specification.

[0051] Before explaining Figure 1, let us look at the terms used herein.

[0052] As used herein, the term "nucleic acid sequence" refers to a nucleotide polymer of DNA or RNA and can be used in the same sense as a base sequence. A nucleic acid sequence encompasses all nucleic acid information, whether a biological structure itself or in bioinformatics. This nucleic acid sequence may be a nucleic acid sequence contained in any type of organism.

[0053] An organism as used in this disclosure may mean an organism belonging to a genus, species, subspecies, subtype, genotype, sirotype, strain, isolate or cultivar. The organism may be a prokaryotic cell (e.g., Mycoplasma pneumoniae, Chlamydophila pneumoniae, Legionella pneumophila, Haemophilus influenzae, Streptococcus pneumoniae, Bordetella pertussis, Bordetella parapertussis, Neisseria meningitidis, Listeria monocytogenes, Streptococcus agalactiae, Campylobacter, Clostridium difficile, Clostridium perfringens, Salmonella, Escherichia coli, Shigella, Vibrio, Yersinia enterocolitica, Aeromonas, Chlamydia trachomatis, Neisseria gonorrhoeae, Trichomonas vaginalis, Mycoplasma hominis, Mycoplasma genitalium, Ureaplasma urealyticum, Ureaplasma parvum, Mycobacterium tuberculosis, Treponema pallidum, Candida, Mobiluncus, Megasphaera, Lacto spp., Mycoplasma genitalium, Clostridium difficile, Helicobacter Pylori, ClariR, CPE, Group B Streptococcus, Enterobacter cloacae complex, Proteus mirabilis, Klebsiella aerogenes, Pseudomonas aeruginosa, Klebsiella oxytoca, Serratia marcescens, Klebsiella pneumoniae, Actinomycetaceae actinotignum, Enterococcus faecium, Staphylococcus epidermidis, Enterococcus faecalis, Staphylococcus saprophyticus, Staphylococcus aureus, Acinetobacter baumannii, Morganella morganii, Aerococcus urinae, Pantoea aglomerans, Citrobacter Freundii, Providencia stuartii, Citrobacter koseri, Streptococcus anginosus, Trichophyton mentagrophytes complex, Microsporum spp., Trichophyton rubrum, Epidermophyton floccosum, Trichophyton tonsurans), eukaryotic cells (e.g., protozoa and parasites, fungi, yeasts, higher plants, lower animals and higher animals including mammals and humans), viruses or viroids.Among the above eukaryotic cells, parasites may include, for example, Giardia lamblia, Entamoeba histolytica, Cryptosporidium, Blastocystis hominis, Dientamoeba fragilis, Cyclospora cayetanensis, stercoralis, trichiura, hymenolepis, Necator americanus, Enterobius vermicularis, Taenia spp., Ancylostoma duodenale, Ascaris lumbricoides, Enterocytozoon spp. / Encephalitozoon spp. Viruses may include, for example, influenza A virus (Flu A), influenza B virus (Flu B), respiratory syncytial virus A (RSV A), respiratory syncytial virus B (RSV B), Covid-19 virus, parainfluenza virus 1 (PIV 1), parainfluenza virus 2 (PIV 2), parainfluenza virus 3 (PIV 3), parainfluenza virus 4 (PIV 4), metapneumovirus (MPV), human enterovirus (HEV), human bocavirus (HBoV), human rhinovirus (HRV), coronaviruses and adenoviruses that cause respiratory illness, and norovirus, rotavirus, adenovirus, astrovirus and sapovirus that cause gastrointestinal illness.As another example, the virus may include human papillomavirus (HPV), Middle East respiratory syndrome-related coronavirus (MERS-CoV), Dengue virus, Herpes simplex virus (HSV), Human herpes virus (HHV), Epstein-Barr virus (EMV), Varicella zoster virus (VZV), Cytomegalovirus (CMV), HIV, Parvovirus B19, Parechovirus, Mumps, Dengue virus, Chikungunya virus, Zika virus, West Nile virus, hepatitis virus, and poliovirus. The target analyte may be GBS serotype, bacterial colony, v600e. The target analyte in the present disclosure may include various analyte objects such as bacteria as well as the aforementioned viruses, and may also be a specific region of a gene cut using CRISPR technology, and the scope of the target analyte is not limited to the aforementioned examples.

[0054] The "biological classification system" in this disclosure refers to a classification system for distinguishing the scope of an organism. For example, a classification system expressed as Species, Genus, Family, Order, Class, Phylum, Kingdom, and Domain may be included within the scope of the "biological classification system" in this disclosure. For example, the biological classification system according to one embodiment of the present disclosure may have a hierarchical structure. The hierarchical structure may refer to a biological system structure in which an upper layer encompasses a lower layer.

[0055] FIG. 1 is a diagram conceptually illustrating an operation of a nucleic acid sequence storage device according to one embodiment of the present invention to obtain a nucleic acid sequence from a public database.

[0056] Here, since Fig. 1 is merely exemplary, the spirit of the present invention is not to be construed as being limited to what is illustrated in Fig. 1. For example, the database that provides subsequent nucleic acid sequences so that the subsequent nucleic acid sequence storage device (100) can obtain the subsequent nucleic acid sequences may be an external database other than the illustrated public database (1).

[0057] Referring to FIG. 1, the subsequent nucleic acid sequence storage device (100) may be connected to a database and a network. The network may refer to a wireless or wired network that provides data transmission and reception between the subsequent nucleic acid sequence storage device (100) and the subsequent nucleic acid sequence storage device (100). Among these, in the case of a wireless network, for example, at least one of LTE (long-term evolution), LTE-A (LTE advance), CDMA (code division multiple access), WCDMA (wideband CDMA), UMTS (universal mobile telecommunications system), WiBro (Wireless Broadband), WiFi (wireless fidelity), Bluetooth (Bluetooth), NFC (near field communication), and GNSS (global navigation stellite system) may be included. Additionally, in the case of a wired network, it may include at least one of, but is not limited to, USB (universal serial bus), HDMI (high definition multimedia interface), RS-232 (recommended standard232), LAN (Local Area Network), WAN (Wide Area Network), Internet, and telephone network.

[0058] The public database (1) that provides the nucleic acid sequence in the subsequent nucleic acid sequence storage device (100) may be a database that stores and manages information related to biological information and provides the nucleic acid sequence. In one embodiment, the public database (1) may be a database of the National Center for Biotechnology Information (NCBI) or the Global Initiative on Sharing Avian Flu Data (GISAID), but is not limited thereto.

[0059] A subsequent nucleic acid sequence storage device (100) according to one embodiment can store a reference nucleic acid sequence and a subsequent nucleic acid sequence obtained from a public database (1). The reference nucleic acid sequence may be a nucleic acid sequence that serves as a standard for a nucleic acid sequence for a specific pathogen. In one embodiment, the reference nucleic acid sequence may be a nucleic acid sequence that is first obtained among the subsequent nucleic acid sequences. In another embodiment, the reference nucleic acid sequence may be a nucleic acid sequence other than the first obtained nucleic acid sequence.

[0060] The reference nucleic acid sequence may be a nucleic acid sequence of an animal, plant, fungi, protozoa, bacteria or virus.

[0061] In one embodiment, the reference nucleic acid sequence is an influenza virus nucleic acid sequence, a respiratory syncytial virus (RSV) nucleic acid sequence, an adenovirus nucleic acid sequence, an

[0062] It may be a respiratory virus selected from the group consisting of, but not limited to, a telovirus nucleic acid sequence, a parainfluenza virus nucleic acid sequence, a metapneumovirus (MPV) nucleic acid sequence, a bocavirus nucleic acid sequence, a rhinovirus nucleic acid sequence, and / or a coronavirus nucleic acid sequence.

