Compounds modulating flap endonuclease (FEN1)
Compounds targeting FEN1 and EXO1 inhibit their activity, addressing the limitations of current cancer therapies by enhancing chemotherapy sensitivity in HR-defective cancers, particularly those with BRCA1/2 mutations.
Patent Information
- Application Number
- PCT/GB2025/050272
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-13
- Filing Date
- 2025-02-13
- Publication Date
- 2025-08-21
AI Technical Summary
Current cancer therapies lack effective targets for treating HR-defective cancers, particularly those with BRCA1 and BRCA2 mutations, and existing FEN1 inhibitors are not sufficient to address drug-resistant cancer cell lines.
Development of compounds that modulate flap endonuclease (FEN1) and optionally exonuclease 1 (EXO1) to inhibit their activity, specifically targeting HR-defective cancers and sensitizing cells to chemotherapeutics.
The compounds effectively inhibit FEN1, potentially enhancing the sensitivity of cancer cells to chemotherapy and providing therapeutic benefits for HR-defective cancers, including bladder, breast, colorectal, gastric, liver, lung, pancreatic, prostate, ovarian, and head and neck cancers.
Smart Images

Figure IMGF000003_0001 
Figure IMGF000004_0001 
Figure IMGF000005_0001
Abstract
Description
[0001] COMPOUNDS MODULATING FLAP ENDONUCLEASE (FEN1)
[0002] FIELD OF THE INVENTION
[0003] The present invention relates to compounds of formula (I), and stereoisomers, tautomers, N-ox- ides, or pharmaceutically acceptable salts thereof that are useful for modulating flap endonuclease (FEN1). The present invention further relates to compounds of the formula (I) for use as a medicament and to pharmaceutical compositions comprising said compounds. Further, the present invention relates to compounds of formula (I) and pharmaceutical compositions comprising said compounds for use in the treatment of cancer, in particular a cancer selected from bladder cancer, breast cancer, colorectal cancer, gastric cancer, liver cancer, lung cancer, pancreatic cancer, prostate cancer, gynaecological cancer, in particular ovarian cancer, and head and neck cancer.
[0004] BACKGROUND OF THE INVENTION
[0005] Flap endonuclease (FEN1) exhibits both endonuclease and exonuclease activity and plays a key role in genome stability, Okazaki fragment maturation during DNA replication and DNA damage repair processes such as base excision repair (BER), alternative end-joining (alt-EJ) and homologous recombination (HR). Disruption of FEN1 function is thought to lead to an accumulation of DNA double-strand breaks. Abnormal expression or mutation of FEN1 in cells can cause pathological responses, leading to various diseases, including cancers, as well as drug resistance in several types of cancers (Sun, H., Ma, L., Tsai, Y. F., Abeywardana, T., Shen, B., Zheng, L. (2023), Okazaki fragment maturation: DNA flap dynamics for cell proliferation and survival, Trends in Cell Biology, 33(3), 221-234).
[0006] One strategy in cancer therapy is to identify targets that are particularly important for the survival of tumour cells. In this context, cancer-specific gene defects are used to develop synthetic lethality strategies. Findings that inhibition with small molecule inhibitors, with FEN1 as a target, led to cell death of mutant BRCA1 and BRCA2 cancer cell lines as well as some additional cancer lines without BRCA1 and BRCA2 mutation, established FEN1 as potential therapeutic target, especially for HR-defective cancers. The growth of the tumours from drug-sensitive but not drug-resistant cancer cell lines, here breast and ovarian cancer, could be reduced by the small molecule FEN1 inhibitor (Guo, E., Ishii, Y., Mueller, J., Srivatsan, A., Gahman, T., Putnam, C. D., Wang, J. Y. J., Kolodner, R. D. (2020), FEN1 endonuclease as a therapeutic target for human cancers with defects in homologous recombination, Proceedings of the National Academy of Sciences, 117(32), 19415-19424).
[0007] Unprocessed 5'-flaps prevent ligation of Okazaki fragments and are therefore potentially harmful. Insufficient expression of FEN1, DNA2 or EXO1 can lead to deficiencies in the processing of 5'-flaps. Pol-a errors are generally removed by 5 -flap cleavage. In addition, they can be excised by the exonuclease activity of FEN1. In most cases, short 5'-flaps are mainly cleaved by FEN1, resulting in a DNA nick for ligation (Sun, H., Ma, L., Tsai, Y. F., Abeywardana, T., Shen, B., Zheng, L. (2023), Okazaki fragment maturation: DNA flap dynamics for cell proliferation and survival, Trends in Cell Biology, 33(3), 221-234).
[0008] Among others, FEN1 was identified as a synthetic lethal gene with BRCA1 and BRCA2 loss of function after it was recognized that BRCA2-deficient cells are selectively dependent on multiple signalling pathways, including base excision repair, ATR signalling and splicing. It was shown that BRCA2-deficient cells require the 5'-flap endonuclease activity of FEN land that chemical inhibition of FEN 1 selectively targets BRCA-deficient cells (Mengwasser, K. E., Adeyemi, R. O., Leng, Y., Choi, M. Y., Clairmont, C., D'Andrea, A. D., Elledge, S. J. (2019), Genetic screens reveal FEN1 and APEX2 as BRCA2 synthetic lethal targets, Molecular cell, 73(5), 885-899).
[0009] A cancer subset with sensitivity to FEN1 inhibition was found to be implicated based on replication-associated alterations in DNA such as microsatellite instabilities (MSI). The findings of Ward et al. suggest that FEN1 inhibitors may be effective in cells in which a number of DNA damage response genes, many associated with cancer, are deleted, mutated or disrupted.
[0010] FEN1 inhibitors further may sensitise cells to chemotherapeutics and DNA repair inhibitors. Cellular sensitivity to inhibitors of the / V-hydroxyurea series of FEN1 has been demonstrated in vitro for colorectal and gastric cell-lines due to a synthetic-lethal interaction between FEN1 and MRE11A, which is frequently mutated in MSI cancers. (Ward, T. A., McHugh, P. J., Durant, S. T. (2017), Small molecule inhibitors uncover synthetic genetic interactions of human flap endonuclease 1 (FEN1) with DNA damage response genes, PLoS One, 12(6), e0179278).
[0011] Therefore, FEN1 could be a prime candidate as a therapeutic target for cancer treatment / oncology drug discovery. In other words, compounds modulating FEN1 may be useful for treating cancer, in particular a cancer selected from bladder cancer, breast cancer, colorectal cancer, gastric cancer, liver cancer, lung cancer, pancreatic cancer, prostate cancer, gynaecological cancer, in particular ovarian cancer, and head and neck cancer.
[0012] OBJECTS AND SUMMARY OF THE INVENTION
[0013] It is therefore an object of the present invention to provide compounds that modulate FEN1 , in particular inhibit FEN1. In particular, it is an object to provide compounds that inhibit FEN1 with high activity. It can be a further object of the present invention to provide compounds that additionally modulate exonuclease 1 (EXO1), in particular inhibit EXO1.
[0014] It is another object of the present invention to provide compounds, which are suitable for use in the treatment of one or more diseases, in which the modulation, in particular the inhibition, of FEN1 is beneficial. It is another object of the present invention to provide compounds, which are suitable for use as a medicament. It is yet another object to provide compounds, which are suitable for the use in the treatment of cancer.
[0015] The above objects can be achieved by the compounds of formula (I) as defined herein (including stereoisomers, tautomers, / V-oxides, or pharmaceutically acceptable salts thereof) as well as pharmaceutical compositions comprising the same, and by the medical uses thereof. The inventors of the present invention inter alia surprisingly found that the compounds of formula (I) as defined herein act as modulators of FEN1, in particular that they inhibit FEN1.
[0016] Accordingly, the compounds of formula (I) (including stereoisomers, tautomers, / V-oxides, or pharmaceutically acceptable salts thereof) as well as the pharmaceutical compositions comprising the same can be used as a medicament, in particular for the treatment of cancer, wherein the treatment preferably involves the administration of the compound of formula (I) as modulators of FEN1 in an effective amount to individuals in need of such treatment.
[0017] Various aspects of the invention are detailed in this document, including compounds represented by formula (I) as well as stereoisomers, tautomers, / V-oxides, or pharmaceutically acceptable salts thereof.
[0018] In a first aspect, the present invention therefore relates to a compound of formula (I) or a stereoisomer, tautomer, / V-oxide, or pharmaceutically acceptable salt thereof, wherein
[0019] X is CHR2, and
[0020] Y is O, S, NH, S(=O), S(=O)2, C(=O), or CHR2; or
[0021] X is S(=O), S(=O)2, or C(=O), and
[0022] Y is O, S, NH, or CHR2, or
[0023] X is O, S, NH, and
[0024] Y is S(=O), S(=O)2, or C(=O), or CHR2; or the moiety R1-X-Y- is R1-S(=O)(R2)=N-;
[0025] R1is phenyl, a 5- or 6-membered aromatic heterocyclyl, or an 8- to 10-membered aromatic carbobicyclyl or heterobicyclyl, wherein the aforementioned heterocyclic and heterobicy- clic rings independently comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxi- dized, and wherein each of the aforementioned aromatic rings is independently unsubstituted or substituted with one or more, same or different, substituents Rx;
[0026] R2is H, CrC4-alkyl, or CrC4-haloalkyl;
[0027] R3is Ci-C4-alkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy-Ci-C4-alkyl, or a 3- to 7-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl, carbocyclyl-Ci-C2-alkyl, heterocyclyl, or heterocyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic rings independently comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different, substituents RY; and
[0028] R4is H; or R4and R3together with the atoms to which they are bonded form a fused 5- to 7-membered saturated heterocyclyl, wherein the aforementioned heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S- atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned heterocyclic rings is independently unsubstituted or substituted with one or more, same or different, substituents Rz; and wherein
[0029] Rxis halogen, CN, C C4-alkyl, Ci-C4-alkoxy, or a 5- or 6-membered aromatic carbocyclyl, carbocyclyl-Ci-C2-alkyl, carbocyclyloxy, heterocyclyl, heterocyclyl-Ci-C2-alkyl, or hetero- cyclyloxy, wherein the aforementioned heterocyclic rings independently of each other comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized;
[0030] RYis Ci-C2-alkyl; and
[0031] Rzis Ci-C2-alkyl.
[0032] In one preferred embodiment, the compound is a compound of formula (IA) or (IB):
[0033] In a more preferred embodiment, the compound is a compound of formula (IA): wherein preferably
[0034] R2is H, Ci-Cz-alkyl, or Ci-Cz-haloalkyl.
[0035] In an even more preferred embodiment, the compound is a compound of formula (IA*): wherein preferably
[0036] R2is H, C C2-alkyl, or C C2-haloalkyl.
[0037] In another preferred embodiment,
[0038] Y is O or S, preferably O.
[0039] In yet another preferred embodiment,
[0040] R1is phenyl, a 6-membered aromatic heterocyclyl, or a 10-membered aromatic cabobicyclyl or heterobicyclyl, wherein the aforementioned heterocyclic and heterobicyclic rings independently comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each of the aforementioned aromatic rings is independently unsubstituted or substituted with one or more, same or different, substituents Rx; and preferably
[0041] R1is phenyl, pyridinyl, naphtalenyl, quinolinyl, or isoquinolinyl, wherein each of the aforementioned aromatic rings is independently unsubstituted or substituted with one or more, same or different, substituents Rx.
[0042] In another preferred embodiment,
[0043] Rxis Cl, F, CN, Ci-C2-alkyl, C C2-alkoxy, phenyl, benzyl, or phenoxy.
[0044] In another preferred embodiment,
[0045] R2is C C2-alkyl, or C C2-haloalkyl; and preferably
[0046] R2is CH3or CF3.
[0047] In another preferred embodiment,
[0048] R3is Ci-C4-alkyl, Ci-C2-haloalkyl, Ci-C2-alkoxy-Ci-C4-alkyl, phenyl, or a 3- to 6-membered saturated carbocyclyl-Ci-C2-alkyl or heterocyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxi- dized, and wherein each of the aforementioned groups is independently unsubstituted or substituted with one or more, preferably one, same or different substituents RY; and
[0049] R4is H; or R4and R3together with the atoms to which they are bonded form a fused 6-membered saturated heterocyclyl, wherein the aforementioned heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein the aforementioned heterocyclic ring is independently unsubstituted or substituted with one or more, preferably one, same or different substituents Rz.
[0050] In a more preferred embodiment,
[0051] R4and R3together with the atoms to which they are bonded form a fused 6-membered saturated heterocyclyl, wherein the aforementioned heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein the aforementioned heterocyclic ring is independently unsubstituted or substituted with one or more, preferably one, same or different substituents Rz.
[0052] In an even more preferred embodiment, the fused saturated heterocyclyl formed by R4and R3together with the atoms to which they are bonded is a morpholinyl of the following structure: wherein the wavy lines indicate the connections to the remainder of the molecule; and preferably the fused saturated heterocyclyl formed by R4and R3together with the atoms to which they are bonded is a morpholinyl of the following structure: wherein the wavy lines indicate the connections to the remainder of the molecule.
