Use of u6 snrna-derived sequences to enhance activities of guide rnas

Abstract

Provided herein are CRISPR guide RNAs (gRNAs), which includes chimeric Cas9 single guide RNAs (sgRNAs) and CRISPR RNAs (crRNAs), comprising a U6 and / or U6cap motif. The crRNAs include CasPhi crRNAs, and Cas12a crRNAs (including AsCas12a and LbCas12a crRNAs) comprising a U6 and / or U6cap motif, e.g., at the 5' end of the RNA, and the gRNAs include SpCas9-, Cas12a-, or CasPhi-gRNAs including SpCas9-, Cas12a-, or CasPhi-based prime editor pegRNAs comprising a U6 and / or U6cap motif, e.g., at the 3' end of the pegRNA. Also provided are compositions comprising the crRNAs and gRNAs, e.g., pegRNAs, and their corresponding proteins, as well as methods of using the same for editing of DNA.

Description

[0001] Use of U6 snRNA-derived sequences to enhance activities of Guide RNAs

[0002] CLAIM OF PRIORITY

[0003] This application claims the benefit of U.S. Provisional Patent Application Serial No. 63 / 549,867, filed on February 5, 2024. The entire contents of the foregoing are hereby incorporated by reference.

[0004] FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0005] This invention was made with Government support under Grant Nos. GM118158 and HG009490 awarded by the National Institutes of Health. The Government has certain rights in the invention.

[0006] TECHNICAL FIELD

[0007] Provided herein are CRISPR guide RNAs (gRNAs), which includes chimeric Cas9 single guide RNAs (sgRNAs) and CRISPR RNAs (crRNAs), comprising a U6 and / or U6cap motif. The crRNAs include CasPhi crRNAs, and Casl2a crRNAs (including AsCasl2a and LbCasl2a crRNAs) comprising a U6 and / or U6cap motif, e.g., at the 5’ end of the RNA, and the gRNAs include SpCas9-. Casl2a-, or CasPhi- gRNAs including SpCas9-, Casl2a-. or CasPhi-based prime editor pegRNAs comprising a U6 and / or U6cap motif, e.g., at the 3’ end of the pegRNA. Also provided are compositions comprising the crRNAs and gRNAs, e.g., pegRNAs, and their corresponding Cas proteins, as well as methods of using the same for editing of DNA.

[0008] BACKGROUND

[0009] RNA-guided CRISPR-Cas systems have revolutionized the field of genome editing, enabling the targeted introduction of desired DNA sequence alterations of interest in living cells and organisms1-2. CRISPR-Cas nuclease systems use a Cas protein and a targeting guide RNA (gRNA) that directs the protein to introduce targeted double-strand DNA breaks1 3. In some systems, including Cas9 (a Type II CRISPR system), the guide RNA is a complex of two parts: the crispr RNA (crRNA) and trans-activating CRISPR RNA (tracrRNA). The crRNA is a ~40 nucleotide sequence that includes a sequence that is complementary' to the target DNA (-17-20 nucleotide "spacer") and to the tracrRNA (~20 nucleotides); the tracrRNA also interacts with and mediates binding to the Cas nuclease (see, e.g.. Fig. le, Jinek et al. Science 2012). The crRNA and tracrRNA can be combined into a single guide RNA (sgRNA). Other systems, including CasPhi (also known as Casl2j; a Type V CRISPR system), use only a crRNA as the guide RNA.

[0010] CRISPR-Cas nuclease-induced DNA double-strand breaks (DSBs) can be repaired by non-homologous end-joining (NHEJ) which, in turn, can lead to the introduction of insertion and / or deletion (indel) mutations4,5. Alternatively, DNA repair of these DSBs by homology-directed repair (HDR) with an exogenous DNA sequence can enable the creation of desired sequence changes of interest4,5. Nextgeneration gene-editing platforms such as base editors6,7and prime editors8use the targeting capability of catalytically impaired dead (BE) or nickase (BE and PE) variant forms of CRISPR-Cas nucleases (which do not cut DNA or only cut one strand of DNA). Base editors utilize DNA deaminase enzy mes directed by CRISPR- Cas nucleases (catalytically dead or as nickases) to induce specific base substitutions (e.g., C-to-T or A-to-G)6,7. Prime editors can be used to induce any desired base substitution(s) and / or small insertion or deletions, with these changes encoded on additional sequences in an extension (which consists of the primer binding site (PBS) and the reverse transcription template (RTT)), appended to a standard guide RNA. The RTT of any given prime editing guide RNA (pegRNA) is then reverse transcribed into DNA sequence that contains the desired alteration(s) of interest8.

[0011] SUMMARY

[0012] Provided herein are guide RNAs (gRNAs) comprising a U6 and / or U6cap sequence. The U6 or U6 cap sequences can include, e.g., U6 stem-loop, 19 nt: gugcucgcuucggcagcac (SEQ ID NO: 1); modified U6 stem-loop, 18 nt: gugcugcuucggcagcac (SEQ ID NO:2); U6 stem-loop with AU AU AC (U6cap) gugcucgcuucggcagcacAUAUAC (SEQ ID NO:3); or modified U6 stem-loop with U6 cap: gugcugcuucggcagcacAUAUAC (SEQ ID NO:4).

[0013] In some embodiments, the U6 and / or U6cap sequence is at the 3' or 5‘ end of the gRNA.

[0014] In some embodiments, the gRNA is a CasPhi (Casl2j) CRISPR RNA (crRNA) or pre-crRNA, or a Cas 12a crRNA, that comprises a U6 and / or U6cap motif at the 5’ end of the crRNA. In some embodiments, the gRNA is a Cas9 gRNA, optionally a single guide RNA (sgRNA) or crRNA, or a crRNA-tracrRNA complex with one or both harboring a U6 and / or U6 cap sequence, or a Cas9- or CasPhi-based prime editor pegRNA, that comprises a U6 and / or U6cap motif at the 3’ end of the gRNA.

[0015] Also provided herein are compositions comprising a gRNA as described herein, and a corresponding Cas protein with which the gRNA interacts; a gRNA as described herein and a nucleic acid encoding its corresponding Cas protein: or a nucleic acid encoding a gRNA as described herein and its corresponding Cas protein.

[0016] In some embodiments, the composition comprises a gRNA as described herein and its corresponding Cas protein.

[0017] In some embodiments, the composition comprises a gRNA as described herein and a nucleic acid encoding its corresponding Cas protein, or a nucleic acid encoding a gRNA as described herein and its corresponding Cas protein, wherein the nucleic acid is mRNA or is in an expression vector.

[0018] In some embodiments, the expression vector is an adeno-associated virus (AAV) that further comprises a promoter for expression of the Cas protein and / or the gRNA.

[0019] In some embodiments, the Cas protein is part of a fusion protein, optionally a base editor or prime editor.

[0020] Also provided herein are methods for editing or modifying a target DNA. the method comprising contacting the target DNA with a gRNA as described herein, and a corresponding Cas protein with which the gRNA interacts; a gRNA as described herein and a nucleic acid encoding its corresponding Cas protein; or a nucleic acid encoding a gRNA as described herein and its corresponding Cas protein.

[0021] In some embodiments, the methods comprise contacting the target DNA with the gRNA and corresponding Cas protein.

[0022] In some embodiments, the methods comprise contacting the target DNA with the gRNA and a nucleic acid encoding corresponding Cas protein, or the nucleic acid encoding the gRNA as described herein and the corresponding Cas protein, wherein the nucleic acid is mRNA or is in an expression vector.

[0023] In some embodiments, the expression vector is an adeno-associated virus (AAV) that further comprises a promoter for expression of the Cas protein and / or the gRNA. In some embodiments, the methods comprise the Cas protein is part of a fusion protein, optionally a base editor or prime editor.

[0024] In some embodiments of the methods described herein, contacting the target DNA is performed in vitro in a dish, ex vivo in isolated living cells, or in vivo in a living organism.

[0025] In some embodiments, the methods comprise comprising contacting the target DNA with a ribonucleoprotein (RNP) complex comprising the protein and the modified gRNA; expressing the gRNA and protein in a cell comprising the target DNA; or expressing the protein and contacting the cell with the modified gRNA.

[0026] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

[0027] Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.

[0028] DESCRIPTION OF DRAWINGS

[0029] FIGs. 1A-1E. Modifications of CasPhi2 crRNAs with RNA structural motifs enhance CasPhi2-DM and CasPhi2-17AAgene editing activity in human cells.