[0063] A subsequent nucleic acid sequence may refer to a nucleic acid sequence other than a reference nucleic acid sequence among the nucleic acid sequences stored in a subsequent nucleic acid sequence storage device (100) for a specific pathogen. In one embodiment, all nucleic acid sequences obtained in a subsequent nucleic acid sequence storage device (100) other than the reference nucleic acid sequence may be referred to as a subsequent nucleic acid sequence.

[0064] The subsequent nucleic acid sequence storage device (100) can store subsequent nucleic acid sequences after storing a reference nucleic acid sequence. The number of subsequent nucleic acid sequences is at least one, and may be plural. The number of subsequent nucleic acid sequences is not limited.

[0065] The subsequent nucleic acid sequence storage device (100) can store a reference nucleic acid sequence and a subsequent nucleic acid sequence using its own database (2) capable of storing and managing nucleic acid sequences. The subsequent nucleic acid sequence storage device (100)'s own database (2) capable of storing and managing nucleic acid sequences may be a database provided in the subsequent nucleic acid sequence storage device (100) or a database provided in a separate device. In one embodiment, the own database (2) may be implemented in the cloud. The implementation method of the subsequent nucleic acid sequence storage device (100)'s own database (2) for storing and managing nucleic acid sequences is not limited thereto and may be implemented in various ways.

[0066] A subsequent nucleic acid sequence storage device (100) can fragment a reference nucleic acid sequence and store it as a collection of multiple fragments. The reference nucleic acid sequence may include consecutively fragmented fragments of a predetermined length. Here, the predetermined length may be a length of a pre-designated nucleic acid sequence and may be constant for each fragment.

[0067] The subsequent nucleic acid sequence storage device (100) can assign a PI (position identifier) ​​to each fragment of the reference nucleic acid sequence and can assign an SI (sequence identifier) ​​to the nucleic acid sequence included in each fragment. Here, PI means an identifier that can identify the fragment, and SI means an identifier that can identify the nucleic acid sequence included in the fragment, which will be described in detail later.

[0068] A reference nucleic acid sequence can be divided into consecutively fragmented fragments of a predetermined length. A subsequent nucleic acid sequence storage device (100) can divide the reference nucleic acid sequence into consecutively fragmented fragments of a predetermined length, assign a PI to each of the fragments, and assign an SI to the nucleic acid sequence contained in each of the fragments of the reference nucleic acid sequence.

[0069] The subsequent nucleic acid sequence storage device (100) can store PI and SI for fragments of the subsequent nucleic acid sequence in the nucleic acid sequence database (2).

[0070] A subsequent nucleic acid sequence storage device (100) according to one embodiment can effectively use the storage space of a database by storing subsequent nucleic acid sequences in the above manner.

[0071] Hereinafter, the operation of the subsequent nucleic acid sequence storage device (100) will be examined with reference to FIGS. 2 to 13. Here, the entity performing each step is a computing device. In one embodiment, the computing device may be the subsequent nucleic acid sequence storage device (100).

[0072] FIG. 2 is a flowchart illustrating steps of a method for storing a subsequent nucleic acid sequence according to one embodiment.

[0073] In step S100 of FIG. 2, a PI may be assigned to each fragment of the reference nucleic acid sequence, and an SI may be assigned to the nucleic acid sequence included in each fragment. Here, PI refers to an identifier that can identify the fragment, and SI refers to an identifier that can identify the nucleic acid sequence included in the fragment, which will be described in detail later.

[0074] A reference nucleic acid sequence can be divided into consecutively fragmented fragments of a predetermined length. A subsequent nucleic acid sequence storage device (100) can divide the reference nucleic acid sequence into consecutively fragmented fragments of a predetermined length, assign a PI to each of the fragments, and assign an SI to the nucleic acid sequence contained in each of the fragments of the reference nucleic acid sequence.

[0075] Thereafter, in step S200, the subsequent nucleic acid sequence may be aligned to the reference nucleic acid sequence. Here, alignment performs sequence alignment for the sequence. Alignment is an operation of comparing nucleic acid sequences to find similar sections in order to reveal functional and structural correlations between DNA, RNA, or protein sequences. A well-known sequence and an unknown nucleic acid sequence are aligned, or two unknown nucleic acid sequences are aligned, wherein the well-known sequence is referred to as the reference nucleic acid sequence or reference sequence. The alignment used in the present specification may be performed in a manner such as global alignment, local alignment, pairwise sequence alignment, or multiple sequence alignment using a conventionally known algorithm. The above-described alignment method is not limited thereto, and may be various methods capable of aligning the subsequent nucleic acid sequence to the reference nucleic acid sequence.

[0076] In step S300, a PI (position identifier) ​​may be assigned to a fragment of a subsequent nucleic acid sequence corresponding to each of the fragments of the reference nucleic acid sequence, and an SI may be assigned to a nucleic acid sequence included in each of the fragments. At this time, the PI assigned to each of the fragments of the subsequent nucleic acid sequence is an identifier corresponding to the PI of the reference nucleic acid sequence. The SI assigned to each of the fragments of the subsequent nucleic acid sequence is an identifier representing whether the fragment of the reference nucleic acid sequence corresponding to the PI of the subsequent nucleic acid sequence and the fragment of the subsequent nucleic acid sequence are the same or different.

[0077] As used herein, the term "sequence identifier" refers to an identifier that represents a specific nucleic acid sequence (e.g., a DNA sequence, an RNA sequence). For example, a sequence identifier may include an annotated sequence name (e.g., a gene name). Examples of annotated sequence names may include sequence names annotated in publicly accessible sequence databases (e.g., GenBank, EMBL, DDBJ, and GSD). For example, a sequence identifier may include an arbitrarily assigned sequence identifier. An example of an arbitrarily assigned sequence identifier may be a sequence identifier (ID) assigned to every sequence fragment generated by fragmentation of a whole genome sequence. For example, the whole genome sequence of Chlamydia trachomatis may be fragmented by a sequence fragmentation algorithm for fragmenting the genome sequence, and, if necessary, may be fragmented and merged, and every sequence fragment thus generated may be assigned a sequence identifier. For example, if a fragment comprises 100 fragments, the fragments may be assigned SEQID1 to SEQID100. In this specification, it is exemplified that if a fragment contains 100 fragments and each fragment is different, the fragment is assigned a sequence identifier of Arabic numerals 1 to 100.

[0078] The subsequent nucleic acid sequence storage device (100) may be configured as a data structure including a PI for each fragment and an SI representing a unique nucleic acid sequence for each PI when storing a reference nucleic acid sequence and a subsequent nucleic acid sequence. This subsequent nucleic acid sequence storage device (100) can store subsequent nucleic acid sequences in an efficient space by assigning a PI to the acquired subsequent nucleic acid sequence and granting an SI. A storage method using this data structure will be described later.

[0079] In step S400, a nucleic acid sequence database (2) including PI and SI for fragments of subsequent nucleic acid sequences can be obtained. The stored nucleic acid sequence database (2) here is a database that stores and manages nucleic acid sequences stored in a subsequent nucleic acid sequence storage device (100), and can provide the stored subsequent nucleic acid sequences to the subsequent nucleic acid sequence storage device (100).

[0080] To examine more specific operations, the following description will be given with reference to Figures 3 to 10.

[0081] Figure 3 is a drawing showing an example of alignment of an acquired reference nucleic acid sequence and a subsequent nucleic acid sequence.

[0082] As shown in Fig. 3, the reference nucleic acid sequence and the subsequent nucleic acid sequence may have the same length. The reference nucleic acid sequence may include sequences from sequence 0 to 499, and the subsequent nucleic acid sequence may also include sequences from sequence 0 to 499. In this case, both the reference nucleic acid sequence and the subsequent nucleic acid sequence may be full sequences.

[0083] FIG. 4 is a diagram showing an example of dividing a reference nucleic acid sequence and a subsequent nucleic acid sequence into consecutively fragmented fragments of a predetermined length and assigning a PI to each of the fragments.