[0053] In another preferred embodiment, the compound according to formula (I) is selected from the group consisting of:
[0054] 4-hydroxy-6-methyl-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyra- zine-3, 5-dione;
[0055] 4-hydroxy-6-methyl-2-[(naphthalen-2-yl)methoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyrazine-
[0056] 3,5-dione;
[0057] 4-hydroxy-6-methyl-2-[(1 R)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyridazino[1,6-a]pyra- zine-3, 5-dione;
[0058] 2-[(1S)-1-(1-chloronaphthalen-2-yl)ethoxy]-4-hydroxy-6-methyl-3H,5H,6H,7H,8H-pyridazino[1,6- a]pyrazine-3, 5-dione;
[0059] 4-hydroxy-6-methyl-2-[(1S)-1-(quinolin-7-yl)ethoxy]-3H,5H,6H,7H,8H-pyridazino[1,6-a]pyrazine- 3,5-dione;
[0060] 6-(cyclopropylmethyl)-4-hydroxy-2-[(1R)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0061] 4-hydroxy-6-methyl-2-[(1 R)-1-(quinolin-7-yl)ethoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyrazine- 3,5-dione;
[0062] 6-(cyclopropylmethyl)-4-hydroxy-2-[(naphthalen-2-yl)methoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6- a]pyrazine-3, 5-dione;
[0063] 6-(cyclopropylmethyl)-4-hydroxy-2-[(1R)-1-(quinolin-7-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0064] 6-(cyclopropylmethyl)-4-hydroxy-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0065] 2-[(1S)-1-(1-chloronaphthalen-2-yl)ethoxy]-6-(cyclopropylmethyl)-4-hydroxy-3H,5H,6H,7H,8H- pyridazino[1,6-a]pyrazine-3, 5-dione;
[0066] 6-(cyclopropylmethyl)-4-hydroxy-2-[(1S)-1-(quinolin-7-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione; (3S)-11 -hydroxy-13-[(1R)-1-(naphthalen-2-yl)ethoxy]-5-oxa-1 , 8, 14-tri azatri cyclop.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;
[0067] (3S)-11-hydroxy-13-[(1S)-1-(naphthalen-2-yl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0068] (3S)-13-[(1S)-1-(1-chloronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0069] (3S)-13-[(1 R)-1-(1-chloronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0070] (3S)-13-[(1S)-1-(7-chloronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;
[0071] (3S)-13-[(1 R)-1-(7-chloronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0072] (3S)-11 -hydroxy-13-[(1 R)-1 -(quinolin-7-yl)ethoxy]-5-oxa-1 ,8, 14-triazatricyclo[8.4.0.03'8]tetradeca-
[0073] 10,13-diene-9, 12-dione;
[0074] 4-hydroxy-2-[(1S)-1-phenylethoxy]-6-(propan-2-yl)-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyrazine-
[0075] 3,5-dione;
[0076] 4-hydroxy-2-[(1 R)-1-phenylethoxy]-6-(propan-2-yl)-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyrazine-
[0077] 3,5-dione;
[0078] 6-(1-cyclopropylethyl)-4-hydroxy-2-[(1 R)-1-phenylethoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]py- razine-3, 5-dione;
[0079] 6-(1-cyclopropylethyl)-4-hydroxy-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0080] 6-(1-cyclopropylethyl)-4-hydroxy-2-[(1 R)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0081] 4-hydroxy-2-[(1 R)-1-(naphthalen-2-yl)ethoxy]-6-[1-(oxan-4-yl)ethyl]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0082] 4-hydroxy-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-6-[1-(oxan-4-yl)ethyl]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0083] 4-hydroxy-6-[1-(oxan-4-yl)ethyl]-2-[(1 R)-1-phenylethoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]py- razine-3, 5-dione;
[0084] 4-hydroxy-6-[1-(oxan-4-yl)ethyl]-2-[(1S)-1-phenylethoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]py- razine-3, 5-dione;
[0085] 6-(1-cyclopropylethyl)-4-hydroxy-2-[(1S)-1-phenylethoxy]-3H,5H,6H,7H,8H-pyridazino[1,6-a]py- razine-3, 5-dione;
[0086] (3S)-13-[1-(7-fluoronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0087] (3S)-13-[1-(6-fluoronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;
[0088] (3S)-11 -hydroxy-13-[(1 R)-1 -(quinolin-2-yl)ethoxy]-5-oxa-1 ,8, 14-triazatricyclo[8.4.0.03’8]tetradeca-
[0089] 10,13-diene-9, 12-dione;
[0090] (3S)-11 -hydroxy-13-[(1S)-1-(quinolin-2-yl)ethoxy]-5-oxa-1 , 8, 14-tri azatri cyclo [8.4.0.03'8]tetradeca-
[0091] 10,13-diene-9, 12-dione;
[0092] (3S)-11-hydroxy-13-[(1S)-1-(4-methylphenyl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;
[0093] (3S)-11 -hydroxy-13-[1-(isoquinolin-3-yl)ethoxy]-5-oxa-1 , 8, 14-triazatricyclo[8.4.0.03 S]tetradeca-
[0094] 10,13-diene-9, 12-dione;
[0095] (3S)-11 -hydroxy-13-[1-(quinolin-3-yl)ethoxy]-5-oxa-1 ,8.14-triazatricyclo[8.4.0.038]tetradeca-
[0096] 10,13-diene-9, 12-dione;
[0097] (3S)-11 -hydroxy-13-[1-(quinolin-6-yl)ethoxy]-5-oxa-1 ,8.14-triazatricyclo[8.4.0.038]tetradeca-
[0098] 10,13-diene-9, 12-dione;
[0099] (3S)-11 -hydroxy-13-[1-(quinolin-7-yl)ethoxy]-5-oxa-1 , 8,14-triazatricyclo[8.4.0.03 S]tetradeca-
[0100] 10,13-diene-9, 12-dione;
[0101] (3S)-11 -hydroxy-13-[1-(isoquinolin-7-yl)ethoxy]-5-oxa-1 , 8, 14-triazatricyclo[8.4.0.03’8]tetradeca-
[0102] 10,13-diene-9, 12-dione;
[0103] (3S)-11 -hydroxy-13-[(1 R)-1 -(isoquinolin-6-yl)ethoxy]-5-oxa-1 ,8, 14-tri azatri cyclop.4.0.038]tetradeca-10,13-diene-9, 12-dione; (3S)-11-hydroxy-13-[(1S)-1-(isoquinolin-6-yl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;
[0104] (3S,7S)-11-hydroxy-7-methyl-13-[(1S)-1-(naphthalen-2-yl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0105] (3S)-11 -hydroxy-13-[(1S)-1-(pyridin-4-yl) ethoxy]-5-oxa-1 , 8, 14-triazatricyclo[8.4.0.03i8]tetradeca- 10,13-diene-9, 12-dione;
[0106] (3S)-13-[(1S)-1-(2-fluorophenyl)ethoxy]-11-hydroxy-5-oxa-1,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0107] (3S)-13-[(1S)-1-(4-fluorophenyl)ethoxy]-11-hydroxy-5-oxa-1,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;
[0108] (3S)-11-hydroxy-13-[(1S)-1-(3-methylphenyl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0109] 4-hydroxy-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-6-phenyl-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyra- zine-3, 5-dione;
[0110] (3S)-13-(benzyloxy)-11 -hydroxy- 5-oxa-1 ,8,14-triazatricyclo[8.4.0.03’8]tetradeca-10,13-diene-
[0111] 9, 12-dione;
[0112] 4-hydroxy-6-(2-methoxyethyl)-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0113] 4-hydroxy-6-(2-methoxyethyl)-2-[(1 R)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0114] 4-hydroxy-6-(3-methoxypropyl)-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0115] 4-hydroxy-6-(3-methoxypropyl)-2-[(1 R)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0116] 3-[(1S)-1-{[(3S)-11 -hydroxy-9, 12-dioxo-5-oxa-1 , 8, 14-triazatricyclo[8.4.0.03’8]tetradeca-10,13- dien-13-yl]oxy}ethyl]benzonitrile;
[0117] (3S)-13-[(1S)-1-(3-chlorophenyl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0118] (3S)-11-hydroxy-13-[(1S)-1-(3-phenoxyphenyl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0119] (3S)-11-hydroxy-13-[(1S)-1-(3-methoxyphenyl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0120] (3S)-13-[(1S)-1-(3-fluorophenyl)ethoxy]-11-hydroxy-5-oxa-1,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0121] (3S)-11-hydroxy-13-[(1S)-1-(2-phenoxyphenyl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0122] (3S)-13-[1-(7-chloronaphthalen-2-yl)-2,2,2-trifluoroethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;
[0123] (3S)-13-[(1 S)-1 -{[1 , 1 '-biphenyl]-3-yl}ethoxy]-11 -hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0124] (3S)-11 -hydroxy-13-{[(naphthalen-2-yl)methyl]sulfanyl}-5-oxa-1 , 8, 14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0125] (3S)-11 -hydroxy-13-[(naphthalen-2-yl)methanesulfonyl]-5-oxa-1 , 8, 14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;
[0126] 2-[(1S)-1-(7-chloronaphthalen-2-yl)ethoxy]-4-hydroxy-6-(2,2,2-trifluoroethyl)-3H,5H,6H,7H,8H- pyridazino[1,6-a]pyrazine-3, 5-dione;
[0127] 4-hydroxy-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-6-(2,2,2-trifluoroethyl)-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0128] 6-(cyclopropylmethyl)-4-hydroxy-2-{[methyl(naphthalen-2-yl)oxo-A6-sulfanylidene]amino}- 3H,5H,6H,7H,8H-pyridazino[1,6-a]pyrazine-3, 5-dione;
[0129] (3S)-11 -hydroxy-13-{[methyl(naphthalen-2-yl)oxo-A6-sulfanylidene]amino}-5-oxa-1 ,8, 14-triazatri- cyclo[8.4.0.03'8]tetradeca-10, 13-diene-9, 12-dione;
[0130] (3S)-11 -hydroxy-13-{[(S)-methyl(naphthalen-2-yl)oxo-A6-sulfanylidene]amino}-5-oxa-1 , 8, 14- triazatricyclo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0131] (3S)-11 -hydroxy-13-{[(R)-methyl(naphthalen-2-yl)oxo-A6-sulfanylidene]amino}-5-oxa-1 , 8, 14- triazatricyclo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione; (3S)-11-hydroxy-13-[(naphthalen-2-yl)methanesulfinyl]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione; and
[0132] (3S)-11 -hydroxy-13-[(1S)-1-phenylethoxy]-5-oxa-1 , 8, 14-triazatricyclo[8.4.0.038]tetradeca-10, 13- diene-9, 12-dione.
[0133] In a further aspect, the present invention relates to a pharmaceutical composition comprising a pharmaceutically effective amount of the compound of formula (I) as defined herein, and optionally a pharmaceutically acceptable carrier, diluent or excipient.
[0134] In yet another aspect, the present invention relates to a compound of formula (I) as defined herein or a pharmaceutical composition as defined herein for use in medicine.
[0135] In yet another aspect, the present invention relates to a compound of formula (I) as defined herein or a pharmaceutical composition as defined herein for use in the treatment of cancer, preferably for use in the treatment of a cancer selected from bladder cancer, breast cancer, colorectal cancer, gastric cancer, liver cancer, lung cancer, pancreatic cancer, prostate cancer, gynaecological cancer, in particular ovarian cancer, and head and neck cancer.
[0136] DETAILED DESCRIPTION OF THE INVENTION
[0137] In the following disclosure, preferred embodiments of the substituents in the above formula (I) are described in further detail. It is to be understood that each preferred embodiment is relevant on its own as well as in combination with other preferred embodiments. Furthermore, it is to be understood that the preferred embodiments in each case also apply to the stereoisomers, tautomers, / V-oxides, or pharmaceutically acceptable salts of the compounds of the invention.
[0138] As indicated above, the present invention relates to a compound of formula (I) or a stereoisomer, tautomer, A / -oxide, or pharmaceutically acceptable salt thereof.
[0139] In one embodiment,
[0140] X is CHR2, and
[0141] Y is O, S, NH, S(=O), S(=O)2, C(=O), or CHR2; or
[0142] X is S(=O), S(=O)2, or C(=O), and
[0143] Y is O, S, NH, or CHR2, or
[0144] X is O, S, NH, and
[0145] Y is S(=O), S(=O)2, or C(=O), or CHR2; or the moiety R1-X-Y- is R1-S(=O)(R2)=N-.
[0146] In a preferred embodiment,
[0147] X is CHR2, and
[0148] Y is O, S, NH, S(=O), S(=O)2, C(=O), or CHR2; or the moiety R1-X-Y- is R1-S(=O)(R2)=N-.
[0149] In a more preferred embodiment,
[0150] X is CHR2, and Y is O, S, S(=O), or S(=O)2; or the moiety R1-X-Y- is R1-S(=O)(R2)=N-.
[0151] Thus, in one preferred embodiment, the compound of formula (I) is a compound of formula (IA) or (IB):
[0152] In one preferred embodiment, the compound of formula (I) is a compound of formula (IA). In another preferred embodiment, the compound of formula (I) is a compound of formula (IB).
[0153] In a particularly preferred embodiment, the compound of formula (I) is a compound of formula
[0154] (IA):
[0155] As indicated above, in connection with the compounds of formula (IA), it is preferred that
[0156] Y is O, S, S(=O), or S(=O)2; and especially preferred that
[0157] Y is O or S, in particular O.
[0158] Depending on the configuration of the chiral carbon atom, the compound of formula (IA) may be a compound of formula (IA*) or (IA**):
[0159] In one preferred embodiment, the compound of formula (I) is a compound of formula (IA*). In another preferred embodiment, the compound of formula (I) is a compound of formula (IA**).
[0160] In connection with the compounds of formula (I A*) and (IA**), it is preferred that
[0161] Y is O, S, S(=O), or S(=O)2; and especially preferred that
[0162] Y is O or S, in particular O.
[0163] In a particularly preferred embodiment, the compound of formula (I) is a compound of formula (IA*): wherein preferably Y is O. In connection with the compounds of formula (I) and in particular in connection with the compounds of formula (IA), (IB), (IA*) or (IA**), the substituents R1, R2, R3, and R4as well as Rx, RY, and Rzare defined as follows:
[0164] In one embodiment,
[0165] R1is phenyl, a 5- or 6-membered aromatic heterocyclyl, or an 8- to 10-membered aromatic carbobicyclyl or heterobicyclyl, wherein the aforementioned heterocyclic and heterobicy- clic rings independently comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxi- dized, and wherein each of the aforementioned aromatic rings is independently unsubstituted or substituted with one or more, same or different, substituents Rx.
[0166] In a preferred embodiment,
[0167] R1is phenyl, a 6-membered aromatic heterocyclyl, or a 10-membered aromatic carbobicyclyl or heterobicyclyl, wherein the aforementioned heterocyclic and heterobicyclic rings independently comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each of the aforementioned aromatic rings is independently unsubstituted or substituted with one or more, same or different, substituents Rx.
[0168] In a more preferred embodiment,
[0169] R1is phenyl, pyridinyl, naphtalenyl, quinolinyl, or isoquinolinyl, wherein each of the aforementioned aromatic rings is independently unsubstituted or substituted with one or more, same or different, substituents Rx.
[0170] In an even more preferred embodiment,
[0171] R1is phenyl, pyridine-4-yl, naphthalen-2-yl, quinolin-2-yl, quinolin-3-yl, quinolin-6-yl, quino- lin-7-yl, isoquinolin-3-yl, isoquinolin-6-yl, isoquinolin-7-yl, wherein each of the aforementioned aromatic rings is independently unsubstituted or substituted with one or more, same or different, substituents Rx.
[0172] In this connection, the following definitions of Rxapply.
[0173] In one embodiment,
[0174] Rxis halogen, CN, Ci-C4-alkyl, Ci-C4-alkoxy, or a 5- or 6-membered aromatic carbocyclyl, carbocyclyl-Ci-C2-alkyl, carbocyclyloxy, heterocyclyl, heterocyclyl-Ci-Cz-alkyl, or hetero- cyclyloxy, wherein the aforementioned heterocyclic rings independently of each other comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized.
[0175] In a preferred embodiment,
[0176] Rxis Cl, F, CN, Ci-C2-alkyl, Ci-C2-alkoxy, phenyl, benzyl, or phenoxy.
[0177] In a more preferred embodiment,
[0178] Rxis Cl, F, CN, CH3, methoxy, phenyl, or phenoxy.
[0179] Thus, in one particularly preferred embodiment of the compounds of formula (I) and in particular of the compounds of formula (IA), (IB), (IA*) or (IA**),
[0180] R1is phenyl, pyridine-4-yl, naphthalen-2-yl, quinolin-2-yl, quinolin-3-yl, quinolin-6-yl, quino- lin-7-yl, isoquinolin-3-yl, isoquinolin-6-yl, isoquinolin-7-yl, wherein each of the aforementioned aromatic rings is independently unsubstituted or substituted with one or more, same or different, substituents Rx, wherein
[0181] Rxis Cl, F, CN, CH3, methoxy, phenyl, or phenoxy.
[0182] In one embodiment,
[0183] R2is H, Ci-C4-alkyl, or Ci-C4-haloalkyl.
[0184] In a preferred embodiment,
[0185] R2is H, Ci-C2-alkyl, or Ci-C2-haloalkyl
[0186] In a more preferred embodiment,
[0187] R2is C C2-alkyl, or C C2-haloalkyl.
[0188] In an even more preferred embodiment,
[0189] R2is CH3or CF3. Thus, in one particularly preferred embodiment of the compounds of formula (I) and in particular of the compounds of formula (IA), (IB), (IA*) or (IA**), R2is CH3or CF3.