[0030] (A) Modifications of CasPhi2 crRNAs that were added individually to either at the 5’ or the 3’ end (left). Predicted RNA secondary structure of three different U6 stemloop motifs (U6 stem-loop (5'-GUGCUCGCUUCGGCAGCAC-3’, SEQ ID NO: 1), modified U6 stem-loop (5'-GUGCUGCUUCGGCAGCAC-3’, SEQ ID N0:2), and U6 stem-loop with AU AU AC) (U6cap) (5’- GUGCUCGCUUCGGCAGCACAUAUAC-3’, SEQ ID NO:3) used for the experiments described (right). (B) Design of crRNAs for 5’ or 3’ modification (top) and schematic maps showing examples of pUC19-based U6 expression vector for 5’ and 3’ modified crRNAs (SEQ ID NOs:24-29). For the 5’ modified crRNAs, a linker was added between the motif and CasPhi2 direct repeat. (C-E) Bar graphs showing insertion and deletion (indel) frequencies (y-axis) as determined by targeted amplicon sequencing, for the 5' and 3’ modified crRNAs (x-axis) with CasPhi2-DM and CasPhi2-17AA at (C) BCLllA site 17(n=l) (D) Matched site 10 (n=l) and (E) Matched site 8 in human HEK293T cells (n=l). Negative controls with non-targeting crRNAs (NT gRNA) and “no treatment" were included in the experiments.

[0031] FIG. 2. Effect of 5’ U6, or 5’U6cap modification of crRNAs on gene editing efficiency of CasPhi2-17AA, at endogenous genomic loci (x-axis) in the human HEK293T cells. Indel frequency (y-axis) was determined by targeted amplicon sequencing of each target site (n=3, independent replicates). “No treatment” was used as the negative control (n=3, independent replicates).

[0032] FIG. 3. In vitro assays showing that 5’ modifications of crRNAs are processed by CasPhi2-17AA. The crRNAs were incubated with CasPhi2-17AA and the processed products resolved on 15% TBE-Urea denaturing polyacrylamide gel and visualized by staining with SYBR gold nucleic acid gel stain. The truncated 5’ U6 or U6cap modified crRNAs (indicated as *) were similar in size to that of processed unmodified pre-cRNA (lanes 2-4). Reactions without CasPhi2-17AA (lanes 6 - 8) were used as controls and did not show any processed product. Mature crRNA without any modifications was used as reference (lanes 1 and 5).

[0033] FIGs. 4A-4E. Effect of 5’ U6, or 5’U6cap modification of crRNAs on base editing activity of the adenine base editor Tad8e-dCasPhi2-17AA(D394A), at endogenous genomic loci in the human HEK293T cells. A-to-G editing frequencies were determined by targeted amplicon sequencing of each target site (n=3, independent replicates). “No treatment” was used as the negative control. The bar plots show A-to-G base editing frequencies (y-axis) induced by Tad8e-dCasPhi2- 17AA(D394A) at each 'A’ position within (A) CD69 site (TTCTTCAGGGAAGAGGTAAA, SEQ ID NO:5), (B) IL2RA site 31 (AAATAATGGAGAAGGATGCG, SEQ ID NO:6), (C) PDCD1 site 11 (TAGCACCGCCCAGACGACTG, SEQ ID NO:7), (D) TRAC site 1 (TCCCACAGATATCCAGAACC. SEQ ID NO:8), and (E) TRAC site 24 (TGGATATCTGTGGGACAAGA, SEQ ID NO: 9).

[0034] FIGs. 5A-5B. Effect of 5’ U6 stem-loop modification of PE-crRNA on the editing activity of CasPhi2-WT, CasPhi2-DM, and CasPhi2-17AA-based split-prime editors with mutant MMLV-RT (without RNase H domain). (A) Diagram showing 5' modified U6 stem-loop PE-crRNAs (5’ modU6 PE-crRNA) with different lengths of spacer (15 nt or 18 nt) that are designed to add ATG insertion edit at two locations indicated on the spacer sequence (Pl 3 or Pl 4). SpCas9 tracrRNA scaffold was used as a linker (top). Exemplar}' schematic maps showing pUC 19-based U6 expression vector for 5’ U6 stem-loop containing PE-crRNAs with 15nt spacer (bottom).

[0035] Sequences shown include:

[0036] U6 promoter: 5’-

[0037] GAGGGCCTATTTCCC ATGATTCCTTC ATATTTGC ATATACGATAC A AGGCTGT TAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAA AATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAAT TATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGAT TTCTTGGCTTTATATATC TTGTGGAAAGGACGAAACACC -3 . SEQ ID NO: 10

[0038] Modified U6 stem loop: 5’-GUGCUGCUUCGGCAGCAC-3’, SEQ ID NO:2.

[0039] ATG insertion at P13:5’-GACCCCTGGCCATCTTCTCCCCGC-3’, SEQ ID NO: 11.

[0040] ATG insertion at P14: 5 -TGACCCCTGGCATCCTTCTCCCCG-3’, SEQ ID NO: 12

[0041] SpCas9 tracrRNA Scaffold: 5’-

[0042] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTT

[0043] GAAAAAGTGGCACCGAGTCGGTGC-3’, SEQ ID NO: 13

[0044] CasPhi2 DR:5’-CAACGATTGCCCCTCACGAGGGGAC-3\ SEQ ID NO 14 Spacer 15nt:5’-GAGCGGGGAGAAGGC-3’, SEQ ID NO: 15 Spacer 18nt:5’-GAGCGGGGAGAAGGCCAG-3‘, SEQ ID NO: 16

[0045] (B) Prime editing efficiencies observed from targeted amplicon sequencing of VEGFA site 3.1 in HEK293T cells (n=l).

[0046] FIG. 6. Effect of 5’ or 3’ modifications of crRNAs on AsCasl2a editing activity' at 4 endogenous genomic loci (x-axis) in the human HEK293T cells. Indel frequency (y-axis) was determined by targeted amplicon sequencing of each target site (n=2. independent replicates). ‘No treatment’ was used as the negative control (n=2, independent replicates).

[0047] FIGs. 7A-7E. Effect of 5’ and 3’ modifications of pegRNAs on SpCas9 nickase-based prime editor (PE3) editing activity'. (A)Schematics of pegRNAs modified with different motifs at the 5’, 3 ’or both ends. An 8 nt linker was added between PBS+RTT and the 3’ modification to prevent unintended secondary' structure formation within pegRNAs. (B) Bar plot showing T-to-A editing frequencies (y-axis) mediated by PE3 using unmodified or modified pegRNAs at the target site HEK site 3 in human HEK293T cells (n=l). (C) Bar plot showing G-to-T editing frequencies (y- axis) mediated by PE3 using unmodified or modified pegRNAs at the target site RNF2 in human HEK293T cells (n=l). (D) Bar plot showing Flag-tag insertion frequencies (y-axis) mediated by PE3 using unmodified or modified pegRNAs at the target site RUNX1 in human HEK293T cells (n=l). (E) Bar plot showing Flag-tag insertion frequencies (y-axis) mediated by PE3 using unmodified or modified pegRNAs at the target site VEGFA in human HEK293T cells (n=l). For all the above experiments, editing frequencies were determined by targeted amplicon sequencing of each target site and non-targeting pegRNA (NT pegRNA) and ‘no treatment’ were used as negative controls (n=l).

[0048] DETAILED DESCRIPTION

[0049] Various RNA modification strategies have previously been used to improve the efficiency of gene editing induced by CRISPR-Cas nucleases, base editors, and prime editors. For example, modifications to the 5’ end of synthetic gRNAs have been used to attempt to increase the stability' of gRNAs in human and other cells. Specific RNA sequences believed to adopt secondary structures have also been added to the 3’ end of pegRNAs used with Streptococcus pyogenes Cas9 (SpCas9)-based prime editors to increase the stability of the PBS and RTT sequences that are not protected by association of these RNAs with the SpCas9 part of the prime editor fusion protein. RNA sequences appended to the 3’ end of these pegRNAs include: evopreQl, mpknot, tevopreQl, and tmpknot9: xr-pegRNA: viral Xml -resistant RNAs (xrRNAs) motif10). Addition of these sequences to pegRNAs led to improved prime editing efficiencies relative to unmodified pegRNAs, presumably due to protection against degradation of the PBS and RTT sequences9 10.