[0084] The subsequent nucleic acid sequence storage device (100) can divide the reference nucleic acid sequence into consecutively fragmented fragments of a predetermined length. For example, when there are a total of 30,000 reference nucleic acid sequences, the subsequent nucleic acid sequence storage device (100) can divide them into consecutively fragmented fragments of 100 lengths. In this case, the reference nucleic acid sequence is fragmented into a total of 300 fragments, and the fragments of the reference nucleic acid sequence can be assigned PIs from P1 to P300.

[0085] The length of the fragments dividing the above reference nucleic acid sequence may be 10 bp to 100 bp, 10 bp to 500 bp, 10 bp to 1000 bp, 10 bp to 10,000 bp, 50 bp to 100 bp, 50 bp to 500 bp, 50 bp to 1000 bp or 50 bp to 10,000 bp, but is not limited thereto.

[0086] The predetermined length to which the reference nucleic acid sequence is fragmented may vary depending on the biological taxonomy to which the reference nucleic acid sequence belongs. In one embodiment, the predetermined length may be the same or different depending on the species to which the reference nucleic acid sequence belongs. In FIG. 4, the subsequent nucleic acid sequence storage device (100) divided the reference nucleic acid sequence from 0 to 499 into consecutively fragmented fragments of a total of 100 lengths. The subsequent nucleic acid sequence storage device (100) assigned P1, P2, P3, P4, and P5 as PIs to each of the consecutively fragmented fragments as shown in FIG. 4. As shown in FIG. 4, the P1 fragment of the reference nucleic acid sequence may include nucleic acid sequences from 0 to 99, the P2 fragment may include nucleic acid sequences from 100 to 199, the P3 fragment may include nucleic acid sequences from 200 to 299, the P4 fragment may include nucleic acid sequences from 300 to 399, and the P5 fragment may include nucleic acid sequences from 400 to 499.

[0087] Likewise, the subsequent nucleic acid sequence storage device (100) can divide the subsequent nucleic acid sequence into consecutively fragmented fragments of a predetermined length.

[0088] In one embodiment, the predetermined length to which the subsequent nucleic acid sequence is fragmented is the same as the predetermined length to which the reference nucleic acid sequence is fragmented. The subsequent nucleic acid sequence storage device (100) divided the subsequent nucleic acid sequences from 1 to 500 into consecutively fragmented fragments of a total of 100 lengths. The subsequent nucleic acid sequence storage device (100) assigned P1, P2, P3, P4, and P5 as PIs to each of the consecutively fragmented fragments, as shown in FIG. 4.

[0089] Similarly, as shown in FIG. 4, the P1 fragment of the subsequent nucleic acid sequence may include nucleic acid sequences from 0 to 99, the P2 fragment may include nucleic acid sequences from 100 to 199, the P3 fragment may include nucleic acid sequences from 200 to 299, the P4 fragment may include nucleic acid sequences from 300 to 399, and the P5 fragment may include nucleic acid sequences from 400 to 499.

[0090] The subsequent nucleic acid sequence storage device (100) can be aligned to correspond to a fragment of a reference nucleic acid sequence by reflecting a region in which an insertion mutation or a deletion mutation has occurred in the subsequent nucleic acid sequence. Hereinafter, a method for assigning PI when a mutation has occurred in the subsequent nucleic acid sequence will be described with reference to FIGS. 5 to 8.

[0091] When aligning a subsequent nucleic acid sequence to the reference nucleic acid sequence, the alignment can be performed to correspond to a fragment of the reference nucleic acid sequence by reflecting a region in which an insertion mutation or a deletion mutation occurred in the subsequent nucleic acid sequence.

[0092] If the subsequent nucleic acid sequence contains an insertion or deletion mutation, the fragment of the subsequent nucleic acid sequence corresponding to the PI containing the insertion or deletion mutation may be different in length from the fragment of the reference nucleic acid sequence.

[0093] Figure 5 is a diagram showing an example of aligning a subsequent nucleic acid sequence to a reference nucleic acid sequence by taking into account a deletion mutation that occurred in the subsequent nucleic acid sequence.

[0094] When a deletion mutation occurs in a subsequent nucleic acid sequence, when the subsequent nucleic acid sequence is aligned with a reference nucleic acid sequence, it can be aligned to correspond to the reference nucleic acid sequence by reflecting the deleted region, as shown in Fig. 5.

[0095] As shown in FIG. 6, the subsequent nucleic acid sequence storage device (100) can fragment the subsequent nucleic acid sequence to correspond to the continuously fragmented reference nucleic acid sequence. In this case, a fragment including a region in which a deletion mutation does not occur among the subsequent nucleic acid sequences can be fragmented into a predetermined length identical to the reference nucleic acid sequence. A fragment including a region in which a deletion mutation occurs among the subsequent nucleic acid sequences is fragmented into a length different from the reference predetermined length. In one embodiment, the total length of the subsequent nucleic acid sequence may be shorter than that of a fragment of the reference nucleic acid sequence when a deletion mutation occurs in the subsequent nucleic acid sequence.

[0096] As shown in Fig. 6, a deletion mutation occurred across the fragments of P3 and P4 in the subsequent nucleic acid sequence, and the subsequent nucleic acid sequence storage device (100) aligned the subsequent nucleic acid sequence to the reference nucleic acid sequence by reflecting the region where the deletion mutation occurred between the P3 fragment and the P4 fragment.

[0097] Figure 7 is a drawing showing an example of aligning a subsequent nucleic acid sequence to a reference nucleic acid sequence by taking into account insertion mutations that occurred in the subsequent nucleic acid sequence.

[0098] When an insertion mutation occurs in a subsequent nucleic acid sequence, when the subsequent nucleic acid sequence is aligned with a reference nucleic acid sequence, the subsequent nucleic acid sequence can be aligned to correspond to the reference nucleic acid sequence by reflecting the inserted region as shown in FIG. 7. As shown in FIG. 8, the subsequent nucleic acid sequence storage device (100) can fragment the subsequent nucleic acid sequence to correspond to the continuously fragmented reference nucleic acid sequence. In this case, a fragment including a region in which an insertion mutation does not occur among the subsequent nucleic acid sequences can be fragmented to a predetermined length identical to the reference nucleic acid sequence. A fragment including a region in which an insertion mutation occurs among the subsequent nucleic acid sequences is fragmented to a length different from the reference predetermined length. In one embodiment, the total length of the subsequent nucleic acid sequence may be longer than that of a fragment of the reference nucleic acid sequence when an insertion mutation occurs in the subsequent nucleic acid sequence.

[0099] As shown in FIG. 8, an insertion mutation occurred across the fragments of P1 and P2 in the subsequent nucleic acid sequence, and the subsequent nucleic acid sequence storage device (100) aligned the subsequent nucleic acid sequence to the reference nucleic acid sequence by reflecting the region where the insertion mutation occurred between the P1 fragment and the P2 fragment.

[0100] Figure 9 is a diagram showing the process of assigning PI to a reference nucleic acid sequence and providing a sequence identifier (SI).

[0101] As shown in Fig. 9, each fragment can be stored as a reference database including PI and SI representing a unique nucleic acid sequence for each PI and a nucleic acid sequence corresponding to the SI.

[0102] Here, the reference database is a database for searching for a nucleic acid sequence corresponding to a fragment of SI using SI, and may have the same configuration as the nucleic acid sequence database (2) described above or a different configuration, and the form of the configuration in which the reference database is implemented is not limited thereto.

[0103] The subsequent nucleic acid sequence storage device (100) can store the nucleic acid sequence in a reference database as shown in FIG. 9. The subsequent nucleic acid sequence storage device (100) can assign the same identifier to a fragment of the subsequent nucleic acid sequence if it is identical to a fragment of the reference nucleic acid sequence, and can assign a different identifier to a fragment of the subsequent nucleic acid sequence if it is different from a fragment of the reference nucleic acid sequence.