[0190] In one embodiment,
[0191] R3is Ci-C4-alkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy-Ci-C4-alkyl, or a 3- to 7-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl, carbocyclyl-Ci-C2-alkyl, het- erocyclyl, or heterocyclyl-CrCz-alkyl, wherein the aforementioned heterocyclic rings independently comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different, substituents RY; and
[0192] R4is H; or R4and R3together with the atoms to which they are bonded form a fused 5- to 7-membered saturated heterocyclyl, wherein the aforementioned heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S- atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned heterocyclic rings is independently unsubstituted or substituted with one or more, same or different, substituents Rz.
[0193] In a preferred embodiment,
[0194] R3is Ci-C4-alkyl, Ci-C2-haloalkyl, Ci-C2-alkoxy-Ci-C4-alkyl, phenyl, or a 3- to 6-membered saturated carbocyclyl-Ci-C2-alkyl or heterocyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each of the aforementioned groups is independently unsubstituted or substituted with one or more, preferably one, same or different substituents RY; and
[0195] R4is H; or R4and R3together with the atoms to which they are bonded form a fused 6-membered saturated heterocyclyl, wherein the aforementioned heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein the aforementioned heterocyclic ring is independently unsubstituted or substituted with one or more, preferably one, same or different substituents Rz.
[0196] In one more preferred embodiment,
[0197] R3is Ci-C4-alkyl, Ci-C2-haloalkyl, Ci-C2-alkoxy-Ci-C4-alkyl, phenyl, or a 3- to 6-membered saturated carbocyclyl-Ci-C2-alkyl or heterocyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each of the aforementioned groups is independently unsubstituted or substituted with one or more, preferably one, same or different substituents RY; and
[0198] R4is H.
[0199] In another more preferred embodiment,
[0200] R4and R3together with the atoms to which they are bonded form a fused 6-membered saturated heterocyclyl, wherein the aforementioned heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein the aforementioned heterocyclic ring is independently unsubstituted or substituted with one or more, preferably one, same or different substituents Rz.
[0201] In an even more preferred embodiment,
[0202] R4and R3together with the atoms to which they are bonded form a fused 6-membered saturated heterocyclyl, wherein the aforementioned heterocyclic ring comprises in addition to the nitrogen atom to which R3is bonded one oxygen atom, wherein said nitrogen atom is independently oxidized or non-oxidized, and wherein the aforementioned heterocyclic ring is independently unsubstituted or substituted with one or more, preferably one, same or different substituents Rz. In this connection, it is even more preferred that the heterocyclic ring is unsubstituted, i.e. that Rzis absent.
[0203] In one particularly preferred embodiment, the fused saturated heterocyclyl formed by R4and R3together with the atoms to which they are bonded is of the following structure: wherein the wavy lines indicate the connections to the remainder of the molecule.
[0204] In another particularly preferred embodiment, the fused saturated heterocyclyl formed by R4and R3together with the atoms to which they are bonded is a morpholinyl of the following structure: wherein the wavy lines indicate the connections to the remainder of the molecule.
[0205] In an especially preferred embodiment the fused saturated heterocyclyl formed by R4and R3together with the atoms to which they are bonded is a morpholinyl of the following structure: wherein the wavy lines indicate the connections to the remainder of the molecule.
[0206] Thus, in one particularly preferred embodiment of the compounds of formula (I) and in particular of the compounds of formula (IA), (IB), (IA*) or (IA**),
[0207] R4and R3together with the atoms to which they are bonded form a fused saturated heterocyclyl of the following structure
[0208] In one embodiment, the compound according to formula (I) is selected from the group consisting of:
[0209] 4-hydroxy-6-methyl-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyra- zine-3, 5-dione;
[0210] 4-hydroxy-6-methyl-2-[(naphthalen-2-yl)methoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyrazine-
[0211] 3,5-dione;
[0212] 4-hydroxy-6-methyl-2-[(1 R)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyridazino[1,6-a]pyra- zine-3, 5-dione;
[0213] 2-[(1S)-1-(1-chloronaphthalen-2-yl)ethoxy]-4-hydroxy-6-methyl-3H,5H,6H,7H,8H-pyridazino[1,6- a]pyrazine-3, 5-dione;
[0214] 4-hydroxy-6-methyl-2-[(1S)-1-(quinolin-7-yl)ethoxy]-3H,5H,6H,7H,8H-pyridazino[1,6-a]pyrazine-
[0215] 3,5-dione;
[0216] 6-(cyclopropylmethyl)-4-hydroxy-2-[(1R)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0217] 4-hydroxy-6-methyl-2-[(1 R)-1-(quinolin-7-yl)ethoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyrazine-
[0218] 3,5-dione;
[0219] 6-(cyclopropylmethyl)-4-hydroxy-2-[(naphthalen-2-yl)methoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6- a]pyrazine-3, 5-dione; 6-(cyclopropylmethyl)-4-hydroxy-2-[(1R)-1-(quinolin-7-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0220] 6-(cyclopropylmethyl)-4-hydroxy-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0221] 2-[(1S)-1-(1-chloronaphthalen-2-yl)ethoxy]-6-(cyclopropylmethyl)-4-hydroxy-3H,5H,6H,7H,8H- pyridazino[1,6-a]pyrazine-3, 5-dione;
[0222] 6-(cyclopropylmethyl)-4-hydroxy-2-[(1S)-1-(quinolin-7-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0223] (3S)-11-hydroxy-13-[(1R)-1-(naphthalen-2-yl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;
[0224] (3S)-11-hydroxy-13-[(1S)-1-(naphthalen-2-yl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0225] (3S)-13-[(1S)-1-(1-chloronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0226] (3S)-13-[(1 R)-1-(1-chloronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;
[0227] (3S)-13-[(1S)-1-(7-chloronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0228] (3S)-13-[(1 R)-1-(7-chloronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0229] (3S)-11 -hydroxy-13-[(1 R)-1 -(quinolin-7-yl)ethoxy]-5-oxa-1 ,8, 14-triazatricyclo[8.4.0.03'8]tetradeca- 10,13-diene-9, 12-dione;
[0230] 4-hydroxy-2-[(1S)-1-phenylethoxy]-6-(propan-2-yl)-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyrazine-
[0231] 3,5-dione;
[0232] 4-hydroxy-2-[(1 R)-1-phenylethoxy]-6-(propan-2-yl)-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyrazine-
[0233] 3,5-dione;
[0234] 6-(1-cyclopropylethyl)-4-hydroxy-2-[(1 R)-1-phenylethoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]py- razine-3, 5-dione;
[0235] 6-(1-cyclopropylethyl)-4-hydroxy-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0236] 6-(1-cyclopropylethyl)-4-hydroxy-2-[(1 R)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0237] 4-hydroxy-2-[(1 R)-1-(naphthalen-2-yl)ethoxy]-6-[1-(oxan-4-yl)ethyl]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0238] 4-hydroxy-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-6-[1-(oxan-4-yl)ethyl]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0239] 4-hydroxy-6-[1-(oxan-4-yl)ethyl]-2-[(1 R)-1-phenylethoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]py- razine-3, 5-dione;
[0240] 4-hydroxy-6-[1-(oxan-4-yl)ethyl]-2-[(1S)-1-phenylethoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]py- razine-3, 5-dione;
[0241] 6-(1-cyclopropylethyl)-4-hydroxy-2-[(1S)-1-phenylethoxy]-3H,5H,6H,7H,8H-pyridazino[1,6-a]py- razine-3, 5-dione;
[0242] (3S)-13-[1-(7-fluoronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;
[0243] (3S)-13-[1-(6-fluoronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0244] (3S)-11 -hydroxy-13-[(1 R)-1 -(quinolin-2-yl)ethoxy]-5-oxa-1 ,8, 14-triazatricyclo[8.4.0.03’8]tetradeca-
[0245] 10,13-diene-9, 12-dione;
[0246] (3S)-11 -hydroxy-13-[(1S)-1-(quinolin-2-yl)ethoxy]-5-oxa-1 , 8, 14-tri azatri cyclo [8.4.0.03,8]tetradeca- 10,13-diene-9, 12-dione;
[0247] (3S)-11-hydroxy-13-[(1S)-1-(4-methylphenyl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03,8]tetradeca-10,13-diene-9, 12-dione;
[0248] (3S)-11 -hydroxy-13-[1-(isoquinolin-3-yl)ethoxy]-5-oxa-1 , 8, 14-triazatricyclo[8.4.0.03’8]tetradeca-
[0249] 10,13-diene-9, 12-dione;
[0250] (3S)-11 -hydroxy-13-[1-(quinolin-3-yl)ethoxy]-5-oxa-1 ,8.14-triazatricyclo[8.4.0.038]tetradeca-
[0251] 10,13-diene-9, 12-dione; (3S)-11 -hydroxy-13-[1-(quinolin-6-yl)ethoxy]-5-oxa-1 ,8,14-triazatricyclo[8.4.0.038]tetradeca- 10,13-diene-9, 12-dione;
[0252] (3S)-11 -hydroxy-13-[1-(quinolin-7-yl)ethoxy]-5-oxa-1 , 8,14-triazatricyclo[8.4.0.038]tetradeca- 10,13-diene-9, 12-dione;
[0253] (3S)-11 -hydroxy-13-[1-(isoquinolin-7-yl)ethoxy]-5-oxa-1 , 8, 14-triazatricyclo[8.4.0.03’8]tetradeca- 10,13-diene-9, 12-dione;
[0254] (3S)-11 -hydroxy-13-[(1 R)-1 -(isoquinolin-6-yl)ethoxy]-5-oxa-1 ,8, 14-tri azatri cyclop.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0255] (3S)-11-hydroxy-13-[(1S)-1-(isoquinolin-6-yl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;
[0256] (3S,7S)-11-hydroxy-7-methyl-13-[(1S)-1-(naphthalen-2-yl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0257] (3S)-11 -hydroxy-13-[(1 S)-1 -(pyridin-4-yl) ethoxy]-5-oxa-1 , 8, 14-triazatricyclo[8.4.0.038]tetradeca- 10,13-diene-9, 12-dione;
[0258] (3S)-13-[(1S)-1-(2-fluorophenyl)ethoxy]-11-hydroxy-5-oxa-1,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;
[0259] (3S)-13-[(1S)-1-(4-fluorophenyl)ethoxy]-11-hydroxy-5-oxa-1,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0260] (3S)-11-hydroxy-13-[(1S)-1-(3-methylphenyl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0261] 4-hydroxy-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-6-phenyl-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyra- zine-3, 5-dione;
[0262] (3S)-13-(benzyloxy)-11 -hydroxy- 5-oxa-1 ,8,14-triazatricyclo[8.4.0.03’8]tetradeca-10,13-diene-
[0263] 9, 12-dione;
[0264] 4-hydroxy-6-(2-methoxyethyl)-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0265] 4-hydroxy-6-(2-methoxyethyl)-2-[(1 R)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0266] 4-hydroxy-6-(3-methoxypropyl)-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0267] 4-hydroxy-6-(3-methoxypropyl)-2-[(1 R)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0268] 3-[(1S)-1-{[(3S)-11 -hydroxy-9, 12-dioxo-5-oxa-1 , 8, 14-triazatricyclo[8.4.0.03’8]tetradeca-10,13- dien-13-yl]oxy}ethyl]benzonitrile;
[0269] (3S)-13-[(1S)-1-(3-chlorophenyl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0270] (3S)-11-hydroxy-13-[(1S)-1-(3-phenoxyphenyl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;
[0271] (3S)-11-hydroxy-13-[(1S)-1-(3-methoxyphenyl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0272] (3S)-13-[(1S)-1-(3-fluorophenyl)ethoxy]-11-hydroxy-5-oxa-1,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0273] (3S)-11-hydroxy-13-[(1S)-1-(2-phenoxyphenyl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;
[0274] (3S)-13-[1-(7-chloronaphthalen-2-yl)-2,2,2-trifluoroethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0275] (3S)-13-[(1 S)-1 -{[1 , 1 '-biphenyl]-3-yl}ethoxy]-11 -hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0276] (3S)-11-hydroxy-13-{[(naphthalen-2-yl)methyl]sulfanyl}-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0277] (3S)-11 -hydroxy-13-[(naphthalen-2-yl)methanesulfonyl]-5-oxa-1 , 8, 14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;
[0278] 2-[(1S)-1-(7-chloronaphthalen-2-yl)ethoxy]-4-hydroxy-6-(2,2,2-trifluoroethyl)-3H,5H,6H,7H,8H- pyridazino[1,6-a]pyrazine-3, 5-dione;
[0279] 4-hydroxy-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-6-(2,2,2-trifluoroethyl)-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione; 6-(cyclopropylmethyl)-4-hydroxy-2-{[methyl(naphthalen-2-yl)oxo-A6-sulfanylidene]amino}- 3H,5H,6H,7H,8H-pyridazino[1,6-a]pyrazine-3, 5-dione;
[0280] (3S)-11 -hydroxy-13-{[methyl(naphthalen-2-yl)oxo-A6-sulfanylidene]amino}-5-oxa-1 ,8, 14-triazatri- cyclo[8.4.0.03’8]tetradeca-10, 13-diene-9, 12-dione;
[0281] (3S)-11 -hydroxy-13-{[(S)-methyl(naphthalen-2-yl)oxo-A6-sulfanylidene]amino}-5-oxa-1 , 8, 14- triazatricyclo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0282] (3S)-11 -hydroxy-13-{[(R)-methyl(naphthalen-2-yl)oxo-A6-sulfanylidene]amino}-5-oxa-1 , 8, 14- triazatricyclo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0283] (3S)-11 -hydroxy-13-[(naphthalen-2-yl)methanesulfinyl]-5-oxa-1 , 8, 14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione; and
[0284] (3S)-11 -hydroxy-13-[(1S)-1-phenylethoxy]-5-oxa-1 , 8, 14-triazatricyclo[8.4.0.038]tetradeca-10, 13- diene-9, 12-dione.