[0050] Here we demonstrate that adding a U6 small nuclear RNA(snRNA)-derived stem-loop (U6) or a U6 snRNA-derived stem-loop with an AU AU AC capping sequence (U6cap) motif to a guide RNA enhances gene editing activity observed wi th co-expression of these modified RNAs and a Cas protein. For example, adding U6 or U6cap to CasPhi2 crRNAs enhanced both CasPhi2-mediated nuclease activity7and CasPhi2-based base editing activity. Interestingly, although one potential mechanism for how U6 and U6 cap enhance gene editor activities might be guide RNA stabilization against nuclease degradation in cells, these motifs appear to be cleaved off from the 5’ end of CasPhi2 nuclease crRNAs by CasPhi2 nuclease itself, suggesting that another mechanism may account for the enhanced activity observed in cells with the addition of these sequences. As an example of one potential mechanism, previous studies have suggested that the U6 snRNA undergoes a post-transcriptional modification that may influence its localization and retention in the nucleus11 12, perhaps explaining why the addition of U6 and U6cap motifs might positively influence gene editor activities. We also show that addition of these sequences to Casl2a crRNAs and SpCas9-based prime editor pegRNAs can enhance the efficiencies of these nucleases and prime editors. Importantly, the U6 and U6cap motifs we define here are smaller (19 nt and 25 nt, respectively) and generally showed superior editing efficiencies compared with other previously described stabilizing motifs.

[0051] Provided herein are crRNAs and gRNAs comprising a U6 and / or U6cap motif. Examples include CasPhi crRNAs and Casl2a crRNAs compnsing a U6 and / or U6cap motif, e.g., at the 5’ end of the RNA, and gRNAs, e.g., Cas9- or CasPhi-based prime editor pegRNAs, comprising a U6 and / or U6cap motif, e.g., at the 3’ end of the gRNA / pegRNA. Also provided are compositions comprising the crRNAs and gRNAs (e.g.. pegRNAs) and their corresponding proteins or sequences encoding the proteins, optionally in expression vectors, expression vectors comprising sequences encoding the corresponding proteins and optionally the guide RNAs, as well as methods of using the same for editing or modifying DNA.

[0052] Also provided herein are other non-coding RNAs with U6 caps, such as shRNAs, siRNAs, miRNAs, and IncRNAs, as well as coding RNAs (e.g., mRNAs).

[0053] U6 and U6cap Motifs

[0054] The full length human U6 small nuclear RNA comprises the sequence:

[0055] 1 gugcucgcuu cggcagcaca uauacuaaaa uuggaacgau acagagaaga uuagcauggc 61 cccugcgcaa ggaugacacg caaauucgug aagcguucca uauuuu ( SEQ ID NO : 17 ) .

[0056] The U6 and U6cap motifs useful in the methods described herein can include : U6 stem-loop, 19 nt: gugcucgcuucggcagcac (SEQ ID NOT);

[0057] Modified U6 stem-loop, 18 nt: gugcugcuucggcagcac (SEQ ID NO:2); U6 stem-loop with AUAUAC (U6cap), 25 nt: gugcucgcuucggcagcacauauac (SEQ ID NO:3); and

[0058] Modified U6 stem-loop with U6 cap: gugcugcuucggcagcacAUAUAC (SEQ ID NO:4).

[0059] Guide RNAs

[0060] As used herein, guide RNAs or gRNAs modified at the 3’ and / or 5’ end to include a U6 or U6cap motif can include, for example, crRNAs and sgRNAs as well as tracrRNAs, that coordinate with a CRISPR protein to direct the protein to a specific sequence in a target DNA molecule that includes a region of complementarity to the protospacer sequence of the guide RNA. Exemplary CRISPR proteins include Cas9 and Cas9 equivalents from any Class 2 CRISPR system (e.g, type II, V, VI), e.g., CasPhi (or Cas<D, also known as Casl2j), or Casl2a. Others include Casl2e, Casl2d, Casl2bl, Casl2b2, Casl3a, Casl2c, Casl2d, Casl2e, Casl2h, Casl2i, Casl2g, Casl2f (Casl4), Casl2fl, and Argonaute. See, e.g., Riesenberg et al.. Nature Communications volume 13, Article number: 489 (2022); Kmiec et al., Int J Mol Sci. 2021 Apr; 22(7): 3327; W02022067130; Anzolone et al., Nature. 2019 Dec;576(7785): 149-157; Anzolone et al, Nat Biotechnol. 2022 May;40(5):731-740; Nidhi et al, Int J Mol Sci. 2021 Apr; 22(7): 3327; and Scollan, “Chapter 2- CRISPR- Cas orthologs and variants,” In Ed. Tsang. CRISPR Genome Surgery in Stem Cells and Disease Tissues, Academic Press, 2022, Pages 7-38. The Cas proteins and variants and mutants thereof with altered properties are know n, including Cas proteins with altered activity' such as altered PAM specificity, improved on-target activity, nickases, and catalytically inactive Cas proteins, as well as fusions thereof with heterologous functional domains, e.g, transcriptional regulators, histone methylation or acety lation modifiers, DNA methylation modifiers, and cytosine or adenine base editors, in which a catalytically inactive or defective Cas protein is fused or linked to a deaminase (Rees and Liu, Nat Rev Genet. 2018 Dec; 19(12): 770-788; Porto et al. Nature Reviews Drug Discovery volume 19, pages839-859 (2020)). See, e.g, Zhou and Yao, Mol Biomed. 2023 Dec; 4: 10. Prime editors are another example, which include a Cas protein fused to an engineered reverse transcriptase that is paired with a prime editing guide RNA (pegRNA) that specifies the target site and encodes the desired edit (Anzalone et al.. Nature volume 576, pagesl49-157 (2019)). Specific examples include the following.

[0061] CasPhi crRNAs and Proteins

[0062] CasPhi crRNAs are described, e.g., in WO2022159822. In some embodiments, the crRNA includes a protein-binding region that binds the CasPhi protein and a targeting region that is complementary to 14-24 nucleotides of a respective target genomic sequence or sequences. In some embodiments, the crRNA comprises one of the following sequences:

[0063] 5’-CAACGAUUGCCCCUCACGAGGGGAC-Ni2-24-Uo-8, SEQ ID NO: 18, or 5 -GCAACGAUUGCCCCUCACGAGGGGAC-N12-24-U0-8, SEQ ID NO: 19, or pre-crRNAs, e.g.,

[0064] 5 -GUCGGAACGCUCAACGAUUGCCCCUCACGAGGGGAC-N12-24-U0-8, SEQ ID NO: 20,

[0065] 5 -GGUCGGAACGCUCAACGAUUGCCCCUCACGAGGGGAC-N12-24-U0- 8, SEQ ID NO: 21,

[0066] 5 -GGCAACGAUUGCCCCUCACGAGGGGAC-N12-24-U0-8, SEQ ID NO: 22, or 5 -GGGUCGGAACGCUCAACGAUUGCCCCUCACGAGGGGAC-N12-24-U0-8, SEQ-ID NO:23, wherein N is any nucleotide (N 12-24 represents the targeting sequence that is complementary to the target genomic sequence). With CasPhi2, we generally observed higher editing with 5’ modified crRNA and 5’ modified pegRNA.

[0067] CasPhi proteins are described in WO2022159822; the CasPhi proteins can include one or more mutations or modifications; in some embodiments, the CasPhi proteins comprise the following mutations: A36R. S106R, D134R, L149R, E159A, S160A, S 164A, D167K, E168A, P277R, T357K, T518R, L571K, S616R, Q684R, T355R, and D679K. In some embodiments, the CasPhi proteins comprise the following mutations: A36R, S106R, D134R, P277R, T355R, T357K, T518R, L571K, S616R. D679K, and Q684R, optionally further comprising a mutation at one or more of the following positions: Si l, S25, G138, T203. A261, D337. N497, L506. S507, N508, S509, D513, Q514, A520, G524, A525, K527, P530, V531, R538, T539, R542, A543, E569, E578, T628, T649, E674, and / or T691, optionally further comprising the following mutations: F23S and S26R, or optionally further comprising the following mutations: T340G. D341R, and D342G. In some embodiments, the CasPhi proteins comprise the following mutations: A36R, S106R, D134R, L149R, P277R, T355R, T357K, T518R, L571K, S616R, D679K, and Q684R. In some embodiments, the CasPhi proteins comprise the following mutations: A36K, S 106K, D134K, P277K. D337K, T355R, T357K, V531R, T539A, A543K, L571K, S616K, D679K, and T691K, optionally further comprising the following mutation: Q684R. In some embodiments, the CasPhi proteins comprise a mutation that catalytically inactivates nuclease activity, wherein the mutation is D394A or E606Q. The numbering is relative to the CasPhi2 wild type sequence (GenBank Accession No. 7LYS A; Pausch P, Soczek KM, Herbst DA, Tsuchida CA, Al-Shayeb B, Banfield JF, Nogales E, Doudna JA. DNA interference states of the hypercompact CRIS PR-CasO effector. Nat Struct Mol Biol. 2021 Aug;28(8):652-661).