[0104] That is, the SI assigned to each fragment of the subsequent nucleic acid sequence can be assigned in such a way that if the nucleic acid sequence of the fragment of the subsequent nucleic acid sequence is identical to the nucleic acid sequence of the fragment of the reference nucleic acid sequence, the identifier of the SI already assigned to the fragment of the reference nucleic acid sequence is assigned, and if they are different, a new identifier is assigned.

[0105] At this time, when the reference nucleic acid sequence is initially stored, if there is no previously stored nucleic acid sequence, a unique identifier may be assigned to all fragments of the reference nucleic acid sequence. In one embodiment, the subsequent nucleic acid sequence storage device (100) may store nucleic acid sequences by PI, and may store them by assigning the same SI to the same nucleic acid sequences, and may store them by assigning different SIs to different nucleic acid sequences in the reference database.

[0106] The SI assigned to each fragment of the reference nucleic acid sequence and the SI assigned to each fragment of the subsequent nucleic acid sequence may be stored in a reference database by matching their nucleic acid sequences. The nucleic acid sequences matching the SI of each of the reference nucleic acid sequence and the subsequent nucleic acid sequence stored in the reference database may be different from each other.

[0107] In addition, the SI assigned to each fragment of the additional subsequent nucleic acid sequence obtained after the subsequent nucleic acid sequence is assigned by considering both the previously stored subsequent nucleic acid sequence and the reference nucleic acid sequence.

[0108] For example, the subsequent nucleic acid sequence storage device (100) can apply the identifier of the SI assigned to the additional subsequent nucleic acid sequence if the fragment of the additional subsequent nucleic acid sequence is the same as the previously stored subsequent nucleic acid sequence and reference nucleic acid sequence, and can assign a new identifier if the fragment is different from the previously stored subsequent nucleic acid sequence and reference nucleic acid sequence.

[0109] A reference database may store SIs with new identifiers and nucleic acid sequences corresponding to the SIs. The nucleic acid sequences are divided into fragments of a predetermined length from the subsequent nucleic acid sequences, and the nucleic acid sequences contained in each fragment are called subsequences.

[0110] As shown in the example of Fig. 9, it is assumed that fragments obtained by fragmenting the reference nucleic acid sequence exist from P1 to P300, and that the nucleic acid sequence of P1 is "ATCGCGCATGC...", the nucleic acid sequence of P2 is "AAAAGATGCTCA...", the nucleic acid sequence of P3 is "AGATGGCAACGG...", and the nucleic acid sequence of P300 is "CTAATTCAGGGTC...".

[0111] When a subsequent nucleic acid sequence storage device (100) obtains a reference nucleic acid sequence, since there is no identical nucleic acid sequence among the previously stored nucleic acid sequences, it can assign a unique SI to the nucleic acid sequences of all fragments of the reference nucleic acid sequence. The reference nucleic acid sequence can assign an SI of "1" to all fragmented fragments.

[0112] The SI of the nucleic acid sequence "ATCGCGCATGC..." of P1 of the reference nucleic acid sequence can be assigned as 1. The SI of the nucleic acid sequence "AAAAGATGCTCA..." of P2 of the reference nucleic acid sequence can be assigned as 1. That is, the storage device (100) can assign SI as 1 while storing "ATCGCGCATGC..." of P1 of the reference nucleic acid sequence, and can assign SI as 1 while storing "AAAAGATGCTCA..." of P2.

[0113] Here, the SI of P1 of the reference nucleic acid sequence is assigned as "1", and the SI of P2 is also assigned as "1". In one embodiment, the SI assigned to each fragment of the reference nucleic acid sequence may be an identifier of the same type assigned to each fragmented fragment. That is, the SI assigned to each of multiple fragments may all be Arabic numerals. Although it is expressed that the same value of SI is assigned to each of multiple fragments, different values ​​of SI may be assigned to each fragment depending on the implementation example.

[0114] In another embodiment, the SI assigned to each fragment of the reference nucleic acid sequence may be assigned a different type of identifier for each fragmented fragment. For example, the SI of P1 of the reference nucleic acid sequence may be assigned the Arabic numeral "1," and the SI of P2 of the reference nucleic acid sequence may be assigned the English letter "a." This is merely one example of implementation, and the SI may be assigned in various ways.

[0115] As shown in Fig. 12, the reference nucleic acid sequences can be stored as fragments of P1, P2, P3, P4, P5 to P300 in the nucleic acid sequence database (2) as {1, 1, 1, 1, 1, ..., 1}.

[0116] When using a conventional storage method, the reference nucleic acid sequence can be stored as "ATCGCGCATGC AAAAGATGCTCAAGATGGCAACGG ... CTAATTCAGGGTC...".

[0117] In this way, the subsequent nucleic acid sequence storage device (100) according to one embodiment can store nucleic acid sequences in a smaller capacity compared to conventional storage methods.

[0118] Figure 10 is a diagram showing a process of assigning PI and granting SI to additional subsequent nucleic acid sequences stored after Figure 9.

[0119] A method for storing a subsequent nucleic acid sequence (seq.1) is described with reference to FIG. 10.

[0120] The PI assigned to each fragment of the subsequent nucleic acid sequence is an identifier corresponding to the PI of the reference nucleic acid sequence. The SI assigned to each fragment of the subsequent nucleic acid sequence is an identifier indicating whether the fragment of the reference nucleic acid sequence corresponding to the PI of the subsequent nucleic acid sequence is identical or different from the fragment of the subsequent nucleic acid sequence.

[0121] For example, it is assumed that fragments of the subsequent nucleic acid sequence (seq. 1) are assigned PIs so that they correspond to the reference nucleic acid sequence and exist from P1 to P300. At this time, it is assumed that the nucleic acid sequence of P1 of the subsequent nucleic acid sequence (seq. 1) is "ATCGCGCATGC...", the nucleic acid sequence of P2 is "AGTTGCAATCAC...", the nucleic acid sequence of P3 is "AGATGGCAACGG...", and the nucleic acid sequence of P300 is "CTAATTCAGGGTC...".

[0122] In this case, the subsequent nucleic acid sequence storage device (100) can search for the nucleic acid sequence stored in the existing fragment of P1 in order to store the nucleic acid sequence "ATCGCGCATGC..." of P1 of the subsequent nucleic acid sequence (seq. 1). The nucleic acid sequence "ATCGCGCATGC..." is already stored in P1 of the reference database stored in FIG. 10. In this case, the subsequent nucleic acid sequence storage device (100) uses the SI of the already stored nucleic acid sequence "ATCGCGCATGC..." as is, and therefore does not store the nucleic acid sequence "ATCGCGCATGC..." separately.

[0123] The subsequent nucleic acid sequence storage device (100) can search for a nucleic acid sequence stored in a fragment of an existing P2 in order to store the nucleic acid sequence "AGTTGCAATCAC..." of P2 of the subsequent nucleic acid sequence (seq. 1). Since the nucleic acid sequence identical to the nucleic acid sequence "AGTTGCAATCAC..." is not stored in P2 of the reference database stored in FIG. 10, the nucleic acid sequence "AGTTGCAATCAC..." is assigned an SI other than the previously assigned SI of "1." In FIG. 10, the SI of the nucleic acid sequence "AGTTGCAATCAC..." of P2 is assigned as "2."

[0124] The subsequent nucleic acid sequence storage device (100) can search for "AGATGGCAACGG..." in the nucleic acid sequence stored in the P3 fragment in the data structure and search for "CTAATTCAGGGTC..." in the nucleic acid sequence stored in the P3 fragment in the data structure to store the nucleic acid sequence "AGATGGCAACGG..." of P3 of the subsequent nucleic acid sequence (seq. 1) and the nucleic acid sequence "CTAATTCAGGGTC..." of P300. In the reference database stored in Fig. 10, the nucleic acid sequence "AGATGGCAACGG..." is already stored in P3, and the nucleic acid sequence "CTAATTCAGGGTC..." is already stored in P3 of the reference database.