[0285] In one preferred embodiment, the compound according to formula (I) is selected from the group consisting of:
[0286] 4-hydroxy-6-methyl-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyra- zine-3, 5-dione;
[0287] 2-[(1S)-1-(1-chloronaphthalen-2-yl)ethoxy]-4-hydroxy-6-methyl-3H,5H,6H,7H,8H-pyridazino[1,6- a]pyrazine-3, 5-dione;
[0288] 4-hydroxy-6-methyl-2-[(1S)-1-(quinolin-7-yl)ethoxy]-3H,5H,6H,7H,8H-pyridazino[1,6-a]pyrazine-
[0289] 3,5-dione;
[0290] 6-(cyclopropylmethyl)-4-hydroxy-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0291] 2-[(1S)-1-(1-chloronaphthalen-2-yl)ethoxy]-6-(cyclopropylmethyl)-4-hydroxy-3H,5H,6H,7H,8H- pyridazino[1,6-a]pyrazine-3, 5-dione;
[0292] 6-(cyclopropylmethyl)-4-hydroxy-2-[(1S)-1-(quinolin-7-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0293] (3S)-11-hydroxy-13-[(1S)-1-(naphthalen-2-yl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0294] (3S)-13-[(1S)-1-(1-chloronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 , 8, 14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0295] (3S)-13-[(1S)-1-(7-chloronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;
[0296] 4-hydroxy-2-[(1S)-1-phenylethoxy]-6-(propan-2-yl)-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyrazine-
[0297] 3,5-dione;
[0298] 6-(1-cyclopropylethyl)-4-hydroxy-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0299] 4-hydroxy-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-6-[1-(oxan-4-yl)ethyl]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0300] 4-hydroxy-6-[1-(oxan-4-yl)ethyl]-2-[(1S)-1-phenylethoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]py- razine-3, 5-dione;
[0301] 6-(1-cyclopropylethyl)-4-hydroxy-2-[(1S)-1-phenylethoxy]-3H,5H,6H,7H,8H-pyridazino[1,6-a]py- razine-3, 5-dione;
[0302] (3S)-11 -hydroxy-13-[(1S)-1-(quinolin-2-yl)ethoxy]-5-oxa-1 , 8, 14-tri azatri cyclo [8.4.0.03'8]tetradeca- 10,13-diene-9, 12-dione;
[0303] (3S)-11-hydroxy-13-[(1S)-1-(4-methylphenyl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;
[0304] (3S)-11-hydroxy-13-[(1S)-1-(isoquinolin-6-yl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0305] (3S,7S)-11-hydroxy-7-methyl-13-[(1S)-1-(naphthalen-2-yl)ethoxy]-5-oxa-1 , 8, 14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0306] (3S)-11 -hydroxy-13-[(1 S)-1 -(pyridin-4-yl) ethoxy]-5-oxa-1 , 8, 14-triazatricyclo[8.4.0.03,8]tetradeca- 10,13-diene-9, 12-dione;
[0307] (3S)-13-[(1S)-1-(2-fluorophenyl)ethoxy]-11-hydroxy-5-oxa-1,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione; (3S)-13-[(1S)-1-(4-fluorophenyl)ethoxy]-11-hydroxy-5-oxa-1,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;
[0308] (3S)-11-hydroxy-13-[(1S)-1-(3-methylphenyl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0309] 4-hydroxy-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-6-phenyl-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyra- zine-3, 5-dione;
[0310] (3S)-13-(benzyloxy)-11-hydroxy-5-oxa-1 ,8,14-triazatricyclo[8.4.0.03'8]tetradeca-10,13-diene-
[0311] 9,12-dione;
[0312] 4-hydroxy-6-(2-methoxyethyl)-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0313] 4-hydroxy-6-(3-methoxypropyl)-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0314] 3-[(1S)-1-{[(3S)-11 -hydroxy-9, 12-dioxo-5-oxa-1 , 8, 14-triazatricyclo[8.4.0.03'8]tetradeca-10,13- dien-13-yl]oxy}ethyl]benzonitrile;
[0315] (3S)-13-[(1S)-1-(3-chlorophenyl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;
[0316] (3S)-11-hydroxy-13-[(1S)-1-(3-phenoxyphenyl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0317] (3S)-11-hydroxy-13-[(1S)-1-(3-methoxyphenyl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0318] (3S)-13-[(1S)-1-(3-fluorophenyl)ethoxy]-11-hydroxy-5-oxa-1,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0319] (3S)-11-hydroxy-13-[(1S)-1-(2-phenoxyphenyl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;
[0320] (3S)-13-[1-(7-chloronaphthalen-2-yl)-2,2,2-trifluoroethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0321] (3S)-13-[(1 S)-1 -{[1 , 1 '-biphenyl]-3-yl}ethoxy]-11 -hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0322] 2-[(1S)-1-(7-chloronaphthalen-2-yl)ethoxy]-4-hydroxy-6-(2,2,2-trifluoroethyl)-3H,5H,6H,7H,8H- pyridazino[1,6-a]pyrazine-3, 5-dione;
[0323] 4-hydroxy-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-6-(2,2,2-trifluoroethyl)-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0324] (3S)-11 -hydroxy-13-{[(S)-methyl(naphthalen-2-yl)oxo-A6-sulfanylidene]amino}-5-oxa-1 , 8, 14- triazatricyclo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione; and
[0325] (3S)-11 -hydroxy-13-[(1S)-1-phenylethoxy]-5-oxa-1 ,8.14-triazatricyclo[8.4.0.038]tetradeca-10, 13- diene-9, 12-dione.
[0326] In another preferred embodiment, the compound according to formula (I) is selected from the group consisting of:
[0327] 4-hydroxy-6-methyl-2-[(1 R)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyridazino[1,6-a]pyra- zine-3, 5-dione;
[0328] 6-(cyclopropylmethyl)-4-hydroxy-2-[(1R)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0329] 4-hydroxy-6-methyl-2-[(1 R)-1-(quinolin-7-yl)ethoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyrazine- 3,5-dione;
[0330] 6-(cyclopropylmethyl)-4-hydroxy-2-[(1R)-1-(quinolin-7-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0331] (3S)-11-hydroxy-13-[(1R)-1-(naphthalen-2-yl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0332] (3S)-13-[(1 R)-1-(1-chloronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0333] (3S)-13-[(1 R)-1-(7-chloronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0334] (3S)-11 -hydroxy-13-[(1 R)-1 -(quinolin-7-yl)ethoxy]-5-oxa-1 ,8, 14-triazatricyclo[8.4.0.03’8]tetradeca- 10,13-diene-9, 12-dione; 4-hydroxy-2-[(1 R)-1-phenylethoxy]-6-(propan-2-yl)-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyrazine- 3,5-dione;
[0335] 6-(1-cyclopropylethyl)-4-hydroxy-2-[(1 R)-1-phenylethoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]py- razine-3, 5-dione;
[0336] 6-(1-cyclopropylethyl)-4-hydroxy-2-[(1 R)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0337] 4-hydroxy-2-[(1 R)-1-(naphthalen-2-yl)ethoxy]-6-[1-(oxan-4-yl)ethyl]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0338] 4-hydroxy-6-[1-(oxan-4-yl)ethyl]-2-[(1 R)-1-phenylethoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]py- razine-3, 5-dione;
[0339] (3S)-11 -hydroxy-13-[(1 R)-1 -(quinolin-2-yl)ethoxy]-5-oxa-1 ,8, 14-triazatricyclo[8.4.0.03’8]tetradeca- 10,13-diene-9, 12-dione;
[0340] (3S)-11 -hydroxy-13-[(1 R)-1 -(isoquinolin-6-yl)ethoxy]-5-oxa-1 ,8, 14-tri azatri cyclop.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;
[0341] , 14-triazatricyclo[8.4.0.03’8]tetradeca-10, 13-diene-9, 12-dione;
[0342] 4-hydroxy-6-(2-methoxyethyl)-2-[(1 R)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;
[0343] 4-hydroxy-6-(3-methoxypropyl)-2-[(1 R)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione; and
[0344] (3S)-11 -hydroxy-13-{[(R)-methyl(naphthalen-2-yl)oxo-A6-sulfanylidene]amino}-5-oxa-1 , 8, 14- triazatricyclo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione.
[0345] DEFINITIONS
[0346] The term “compound(s) of the present invention” is to be understood as equivalent to the term "compound(s) according to the invention" and relates to the compounds of formula (I) as well as to compounds of formula (IA), (IB), (IA*), (IA**) and also covers a stereoisomer, tautomer, / V-ox- ide, or pharmaceutically acceptable salt thereof.
[0347] The compounds according to the invention may be amorphous or may exist in one or more different crystalline states (polymorphs), which may have different macroscopic properties such as stability or show different biological properties such as activities. The present invention relates to amorphous and crystalline forms of compounds of formula (I), mixtures of different crystalline states of the compounds of formula (I), as well as amorphous or crystalline salts thereof.
[0348] The compounds according to the invention also include solvates, in particular hydrates of the compounds of formula (I). The term “hydrate” in connection with the compounds of formula (I) refers to a compound of formula (I), which contains water or its constituent elements (i.e. H and OH). Preferably, a hydrate of the compounds of formula (I) is a compound of formula (I), which incorporates water molecules in the crystalline structure but does not alter the chemical structure of formula (I). It is to be understood that such hydrates of the compounds provided herein, particularly the compounds of the present invention, also include hydrates of pharmaceutically acceptable salts of the corresponding compounds.
[0349] Salts of the compounds according to the invention are preferably pharmaceutically acceptable salts, such as those containing counterions present in drug products listed in the US FDA Orange Book database. They can be formed in a customary manner, e.g., by reacting the compound with an acid of the anion in question, if the compounds according to the invention have a basic functionality, or by reacting acidic compounds according to the invention with a suitable base.
[0350] Suitable cationic counterions are in particular the ions of the alkali metals, preferably lithium, sodium and potassium, of the alkaline earth metals, preferably calcium, magnesium and barium, and of the transition metals, preferably manganese, copper, silver, zinc and iron, and also ammonium (NH4+) and substituted ammonium in which one to four of the hydrogen atoms are replaced by Ci-C4-alkyl, Ci-C4-hydroxyalkyl, Ci-C4-alkoxy, Ci-C4-alkoxy-Ci-C4-alkyl, hydroxy-Ci- C4-alkoxy-Ci-C4-alkyl, phenyl or benzyl. Examples of substituted ammonium ions comprise methylammonium, isopropylammonium, dimethylammonium, diisopropylammonium, trimethylammonium, tetramethylammonium, tetraethylammonium, tetrabutylammonium, 2-hydroxy- ethylammonium, 2-(2-hydroxyethoxy)ethyl-ammonium, bis(2-hydroxyethyl)ammonium, benzyltrimethylammonium and benzyltriethylammonium, furthermore the cations of 1 ,4-piperazine, meglumine, benzathine and lysine.
[0351] Suitable anionic counterions are in particular chloride, bromide, hydrogensulfate, sulfate, dihydrogenphosphate, hydrogenphosphate, phosphate, nitrate, bicarbonate, carbonate, hexafluorosilicate, hexafluorophosphate, benzoate, and the anions of Ci-C4-alkanoic acids, preferably formate, acetate, propionate and butyrate, furthermore lactate, gluconate, and the anions of poly acids such as succinate, oxalate, maleate, fumarate, malate, tartrate and citrate, furthermore sulfonate anions such as besylate (benzenesulfonate), tosylate (p-toluenesulfonate), napsylate (naphthalene-2-sulfonate), mesylate (methanesulfonate), esylate (ethanesulfonate), and ethanedisulfonate. They can be formed by reacting compounds according to the invention that have a basic functionality with an acid of the corresponding anion.
[0352] Tautomers may be formed, if a substituent is present at the compound of formula (I), which allows for the formation of tautomers such as keto-enol tautomers, imine-enamine tautomers, am- ide-imidic acid tautomers or the like.
[0353] The term " / V-oxide" includes any compound of the present invention which has at least one tertiary nitrogen atom that is oxidized to an / V-oxide moiety.
[0354] Depending on the substitution pattern, the compounds according to the invention may have one or more centres of chirality, including axial chirality providing different stereoisomers. The invention provides both, pure enantiomers or pure diastereomers, of the compounds according to the invention, and their mixtures, including racemic mixtures. Suitable compounds according to the invention also include all possible geometrical stereoisomers (cis / trans isomers or E / Z isomers) and mixtures thereof. E / Z- isomers may be present with respect to, e.g., an alkene, carbon-ni- trogen double-bond or amide group.
[0355] Any formula or structure given herein, including compounds of formula (I), is also intended to represent unlabeled forms as well as isotopically labeled forms of the compounds. Isotopically labeled compounds have structures depicted by the formulas given herein except that one or more atoms are replaced by an atom having a selected atomic mass or mass number. Examples of isotopes that can be incorporated into compounds of the disclosure include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorous, fluorine and chlorine, such as, but not limited to2H (deuterium, D),3H (tritium),11C,13C,14C,15N,18F,31P,32P,35S,36CI and125l. For example, radioactive isotopes such as3H,13C and14C provide isotopically labelled compounds useful in metabolic studies, reaction kinetic studies, detection or imaging techniques, such as positron emission tomography (PET) or single-photon emission computed tomography (SPECT) including drug or substrate tissue distribution assays or in radioactive treatment of patients. Further, the disclosure includes compounds of formula (I) in which from 1 to n hydrogens attached to a carbon atom is / are replaced by deuterium, in which n is the number of hydrogens in the molecule. Deuterium labeled or substituted therapeutic compounds of the disclosure may have improved DMPK (drug metabolism and pharmacokinetics) properties, relating to distribution, metabolism and excretion (ADME). Substitution with heavier isotopes such as deuterium may afford certain therapeutic advantages resulting from greater metabolic stability, for example increased in vivo half-life, reduced dosage requirements and / or an improvement in therapeutic index. See, for example, Poster, "Deuterium Isotope Effects in Studies of Drug Metabolism", Trends Pharmacol. Sei. 5(12):524- 527 (1984). Such compounds are synthesized by means well known in the art, for example by employing starting materials in which one or more hydrogens have been replaced by deuterium. The concentration of such a heavier isotope, specifically deuterium, may be defined by an isotopic enrichment factor. Unless otherwise stated, when a position is designated specifically as "H" or "hydrogen", the position is understood to have hydrogen at its natural abundance isotopic composition. Accordingly, in the compounds of this disclosure any atom specifically designated as a deuterium (D) is meant to represent deuterium.
[0356] The term "substituted", as used herein, means that a hydrogen atom bonded to a designated atom is replaced with a specified substituent, provided that the substitution results in a stable or chemically feasible compound. Unless otherwise indicated, a substituted atom may have one or more substituents and each substituent is independently selected. The term "substitutable atom" means that attached to the atom is a hydrogen, which can be replaced with a suitable substituent. The term "substitutable", when used in reference to a designated atom, means that attached to the atom is a hydrogen, which can be replaced with a suitable substituent. When it is referred to certain atoms or moieties being substituted with “one or more” substituents, the term “one or more” is intended to cover at least one substituent, e.g., 1 to 10 substituents, preferably 1, 2, 3, 4, or 5 substituents, more preferably 1 , 2, or 3 substituents, most preferably 1 , or 2 substituents. When neither the term “unsubstituted” nor “substituted” is explicitly mentioned concerning a moiety, said moiety is to be considered as unsubstituted.
[0357] The organic moieties mentioned in the above definitions of the variables are - like the term halogen - collective terms for individual listings of the individual group members. The prefix Cn-Cmindicates in each case the possible number of carbon atoms in the group.
[0358] The term “halo” refers to fluoro, chloro, or bromo, particularly fluoro or chloro. The term “halogen” denotes in each case fluorine, bromine, chlorine or iodine, in particular fluorine, chlorine, or bromine.
[0359] The term "alkyl" as used herein denotes in each case a straight-chain or branched alkyl group having usually from 1 to 6 carbon atoms, preferably 1 to 5 or 1 to 4 carbon atoms, more preferably 1 to 3 or 1 or 2 carbon atoms. Examples of an alkyl group are methyl, ethyl, n-propyl, isopropyl, -butyl, 2-butyl, / so-butyl, tert-butyl, r?-pentyl, 1-methylbutyl, 2- methylbutyl, 3-methyl- butyl, 2,2-dimethylpropyl, 1 -ethyl propyl, n-hexyl, 1,1 -di methyl propyl, 1,2-dimethylpropyl, 1- methylpentyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 1 ,1 -dimethylbutyl, 1,2-dimethyl- butyl, 1,3-di methyl butyl, 2,2-dimethylbutyl, 2,3-dimethylbutyl, 3,3-dimethylbutyl, 1 -ethylbutyl, 2- ethylbutyl, 1 ,1,2-trimethylpropyl, 1,2,2- trimethylpropyl, 1-ethyl1-methylpropyl, and 1-ethyl-2- methylpropyl.
[0360] The term "haloalkyl" as used herein denotes in each case a straight-chain or branched alkyl group having usually from 1 to 4 carbon atoms, preferably 1 to 3 or 1 or 2 carbon atoms, wherein the hydrogen atoms of this group are partially or totally replaced with halogen atoms. Preferred haloalkyl moieties are selected from Ci-C4-haloalkyl, more preferably from C1-C3- haloalkyl or CrCz-haloalkyl, in particular from Ci-C2-fluoroalkyl such as fluoromethyl, difluoromethyl, trifluoromethyl, 1 -fluoroethyl, 2-fluoroethyl, 2,2-difluoroethyl, 2,2,2-trifluoroethyl, pentafluoroethyl, and the like.