[0068] The CasPhi proteins need not be active nucleases or nickases, but can be part of a fusion protein, e.g., a base editor or prime editor.

[0069] Casl2a crRNAs and Proteins

[0070] Mature crRNAs for Cast 2a are 42-44 nt in length, containing a 19 nt repeat and 23-25 nt spacer sequence. Engineered Cast 2a crRNAs are known in the art, including those described in WO2020165768. With Casl2a, we generally observed higher editing with 5’ modified crRNA and 5’ modified pegRNA.

[0071] Casl2a (also known as Cpfl) orthologs have been isolated from anumber of organisms, including Acidaminococcus sp. BV3L6, Francisella tularensis 1, Francisella tularensis subsp. novicida, Prevotella albensis, Lachnospiraceae bacterium MC2017 1, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium GW201 l_GWA2_33_10, Parcubacteria bacterium

[0072] GW2011 GWC2 44 17, Smithella sp. SCADC, Acidaminococcus sp. BV3L6, Lachnospiraceae bacterium MA2020, Candidatus Methanoplasma termiium. Eubacterium eligens, Moraxella bovoculi 237, Leptospira inadai, Lachnospiraceae bacterium ND2006, Porphyromonas crevioricanis 3, Prevotella disiens, and Porphyromonas macaca.' sequences for these proteins, and their corresponding crRNAs, are presented in W02016205711, and variants of the Cas protein from Acidaminococcus sp. BV3L6 (AsCasl2a or AsCpfl) and Lachnospiraceae bacterium ND2006 (LbCasl2a) and Francisella tularensis (FnCasl2A) are described in WO2018195545, WO2018022634, and WO2018195540. The Casl2a proteins need not be active nucleases or nickases, but can be part of a fusion protein, e.g.. a base editor or prime editor. Cas9 gRNAs and Proteins

[0073] The CRISPR-Cas9 system, as noted above, uses a Cas9 protein and either a tracrRNA / crRNA complex, or a single guide RNA (sgRNA). With SpCas9, we observed improved editing when the modification was added at the 3’ end of pegRNA. In some embodiments, where a crRNA / tracrRNA complex is used, 5’ end modification of the crRNA and / or 3' end modification of the tracrRNA is preferred.

[0074] Cas9 orthologs have been described in various species, including Staphylococcus aureus. Neisseria meningitis, Streptococcus pyogenes, and Streptococcus thermophilus, and variants and mutants thereof with altered properties are known, including proteins with altered activity such as altered PAM specificity, improved on-target activity; nickases, and catalytically inactive Cas proteins, as well as fusions thereof with heterologous functional domains. See, e.g., Riesenberg et al., Nature Communications volume 13, Article number: 489 (2022); Kmiec et al., Int J Mol Sci. 2021 Apr; 22(7): 3327; Li et al., Signal Transduct Target Ther. 2023; 8: 36; and Zhou and Yao. Mol Biomed. 2023 Dec; 4: 10; Wang et al., Cell Rep. 2020 Jun 2;31(9): 107723 (Casl2a base editors). The Cas9 proteins need not be active nucleases or nickases, but can be part of a fusion protein, e.g., a base editor or prime editor.

[0075] Compositions and Vectors

[0076] The modified gRNAs described herein can be provided in a composition, which can further include the corresponding Cas protein (the protein to which they bind, with which they interact, to direct the Cas protein to a particular sequence), or a nucleic acid sequence encoding the Cas protein. The nucleic acid sequence can be, e.g., naked DNA or mRNA, or can be in an expression vector, e.g., a plasmid or viral vector. Exemplary viral vectors for use in the present methods and compositions include recombinant retroviruses, adenovirus, adeno-associated virus, alphavirus, and lentivirus.

[0077] A preferred viral vector system useful for delivery of nucleic acids in the present methods is the adeno-associated virus (AAV). AAV is a tiny non-enveloped virus having a 25 nm capsid. No disease is known or has been shown to be associated with the wild type virus. AAV has a single-stranded DNA (ssDNA) genome. AAV has been shown to exhibit long-term episomal transgene expression, and AAV has demonstrated excellent transgene expression in the brain, particularly in neurons. Vectors containing as little as 300 base pairs of AAV can be packaged and can integrate. Space for exogenous DNA is limited to about 4.7 kb. An AAV vector such as that described in Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985) can be used to introduce DNA into cells. A variety of nucleic acids have been introduced into different cell types using AAV vectors (see for example Hermonat et al., Proc. Natl. Acad. Sci. USA 81:6466-6470 (1984); Tratschin et al. Mol. Cell. Biol. 4:2072-2081 (1985); Wondisford et al. Mol. Endocrinol. 2:32-39 (1988); Tratschin et al, J. Virol. 51:611-619 (1984); and Flotte et al.. J. Biol. Chem. 268:3781-3790 (1993). There are numerous alternative AAV variants (over 100 have been cloned), and AAV variants have been identified based on desirable characteristics. In some embodiments, the AAV is AAV1, AAV2, AAV4, AAV5, AAV6, AV6.2, AAV8, AAV9, rh.10, rh.39, rh.43 or CSp3, or a pseudotyped AAV. Non-limiting examples of derivatives and pseudotypes include AAVrh.10, rAAV2 / l, rAAV2 / 5, rAAV2 / 8, rAAV2 / 9, AAV2- AAV3 hybrid, AAVhu.14, AAV3a / 3b, AAVrh32.33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, AAV6.2, AAV2i8, AAV-HSC15 / 17, AAVM41, AAV9.45, AAV6(Y445F / Y731F), AAV2.5T, AAV-HAE1 / 2, AAV clone 32 / 83, AAVShHIO, AAV2 (Y->F), AAV8 (Y733F), AAV2.15. AAV2.4. AAVM41. and AAVr3.45. AAV serotypes and derivatives / pseudotypes, and methods of producing such are known in the art (see, e.g., Mol Then 2012 April; 20(4):699-708). In some embodiments, the rAAV particle is a pseudotyped rAAV particle, which comprises (a) an rAAV vector comprising ITRs from one serotype (e.g, AAV2, AAV3) and (b) a capsid comprised of capsid proteins derived from another serotype (e.g, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAV 10). Methods for producing and using pseudotyped rAAV vectors are known in the art (see. e.g, Duan et al, J. Virol, 75:7662-7671, 2001; Halbert et al, J. Virol.. 74: 1524-1532, 2000; Zolotukhin et al. Methods, 28: 158-167, 2002; and Auricchio et al. Hum. Molec. Genet, 10:3075-3081, 2001).

[0078] The expression vector can also include a sequence encoding the guide RNA with U6 cap modification as well as the Cas protein.

[0079] In some embodiments the compositions include an AAV comprising a nucleotide sequence encoding the Cas protein.

[0080] The AAV should generally also include a promoter to drive expression of the inhibitory nucleic acid. In some embodiments, expression is driven by a ubiquitous promoter, such as cytomegalovirus (CMV); a hybrid CMV enhance / chicken -actin (CBA) promoter; a promoter comprising the CMV early enhancer element, the first exon and first intron of the chicken p-actin gene, and the splice acceptor of the rabbit P-globin gene (commonly call the ‘CAG promoter”); beta glucuronidase (GUSB); ubiquitin; UBC, Rous sarcoma virus (RSV) promoter; or a 1.6-kb hybrid promoter composed of a CMV immediate-early enhancer and CBA intron 1 / exon 1 (commonly called the CAGGS promoter; Niwa et al. Gene, 108:193-199 (1991)). Modifications of these sequences may be possible or desirable in certain applications, and such modifications are within the scope of this disclosure. The woodchuck hepatitis virus posttranscriptional response element (WPRE) can also be used.