[0125] Since the subsequent nucleic acid sequence storage device (100) uses the SI of the nucleic acid sequence "AGATGGCAACGG..." already stored in P3 as is, it does not separately store the nucleic acid sequence "AGATGGCAACGG...". Similarly, since the subsequent nucleic acid sequence storage device (100) uses the SI of the nucleic acid sequence "CTAATTCAGGGTC..." already stored in P300 as is, it does not separately store the nucleic acid sequence "CTAATTCAGGGTC...".

[0126] Referring to FIG. 12, the subsequent nucleic acid sequence (seq. 1) may be stored as fragments of P1, P2, P3, to P300 in the nucleic acid sequence database (2) as {1, 2, 4, 1, 5, ..., 4}.

[0127] Referring again to FIG. 10, a method for storing additional subsequent nucleic acid sequences (seq.2) is described.

[0128] In one embodiment, when storing an additional subsequent nucleic acid sequence, the subsequent nucleic acid sequence storage device (100) can compare a previously stored subsequent nucleic acid sequence with a reference nucleic acid sequence before storing the additional subsequent nucleic acid sequence to assign an SI to the subsequent nucleic acid sequence.

[0129] The subsequent nucleic acid sequence storage device (100) can obtain an additional subsequent nucleic acid sequence after the subsequent nucleic acid sequence. The subsequent nucleic acid sequence storage device (100) can assign an SI to a unique fragment among the fragments of the additional subsequent nucleic acid sequence obtained. The subsequent nucleic acid sequence storage device (100) can assign the same identifier to the additional subsequent nucleic acid sequence if it is identical to the previously stored subsequent nucleic acid sequence and the reference nucleic acid sequence, and can assign a different identifier to the additional subsequent nucleic acid sequence if it is different from the previously stored nucleic acid sequence and the reference nucleic acid sequence.

[0130] That is, the SI assigned to each fragment of the subsequent nucleic acid sequence (seq. 2) may be an identifier representing whether the fragment of the reference nucleic acid sequence (ref) corresponding to the PI of the subsequent nucleic acid sequence (seq. 2) and the fragment of the previously stored subsequent nucleic acid sequence (seq. 1) before storing the subsequent nucleic acid sequence (seq. 2) are identical to or different from the fragment of the subsequent nucleic acid sequence.

[0131] For example, it is assumed that fragments of the subsequent nucleic acid sequence (seq. 2) are assigned PIs so that they correspond to the reference nucleic acid sequence and exist from P1 to P300. At this time, it is assumed that the nucleic acid sequence of P1 of the subsequent nucleic acid sequence is "ATCGCGCATGC...", the nucleic acid sequence of P2 is "AGTTGCAATCAC...", the nucleic acid sequence of P3 is "AGCGCGGATGC...", and the nucleic acid sequence of P300 is "CTAATTCAGGGTC...".

[0132] In this case, the subsequent nucleic acid sequence storage device (100) can search for the nucleic acid sequence stored in the existing fragment of P1 in order to store the nucleic acid sequence "ATCGCGCATGC..." of P1 of the subsequent nucleic acid sequence (seq. 2). Since the nucleic acid sequence "ATCGCGCATGC..." is already stored in P1 of the reference database stored in FIG. 10, the subsequent nucleic acid sequence storage device (100) uses the SI of the already stored nucleic acid sequence "ATCGCGCATGC..." as is, and thus does not store the nucleic acid sequence "ATCGCGCATGC..." separately.

[0133] The subsequent nucleic acid sequence storage device (100) can search for the nucleic acid sequence stored in the existing fragment of P2 in order to store the nucleic acid sequence "AGTTGCAATCAC..." of P2 of the subsequent nucleic acid sequence (seq. 2). In the reference database stored in Fig. 10, a nucleic acid sequence identical to the nucleic acid sequence "AGTTGCAATCAC..." is already stored in "2" of SI. Since the subsequent nucleic acid sequence storage device (100) uses the SI of the already stored nucleic acid sequence "AGTTGCAATCAC..." as is, it does not separately store the nucleic acid sequence "AGTTGCAATCAC...".

[0134] The subsequent nucleic acid sequence storage device (100) can search for the nucleic acid sequence stored in the fragment of the existing P3 in order to store the nucleic acid sequence "AGCGCGGATGC..." of P3 of the subsequent nucleic acid sequence (seq. 2). In the reference database stored in Fig. 10, a nucleic acid sequence identical to the nucleic acid sequence "AGCGCGGATGC..." is already stored in "2" of SI in P3. Since the subsequent nucleic acid sequence storage device (100) uses the SI of the already stored nucleic acid sequence "AGCGCGGATGC..." as is, it does not separately store the nucleic acid sequence "AGCGCGGATGC...".

[0135] Likewise, the subsequent nucleic acid sequence storage device (100) can search for the nucleic acid sequence "CTAATTCAGGGTC..." in the nucleic acid sequence stored in the P300 fragment in the data structure to store the nucleic acid sequence "CTAATTCAGGGTC..." of P300 of the subsequent nucleic acid sequence (seq. 2). The nucleic acid sequence "CTAATTCAGGGTC..." is already stored in P300 of the reference database stored in FIG. 10.

[0136] Since the subsequent nucleic acid sequence storage device (100) uses the SI of the nucleic acid sequence "CTAATTCAGGGTC..." already stored in P300, it does not separately store the partial sequence "CTAATTCAGGGTC...".

[0137] Below, we will describe an example of a reference database stored in this manner.

[0138] The reference database constructed in this manner is then used to reconstruct the entire subsequent nucleic acid sequence using the partial sequence corresponding to SI.

[0139] As shown in Fig. 12, the subsequent nucleic acid sequence (seq.2) can be stored as {2, 2, 5, 1, 5, ..., 1} in the nucleic acid sequence database (2) as fragments of P1, P2, P3, to P300.

[0140] In this way, when storing a nucleic acid sequence that overlaps with a nucleic acid sequence that has already been stored, the subsequent nucleic acid sequence storage device (100) does not repeatedly store the overlapping nucleic acid sequence, and when storing it in the nucleic acid sequence database (2), only the SI can be stored in the PI of each fragment.

[0141] That is, compared to the conventional storage method of storing the subsequent nucleic acid sequence (seq. 2) in the nucleic acid sequence database (2) as ATCGCGCATGC...AGTTGCAATCAC...AGCGCGGATGC...CTAATTCAGGGTC...", the subsequent nucleic acid sequence storage device (100) according to one embodiment can store only information consisting of SI of the subsequent nucleic acid sequence (seq. 2) in the nucleic acid sequence database (2).

[0142] FIG. 11 is a diagram showing an example of a reference database to which SI is assigned through the process of FIGS. 9 and 10.

[0143] The reference database (1) can store data to which identifiers for different nucleic acid sequences are assigned. Through the processes of FIGS. 9 and 10, the SI of the nucleic acid sequence "ATCGCGCATGC..." can be assigned as 1, the SI of the nucleic acid sequence "AAAAGATGCTCA..." can be assigned as 2, the SI of the nucleic acid sequence "AGATGGCAACGG..." can be assigned as 3, the SI of the nucleic acid sequence "CTAATTCAGGGTC..." can be assigned as 4, and the SI of the nucleic acid sequence "GCGTGAGCGCG..." can be assigned as 240. Here, the SI assigned with a new identifier, such as SI 240, can be stored in the reference database together with the matching nucleic acid sequence.

[0144] According to one embodiment, when storing subsequent nucleic acid sequences in a database, there is an advantage in that less database storage space is used compared to the existing method by storing them using a reference database (1).