[0361] The term "alkoxy" as used herein denotes in each case a straight-chain or branched alkyl group which is bonded via an oxygen atom to the remainder of the molecule and has usually from 1 to 4 carbon atoms, preferably 1 to 2 carbon atoms, more preferably 1 carbon atom. Examples of an alkoxy group are methoxy, ethoxy, n-propoxy, / so-propoxy, n-butyloxy, 2-butyloxy, / so-bu- tyloxy, tert-butyloxy, and the like.
[0362] The term “alkoxyalkyl” as used herein refers to an alkoxy group as defined herein having usually from 1 to 4 carbon atoms, preferably 1 to 2 carbon atoms, more preferably 1 carbon atom, which is bonded via an alkyl group as defined herein having usually from 1 to 4 carbon atoms, preferably 1 to 2 carbon atoms, more preferably 1 carbon atom, to the remainder of the molecule. Thus, it refers to an alkyl group, which is bonded via oxygen to a further alkyl group, which is then bonded to the remainder of the molecule. Examples of alkoxyalkyl groups are methoxymethyl, methoxyethyl, ethoxymethyl, ethoxyethyl, and the like. Alkyl and alkoxy groups can be unbranched or branched, and examples of alkyl include but are not limited to methyl, ethyl, n- propyl, iso -propyl, n-butyl, iso -butyl, sec-butyl, and tert-butyl. Examples of alkoxy include methoxy, ethoxy, r?-propoxy, iso -propoxy, n-butoxy, iso -butoxy, sec-butoxy, and tert-butoxy.
[0363] The term "haloalkoxy" as used herein denotes in each case a straight-chain or branched alkoxy group having from 1 to 4 carbon atoms, preferably 1 to 2 carbon atoms, more preferably 1 carbon atom, wherein the hydrogen atoms of this group are partially or totally replaced with halogen atoms, in particular fluorine atoms. Preferred haloalkoxy moieties include Ci-haloalkoxy, in particular Ci-fluoroalkoxy, such as trifluoromethoxy and the like.
[0364] The term “hydroxyalkyl” as used herein denotes in each case a straight-chain or branched alkyl group having usually from 1 to 6 carbon atoms, preferably from 1 to 4 carbon atoms, more preferably 1 to 2 carbon atoms, and being further substituted with 1 to 5, preferably with 1 to 2 hydroxy groups, in particular with 1 hydroxy group, wherein a hydroxy group is a OH group. Preferably, the one hydroxy group is terminating the straight-chain or branched alkyl group so that the hydroxy group is bonded to an alkyl bridge, which is bonded to the remainder of the molecule. Examples of an hydroxyalkyl group are hydroxymethyl, hydroxyethyl, n-hydroxypropyl, 2- hydroxypropyl, n-hydroxybutyl, 2-hydroxy butyl, 2-hydroxy-2-methylpropyl, and n-hydroxypentyl. Hydroxymethyl, hydroxyethyl, hydroxypropyl, and hydroxybutyl, are preferred, in particular hydroxymethyl and hydroxyethyl.
[0365] ‘ -O” represents an oxo substituent
[0366] The term “carbocyclic”, “carbocyclyl”, or “carbocycle” includes, unless otherwise indicated, in general a 3- to 10- membered monocyclic or bicyclic ring, preferably a 4- to 8-membered or a 3- to 6-membered or a 5- to 7-membered monocyclic or bicyclic ring, more preferably a 3-, 4-, 5- or 6-membered monocyclic ring, comprising 3 to 10, preferably 4 to 8 or 3 to 6 or 5 to 7, more preferably 3, 4, 5 or 6 carbon atoms. The carbocycle may be saturated, partially or fully unsaturated, or aromatic, wherein saturated means that only single bonds are present, and partially or fully unsaturated means that one or more double bonds may be present in suitable positions, while the Huckel rule for aromaticity is not fulfilled, whereas aromatic means that the Huckel (4n + 2) rule is fulfilled. Also “aryls” are covered by the term “carbocycles”.
[0367] The term “aryl” or “aromatic carbocycle” refers to aromatic carbocyclic rings based on carbon atoms as ring members, preferably 6-membered aromatic carbocyclic rings based on carbon atoms as ring members. A preferred example is phenyl. Unless otherwise indicated, the term “aryl” further covers “aromatic carbobicycles” as defined herein. The term “carbocyclic” or “carbocyclyl”, unless otherwise indicated, may therefore cover inter alia cycloalkyl, cycloalkenyl, as well as phenyl. Preferably, the term “carbocyclic” or “carbocyclyl” covers phenyl and cycloalkyl, for example phenyl, cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl. The term “cycloalkyl” as used herein denotes in each case a monocyclic cycloaliphatic radical having usually from 3 to 10 or from 3 to 6 carbon atoms, such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclononyl and cyclodecyl or cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl. Cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl are preferred.
[0368] The term "carbobicyclic" or “carbobicyclyl” includes in general 6 to 14-membered, preferably 7- to 12-membered or 8- to 10-membered, more preferably 9- or 10-membered bicyclic rings comprising 6 to 14, preferably 7 to 12 or 8 to 10, more preferably 9 or 10 carbon atoms. The carbobicycle may be saturated, partially or fully unsaturated, or aromatic, wherein saturated means that only single bonds are present, and partially or fully unsaturated means that one or more double bonds may be present in suitable positions, while the Huckel rule for aromaticity is not fulfilled, whereas aromatic means that the Huckel (4n + 2) rule is fulfilled. Preferably, the term “aromatic” in connection with the carbobicyclic ring means that both rings of the bicylic moiety are aromatic, so that, e.g., 8 IT electrons are present in case of a 10-membered aromatic carbobicyclic ring. The term “carbobicylce” or “carbobicyclyl”, unless otherwise indicated, may therefore cover inter alia bicycloalkyl, bicycloalkenyl, as well as bicyclic aromatic groups, for example bicyclohexane (decalin), bicycloheptane (such as norbomane), bicyclooctane (such as bicyclo[2.2.2]octane, bicyclo[3.2.1]octane or bicyclo[4.2.0]octane), bicyclononane (such as bicy- clo[3.3.1]nonane or bicyclo[4.3.0]nonane ), bicyclodecane (such as bicyclo[4.4.0]decane), bicycloundecane (such as bicyclo[3.3.3]undecane), norbornene, naphthalene and the like. Preferably, the carbobicycle is a fused carbobicycle, which is preferably aromatic, for example naphthalene. The term “carbocyclylalkyl” as used herein, refers to carbocyclyl as defined herein, which is bonded to the remainder of the molecule via an alkyl group having usually from 1 to 2 carbon atoms, preferably 1 carbon atom. Preferably, the term “carbocyclylalkyl” refers to phenylalkyl or cycloalkylalkyl, which refers to the corresponding groups being bonded to the remainder of the molecule via an alkyl group. Preferred examples of carbocyclylalkyl include benzyl (i. e. , phenylmethyl), phenylethyl, cyclopropylmethyl, cyclopropylethyl, cyclobutylmethyl, cyclobutylethyl, cyclopentylmethyl, cyclopentylethyl, cyclohexylmethyl, cyclohexylethyl. The term “carbocyclyloxy” as used herein denotes in each case a carbocyclyl as defined herein, which is bonded via an oxygen atom to the remainder of the molecule. Examples of carbocyclyloxy include phenyloxy or cyclopropyloxy. The same applies to the terms “aryloxy” and “benzyloxy” referring to the corresponding groups, which are bonded to the remainder of the molecule via an oxygen atom.
[0369] The term “heterocyclic” or “heterocyclyl” includes, unless otherwise indicated, in general a 3- to 10-membered, preferably a 4- to 8-membered or 5- to 7-membered, more preferably 5- or 6- membered, in particular 6-membered monocyclic ring. The heterocycle may be saturated, partially or fully unsaturated, or aromatic, wherein saturated means that only single bonds are present, and partially or fully unsaturated means that one or more double bonds may be present in suitable positions, while the Hiickel rule for aromaticity is not fulfilled, whereas aromatic means that the Huckel (4n + 2) rule is fulfilled. The heterocycle typically comprises one or more, e.g. 1 , 2, 3, or 4, preferably 1 , 2, or 3 heteroatoms selected from N, O and S as ring members, where S-atoms as ring members may be present as S, SO or SO2. The remaining ring members are carbon atoms. In a preferred embodiment, the heterocycle is an aromatic heterocycle, preferably a 5- or 6-membered aromatic heterocycle comprising one or more, e.g. 1 , 2, 3, or 4, preferably 1 , 2, or 3 heteroatoms selected from N, O and S as ring members, where S-atoms as ring members may be present as S, SO or SO2. Examples of aromatic heterocycles are provided below in connection with the definition of “hetaryl”. “Hetaryls” or “heteroaryls” are covered by the term “heterocycles”. The saturated or partially or fully unsaturated heterocycles usually comprise 1 , 2, 3, 4 or 5, preferably 1, 2 or 3 heteroatoms selected from N, O and S as ring members, where S-atoms as ring members may be present as S, SO or SO2.
[0370] The skilled person is aware that S, SO or SO2 is to be understood as follows: jA A . . „ - v
[0371] U n
[0372] Further, a skilled person is aware that resonance structures of the oxidized forms may be possible. Saturated heterocycles include, unless otherwise indicated, in general 3- to 10-membered, preferably 4- to 8-membered or 5- to 7-membered, more preferably 5- or 6-membered monocyclic rings comprising 3 to 10, preferably 4 to 8 or 5 to 7, more preferably 5 or 6 atoms comprising at least one heteroatom, such as pyrrolidine, tetrahydrothiophene, tetrahydrofuran, piperidine, tetrahydropyran, dioxane, morpholine or piperazine.
[0373] The term “heterobicyclic” or “heterobicyclyl” includes, unless otherwise indicated, in general 6 to 14-membered, preferably 7- to 12-membered or 8- to 10-membered, more preferably 8- or 9- membered bicyclic rings. The heterobicycle may be saturated, partially or fully unsaturated, or aromatic, wherein saturated means that only single bonds are present, and 5 partially or fully unsaturated means that one or more double bonds may be present in suitable positions, while the Huckel rule for aromaticity is not fulfilled, whereas aromatic means that the Huckel (4n + 2) rule is fulfilled. For being “aromatic”, it is sufficient if one of the two rings of the bicyclic moieties is aromatic, while the other is non-aromatic. The heterobicycle typically comprises one or more, e.g., 1, 2, 3, or 4, preferably 1, 2, or 3 heteroatoms selected from N, O and S as ring members, where S-atoms as ring members may be present as S, SO or SO2. The remaining ring members are carbon atoms. Examples of heterobicycles include but are not limited to: benzofuranyl, benzothienyl, indolyl, indazolyl, benzimidazolyl, benzoxathiazolyl, benzoxadiazolyl, benzothiadia- zolyl, benzoxazinyl, quinolinyl, isoquinolinyl, purinyl, 1,8-naphthyridyl, pteridyl, pyrido[3,2-d]py- rimidyl, pyridoimidazolyl, triethylenediamine or quinuclidine and the like.
[0374] The term “heteroaryl” or “aromatic heterocycle” or “aromatic heterocyclic ring” or "hetaryl" or “heterocyclyl” includes monocyclic 5- or 6-membered aromatic heterocycles comprising as ring members 1, 2, 3 or 4 heteroatoms selected from N, O and S, where S-atoms as ring members may be present as S, SO or SO2. Examples of 5- or 6-membered aromatic heterocycles include pyridyl (also referred to as pyridinyl), i.e. 2-, 3-, or 4-pyridyl, pyrimidinyl, i.e. 2-, 4- or 5- pyrimidi- nyl, pyrazinyl, pyridazinyl, i.e. 3- or 4-pyridazinyl, thienyl, i.e. 2- or 3-thienyl, furyl, i.e. 2-or 3-fu- ryl, pyrrolyl, i.e. 2- or 3-pyrrolyl , oxazolyl, i.e. 2-, 3- or 5-oxazolyl, isoxazolyl, i.e. 3-, 4- or 5-isoxa- zolyl, thiazolyl, i.e. 2-, 3- or 5- thiazolyl, isothiazolyl, i.e. 3-, 4- or 5-isothiazolyl, pyrazolyl, i.e. 1-, 3-, 4- or 5-pyrazolyl, i.e. 1-, 2-, 4- or 5-imidazolyl, oxadiazolyl, e.g. 2- or 5-[1,3,4]oxadiazolyl, 4- or 5-(1 ,2,3-oxadiazol)yl, 3- or 5-(1,2,4-oxadiazol)yl, 2- or 5-(1,3,4- thiadiazol)yl, thiadiazolyl, e.g. 2- or 5-(1 ,3,4-thiadiazol)yl, 4- or 5-(1 ,2,3-thiadiazol)yl, 3- or 5- (1 ,2,4-thiadiazol)yl, triazolyl, e.g. 1 H-, 2H- or 3H-1 ,2,3-triazol-4-yl, 2H-triazol-3-yl, 1H-, 2H-, or 4H-1,2,4-triazolyl and tetrazolyl, i.e. 1 H- or 2H-tetrazolyl. Unless otherwise indicated, the term “hetaryl” further covers “aromatic heterobicycles” as defined above.
[0375] As used herein, the terms “carbocyclylalkyl” and “heterocyclylalkyl” as well as the terms “arylalkyl”, “cycloalkylalkyl”, “hetarylalkyl”, and the like refer to the corresponding groups, which are bonded to the remainder of the molecule via an alkyl, preferably via a Ci-C2-alkyl group. Preferred examples include benzyl (i.e. phenylmethyl), cyclohexylmethyl, pyridinylmethyl, and pi- peridinomethyl.
[0376] As used herein, the terms “aryloxy” and “benzyloxy” refer to the corresponding groups, which are bonded to the remainder of the molecule via an oxygen atom. Preferred examples include phenyloxy and phenylmethyloxy (i.e. benzyloxy).
[0377] The term "cancer" pertains to a disease characterized by the rapid and uncontrolled growth of abnormal cells that can spread locally or through the bloodstream and lymphatic system. Various cancers, including colorectal, gastric, endometrial, prostate, adrenocortical, uterine, cervical, oesophageal, breast, kidney, and ovarian cancer, among others, are described herein. The terms "tumour", “tumor” and "cancer" are used interchangeably and encompass both solid and liquid tumours, including diffuse or circulating tumours. As used herein, the terms "tumour" and "cancer" include premalignant, as well as malignant cancers and tumours.
[0378] A “FEN1 modulator” or "FEN1 inhibitor" refers to a compound that modulates or inhibits flap endonuclease (FEN1).
[0379] The term "medicine" as used herein is intended to be a generic term inclusive of prescription and non-prescription medications. The compound for use in medicine should be understood as being useful in maintaining health or promoting recovery from a disease, preferably cancer. Further, the term "medicine" includes medicine in any form, including, without limitation, e.g., pills, salves, creams, powders, ointments, capsules, injectable medications, drops, vitamins and suppositories. The scope of this invention is not limited by the type, form or dosage of the medicine.