[0081] In some embodiments, the AAV vector comprises at least, in order from 5' to 3 ', a first adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence, a promoter operably linked to a nucleotide sequence encoding a Cas protein, a polyadenylation signal, and a second AAV inverted terminal repeat (ITR) sequence.

[0082] Methods of Use

[0083] The modified gRNAs described herein can be used with their corresponding proteins to edit or modify target DNA, e.g., to induce single or double stranded breaks (e.g., nucleases or nickases), or to alter base sequence (e.g., cytosine or adenine base editors), insert sequences (e.g.. prime editors), alter transcriptional regulation (e.g., fusions with a transcriptional activator or repressor), alter histone methylation or acetylation modifiers (e.g., fusion with a histone acetyltransferase (HAT), histone deacetylase (HD AC), histone methyltransferase (HMT), or histone demethylase), or alter DNA methylation. See, e.g., WO 2014 / 152432. Such methods can include contacting the target DNA (e.g., in vitro in a dish, or ex vivo in isolated living cells (e.g., in culture), or in vivo in a living organism) with the modified gRNAs described herein and their corresponding Cas protein. This can be achieved, e.g., by contacting the target DNA with a ribonucleoprotein (RNP) complex comprising the Cas protein and the modified gRNA, or by expressing the gRNA and Cas protein in a cell comprising the target DNA, or by expressing the Cas protein and contacting the cell with the modified gRNA.

[0084] EXAMPLES

[0085] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims. Methods

[0086] The following materials and methods were used in the Examples below.

[0087] Molecular cloning. All crRNAs and gRNAs used in this study were cloned into a pUC19-U6 mammalian expression vector and pegRNAs were cloned into a pU6 mammalian expression vector. pUC19-U6 vector was digested with BsmBI-v2 and Hindlll-HF and pU6 vector was digested with Bsal-HF. DNA fragments that contain the direct repeat sequence / scaffold and the spacer sequence were prepared by overlap extension PCR with oligos with overlapping sequences using Phusion high- fidelity7DNA polymerase. The PCR fragments were separated by 1% agarose gel electrophoresis and purified using QIAquick PCR purification kit. The purified PCR fragments were inserted into the digested vector prepared as above by Gibson Assembly using 2x Gibson master mix at 50°C for 1.5 h and the reaction mixture was then used to transform competent Escherichia coli XLl-Blue cells. The plasmids were purified from transformed cells by QIAgen Miniprep or Plus Midi kits. The plasmids encoding the Cas proteins used in this study (e.g., CasPhi2 17AA (comprising mutations

[0088] A36R / S 106R / D 134R / L 149R / E159 A / S 160 A / S 1 4A / D 167K / E168 A / P277R / T355R / T 357K / T518R / L571K / S616R / D679K / Q684R), AsCasl2a20, MMLV-RT19, and PE319) were prepared previously by Gibson assembly using pCMV or pCAG mammalian expression vector.

[0089] To overexpress Casphil7AA protein, the variant sequence region was amplified from pCMV-CasPhi2 17AA and inserted into the CasPhi2 WT overexpression plasmid (pRSFDuet-1, Addgene no. 158795) digested with EcoRI and BsrGI-HF though Gibson assembly. The reaction mixture was used to transform competent E. coli XLl-Blue cells.

[0090] Cell culture.HEK293T cells were cultured in Dulbecco’s modified Eagle medium (Gibco) with 2 mM L-glutamine supplemented with 10% FBS, 50 units / ml penicillin and 50 pg / ml streptomycin, and 1% GlutaMAX (Gibco). Cells were grown at 37 °C with 5% CO2 and passaged when reaching 80% confluency. Cell culture supernatants were tested for mycoplasma contamination every 4 weeks using My co Alert PLUS mycoplasma detection kit (Lonza).

[0091] Transfection. HEK293T cells were seeded at 1.25 x 104cells in 92 pL growth medium / well. After 18-24 h incubation, the cells were transfected with 30 ng CasPhi2 WT, CasPhi2 variant or AsCasl2a and 10 ng crRNA using 0.3 pL TransIT-X2 lipofection reagent (Minis) and 9 pL of Opti-MEM (Gibco) per well. For split prime editing, the cells were transfected with 30 ng CasPhi2 variants, 15 ng MMLV-RT variant (without RNase H domain), and 10 ng of pegRNAs using 0.3 pL TransIT-X2 lipofection reagent (Minis) and 9 pL of Opti-MEM (Gibco) per well. For prime editing with PE3, the cells were transfected with 30 ng PE2, 10 ng pegRNA, and 3.3 ng of nicking gRNA using 0.3 pL TransIT-X2 lipofection reagent (Mirus) and 9 pL of Opti-MEM (Gibco) per well. After transfection, the cells were incubated at 37 °C with 5% CO2 for 72 h before extraction of genomic DNA.

[0092] DNA extraction. HEK293T cells were washed with lx PBS (Coming) and treated with 43.5 pl of gDNA lysis buffer (100 mM Tris-HCl at pH 8. 200 mM NaCl. 5 mM EDTA, 0.05% SDS) supplemented with 5.25 pl of 20 mg ml-1 Proteinase K (NEB) and 1.25 pL of 1 M DTT (Sigma) per well in 96-well plates. Cells were lysed overnight by shaking at 500 rpm at 55 °C. Subsequently, gDNA was extracted from lysates using 2x paramagnetic beads, washed twice with 70% ethanol, and eluted with 30 pl of O. lx EB.

[0093] Library preparation for targeted amplicon sequencing. The gDNA concentrations were determined using a Qubit fluorometer and dsDNA HS Assay Kit (Thernio Fisher). The amplicon library for Miseq was generated by a 2-PCR process. For PCR1, the sequence of interest was amplified from 30-100 ng gDNA using primers containing Illumina adapter sequences. The amplicons were purified with 0.7x paramagnetic beads and eluted in 30 pl nuclease-free water. In PCR2, 20-100ng of the PCR1 product was used to add Illumina-compatible barcodes by PCR amplification which was subsequently purified with 0.7x paramagnetic beads, eluted in 20 pl nuclease-free water, and quantified using the Quantifluor system (Promega). The PCR2 products were pooled based on the concentrations to ensure that all samples were represented equally in the final library' and the final library' was sequenced using an Illumina Miseq kit (Miseq Reagent Kit v.2; 300 cycles, 2 x 150 bp, paired-end). The FASTQ files were downloaded from BaseSpace (Illumina) for sequencing data analysis.

[0094] Next-generation sequencing analysis. Amplicon sequencing data were analy zed using CRISPResso2 using Base Editor Output mode. The CRISPResso2 output table 'CRISPRessoBatch_quantincation_of_editing_frequency.txt.' was utilized to calculate indel frequencies reported around the cut site using the window parameters (-wc -1 -w 6) using the formula: (( insertions'+'delelions'-'insertions and deletions’) / ’ reads aligned’) * 100.

[0095] Protein purification. CasPhi2 17AA overexpression plasmid was used to transform into Rosetta (DE3) competent cells (Novagen). A single colony was picked and inoculated in 60 ml TB medium with Kanamycin (50 pg / ml) as starter culture and incubated at 37 °C. shaking at 240 rpm overnight. The following day. 1 L TB medium wi th Kanamycin (50 pg / ml) was inoculated with 11 mL starter culture and grown at 37 °C to an ODeoo of 0.6. Subsequently, cultures were cooled down on ice for Ih and protein expression was induced with IPTG (final concentration of 0.5 mM) followed by incubation overnight at 16 °C, shaking at 240 rpm. Cells were harvested by centrifugation and cell pellets were stored at -80 °C. To purify CasPhi2 17AA protein, cell pellets were resuspended with lysis buffer (50 mM HEPES pH 7.5 (at RT), 1 M NaCl, 20 mM imidazole, 5% glycerol. 0.5 rnM TCEP, 1 tablet of complete™ EDTA-free Protease Inhibitor Cocktail (Roche)) and lysed by sonication. The lysate was subjected to centrifugation and the supernatant was loaded on a 5 ml Ni-NTA Superflow Cartridge (Qiagen) which was pre-equilibrated with wash buffer (50 mM HEPES pH 7.5 (at RT), 1 M NaCl, 20 mM imidazole, 5% glycerol, 0.5 mM TCEP). Bound proteins were washed with 20 column volumes (CV) wash buffer and eluted with a linear gradient of 9 CV elution buffer (50 mM HEPES pH 7.5 (at RT), 500 rnM NaCl, 500 mM imidazole, 5% glycerol, 0.5 mM TCEP). Fractions with the target proteins were collected and diluted in a buffer containing(50 mM HEPES pH 7.5 (at RT), 5% gly cerol and 0.5 rnM TCEP to bring the final concentration to 100 mM NaCl which was then loaded to a 5ml HiTrap SP HP (Cytiva) pre-equilibrated with wash buffer (50 mM HEPES pH 7.5 (at RT), 100 mM NaCl, 5% glycerol, 0.5 rnM TCEP). The bound proteins were w ashed with 10 CV of w ash buffer and eluted with a linear gradient of 10 CV of elution buffer (50m M HEPES pH 7.5 (at RT), 1 M NaCl, 5% glycerol. 0.5 mM TCEP). Fractions with the target proteins were collected, concentrated, and dialyzed against storage buffer (20 mM HEPES pH 7.5 (at RT), 500 mM NaCl, 20% glycerol, 0.5 mM TCEP) at 4 °C overnight. Purified proteins were aliquoted and stored at -80 °C.