[0145] Fig. 13 is a diagram conceptually illustrating an operation of obtaining a subsequent nucleic acid sequence from a nucleic acid sequence database (2), and Fig. 14 is a diagram illustrating an example of specifying a fragment corresponding to a query using PI and SI stored in the database.

[0146] In one embodiment, the subsequent nucleic acid sequence storage device (100) can extract subsequent nucleic acid sequences corresponding to the generated query from the nucleic acid sequence database (2) and the reference database. At this time, the query generated to extract the subsequent nucleic acid sequence may include at least one of genetic information and nucleic acid sequence section information for the subsequent nucleic acid sequence.

[0147] At this time, the subsequent nucleic acid sequence storage device (100) can reconstruct the nucleic acid sequence information into nucleic acid sequence information corresponding to the query.

[0148] That is, the subsequent nucleic acid sequence storage device (100) can use the SI stored in the nucleic acid sequence database (2) to reference the reference database (1) in which the SI and the partial sequence corresponding to the SI are stored, and can use the referenced result to reconstruct the nucleic acid sequence information into nucleic acid sequence information corresponding to the query.

[0149] In one embodiment, when the query is genetic information of a nucleic acid sequence, the subsequent nucleic acid sequence storage device (100) can designate fragments corresponding to the genetic information of the query among the subsequent nucleic acid sequences.

[0150] Figure 15 is a diagram showing an example of interval information of a query of a nucleic acid sequence.

[0151] As shown in Fig. 15, when the location of the gene corresponding to the genetic information of the nucleic acid sequence is from nucleic acid sequence number 150 to nucleic acid sequence number 297, the subsequent nucleic acid sequence storage device (100) can designate fragments P2 to P4 for all nucleic acid sequences stored in the nucleic acid sequence database (2).

[0152] Specifically, when the query is genetic information of a nucleic acid sequence, the subsequent nucleic acid sequence storage device (100) can designate PIs corresponding to the genetic information of the query among the subsequent nucleic acid sequences, continuously connect the nucleic acid sequences of the SI assigned to the nucleic acid sequences included in the designated PIs, and trim both ends of the continuously connected nucleic acid sequences to a region corresponding to the genetic information of the query.

[0153] The subsequent nucleic acid sequence storage device (100) can combine partial sequences matching the designated fragments into a continuously connected nucleic acid sequence. Thereafter, the subsequent nucleic acid sequence storage device (100) can fragment both ends of the fragments to which the partial sequences are combined into regions corresponding to the genetic information of the query. That is, the subsequent nucleic acid sequence storage device (100) can fragment the nucleic acid sequence located before the 150th nucleic acid sequence and fragment the nucleic acid sequence located after the 297th nucleic acid sequence for post-processing.

[0154] Similarly, if the query is nucleic acid sequence section information, fragments of the nucleic acid sequence corresponding to the section information of the query can be designated among subsequent nucleic acid sequences.

[0155] Specifically, when the query is nucleic acid sequence section information, the subsequent nucleic acid sequence storage device (100) can designate PIs corresponding to the section information of the query among the subsequent nucleic acid sequences, continuously connect the SI nucleic acid sequences assigned to the nucleic acid sequences included in the designated PIs, and trim both ends of the continuously connected nucleic acid sequences to an area corresponding to the section information of the query.

[0156] As shown in FIG. 14, the subsequent nucleic acid sequence storage device (100) can designate fragments P2 to P4, which are fragments corresponding to nucleic acid sequences No. 150 to 297 among the nucleic acid sequences stored in the nucleic acid sequence database (2). The subsequent nucleic acid sequence storage device (100) can combine partial sequences matching the designated fragments into a continuously connected nucleic acid sequence. Thereafter, the subsequent nucleic acid sequence storage device (100) can fragment both ends of the fragments to which the partial sequences are combined into regions corresponding to the genetic information of the query. That is, the subsequent nucleic acid sequence storage device (100) can fragment the nucleic acid sequence located before the nucleic acid sequence No. 150 and fragment the nucleic acid sequence located after the nucleic acid sequence No. 297 for post-processing. According to one embodiment, even when the number of nucleic acid sequences of the same species or similar species increases explosively, it is possible to save time and cost for extracting nucleic acid sequences from a database without repeatedly storing nucleic acid sequences that overlap with already stored nucleic acid sequences.

[0157] Figure 16 is a hardware configuration diagram of a nucleic acid sequence storage device according to one embodiment.

[0158] A component, module, or portion in the present disclosure includes a routine, procedure, program, component, reference database, or the like that performs a particular task or implements a particular abstract data type. Furthermore, those skilled in the art will readily appreciate that the methods presented in the present disclosure can be implemented with other computer system configurations, including single-processor or multiprocessor computing systems, minicomputers, mainframe computers, as well as personal computers, handheld computing devices, microprocessor-based or programmable consumer electronics, and the like, each of which may be operatively connected to one or more associated devices.

[0159] The embodiments described in this disclosure can also be implemented in distributed computing environments, where certain tasks are performed by remote processing devices that are connected through a communications network. In a distributed computing environment, program modules may be located in both local and remote memory storage devices.

[0160] Computing devices typically include a variety of computer-readable media. Computer-readable media can be any media accessible by a computer, including volatile and nonvolatile media, transitory and non-transitory media, removable and non-removable media. By way of example, and not limitation, computer-readable media can include computer-readable storage media and computer-readable transmission media.

[0161] Computer-readable storage media includes volatile and nonvolatile media, transitory and non-transitory media, removable and non-removable media implemented in any method or technology for storing information such as computer-readable instructions, reference databases, program modules, or other data. Computer-readable storage media includes, but is not limited to, RAM, ROM, EEPROM, flash memory or other memory technology, CD-ROM, digital video disks (DVD) or other optical disk storage, magnetic cassettes, magnetic tape, magnetic disk storage or other magnetic storage devices, or any other medium that can be accessed by a computer and used to store the desired information.

[0162] Computer-readable transmission media typically embodies computer-readable instructions, reference databases, program modules, or other data in a modulated data signal, such as a carrier wave or other transport mechanism, and includes any information delivery media. The term modulated data signal means a signal that has one or more of its characteristics set or changed so as to encode information in the signal. By way of example, and not limitation, computer-readable transmission media includes wired media, such as a wired network or direct-wired connection, and wireless media, such as acoustic, RF, infrared, or other wireless media. Combinations of any of the above are also intended to be included within the scope of computer-readable transmission media.

[0163] An exemplary environment (2000) implementing various aspects of the present invention is illustrated, including a computer (2002), which includes a processing unit (2004), a system memory (2006), and a system bus (2008). The computer (2000) herein may be used interchangeably with a computing device. The system bus (2008) connects system components, including but not limited to the system memory (2006), to the processing unit (2004). The processing unit (2004) may be any of a variety of commercially available processors. Dual processors and other multiprocessor architectures may also be utilized as the processing unit (2004).

[0164] The system bus (2008) may be any of several types of bus structures that may be additionally interconnected to a memory bus, a peripheral bus, and a local bus using any of a variety of commercial bus architectures. The system memory (2006) includes read-only memory (ROM) (2010) and random access memory (RAM) (2012). A basic input / output system (BIOS) is stored in non-volatile memory (2010), such as ROM, EPROM, or EEPROM, and contains basic routines that help transfer information between components within the computer (2002), such as during start-up. The RAM (2012) may also include high-speed RAM, such as static RAM, for caching data.

[0165] The computer (2002) also includes an internal hard disk drive (HDD) (2014) (e.g., EIDE, SATA), a magnetic floppy disk drive (FDD) (2016) (e.g., for reading from or writing to a removable diskette (2018)), a solid state drive (SSD), and an optical disk drive (2020) (e.g., for reading from or writing to a CD-ROM disk (2022) or other high-capacity optical media such as a DVD). The hard disk drive (2014), the magnetic disk drive (2016), and the optical disk drive (2020) may be connected to the system bus (2008) by a hard disk drive interface (2024), a magnetic disk drive interface (2026), and an optical drive interface (2028), respectively. The interface (2024) for implementing an external drive includes, for example, at least one or both of Universal Serial Bus (USB) and IEEE 1394 interface technologies.