[0380] A "pharmaceutical composition" is a compound of the invention or a pharmaceutically acceptable salt thereof, along with at least one pharmaceutically acceptable carrier, prepared for oral or parenteral administration. A "pharmaceutically acceptable carrier" includes substances used in the preparation or use of pharmaceutical compositions, such as diluents, solvents, dispersion media, surfactants, antioxidants, preservatives, isotonic agents, buffering agents, emulsifiers, and more. The term “pharmaceutically acceptable excipient” as used herein refers to compounds commonly comprised in pharmaceutical compositions, which are known to the skilled person. Typically, a pharmaceutically acceptable excipient can be defined as being pharmaceutically inactive.
[0381] A "therapeutically effective amount" of a compound refers to an amount that, when administered to a subject, achieves a biological or medical response, such as the reduction of enzyme or protein activity or the alleviation, mitigation, or prevention of symptoms, disease progression, or the disease itself.
[0382] A "subject" can be a human, primate, dog, rabbit, guinea pig, pig, rat, or mouse, depending on the context.
[0383] "Treat," "treating," or "treatment" refers to alleviating or mitigating a disease or disorder or reducing symptoms. The term “treatment” is to be understood as also including the option of “prophylaxis”. Thus, whenever reference is made herein to a “treatment” or “treating”, this is to be understood as “treatment and / or prophylaxis” or “treating and / or preventing”. "Prevent," "preventing," or "prevention" involves prophylactic treatment or delaying the onset or progression of a disease. A subject is "in need of" treatment if they would benefit from it biologically, medically, or in terms of quality of life.
[0384] It needs to be understood that the term “comprising” is not limiting. For the purposes of the present invention, the term “consisting of’ is considered to be a preferred embodiment of the term “comprising of”. If hereinafter a group is defined to comprise at least a certain number of embodiments, this is also meant to encompass a group which preferably consists of these embodiments only.
[0385] The terms “about” and “approximately” in the context of the present invention denotes an interval of accuracy that a person skilled in the art will understand to still ensure the technical effect of the feature in question. The term typically indicates a deviation from the indicated numerical value of ±10% and preferably ±5%.
[0386] Finally, terms such as “a”, “an”, “the”, and similar terms encompass both singular and plural forms unless otherwise indicated or contradicted by the context. The use of examples or exemplary language serves to clarify the invention but does not limit the scope of the claimed invention.
[0387] ROUTES OF ADMINISTRATION AND FORMULATIONS
[0388] A pharmaceutical composition according to the present invention may be formulated for oral, buccal, nasal, rectal, topical, transdermal or parenteral application. Preferred non-parenteral routes include mucosal (e.g., oral, vaginal, nasal, cervical, etc.) routes, of which the oral application may be preferred. Preferred parenteral routes include but, are not limited to, one or more of subcutaneous, intravenous, intra-muscular, intraarterial, intradermal, intrathecal and epidural administrations. Preferably administration is by subcutaneous, intra-tumoral or peri-tumoral routes. Particularly preferred is intratumoral administration. The compound according to formula (I) should be applied in pharmaceutically effective amounts, for example in the amounts as set out herein below.
[0389] A pharmaceutical composition of the present invention may also be designated as formulation or dosage form. A compound of formula (I) may also be designated in the following as (pharmaceutically) active agent or active compound.
[0390] Pharmaceutical compositions may be solid or liquid dosage forms or may have an intermediate, e.g. gel-like character depending inter alia on the route of administration.
[0391] In general, the inventive dosage forms can comprise various pharmaceutically acceptable excipients which will be selected depending on which functionality is to be achieved for the dosage form. A “pharmaceutically acceptable excipient” in the meaning of the present invention can be any substance used for the preparation of pharmaceutical dosage forms, including coating materials, film-forming materials, fillers, disintegrating agents, release-modifying materials, carrier materials, diluents, binding agents and other adjuvants. Typical pharmaceutically acceptable excipients include substances like sucrose, mannitol, sorbitol, starch and starch derivatives, lactose, and lubricating agents such as magnesium stearate, disintegrants and buffering agents. The term “carrier” denotes pharmaceutically acceptable organic or inorganic carrier substances with which the active ingredient is combined to facilitate the application. Suitable pharmaceutically acceptable carriers include, for instance, water, aqueous salt solutions, alcohols, oils, preferably vegetable oils, propylene glycol, polyoxyethelene sorbitans, polyethylene-polypropylene block co-polymers such as poloxamer 188 or poloxamer 407, polyethylene glycols such as polyethylene glycol 200, 300, 400, 600, etc., gelatin, lactose, amylose, magnesium stearate, surfactants, perfume oil, fatty acid monoglycerides, diglycerides and triglycerides, polyoxyethylated medium or long chain fatty acids such as ricinoleic acid, and polyoxyethylated fatty acid mono-, di, and triglycerides such as capric or caprilic acids, petroethral fatty acid esters, hydroxymethyl celluloses such as hydroxymethyl, hydroxyethyl, hydroxypropyl, hydroxypropyl acetate succinate, polyvinylpyrrolidone, crosspovidone and the like. Preferably, the compounds of the present invention are administered in a pharmaceutical composition comprising of lipids, interbilayer crosslinked multilamellar vesicles, biodegradeable poly(D,L-lactic-co-glycolic acid) [PLGA]- based or poly anhydride-based nanoparticles or microparticles, nanoporous particle-supported lipid bilayers and as a conjugate with an antibody.
[0392] The pharmaceutical compositions can be sterile and, if desired, mixed with auxiliary agents, like lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavoring and / or aromatic substances and the like which do not del- eteriously react with the active compound. It is to be understood that the term “carrier” also covers an antibody that delivers the compound of formula (I).
[0393] If liquid dosage forms are considered for the present invention, these can include pharmaceutically acceptable emulsions, solutions, suspensions and syrups containing inert diluents commonly used in the art such as water. These dosage forms may contain e.g. microcrystalline cellulose for imparting bulk, alginic acid or sodium alginate as a suspending agent, methylcellulose as a viscosity enhancer and sweeteners / flavoring agents.
[0394] For parenteral application, particularly suitable vehicles consist of solutions, preferably oily or aqueous solutions, as well as suspensions, emulsions, or implants. Pharmaceutical formulations for parenteral administration are particularly preferred and include aqueous solutions of the compounds of formula (I) in water-soluble form. Additionally, suspensions of the compounds of formula (I) may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
[0395] Particularly preferred dosage forms are injectable preparations of a compound of formula (I). Thus, sterile injectable aqueous or oleaginous suspensions can for example be formulated according to the known art using suitable dispersing agents, wetting agents and / or suspending agents. A sterile injectable preparation can also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent. Among the acceptable vehicles and solvents that can be used are water and isotonic sodium chloride solution. Sterile oils are also conventionally used as solvent or suspending medium. Preferred applications for injectable preparations comprising the compounds of the present invention are intravenous, intratumoral and peritumoral administration. Suppositories for rectal administration of a compound of formula (I) can be prepared by e.g. mixing the compound with a suitable non-irritating excipient such as cocoa butter, synthetic triglycerides and polyethylene glycols which are solid at room temperature but liquid at rectal temperature such that they will melt in the rectum and release the compound according to formula (I) from said suppositories.
[0396] For administration by inhalation, the compounds according to the present invention may be conveniently delivered in the form of an aerosol spray from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro- tetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g. gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
[0397] Oral dosage forms may be liquid or solid and include e.g. tablets, troches, pills, capsules, powders, effervescent formulations, dragees and granules. Pharmaceutical preparations for oral use can be obtained as solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellu- lose, sodium carboxymethylcellulose, and / or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. The oral dosage forms may be formulated to ensure an immediate release of the compound of formula (I) or a sustained release of the compound of formula (I).
[0398] A solid dosage form may comprise a film coating. For example, the inventive dosage form may be in the form of a so-called film tablet. A capsule of the invention may be a two-piece hard gelatin capsule, a two-piece hydroxypropylmethylcellulose capsule, a two-piece capsule made of vegetable or plant-based cellulose or a two-piece capsule made of polysaccharide.
[0399] The dosage form according to the invention may be formulated for topical application. Suitable pharmaceutical application forms for such an application may be a topical nasal spray, sublingual administration forms and controlled and / or sustained release skin patches. For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.
[0400] The compositions may conveniently be presented in unit dosage forms and may be prepared by any of the methods well known in the art of pharmacy. The methods can include the step of bringing the compounds into association with a carrier, which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the compounds into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product. Liquid dose units are vials or ampoules. Solid dose units are tablets, capsules and suppositories.
[0401] As regards human patients, the compound of formula (I) may be administered to a patient in an amount of about 0.001 mg to about 5000 mg per day, preferably of about 0.01 mg to about 1000 mg per day, more preferably of about 0.05 mg to about 250 mg per day, which is the effective amount. The phrase “effective amount’’ means an amount of compound that, when administered to a mammal in need of such treatment, is sufficient to treat or prevent a particular disease or condition.
[0402] MEDICAL INDICATIONS The compounds according to the present invention are suitable for use in medicine. The compounds of the present invention are useful for (partially) modulating FEN1. Thus, the compounds according to the present invention are particularly suitable for use in the treatment of a disease associated with modulating FEN1, in particular a proliferative disorder such as cancer or pre- cancerous syndromes.
[0403] Thus, in one embodiment, the present invention relates to a compound of formula (I) as defined herein or a pharmaceutical composition as defined herein for use in medicine. In particular, the compound of the present invention or a pharmaceutical composition comprising the same is for use in the treatment of a disease selected from the group consisting of cancer or pre-cancerous syndromes. Preferably, said cancer is selected from the group consisting of bladder, breast, colorectal, gastric, liver, lung, pancreatic, prostate, gynaecological cancer, in particular ovarian cancer, and head and neck cancer.
[0404] In further aspects, the present invention relates to methods of treatment comprising the administration of a compound of formula (I) as defined herein or a pharmaceutical composition comprising the same as defined herein to a human or animal body. In particular, the present invention relates to methods of treating diseases that can be addressed by FEN1 modulation, with a particular emphasis on cancers such as bladder, breast, colorectal, gastric, liver, lung, pancreatic, prostate, gynaecological cancer, in particular ovarian cancer, as well as head and neck cancer.
[0405] Moreover, the invention further relates to the manufacture of a medicament for the treatment of diseases that can be addressed by FEN1 modulation, with a particular emphasis on cancers such as bladder, breast, colorectal, gastric, liver, lung, pancreatic, prostate, gynaecological cancer, in particular ovarian cancer, as well as head and neck cancer.
[0406] It is to be understood that in connection with the medical uses of the invention it can be preferred that the compounds according to the present invention are administered in combination with antibodies, radiotherapy, surgical therapy, immunotherapy, chemotherapy, toxin therapy, gene therapy, or any other therapy known to those of ordinary skill in the art for treatment of a particular disease. This is particularly relevant in connection with the treatment of cancer.
[0407] The present invention is further illustrated by the following examples.
[0408] EXAMPLES
[0409] The compounds described herein may be prepared using the following methods and schemes. The sequence of reactions is an illustrative example. Swapping steps is possible and reaction conditions can be easily adapted. Unless specified otherwise, all starting materials used are commercially available or can be synthesised analogously to the described intermediates or to routes described in the literature.
[0410] The following abbreviations are used herein: aq (aqueous), h or hrs (hour(s)), g (gram), L (liter), mg (milligram), MHz (Megahertz), min. (minute), mm (millimeter), mmol (millimole), mM (millimolar), m.p. (melting point), eq ( equivalent), mL (milliliter), pL (microliter), ACN (acetonitrile), AcOH (acetic acid), CDC (deuterated chloroform), CD3OD (deuterated methanol), CH3CN (acetonitrile), c-hex (cyclohexane), DCC (dicyclohexyl carbodiimide), DCM (dichloromethane), DIC (diisopropyl carbodiimide), DIEA (diisopropylethyl-amine), DMF (dimethylformamide), DMSO (dimethylsulfoxide), DMSO-de (deuterated dimethylsulfoxide), EDC (1-(3-dimethyl-amino-propyl)-3-ethylcarbodiimide), ESI (Electrospray ionization), EtOAc or EA (ethyl acetate), Et20 (diethyl ether), EtOH (ethanol), FA (formic acid), PG (protecting group), HATU (dimethylamino-([1 ,2,3]triazolo[4,5-b]pyridin-3-yloxy)-meth- ylene]-dimethyl-ammonium hexafluorophosphate), HPLC (High Performance Liquid Chromatography), i-PrOH (2-propanol), K2CO3 (potassium carbonate), LC (Liquid Chromatography), LCMS, LC MS, LC-MS, or LC / MS (High-Performance Liquid Chromatography coupled to Mass Spectrometry), MeOH (methanol), MgSCU (magnesium sulfate), MS (mass spectrometry), MTBE (Methyl tert-butyl ether), NaHCOs (sodium bicarbonate), NaBH4(sodium borohydride), NMM (N-methyl morpholine), NMR (Nuclear Magnetic Resonance), PyBOP (benzotriazole-1-yl- oxy-tris-pyrrolidino-phosphonium hexafluorophosphate), RT (room temperature), Rt (retention time), SPE (solid phase extraction), T or temp (temperature); TBTU (2-(1-H-benzotriazole-1-yl)- 1 ,1 ,3,3-tetramethyluromium tetrafluoro borate), TEA (triethylamine), TFA (trifluoroacetic acid), THF (tetrahydrofuran), TLC (Thin Layer Chromatography), UPLCMS, UPLC MS, UPLC-MS, or UPLC / MS (Ultra-Performance Liquid Chromatography coupled to Mass Spectrometry), UV (Ultraviolet).
[0411] Instrument specifications:
[0412] The microwave chemistry is performed on a single mode microwave reactor EmrysTM Opti- miser from Personal Chemistry.
[0413] Preparative column chromatography was performed with a Teledyne-lsco CombiFlash EZ Prep or Biotage Isolera Prime or preparative HPLC. Preparative HPLC was performed on an Agilent 1200. Column: Chromolith prep RP 18e Merck KGaA; C18 silica gel; mobile phase: 0.1 % formic acid in water / 0.1% formic acid in acetonitrile; 10% to 50% gradient in 10 min; detector UV 254 nm; if not indicated otherwise.
[0414] Mass spectrum: LC / MS Waters ZMD (ESI) or Hewlett Packard System of the HP 1100 series (Ion source: Electrospray (positive mode) or Waters Acquity H Class SQD; Scan: 100-1000 m / z; Fragmentation-voltage: 60 V; Gas-temperature: 300°C, DAD: 220 nm. Flow rate: 2.4 ml / Min. The used splitter reduced the flow rate after the DAD for the MS to 0,75ml / Min; Column: Chromolith Speed ROD RP-18e 50-4.6; Solvent: LiChrosolv-quality from the company Merck KGaA or as mentioned in the method. LCMS data provided in the examples are given with retention time, purity and / or mass in m / z.