[0096] In vitro pre-crRNA processing assay. For pre-crRNA processing assay, pre- crRNA, crRNA, and U6- or U6cap-modified crRNAs were ordered from IDT. CasPhi2 17AA was incubated with crRNA substrates (final concentration of 2.5 pM and IpM, respectively) in a reaction buffer (10 mM HEPES pH7.5. 150 rnM KC1, 5 mM MgCE, 10% glycerol, 0.5 mM TCEP) for 1 h at 37 °C. Reaction mixtures were digested with Proteinase K (800 U / ml) for 45 min at 37 °C. Each reaction was mixed with an equal volume of 2x denaturing loading dye, incubated for 5 min at 95 °C, and resolved on 15% TBE-Urea denaturing polyacr lamide gel (Invitrogen). The gel was stained with SYBR gold nucleic acid gel stain (Invitrogen) for 30 min (1 to 10.000 dilution lx TBE) and visualized with a UV transilluminator.

[0097] Example 1. Addition of U6 or U6cap motifs to crRNAs enhanced CasPhiZ nuclease-induced gene editing activities in human cells.

[0098] In initial studies, we sought to assess the impact of adding U6 and U6cap motifs to crRNAs for CasPhi2 nuclease variants that we previously engineered to have robust gene editing activities human cells. The bacteriophage CasPhi2 protein is a hypercompact member of the CRISPR-Cas system and is only 757 amino acids in length (much smaller than SpCas9 nuclease which is 1368 amino acids), making it a highly attractive system for use in gene editing. CasPhi2 protein associates with a short CRISPR RNA (crRNA) that is ~45 nts in length and that guides the nuclease to a target site. This crRNA consists of a direct repeat (DR) at its 5’ end and a spacer sequence complementary to a target site at its 3’ end. We envisioned that addition of a U6 or U6cap structural motif (FIG. 1A) to the 5’ or 3’ ends of a CasPhi2 crRNA (FIG. IB) might potentially enhance its expression, nuclear localization, and / or stability and thereby improve the activities of CasPhi2 nuclease-crRNA nuclease complexes in human cells. These hypotheses were based on: (1) previous studies demonstrating enhanced RNA stability associated with U6 5’ leader sequences13,14, (2) the known retention of U6 snRNA in the nucleus following its transcription and post-transcriptional modification11 12,15,16, and (3) the structures of the 19 nt U6 and 25 nt U6cap sequences that are predicted to be short stem-loops. In addition to adding U6 or U6 cap sequences to the 5’ or 3’ ends of a CasPhi2 crRNA, we also created additional modified crRNAs in which we added structural motifs (evopreQl or mpknot) to the 5‘ or 3’ ends (FIG. IB). These motifs had been previously added to the 3‘ end of SpCas9 pegRNAs to stabilize them in human cells9. (Note that for all crRNAs in which we added a sequence to the 5’ end, we also included an intervening 8 nt linker before CasPhi2 direct repeat (DR) to attempt to prevent the formation of unwanted secondary structure between these two sequences (FIG. IB)). We constructed these various crRNAs for three different endogenous human gene target loci (BCL11A site 17, Matched site 10, and Matched site 8).

[0099] We tested the impacts of the added sequences of the activities of these crRNAs by co-expressing each of them together with two different engineered CasPhi2 nuclease variants in HEK293T cells and assessing gene editing frequencies at the intended target genomic loci (Methods). We used engineered CasPhi2 nuclease variants because we recently demonstrated that wild-type CasPhi2 exhibits very low or no activity as a gene editor in human cells, despite functioning efficiently in vitro. The two engineered CasPhi2 variants we used for these experiments were generated using a structure-guided molecular evolution process, are more robust and efficient for gene editing than wild-type CasPhi2 in human cells, and are referred to as CasPhi2-DM (double-mutant, bearing T355R and D679K substitutions) and CasPhi2-17AA (an even more highly active variant bearing 17 different mutations that we refer to as (17AA).

[0100] With the CasPhi2-DM variant at two of the target sites (BCL11 A site 17 and matched site 10) where there was essentially no evidence of gene editing with wildtype crRNA, none of the motifs added at either the 5’ or 3’ end of the crRNA enhanced the frequency of indels (Figs. 1C - ID). With CasPhi2-DM at matched site 8 where wild-type crRNA induced modest (-8.5%) indel frequencies, all of the various motifs to the 3’ end and addition of evopreQl and mpknot to the 5’ end all decreased gene editing activity' whereas addition of U6 and U6cap to the 5’ end all increased indel frequencies by more than two-fold (Fig. IE). With the CasPhi2-17AA variant, the wild-type crRNA induced higher indel frequencies at all three sites but the addition of the various motifs at the 3’ end of the crRNA did not lead to increases in gene editing activities and in some cases led to decreased indel frequencies (Figs. 1C - IE); however, addition of motifs at the 5’ end generally led to increase gene editing activities with the U6 and U6 cap inducing higher indel frequencies than the evopreQl and mpknot motifs at all three sites (Figs. 1C - IE). These findings suggest that addition of the U6 or U6cap motifs to the 5' end of crRNAs led to the most consistent and greatest increases in gene editing activities with both CasPhi2-DM and CasPhi2-17AA, outperforming previously reported evopreQl and mpknot motifs in this context. To more broadly test the positive effects of adding 5’ U6 or 5‘ U6cap motifs, we constructed crRNAs with or without these added sequences for 12 additional endogenous human gene loci target sites and assessed their gene editing activities with CasPhi2-17AA in HEK293T cells (Methods). Unmodified crRNAs coexpressed with CasPhi2-17AA induced a range of different mean indel frequencies across these 12 different target sites (1% to 61%) (Fig. 2). Relative to wild-type crRNA controls, modified crRNAs with U6 or U6cap at their 5’ ends induced mean indel frequencies that were consistently higher than those observed with their wildtype crRNA counterparts across all 12 target sites when co-expressed with CasPhi2- 17AA (Fig. 2). Interestingly, the crRNAs with the 5’ U6cap motif induced higher indel frequencies with CasPhi2-17AA than did crRNAs with the 5’ U6 motif at nine of the 12 sites we tested (Fig. 2). Taken together, our experiments show that addition of 5’ U6 and U6cap motifs to the 5’ end of CasPhi2 crRNAs can be used as a general method to enhance the activities of CasPhi2 nucleases.