[0166] These drives and their associated computer-readable media provide nonvolatile storage of data, data structures, computer-executable instructions, and the like. In the case of the computer (2002), the drives and media correspond to storing any data in a suitable digital format. While the description of computer-readable storage media above refers to HDDs, removable magnetic disks, and removable optical media such as CDs or DVDs, those skilled in the art will appreciate that other types of computer-readable storage media, such as zip drives, magnetic cassettes, flash memory cards, cartridges, and the like, may also be used in the exemplary operating environment, and that any such media may contain computer-executable instructions for performing the methods of the present invention.

[0167] A number of program modules, including an operating system (2030), one or more application programs (2032), other program modules (2034), and program data (2036), may be stored in the drive and RAM (2012). All or portions of the operating system, applications, modules, and / or data may also be cached in RAM (2012). It will be appreciated that the present invention may be implemented in various commercially available operating systems or combinations of operating systems.

[0168] A user may enter commands and information into the computer (2002) via one or more wired / wireless input devices, such as a keyboard (2038) and a pointing device such as a mouse (2040). Other input devices (not shown) may include a microphone, an IR remote control, a joystick, a game pad, a stylus pen, a touch screen, and the like. These and other input devices are often connected to the processing unit (2004) via an input device interface (2042) that is connected to the system bus (2008), but may be connected by other interfaces such as a parallel port, an IEEE 1394 serial port, a game port, a USB port, an IR interface, and the like.

[0169] A monitor (2044) or other type of display device is also connected to the system bus (2008) via an interface, such as a video adapter (2046). In addition to the monitor (2044), the computer typically includes other peripheral output devices (not shown), such as speakers, a printer, and so on.

[0170] The computer (2002) may operate in a networked environment using logical connections to one or more remote computers, such as remote computer(s) (2048), via wired and / or wireless communications. The remote computer(s) (2048) may be a workstation, a server computer, a router, a personal computer, a portable computer, a microprocessor-based entertainment device, a peer device, or other conventional network node, and generally include many or all of the components described for the computer (2002), although for simplicity, only the memory storage device (2050) is shown. The logical connections shown include wired / wireless connections to a local area network (LAN) (2052) and / or a larger network, such as a wide area network (WAN) (2054). Such LAN and WAN networking environments are common in offices and companies and facilitate enterprise-wide computer networks, such as intranets, all of which may be connected to a worldwide computer network, such as the Internet.

[0171] When used in a LAN networking environment, the computer (2002) is connected to a local network (2052) via a wired and / or wireless communication network interface or adapter (2056). The adapter (2056) may facilitate wired or wireless communications to the LAN (2052), which may also include a wireless access point installed therein for communicating with the wireless adapter (2056). When used in a WAN networking environment, the computer (2002) may include a modem (2058), be connected to a communications server on the WAN (2054), or have other means for establishing communications over the WAN (2054), such as via the Internet. The modem (2058), which may be internal or external and wired or wireless, is connected to the system bus (2008) via a serial port interface (2042). In a networked environment, program modules described for the computer (2002) or portions thereof may be stored in a remote memory / storage device (2050). It will be appreciated that the network connections depicted are exemplary and that other means of establishing a communications link between the computers may be used.

[0172] The computer (2002) communicates with any wireless device or object that is configured and operates via wireless communication, such as a printer, a scanner, a desktop and / or portable computer, a portable data assistant (PDA), a communication satellite, any equipment or location associated with a radio-detectable tag, and a telephone. This includes at least Wi-Fi and Bluetooth wireless technologies. Accordingly, the communication may be a predefined structure, as in a conventional network, or may simply be an ad hoc communication between at least two devices.

[0173] Meanwhile, the method according to the various embodiments described above can be implemented in the form of a computer program stored in a computer-readable recording medium programmed to perform each step of the method, and can also be implemented in the form of a computer-readable recording medium storing a computer program programmed to perform each step of the method.

[0174] The above description is merely an illustrative illustration of the technical idea of ​​the present invention, and those skilled in the art will appreciate that various modifications and variations can be made without departing from the essential quality of the present invention. Therefore, the embodiments disclosed in the present invention are intended to illustrate, rather than limit, the technical idea of ​​the present invention, and the scope of the technical idea of ​​the present invention is not limited by these embodiments. The scope of protection of the present invention should be interpreted by the following claims, and all technical ideas within a scope equivalent thereto should be interpreted as being included within the scope of the rights of the present invention.

Claims

1. A method for storing a subsequent nucleic acid sequence using a reference nucleic acid sequence including continuously fragmented fragments of a predetermined length, A step of dividing the above reference nucleic acid sequence into consecutively fragmented fragments of a predetermined length, assigning a PI (position identifier) to each of the fragments, and assigning a SI (sequence identifier) to the nucleic acid sequence included in each of the fragments of the above reference nucleic acid sequence; A step of aligning the above subsequent nucleic acid sequence to the above reference nucleic acid sequence; A step of assigning a PI to a fragment of a subsequent nucleic acid sequence corresponding to each of the fragments of the reference nucleic acid sequence to which the PI is assigned, and assigning SI to a nucleic acid sequence included in each of the fragments; the PI assigned to each of the fragments of the subsequent nucleic acid sequence is an identifier corresponding to the PI of the reference nucleic acid sequence, and the SI assigned to each of the fragments of the subsequent nucleic acid sequence is an identifier representing whether the fragment of the reference nucleic acid sequence corresponding to the PI of the subsequent nucleic acid sequence and the fragment of the subsequent nucleic acid sequence are the same or different, and characterized by comprising a step of storing PI and SI for fragments of the subsequent nucleic acid sequence in a nucleic acid sequence database. A method for storing subsequent nucleic acid sequences.

2. In paragraph 1, The above reference nucleic acid sequence is, Characterized by being a nucleic acid sequence of an animal, plant, fungi, protozoa, bacteria or virus A method for storing subsequent nucleic acid sequences.

3. In paragraph 1, The above reference nucleic acid sequence is, Influenza virus nucleic acid sequence, respiratory syncytial virus (RSV) nucleic acid sequence, adenovirus nucleic acid sequence, A respiratory virus characterized by being selected from the group consisting of a telovirus nucleic acid sequence, a parainfluenza virus nucleic acid sequence, a metapneumovirus (MPV) nucleic acid sequence, a bocavirus nucleic acid sequence, a rhinovirus nucleic acid sequence, and / or a coronavirus nucleic acid sequence. A method for storing subsequent nucleic acid sequences.

4. In paragraph 1, The predetermined length to which the above reference nucleic acid sequence is fragmented is Characterized in that the above reference nucleic acid sequence is identical or different depending on the species to which it belongs. A method for storing subsequent nucleic acid sequences.

5. In paragraph 1, The SI assigned to each of the fragments of the above subsequent nucleic acid sequence is If the nucleic acid sequence of the fragment of the above subsequent nucleic acid sequence is identical to the nucleic acid sequence of the fragment of the above reference nucleic acid sequence, the identifier of the SI previously assigned to the fragment of the above reference nucleic acid sequence is assigned, and if it is different, a new identifier is assigned. A method for storing subsequent nucleic acid sequences.

6. In paragraph 1, The SI assigned to each fragment of the above reference nucleic acid sequence and the SI assigned to each fragment of the above subsequent nucleic acid sequence are characterized in that they are stored in a reference database by matching their nucleic acid sequences. A method for storing subsequent nucleic acid sequences.