[0415] LCMS method 1
[0416] A: H2O + 0,05% HCOOH, B: MeCN + 0,04% HCOOH; T: 45 °C , Flow: 0,75 ml / min, Column: CORTECS T3 1,6 m 75-2,1 mm, 5% -> 99% B: 0 -> 1,8 min | 99% B: 1 ,8 -> 2,5 min LCMS method 2
[0417] Chromolith performance RP-18e 100-3 mm, Water + 0.1%(Vol.): TFA Acetonitrile + 0.1%(Vol.) TFA; 0.0 to 0.2 min: 99:01 0.2 to 3.8 min: 99:01— > 0:100 3.8 to 4.2 min: 0:100 LCMS method 3
[0418] Column: HALO C18, 2 pm, 3.0 x 30 mm, Column Oven: 40C; Mobile Phase A:6.5mM NH4HCO3+NH4OH(pH=10); Mobile Phase B: Acetonitrile; Flow rate: 1.5 mL / min; Gradient:5%B to 100%B in 3.0min, hold 0.6 min; 254nm LCMS method 4
[0419] Column: HALO C18, 2 pm, 3.0 x 30 mm, Column Oven: 40C; Mobile phase A:Water / 0.1% FA;Mobile phase B:Acetonitrile / 0.1% FA; Flow rate: 1.5 mL / min; Gradient:5%B to 100%B in 1.2 min, hold 0.5 min; 254nm LCMS method 5
[0420] Column: Xbridge C18, 5um, 4.6*50mm; QC Mobile Phase A: 0.05% TFA in water, Mobile Phase B: acetonitrile; Gradient: 0.0 min: 5% B, 4.5 min: 95% B, 5.8 min: 95% B, 6.0 min: 5 % B, 6.5 min: 5% B
[0421] LCMS method 6
[0422] HALO C18; Mobile phase A:Water / 0.1%FA, Mobile phase B:Acetonitrile / 0.1%FA
[0423] LCMS method 7
[0424] HALO C18; Solvent A: water + 0.1 % TFA; Solvent B: ACN + 0.1 % TFA;
[0425] LCMS method 8
[0426] HALO C18; Solvent A: Water / 0.1 %FA, Solvent B:Acetonitrile / 0.1%FA
[0427] LCMS method 9
[0428] HPLC_MS 13; waters XBridge C18 5um, 50*4.6mm;;Mobile Phase A: water (0.05%TFA), Mobile Phase B: acetonitrile, Gradient: 5-95 % (%B) in 6.5 min LCMS method 10
[0429] HPLC_MS 13; waters XBridge C18 5um, 50*4.6mm;Mobile Phase A: water (0.05%TFA), Mobile Phase B: acetonitrile, Gradient: 5-95 % (%B) in 6.5 min LCMS method 11
[0430] HPLC_MS 24; waters XBridge C18 5um, 50*4.6mm;6.5mins P-20-60-TFA-column2,
[0431] LCMS method 12
[0432] HPLC_MS 24; waters XBridge C18 5um, 50*4.6mm;;20-60%: Flow Rate: 1.5 mL / min; Analysis Time:6.5 min; MS scan range: 100-1000; Mobil Phase A:0.1% TFA in water; Mobil Phase ^acetonitrile; Gradient: 0.15 min: 5 % B, 4.5 min: 60 % B, 6.0 min: 95 % B, 6.5 min:5% B,6.5 min:5% B
[0433] LCMS method 13
[0434] HPLC_MS 24; waters XBridge C18 5um, 50*4.6mm;;Mobile Phase A: water (0.05%TFA), Mobile Phase B: acetonitrile, Gradient: 5-95 % (%B) in 6.5 min
[0435] LCMS method 14
[0436] HPLC_MS 24; waters XBridge C18 5um, 50*4.6mm;;Mobile Phase A: water (0.1 %TFA), Mobile
[0437] Phase B: acetonitrile, Gradient: 5-40 % (%B) in 6.5 min
[0438] LCMS method 15
[0439] HPLC_MS 24; waters XBridge C18 5um, 50*4.6mm;Mobile Phase A: water (0.02%NH4AC),
[0440] Mobile Phase B: acetonitrile, Gradient: 30-50 % (%B) in 6.5 min
[0441] LCMS method 16
[0442] HPLC_MS 24; waters XBridge C18 5um, 50*4.6mm;Mobile Phase A: water (0.05%TFA), Mobile Phase B: acetonitrile, Gradient: 5-40 % (%B) in 6.5 min LCMS method 17
[0443] HPLC_MS 24; waters XBridge C18 5um, 50*4.6mm;Mobile Phase A: water (0.05%TFA), Mobile Phase B: acetonitrile, Gradient: 5-95 % (%B) in 6.5 min LCMS method 18
[0444] HPLC_MS 24; waters XBridge C18 5um, 50*4.6mm;P-20-60-TFA-column2.lcm
[0445] LCMS method 19
[0446] HPLC_MS 3; waters XBridge C18 5um, 50*4.6mm;;Mobile Phase A: water (0.1 %TFA), Mobile
[0447] Phase B: acetonitrile, Gradient: 5-95 % (%B) in 6.5 min
[0448] LCMS method 20
[0449] LC-MS, Agilent 1200 Series, Chromolith HR RP-18e 50-4,6; 3.3ml / min; solvent A: Water + 0.1% TFA; solvent B: Acetonitrile + 0.1% TFA; 220 nm; 0 to 2,0 min: 1%B to 99%B; 2,0 to 2,5 min. 99% B
[0450] LCMS method 21
[0451] LCMS-24 waters XBridge C18 5um, 50*4.6mm;5-95%: Flow Rate:3.3 mL / min; Analysis
[0452] Time:6.5 min; MS scan range: 100-1500
[0453] LCMS method 22
[0454] LCMS-3,column:Xbridge C18;column size:4.6*50mm,5um;5-95%: Flow Rate:3.3 mL / min; Analysis Time:6.5 min; MS scan range: 100-1500
[0455] LCMS method 23
[0456] LCMS-3,column:Xbridge C18;column size:4.6*50mm,5um;P-05-95-TFA. mobile phase:B(ACN),A(0.05%TFA aq.),gradient(B%)as Acq.
[0457] LCMS method 24
[0458] Poroshell HPH-C18;Solvent A: water + 6.5mM NH4HCO3+NH4OH(pH=10); Solvent B: ACN
[0459] LCMS method 25
[0460] QC 3 waters XBridge C18 5um, 50*4.6mm;5-95%: Mobile Phase A: 0.05% TFA in water, Mobile Phase B: acetonitrile; Gradient: 0.00 min: 5% B, 4.5 min: 95% B, 5.8 min: 95% B, 6.0 min: 5 % B, 6.5 min: 5% B
[0461] LCMS method 26
[0462] QC Column: Xbridge C18, 3.5um, 4.6*50mm;Mobile Phase A: 0.05% TFA in water, Mobile Phase B: acetonitrile; Gradient: 0.0 min: 5% B, 4.5 min: 95% B, 5.8 min: 95% B, 6.0 min: 5 % B, 6.5 min: 5% B
[0463] LCMS method 27
[0464] QC24:LCMS-15; basic; Column: Waters Xbridge C18, 3.5pm, 50 x 4.6 mm;Mobile Phase A1:
[0465] 0.1 % TFA in water; Mobile Phase B1: acetonitrile
[0466] LCMS method 28 QC: HPLC_MS 24; Column: Waters XBridge C18 3.5um, 50*4.6mm;QC-24: 20-70%: Flow Rate:1.5 mL / min;AnalysisTime:6.5 min;MS scan range:100-1000;Mobil Phase A:0.02NH4QAc in water; Mo bi I Phase B:acetonitrile; Gradient:0.15min:20% B, 4.5min:70% B, 4.6min:95% B,6.0 min:95 %B,6.1min:5% B,6.5 min: 5% LCMS method 29
[0467] QC: HPLC_MS 3; Column 1 : waters XBridge C18 5um, 50*4.6mm;Mobil Phase A:0.02 NH4OAc in water; Mobil Phase B:acetonitrile; Gradient: 0.15 min: 10 % B, 4.5 min: 95 % B, 6.0 min: 95 % B, 6.1 min: 5% B, 6.5 min: 5% B;
[0468] LCMS method 30
[0469] QC: HPLC_MS 3; Column 1 : waters XBridge C18 5um, 50*4.6mm;Mobil Phase A:0.1% TFA in water; Mobil Phase B:acetonitrile; Gradient: 0.15 min: 10 % B, 4.5 min: 95 % B, 6.0 min: 95 % B, 6.1 min: 5% B, 6.5 min: 5% B;
[0470] LCMS method 31
[0471] QC: HPLC_MS 3; Column 1 : waters XBridge C18 5um, 50*4.6mm;TFA, MS scan range: 100- 1000; Mobil Phase A:0.1 % TFA in water; Mobil Phase B:acetonitrile; Gradient: 5-95 % in 3.0 min
[0472] LCMS method 32
[0473] Column: HALO C18, 2 pm, 3.0 x 30 mm, Column Oven: 40C;Mobile phase A:Water / 0.1 % FA;Mobile phase B:Acetonitrile / 0.1% FA; Flow rate: 1.5 mL / min; Gradient:5%B to 100%B in 2.0 min, hold 0.5 min; 254nm
[0474] 1 H NMR was recorded on Bruker DPX-300, DRX-400 or AVII-400 spectrometer, using residual signal of deuterated solvent as internal reference. Chemical shifts (5) are reported in ppm relative to the residual solvent signal (5 = 2.49 ppm for 1 H NMR in DMSO-d6). 1 H NMR data are reported as follows: chemical shift (multiplicity, coupling constants, and number of hydrogens). Multiplicity is abbreviated as follows: s (singlet), d (doublet), t (triplet), q (quartet), m (multiplet), br (broad).
[0475] General Synthetic Schemes:
[0476] Scheme A: Synthesis route and typical conditions to key intermediate ethyl 5-(benzyloxy)-4-oxo- 1 ,4-dihydropyridazine-3-carboxylate hydrochloride. flow reactor 25-30 °C
[0477] Di-tert-butyl dicarbonate,
[0478] NaHC03, THF, RT, 16 h Scheme B: Synthesis route and typical conditions to 2-6-7-substituted-4-hydroxy-7,8-dihydro- 3H-pyrazino[1,2-b]pyridazine-3,5(6H)-dione
[0479] Route B1 : a) Protecting group introduction, e.g. N,O-Bis(trimethylsilyl)-acetamide and 2-(Trime- thylsilyl)ethoxymethyl chloride in tert-Butyl methyl ether at RT for 4 hours; b) amide coupling with typical acid activation conditions like HATU, thionylchlorid, BOP; c) Chlorination with e.g. thionylchlorid in DCM at RT for 45 min; d) cyclisation with e.g. Li Br in Dioxane at 130 °C for 1.5 hours; e) chlorination with e.g. NCS at 50°C for 3 h; f) protecting group introduction, e.g. benzyl via benzylbromid, a base like triethylamine and a solvent like DMF at 75 °C for 2 hours or via Mitsunobu conditions, alternative protecting group can be, but not limited to Pivaloyl; g) aromatic nucleophilic halogen displacement under basic conditions, e.g. with Potassium tert-bu- tylate or NaH; h) removal of protecting group, condition dependent on selected protecting group, for benzyl, e.g., LiCI is suitable, but not limited to it.
[0480] Route B2: i) basic ester saponification, e.g. with NaOH at 75°C for 1 h; j) amide coupling with typical acid activation conditions like HATU, thionylchlorid, BOP; k) ring closing via converting the alcohol into a leaving group, like SOCh; I) Benzyl protecting group removal, e.g. under acidic conditions with TFA; m) protecting group introduction, e.g. benzyl via benzylbromid, a base like triethylamine and a solvent like DMF at 75 °C for 2 hours or via Mitsunobu conditions, alternative protecting group can be, but not limited to Pivaloyl; n) chlorination with e.g. NCS at 50°C for 3 h. g) aromatic nucleophilic halogen displacement under basic conditions, e.g. with Potassium tert-butylate or NaH; h) removal of protecting group, condition dependent on selected protecting group, for benzyl, e.g., LiCI is suitable, but not limited to it.
[0481] Synthesis of key intermediate (Scheme A)
[0482] Synthesis of key intermediate ethyl 5-(benzyloxy)-4-oxo-1 ,4-dihydropyridazine-3-carboxylate hydrochloride following Scheme A.
[0483] Intermediate ethyl (2E)-4-(benzyloxy)-2-hydrazinylidene-3-oxobutanoate
[0484] Synthesis of ethyl (2E)-4-(benzyloxy)-2-hydrazinylidene-3-oxobutanoate was done in flow chemistry with a Vapourtec R-series Flow-Reactor, equipped with R2plus and R2Splus Pump modules, and four 10 ml standard PFA tube reactors.
[0485] System Solvent: ACN
[0486] BPR=6 bar
[0487] Flow rate A: 0.50 ml / min
[0488] Flow rate B: 0.50 ml / min
[0489] Flow rate D: 0,50 ml / min
[0490] Reactor temp 1 = 25°C
[0491] Reactor temp 2 = 25°C
[0492] Reactor temp 3 = 30°C
[0493] Reactor temp 4 = 30°C
[0494] Channel A: Solution of ethyl 4-(benzyloxy)-3-oxobutanoate (11.8 g; 50 mmol; 1 eq.) and triethylamine (10.4 ml; 75 mmol; 1.5 eq.) in acetonitrile filled up to 100 ml (to give a 0.5 M solution of ethyl 4-(benzyloxy)-3-oxobutanoate)
[0495] Channel B: p-Toluenesulfonyl azide solution, 11-15 % (w / w) in toluene (99.7 ml; 50 mmol; 1 eq.) Channel D: Trimethylphosphine solution, 1.0 M in THF (100 ml; 100 mmol; 2 eq.)
[0496] The streams of A and B were mixed in a T-mixer and pumped through reactor 1 and 2 (in series, total flow: 1 ,0 ml / min, T=25°C). The product stream of reactor 1 and 2 was mixed with the stream D via T-mixer and pumped through the reactors 2 and 3 (in series) at T=35"C. The final product stream was collected in a flask that contains 100 ml of water equipped with a stir bar. The mixture was stirred for 1h at RT to quench the trimethylphospine, diluted with EtOAc and washed with water and brine. The separated organic layer was dried over Na2SO4 and the solvent was removed in vacuo to give crude ethyl (2E)-4-(benzyloxy)-2-hydrazinylidene-3-oxobuta- noate (22,30 g; 36,706 mmol) as an orange oil (22.3 g).
[0497] LCMS (LC-MS, Agilent 1200 Series, Chromolith HR RP-18e 50-4,6; 3.3ml / min; solvent A: Water + 0.1% TFA; solvent B: Acetonitrile + 0.1% TFA; 220 nm; 0 to 2,0 min: 1 %B to 99%B; 2,0 to 2,5 min. 99%B): purity 43.5 %, Rt 1 .39 and 1.437 min (E / Z mixture), [M+Na]+287.0 m / z.
[0498] Intermediate ethyl (2E)-4-(benzyloxy)-2-({[(tert-butoxy)carbonyl]amino}imino)-3-oxobutanoate
[0499] Di-tert-butyl dicarbonate for synthesis (11.8 ml; 55 mmol; 1.5 eq.) and sodium hydrogen carbonate (9.25 g; 3 eq.) were added to a solution of ethyl (2E)-4-(benzyloxy)-2-hydrazinylidene-3- oxobutanoate (22.3 g; 36.7 mmol; 1 eq.) in tetra hydrofuran (250 ml) and the resulting mixture was stirred at RT for 16h. The reaction mixture was diluted with EtOAc and washed with water and brine. The separated organic layer was dried over Na2SC>4 and the solvent was removed in vacuo. The residue was purified by flash chromatography (n-Heptane / EtOAc) to yield ethyl (2E)- 4-(benzyloxy)-2-({[(tert-butoxy)carbonyl]amino}imino)-3-oxobutanoate (9.4 g) as an off-white solid.
[0500] LCMS (LC-MS, Agilent 1200 Series, Chromolith HR RP-18e 50-4,6; 3.3ml / min; solvent A: Water + 0.1% TFA; solvent B: Acetonitrile + 0.1% TFA; 220 nm; 0 to 2,0 min: 1 %B to 99%B; 2,0 to 2,5 min. 99%B): purity 100 %, Rt 1.82 min, [M+Na]+381.1 m / z.