[0101] To attempt to better understand the enhancing effects of adding a 5' motif to a CasPhi2 crRNA, we sought to determine whether these sequences might be removed by the known post-transcriptional cleavage activity of CasPhi2 nuclease. Previous studies have shown that CasPhi2 nuclease possesses an RNA endonuclease activity responsible for post-transcriptional processing of pre-crRNAs, with RNA sequence upstream of the crRNA DR being removed to yield mature crRNAs17. This suggested the possibility that the 5’ U6 and U6cap motifs we added to crRNAs might also be removed by CasPhi2 nuclease. To test this, we used an in vitro assay in which different chemically synthesized crRNA substrates are each incubated with or without purified CasPhi2-17AA and then the RNA species from the reactions are visualized on denaturing polyacrylamide gels (Fig. 3). A mature crRNA (46 nts in length) used as a negative control did not show processing in the presence of CasPhi2-17AA relative to its absence (Fig. 3). As expected, a pre-crRNA (60 nts in length) used as a positive control showed processing by CasPhi2-17AA into a smaller RNA that matches the mature crRNA (46 nts) in size (Fig. 3). Importantly, crRNAs modified with either a 5’ U6 or U6cap motif also showed processing into a 46 nt RNA species (Fig. 3), demonstrating that despite the sequence difference from a pre-crRNA, the 5 ’ motifs can be removed by CasPhi2-17AA from these modified crRNAs. Although the precise mechanism by which addition of a 5’ U6 or U6cap motif enhances gene editing activity of CasPhi2 nuclease remains unproven, if the 5' U6 or U6cap sequences are also post-transcriptionally removed when expressed in cells, this suggests that their effects may not be due to RNA stabilization or increased RNA expression, leaving open the possibility that perhaps the presence of these sequences might increase initial nuclear localization of crRNAs.

[0102] Example 2. Addition of U6 or U6cap motifs to crRNAs enhanced CasPhi2-based adenine base editor activities in human cells.

[0103] We next sought to test whether addition of 5’ U6 or U6cap motifs to crRNAs might also increase the base editing activities of CasPhi2-17AA-based adenine base editors (ABEs). For these experiments, we used an ABE composed of the TadA8e adenine deaminase18fused to a catalytically inactive CasPhi2-l 7AA variant harboring a D394A mutation (dead CasPhi2-17AA or dCasPhi2-17AA). We used targeted amplicon sequencing to assess the A-to-G editing frequencies induced by TadA8e- dCasPhi2-17AA when co-expressed with unmodified or 5' U6 or U6cap modified crRNAs targeting five different endogenous gene loci in HEK293T cells (Methods). We found crRNAs with 5’ U6 or U6cap motifs resulted in consistently higher mean A-to-G frequencies in all five target sites at every adenine for which detectable editing was observed relative to a negative control (Figs. 4A - 4E). Notably , editing frequencies were also consistently (albeit modestly) higher with crRNAs harboring the 5’ U6cap motif compared with those harboring the 5’ U6 motif (Figs. 4A - 4E), consistent with the pattern we observed with CasPhi2-17AA nuclease. These results demonstrate that addition of a U6 or U6cap motif to crRNAs can increase the base editing activities of CasPhi2-based ABEs.

[0104] Example 3. A modified U6 stem-loop motif added to a CasPhi2-based prime editor crRNA can function to induce prime editing in human cells.

[0105] We additionally explored the possibility of whether a modified version of the U6 stem-loop motif might be compatible with a CasPhi2-based prime editing system. This modified U6 stem loop lacks nucleotide C6 from the parental sequence, a nucleotide that is expected to bulge out from the predicted stem region (Fig. 1A) and that we deleted to try and further stabilize the predicted stem-loop structure. We added this modified U6 (modU6) motif to the 5’ end of CasPhi2 crRNAs we designed for use in prime editing. These PE-crRNAs targeted a site in an endogenous human gene (VEGFA site 3.1) and have the sequences shown in Fig. 5 A. which include RTT sequences that encode an ATG trinucleotide at spacer positions 13 or 14 and spacer targeting sequences with lengths of 15 or 18 nts. (Note that we also added SpCas9 tracrRNA scaffold as a linker between the PBS+RTT and CasPhi2 DR sequences in these PE crRNAs (FIG. 5A).) To perform PE with these various PE-crRNAs, we coexpressed each with wild-type CasPhi2, CasPhi2-DM, or CasPhi2-17AA nuclease and a previously described MMLV-RT pentamutant that also lacks its RNase H domain in HEK293T cells19and then assessed prime editing efficiencies using targeted amplicon sequencing (Methods). In these experiments, we identified the desired ATG insertion edit with all three CasPhi2 proteins but with the highest edit frequency observed when using a PE-crRNA with an 18 nt length spacer and the insertion at spacer position 14 (Fig. 5B). These data demonstrate that the 5’ modU6 motif can also be used with PE- crRNAs to induce CasPhi2-based prime editing in human cells.

[0106] Example 4. Addition of U6 or U6cap motifs to guide RNAs enhanced the activities of other CRISPR-Cas gene editors in human cells.

[0107] Given the positive effects of adding U6 or U6 cap motifs to CasPhi2 crRNAs, we also explored whether this strategy' might also be used to improve the editing efficiencies of other CRISPR-Cas systems such as AsCas 12a nuclease (another type V nuclease) and SpCas9-based prime editors.

[0108] AsCasl2a nuclease: We assessed the impact of adding a U6, U6cap, evopreQl or mpknot motif to the 5’ or 3’ end of AsCasl2a crRNAs targeted to 4 different endogenous gene target sites (DNMT1 site 4, EMX site 1, matched site 8, and matched site 10) on AsCas 12a nuclease-induced gene editing in HEK293T cells (Methods). Unmodified crRNAs co-expressed with AsCas 12a nuclease induced high frequencies of indel mutations at all four target sites as assessed by targeted amplicon sequencing (Fig. 6). Similar to what was observed with CasPhi2 crRNAs (Figs. 1C - IE), additions of any of the four motifs to the 3‘ end of crRNAs reduced the editing activities of AsCas 12a (Fig. 6). Somewhat surprisingly, addition of the evopreQl and mpknot motifs to the 5’ end of crRNAs generally led to decreases in mean indel frequencies induced by AsCas 12a relative to unmodified crRNAs (Fig. 6). Addition of U6 and U6cap at the 5’ end of crRNAs resulted in mean indel frequencies that w ere comparable (at the EMX site 1 and matched site 8 target sites) or slightly higher (at the DNMT1 site 4 and matched site 10 target sites) than those observed with matched unmodified crRNAs (Fig. 6). Overall, our data suggest that 5 ' U6 and 5’ U6cap modification of AsCasl2a crRNAs can also confer increases in AsCasl2a nuclease- induced gene editing activities in human cells, albeit with more modest effects than what we observed with CasPhi2-based gene editors.

[0109] SpCas9-based prime editors: Previously published work has shown that addition of the evopreQl and mpknot motifs to the 3’ end of SpCas9-based pegRNAs can increase prime editing frequencies in human cells relative to unmodified pegRNAs9. We sought to assess the effects of (1 ) adding a U6 or U6cap motif to the 3’ end of unmodified pegRNAs and (2) inserting a U6 or U6cap motif to pegRNAs bearing the evopreQl or mpknot motifs on their 3’ ends (Fig. 7A). In addition, we also wished to test the effects of adding a U6 or U6cap motif to the 5’ ends of unmodified pegRNAs and modified pegRNAs bearing the evopreQl or mpknot motifs on their 3’ ends (Fig. 7A). We constructed these various unmodified and modified pegRNAs for four different endogenous human gene target sites and coexpressed each pegRNA with PE2 protein (consisting of an SpCas9-H840A nickase fused to a MMLV-RT pentamutant8) and an additional nicking gRNA (to enhance editing efficiencies, i.e., the previously described PE3 method8) in HEK293T cells. Various types of mutations were introduced at each of the four different target sites: for example, single base changes or insertion of a FLAG epitope tag coding sequence (Figs. 7B - 7E). We also used a non-targeting (NT) pegRNA for a negative control (Figs. 7B - 7E). We then performed targeted amplicon sequencing using genomic DNA isolated from these cells to assess prime editing frequencies at each target site (Methods). These experiments demonstrated that addition of the evopreQl and mpknot motifs to the 3’ end of pegRNAs increased PE frequencies as previously reported (Figs. 7B - 7E). Notably, addition of the U6 or U6cap motifs to the 3’ end of pegRNAs also increased PE frequencies to levels comparable to or (in one case) higher than those induced by the evopreQl and mpknot motifs (Figs. 7B - 7E). By contrast, addition of U6 or U6cap motifs to the 5’ ends of unmodified pegRNAs and of modified pegRNAs with the evopreQl or mpknot motifs at their 3’ ends actually decreased PE frequencies, in some cases quite substantially (Figs. 7B - 7E). Interestingly, insertion of U6 or U6cap motifs in between the standard pegRNA sequence and 3’ end evopreQl or mpknot motifs could, in some instances, lead to additional increases in PE frequencies beyond what was observed with either motif alone at the 3' end of pegRNAs (Figs. 7B - 7E).