7. In paragraph 6, The nucleic acid sequences matching the SI of each of the reference nucleic acid sequence and the subsequent nucleic acid sequence stored in the reference database are characterized in that they are different from each other. A method for storing subsequent nucleic acid sequences.

8. In paragraph 6, The SI to which the above new identifier has been assigned is, Stored in a reference database together with a nucleic acid sequence matching the above SI, The above reference database is, Characterized in that it stores data to which identifiers for different nucleic acid sequences are assigned. A method for storing subsequent nucleic acid sequences.

9. In paragraph 1, The above nucleic acid sequence database is, characterized in that it includes SI matching the PI of each of the above reference nucleic acid sequence and the above subsequent nucleic acid sequence. A method for storing subsequent nucleic acid sequences.

10. In paragraph 1, The step of aligning the above subsequent nucleic acid sequence to the above reference nucleic acid sequence comprises: It is characterized in that it aligns to correspond to a fragment of the reference nucleic acid sequence by reflecting a region where an insertion mutation or a deletion mutation occurred in the subsequent nucleic acid sequence. A method for storing subsequent nucleic acid sequences.

11. In paragraph 10, If the above subsequent nucleic acid sequence contains an insertion or deletion mutation, A fragment of the subsequent nucleic acid sequence corresponding to the PI including the above insertion or deletion mutation is characterized in that its length is different from that of the fragment of the reference nucleic acid sequence. A method for storing subsequent nucleic acid sequences.

12. In paragraph 1, A step of aligning an additional subsequent nucleic acid sequence obtained after the above subsequent nucleic acid sequence to the above reference nucleic acid sequence; and Further comprising the step of assigning PI to a fragment of an additional subsequent nucleic acid sequence corresponding to each of the fragments of the reference nucleic acid sequence to which the PI is assigned, and assigning SI to a nucleic acid sequence included in each of the fragments of the additional subsequent nucleic acid sequence, The SI assigned to each of the fragments of the above additional subsequent nucleic acid sequence is: It is characterized in that the identifier is an identifier that indicates whether the additional subsequent nucleic acid sequence and the reference nucleic acid sequence are the same or different by comparing the previously stored subsequent nucleic acid sequence and the reference nucleic acid sequence before the additional subsequent nucleic acid sequence is stored. A method for storing subsequent nucleic acid sequences.

13. In paragraph 6, It is characterized by further comprising a step of obtaining a subsequent nucleic acid sequence from the nucleic acid sequence database and the reference database. A method for storing subsequent nucleic acid sequences.

14. In paragraph 13, The step of obtaining subsequent nucleic acid sequences from the above nucleic acid sequence database and the above reference database is: A step of generating a query including at least one of genetic information and nucleic acid sequence section information for the subsequent nucleic acid sequence; and characterized in that it comprises a step of reconstructing nucleic acid sequence information corresponding to the query using the nucleic acid sequence database and the reference database. A method for storing subsequent nucleic acid sequences.

15. In paragraph 14, The step of reconstructing the above nucleic acid sequence information into nucleic acid sequence information corresponding to the above query is: When the query is genetic information of a nucleic acid sequence, a step of designating PIs corresponding to the genetic information of the query among the subsequent nucleic acid sequences; A step of sequentially connecting the nucleic acid sequence of the SI assigned to the nucleic acid sequence included in the above-mentioned PI; and It is characterized by including a step of trimming both ends of the continuously connected nucleic acid sequence to a region corresponding to the genetic information of the query. A method for storing subsequent nucleic acid sequences.

16. In paragraph 15, The step of reconstructing the above nucleic acid sequence information into nucleic acid sequence information corresponding to the above query is: If the above query is nucleic acid sequence section information, a step of designating PIs corresponding to the section information of the query among the subsequent nucleic acid sequences; A step of sequentially connecting the SI nucleic acid sequence assigned to the nucleic acid sequence included in the above-mentioned PI; and It is characterized by including a step of trimming both ends of the continuously connected nucleic acid sequence to an area corresponding to the section information of the query. A method for storing subsequent nucleic acid sequences.

17. A device for storing a subsequent nucleic acid sequence using a reference nucleic acid sequence including continuously fragmented fragments of a predetermined length, Memory that stores at least one instruction; network; and Includes a processor, The processor performs at least one instruction, An instruction for dividing the above reference nucleic acid sequence into consecutive fragments of a predetermined length, assigning a PI (position identifier) to each of the fragments, and assigning a SI (sequence identifier) to a nucleic acid sequence included in each of the fragments of the above reference nucleic acid sequence; Instructions for aligning the above subsequent nucleic acid sequence to the above reference nucleic acid sequence; An instruction for assigning a PI to a fragment of a subsequent nucleic acid sequence corresponding to each of the fragments of the reference nucleic acid sequence to which the PI is assigned, and assigning SI to a nucleic acid sequence included in each of the fragments; the PI assigned to each of the fragments of the subsequent nucleic acid sequence is an identifier corresponding to the PI of the reference nucleic acid sequence, and the SI assigned to each of the fragments of the subsequent nucleic acid sequence is an identifier representing whether the fragment of the reference nucleic acid sequence corresponding to the PI of the subsequent nucleic acid sequence and the fragment of the subsequent nucleic acid sequence are the same or different, and Characterized in that it includes instructions for storing PI and SI for fragments of the subsequent nucleic acid sequence in a nucleic acid sequence database. Subsequent nucleic acid sequence storage device.

18. A computer-readable recording medium that stores a computer program, The above computer program, A step of dividing a reference nucleic acid sequence including continuously fragmented fragments of a predetermined length into continuously fragmented fragments of a predetermined length, assigning a PI (position identifier) to each of the fragments, and assigning a SI (sequence identifier) to a nucleic acid sequence included in each of the fragments of the reference nucleic acid sequence; A step of aligning a subsequent nucleic acid sequence to the reference nucleic acid sequence; A step of assigning a PI to a fragment of a subsequent nucleic acid sequence corresponding to each of the fragments of the reference nucleic acid sequence to which the PI is assigned, and assigning SI to a nucleic acid sequence included in each of the fragments; the PI assigned to each of the fragments of the subsequent nucleic acid sequence is an identifier corresponding to the PI of the reference nucleic acid sequence, and the SI assigned to each of the fragments of the subsequent nucleic acid sequence is an identifier representing whether the fragment of the reference nucleic acid sequence corresponding to the PI of the subsequent nucleic acid sequence and the fragment of the subsequent nucleic acid sequence are identical or different, and Programmed to perform a step including storing PI and SI for fragments of the subsequent nucleic acid sequence in a nucleic acid sequence database. A computer-readable recording medium that stores a computer program.

19. A computer program stored on a computer-readable recording medium, The above computer program, A step of dividing a reference nucleic acid sequence including continuously fragmented fragments of a predetermined length into continuously fragmented fragments of a predetermined length, assigning a PI (position identifier) to each of the fragments, and assigning a SI (sequence identifier) to a nucleic acid sequence included in each of the fragments of the reference nucleic acid sequence; A step of aligning a subsequent nucleic acid sequence to the reference nucleic acid sequence; A step of assigning a PI to a fragment of a subsequent nucleic acid sequence corresponding to each of the fragments of the reference nucleic acid sequence to which the PI is assigned, and assigning SI to a nucleic acid sequence included in each of the fragments; the PI assigned to each of the fragments of the subsequent nucleic acid sequence is an identifier corresponding to the PI of the reference nucleic acid sequence, and the SI assigned to each of the fragments of the subsequent nucleic acid sequence is an identifier representing whether the fragment of the reference nucleic acid sequence corresponding to the PI of the subsequent nucleic acid sequence and the fragment of the subsequent nucleic acid sequence are identical or different, and Programmed to perform a step including storing PI and SI for fragments of the subsequent nucleic acid sequence in a nucleic acid sequence database. A computer program stored on a computer-readable recording medium.

Images