[0110] Our results demonstrate that addition of U6 and U6cap motifs to the 3’ end of pegRNAs can increase SpCas9-based prime editing activities to levels comparable to or higher than increases observed with addition of the evopreQl or mpknot motifs to the 3‘ end of these pegRNAs. An important advantage of using the U6 or U6cap motifs is their shorter lengths (19 nts or 25 nts, respectively) relative to the longer evopreQl and mpknot motifs (42 nts and 56 nts, respectively). In addition, our results suggest that using pairs or combinations of U6, U6cap, evopreQl, and mpknot motifs may also result in additional improvements in PE activities beyond what is observed with just the addition of a single motif to the 3' end of pegRNAs. These results, together with those we observed with CasPhi2-based editors, also suggest that the U6 or U6cap motif can be positioned on different ends (i.e., 5’ or 3’ ends) of guide RNAs or pegRNAs.

[0111] References

[0112] 1. Doudna, J. A. & Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science 346, 1258096 (2014).

[0113] 2. Wang, J. Y. & Doudna. J. A. CRISPR technology: A decade of genome editing is only the beginning. Science 379, eadd8643 (2023).

[0114] 3. Cong, L. et al. Multiplex Genome Engineering Using CRISPR / Cas Systems. Science 339, 819-823 (2013).

[0115] 4. Yeh, C. D., Richardson, C. D. & Com, J. E. Advances in genome editing through control of DNA repair pathways. Nat. Cell Biol. 21, 1468-1478 (2019).

[0116] 5. Pawelczak, K. S., Gavande, N. S., VanderVere-Carozza, P. S. & Turchi, J. J. Modulating DNA Repair Pathways to Improve Precision Genome Engineering. ACS Chem. Biol. 13, 389-396 (2018).

[0117] 6. Gaudelli, N. M. et al. Programmable base editing of A«T to G*C in genomic DNA without DNA cleavage. Nature 551, 464-471 (2017).

[0118] 7. Komor, A. C., Kim, Y. B., Packer, M. S., Zuris, J. A. & Liu, D. R. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature 533, 420-424 (2016). 8. Anzalone. A. V. et al. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature 576, 149-157 (2019).

[0119] 9. Nelson, J. W. et al. Engineered pegRNAs improve prime editing efficiency. Nat. Biotechnol. 40, 402-410 (2022).

[0120] 10. Zhang, G. et al. Enhancement of prime editing via xrRNA motif-joined pegRNA. Nat. Commun. 13, 1856 (2022).

[0121] 11. Singh, R.. Gupta. S. & Reddy, R. Capping of mammalian U6 small nuclear RNA in vitro is directed by a conserved stem-loop and AU AU AC sequence: conversion of a noncapped RNA into a capped RNA. Mol. Cell. Biol. 10, 939-946 (1990).

[0122] 12. Didychuk, A. L., Butcher, S. E. & Brow. D. A. The life of U6 small nuclear RNA, from cradle to grave. RNA 24, 437-460 (2018).

[0123] 13. Tuerk, C. et al. CUUCGG hairpins: extraordinarily stable RNA secondary' structures associated with various biochemical processes. Proc. Natl. Acad. Sci. 85. 1364-1368 (1988).

[0124] 14. Black, D. L. & Steitz, J. A. Pre-mRNA splicing in vitro requires intact U4 / U6 small nuclear ribonucleoprotein. Cell 46, 697-704 (1986).

[0125] 15. Pessa, IT. K. J. et al. Minor spliceosome components are predominantly localized in the nucleus. Proc. Natl. Acad. Sci. 105, 8655-8660 (2008).

[0126] 16. Vankan, P.. McGuigan. C. & Mattaj. I. W. Domains of U4 and U6 snRNAs required for snRNP assembly and splicing complementation in Xenopus oocytes. EMBO J. 9, 3397-3404 (1990).

[0127] 17. Pausch, P. et al. CRISPR-CasO from huge phages is a hypercompact genome editor. Science 369, 333-337 (2020).

[0128] 18. Richter, M. F. et al. Phage-assisted evolution of an adenine base editor with improved Cas domain compatibility and activity. Nat. Biotechnol. 38, 883-891 (2020).

[0129] 19. Griinewald, J. et al. Engineered CRISPR prime editors with compact, untethered reverse transcriptases. Nat. Biotechnol. (2022) doi: 10. 1038 / s41587-022- 01473-1.

[0130] 20. Kleinstiver, B. P. et al. Genome-wdde specificities of CRISPR-Cas Cpfl nucleases in human cells. Nat. Biotechnol. 34, 869-874 (2016). OTHER EMBODIMENTS

[0131] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

WHAT IS CLAIMED IS:

1. A guide RNA (gRNA) comprising a U6 and / or U6cap sequence, preferably wherein the U6 or U6 cap sequence comprises U6 stem-loop, U6 stem-loop, 19 nt: gugcucgcuucggcagcac (SEQ ID NO: 1); modified U6 stem-loop, 18 nt: gugcugcuucggcagcac (SEQ ID NO:2); U6 stem-loop with AU AU AC (U6cap) gugcucgcuucggcagcacauauac (SEQ ID NO:3); or modified U6 stem-loop with U6 cap: gugcugcuucggcagcacauauac (SEQ ID NO:4).

2. The gRNA of claim 1, wherein the U6 and / or U6cap sequence is at the 3’ or 5’ end of the gRNA.

3. The gRNA of claim 1, which is a CasPhi (Casl2j) CRISPR RNA (crRNA), or pre- crRNA.

4. The gRNA of claim 1, which is a Casl2a crRNA.

5. The gRNA of claims 3 of 4, comprising a U6 and / or U6cap motif at the 5’ end of the crRNA.

6. The gRNA of claim 1, which is a Cas9 gRNA. optionally a single guide RNA (sgRNA) or crRNA, or a crRNA-tracrRNA complex with one or both harboring a U6 and / or U6 cap sequence.

7. The gRNA of claim 1, which is a Cas9- or CasPhi-based prime editor pegRNA.

8. The gRNA of claims 6 or 7, comprising a U6 and / or U6cap motif at the 3’ end of the gRNA.

9. A composition comprising the gRNA of any of claims 1 -8, and a corresponding Cas protein with which it interacts; the gRNA of any of claims 1-8 and a nucleic acid encoding the corresponding Cas protein; or a nucleic acid encoding the gRNA of any of claims 1-8 and the corresponding Cas protein.

10. The composition of claim 9, comprising the gRNA and corresponding Cas protein.

11. The composition of claim 9, comprising the gRNA and a nucleic acid encoding corresponding Cas protein, or the nucleic acid encoding the gRNA of any of claims 1-8 and the corresponding Cas protein, wherein the nucleic acid is mRNA or is in an expression vector.

12. The composition of claim 11, wherein the expression vector is an adeno- associated virus (AAV) that further comprises a promoter for expression of the Cas protein and / or the gRNA.

13. The composition of claims 9-12, wherein the Cas protein is part of a fusion protein, optionally a base editor or prime editor.

14. A method for editing or modifying a target DNA, the method comprising contacting the target DNA with a gRNA of any of claims 1-8 and a corresponding Cas protein with which is interacts; the gRNA of any of claims 1-8 and a nucleic acid encoding the corresponding Cas protein; or a nucleic acid encoding the gRNA of any of claims 1-8 and the corresponding Cas protein.

15. The method of claim 14, comprising contacting the target DNA with the gRNA and corresponding Cas protein.

16. The method of claim 14, comprising contacting the target DNA with the gRNA and a nucleic acid encoding corresponding Cas protein, or the nucleic acid encoding the gRNA of any of claims 1-8 and the corresponding Cas protein, wherein the nucleic acid is mRNA or is in an expression vector.

17. The method of claim 16, wherein the expression vector is an adeno-associated virus (AAV) that further comprises a promoter for expression of the Cas protein and / or the gRNA.

18. The method of claims 14-17. wherein the Cas protein is part of a fusion protein, optionally a base editor or prime editor.

19. The method of claims 14-18, wherein contacting the target DNA is performed in vitro in a dish, ex vivo in isolated living cells, or in vivo in a living organism.

0. The method of claims 14-19, comprising contacting the target DNA with a ribonucleoprotein (RNP) complex comprising the protein and the modified gRNA; expressing the gRNA and protein in a cell comprising the target DNA; or expressing the protein and contacting the cell with the modified gRNA.

Images