[0501] Key intermediate ethyl 5-(benzyloxy)-4-oxo-1 ,4-dihydropyridazine-3-carboxylate hydrochloride
[0502] Synthesis of key intermediate ethyl 5-(benzyloxy)-4-oxo-1 ,4-dihydropyridazine-3-carboxylate hydrochloride was done in flow chemistry with a Vapourtec R-series Flow-Reactor equipped with R2plus and R2Splus Pump modules, and four 10 ml standard PFA tube reactors.
[0503] System Solvent: THF
[0504] BPR=6 bar
[0505] Flow rate A: 0.50 ml / min
[0506] Flow rate B: 0.50 ml / min
[0507] Reactor temp 1 = 60°C
[0508] Reactor temp 2 = 60°C
[0509] Reactor temp 3 = 60°C
[0510] Reactor temp 4 = 60°C
[0511] Channel A: Solution of tert-butoxy bis(dimethylamino)methane (13.5 g; 77.4 mmol; 3 eq.) in 10 ml tetra hydrofuran, filled up with tetrahydrofuran to 50 ml (about 1.5 M tert-butoxy bis(dimethyla- mino)methane).
[0512] Channel B: Solution of ethyl (2E)-4-(benzyloxy)-2-({[(tert-butoxy)carbonyl]amino}imino)-3-oxobu- tanoate (9.4 g; 25.8 mmol; 1 eq.) in 30 ml tetrahydrofuran, filled up with tetrahydrofuran to 50 ml (about 0.5 M of ethyl (2E)-4-(benzyloxy)-2-({[(tert-butoxy)carbonyl]amino}imino)-3-oxobuta- noate).
[0513] The stream of A was pumped through reactor 1 (2ml volume) at 60°C for pre-heating the reagent. The output of reactor 1 and stream B were mixed in a T-mixer and pumped at 60°C through the reactors 2-4 (in series, 30 ml total volume). Total flow: 1.0 ml / min. The final product stream was manually collected in a flask. The collected product solution was cooled in an ice bath and acidified to pH 2 by adding hydrogen chloride solution (4 M in dioxane). The precipitated product was isolated by filtration, washed with acetone / water 1:1 and dried in vacuo to give ethyl 5-(benzyloxy)-4-oxo-1 ,4-dihydropyridazine-3-carboxylate hydrochloride (5.07 g) as a colorless solid.
[0514] LCMS (LC-MS, Agilent 1200 Series, Chromolith HR RP-18e 50-4,6; 3.3ml / min; solvent A: Water + 0.1% TFA; solvent B: Acetonitrile + 0.1% TFA; 220 nm; 0 to 2,0 min: 1 %B to 99%B; 2,0 to 2,5 min. 99%B): purity 96.4 %, Rt 1.12 min., [M+Na]+297.0 m / z.
[0515] Synthesis of compounds of formula (I) according to Route B1 or Route B2 of Scheme B Compounds of formula (I) were synthesized according to route B1 as described for Example 14 and Example 17 in the following, or route B2 of scheme B.
[0516] Route B1
[0517] Intermediate 5-(benzyloxy)-4-oxo-1-{[2-(trimethylsilyl)ethoxy]methyl}-1 ,4-dihydropyridazine-3- carboxylic acid
[0518] At RT N,O-Bis(trimethylsilyl)-acetamide (52.1 ml; 212.4 mmol; 2.2 eq.) was added to a suspension of ethyl 5-(benzyloxy)-4-oxo-1,4-dihydropyridazine-3-carboxylate hydrochloride (30 g; 96 mmol; 1 eq.) in tert-Butyl methyl ether (500 ml) and the mixture was stirred for 30 min. at RT. To the resulting solution 2-(Trimethylsilyl)ethoxymethyl chloride (25.6 ml; 144.8 mmol; 1.5 eq.) was added and the mixture was stirred for 4h at RT. The reaction mixture was quenched with sat. NaHCO3-solution to pH 4-5 and the phases were separated. To the separated organic layer was added Sodium hydroxide solution c(NaOH) = 1 mol / l (1 N) (193 ml; 193 mmol; 2 eq.) and the mixture was stirred at RT. The phases were separated. The aqueous layer was acidified to pH 2-3 by adding 2-N HCI. The resulting white solid was isolated by filtration, washed with water and dried at 50°C in vacuo to give 5-(benzyloxy)-4-oxo-1-{[2-(trimethylsilyl)ethoxy]methyl}-1,4- dihydropyridazine-3-carboxylic acid (33,30 g; 88,451 mmol) as a colourless solid 33.3 g (92%). LC / MS (Agilent 1200 Series, Chromolith HR RP-18e 50-4,6; 3.3ml / min; solvent A: Water + 0.1% TFA; solvent B: Acetonitrile + 0.1% TFA; 220 nm; 0 to 2,0 min: 1%B to 99%B; 2,0 to 2,5 min. 99%B): [M+H] 377.1 ; [M+Na] 399.1 m / z, purity 100%, Rt 1.752 min.
[0519] Intermediate: 5-(benzyloxy)-3-[(3S)-3-(hydroxymethyl)morpholine-4-carbonyl]-1-{[2-(trimethylsi- lyl)ethoxy]methyl}-1 ,4-dihydropyridazin-4-one d / V-Ethyldiisopropylamine (46.31 ml; 5 eq.) was added to a solution of 5-(benzyloxy)-4-oxo-1-{[2-(trimethylsilyl)ethoxy]methyl}-1,4-dihydropyridazine-3- carboxylic acid (1.3 g; 0.06 eq.) in Dichloromethane (350 ml) and the mixture was stirred for 1 h at RT. [(3S)-morpholin-3-yl]methanol hydrochloride (10.88 g; 1.3 eq.) was added and the resulting mixture was stirred for 18h at RT. The reaction mixture was diluted with DCM and washed with dil. HCI, sat. NaHCCh and brine. The separated organic layer was dried over NazSC and concentrated in vacuo to give 5-(benzyloxy)-3-[(3S)-3-(hydroxymethyl)morpholine-4-carbonyl]-1- {[2-(trimethylsilyl)ethoxy]methyl}-1 ,4-dihydropyridazin-4-one (49 g) as an orange sirup.
[0520] LCMS (Agilent 1200 Series, Chromolith HR RP-18e 50-4,6; 3.3ml / min; solvent A: Water + 0.1% TFA; solvent B: Acetonitrile + 0.1% TFA; 220 nm; 0 to 2,0 min: 1%B to 99%B; 2,0 to 2,5 min. 99%B): [M+Na] 476.1 m / z, purity 66 %, Rt 1.576 min.
[0521] Intermediate 5-(benzyloxy)-3-[(3R)-3-(chloromethyl)morpholine-4-carbonyl]-1-{[2-(trimethylsi- lyl)ethoxy]methyl}-1 ,4-dihydropyridazin-4-one
[0522] A solution of 5-(benzyloxy)-3-[(3S)-3-(hydroxymethyl)morpholine-4-carbonyl]-1-{[2-(trimethylsi- lyl)ethoxy]methyl}-1 ,4-dihydropyridazin-4-one (49 g; 1 eq.) in Dichloromethane (500 ml) was cooled in ice / water and Thionyl chloride for synthesis (19.7 ml; 4 eq.) was added. The resulting mixture was stirred at RT for 45 min. The reaction mixture was concentrated in vacuo. The residue was dissolved in DCM and evaporated again. The crude product was purified by flash chromatography (Si-60, n-heptane / ethyl acetate) to give 5-(benzyloxy)-3-[(3R)-3-(chloromethyl)mor- pholine-4-carbonyl]-1-{[2-(trimethylsilyl)ethoxy]methyl}-1 ,4-dihydropyridazin-4-one (28 g) as a colorless solid.
[0523] LCMS (Agilent 1200 Series, Chromolith HR RP-18e 50-4,6; 3.3ml / min; solvent A: Water + 0.1% TFA; solvent B: Acetonitrile + 0.1% TFA; 220 nm; 0 to 2,0 min: 1%B to 99%B; 2,0 to 2,5 min. 99%B): [M+Na] 494.1 m / z, purity 93 %, Rt 1.771 min.
[0524] Intermediate (3S)-11-hydroxy-5-oxa-1 , 8, 14-triazatricyclo[8.4.0.03,8]]tetradeca-10,13-diene-9, 12- dione
[0525] (3S)-11-hydroxy-5-oxa-1 , 8, 14-triazatricyclo[8.4.0.038]tetradeca-10,13-diene-9, 12-dione was synthesised in two batches.
[0526] Lithiumbromide (12 g) was added to a solution of 5-(benzyloxy)-3-[(3R)-3-(chloromethyl)mor- pholine-4-carbonyl]-1-{[2-(trimethylsilyl)ethoxy]methyl}-1 ,4-dihydropyridazin-4-one (89 g) in Dioxane (600 ml) and the mixture was heated to 130°C in a Buchi 1 I Uniclave pressure reactor. After cooling to RT the reaction mixtures of both batches were combined. The precipitated product was collected by filtration and rinsed with Dioxane (500 ml) and THF (300 ml). The solid was slurried in 300 ml THF, sonicated for 2 min., and filtered. This procedure was repeated one time. The product was dried in vacuo at 50°C to give (3S)-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03,8]tetradeca-10,13-diene-9, 12-dione (31.5 g) as a brown solid.
[0527] LCMS (Agilent 1200 Series, Chromolith HR RP-18e 50-4,6; 3.3ml / min; solvent A: Water + 0.1% TFA; solvent B: Acetonitrile + 0.1% TFA; 220 nm; 0 to 2,0 min: 1%B to 99%B; 2,0 to 2,5 min. 99%B): [M+Na] 238.1 m / z, purity 98.9 %, Rt 0.745 min.
[0528] Intermediate (3S)-13-chloro-11 -hydroxy- 5-oxa-1 ,8,14-triazatricyclo[8.4.0.03’8]]tetradeca-10,13- diene-9, 12-dione
[0529] A mixture of (3S)-11-hydroxy-5-oxa-1 ,8, 14-triazatricyclo[8.4.0.03’8]]tetradeca-10,13-diene-9, 12- dione (31.5 g; 1 eq.) and V-Chlorosuccinimide (23.26 g; 1.3 eq.) in Acetonitrile (310 ml) was stirred at 100°C for 2.5 hours. The reaction mixture was cooled to about 50°C, A / -Chlorosuccin- imide (1.79 g; 0.1 eq.) was added and heated to 100°C for 30 min. After cooling to RT the reaction mixture was concentrated in vacuo. EtOAc was added to the residue and the mixture was sonicated until a fine solid precipitated. The solids were isolated by filtration, washed with EtOAc and dried in vacuo to give (3S)-13-chloro-11-hydroxy-5-oxa-1,8,14-triazatricy- clo[8.4.0.03'8]]tetradeca-10,13-diene-9, 12-dione (21.30 g) as a light-brown solid.
[0530] LCMS (Agilent 1200 Series, Chromolith HR RP-18e 50-4,6; 3.3ml / min; solvent A: Water + 0.1% TFA; solvent B: Acetonitrile + 0.1% TFA; 220 nm; 0 to 2,0 min: 1%B to 99%B; 2,0 to 2,5 min. 99%B): [M+Na] 272 m / z, purity 100 %, Rt 0.856 min.
[0531] Different protecting group routes
[0532] Intermediate in benzyl protecting group route:
[0533] (3S)-11 -(benzyloxy)- 13-chloro-5-oxa-1 ,8,14-triazatricyclo[8.4.0.03’8]]tetradeca-10, 13-diene-9, 12- dione
[0534] N-Ethyldiisopropylamine (28.55 ml; 3 eq.) was added to a solution of (3S)-13-chloro-11-hy- droxy-5-oxa-1 , 8, 14-triazatricyclo[8.4.0.03’8]]tetradeca-10,13-diene-9, 12-dione (15.2 g; 1 eq.) in DMF (150 ml) and the mixture was stirred at RT. After 20 min. Benzyl bromide (13.29 ml; 2 eq.) was added and the mixture was heated to 75°C for 2 h. The reaction mixture was poured into water and extracted with EtOAc. The combined organic layers were dried over Na2SO4 and concentrated in vacuo.
[0535] The crude product was purified by column chromatography (Si-60, gradient n-Heptane / EtOAc) to afford (3S)-11-(benzyloxy)-13-chloro-5-oxa-1 ,8,14-triazatricyclo[8.4.0.03’8]]tetradeca-10,13- diene-9, 12-dione (8.7 g) as a beige solid.
[0536] LCMS (Agilent 1200 Series, Chromolith HR RP-18e 50-4,6; 3.3ml / min; solvent A: Water + 0.1% TFA; solvent B: Acetonitrile + 0.1% TFA; 220 nm; 0 to 2,0 min: 1%B to 99%B; 2,0 to 2,5 min. 99%B): purity 95.9 %, Rt 1.28 min; [M+H] 362.1 m / z.
[0537] Intermediate in pivaloyl protecting group route:
[0538] (3S)-13-chloro-9, 12-dioxo-5-oxa-1 ,8, 14-triazatricyclo[8.4.0.03’8]tetradeca-10, 13-dien-11 -yl 2,2- dimethylpropanoate
[0539] To a stirred mixture of (3S)-13-chloro-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03,8]tetradeca-10,13-diene-9, 12-dione (780.00 mg; 2.30 mmol; 1.00 eq.) and 2,2-dime- thylpropanoyl chloride (437.00 mg; 3.44 mmol; 1.50 eq.) in DCM (5.00 ml) was added DIEA (1.25 g; 9.19 mmol; 4.00 eq.) at room temperature. The resulting mixture was stirred for 30 min at room temperature under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by column chromatography (PE / EtOAc (1 :1)) to afford (3S)-13-chloro-9,12-dioxo-5-oxa-1 ,8,14-triazatricyclo[8.4.0.03’8]tetradeca-10,13-dien-11-yl 2,2-dimethylpropanoate (276 mg) as colourless solid.
[0540] LCMS (Column: HALO C18, 2 pm, 3.0 x 30 mm, Column Oven: 40C;Mobile phase A:Wa- ter / 0.1% FA; Mobile phase B:Acetonitrile / 0.1% FA; Flow rate: 1.5 mL / min; Gradient:5%B to 100%B in 1.2 min, hold 0.5 min; 254nm): purity 96.6 %, Rt 0.56 min., [M+H] 356.0 m / z.
[0541] Intermediate in benzoyl protecting group route:
[0542] (3S)-13-chloro-9, 12-dioxo-5-oxa-1 ,8, 14-triazatricyclo[8.4.0.03'8]]tetradeca-10, 13-dien-11 -yl benzoate
[0543] (3S)-13-chloro-11-hydroxy-5-oxa-1 ,8,14-triazatricyclo[8.4.0.03’8]]tetradeca-10,13-diene-9,12-di- one (3 g; 1.0 eq.) was dissolved in Pyridine (25 ml). At 0°C Benzoyl chloride (1.54 ml; 1,2 eq.) was added dropwise. It was stirred at 0°C for 20min and then 30min at RT. The mixture was diluted with water and extracted with EtOAc. The organic layer was washed with brine, dried with Na2SO4, filtered and evaporated to dryness. The crude residue was purified by column chromatography to give (3S)-13-chloro-9,12-dioxo-5-oxa-1 ,8,14-triazatricyclo[8.4.0.03'8]]tetradeca- 10,13-dien-11-yl benzoate (2.15 g) as a beige foam.
[0544] LCMS (CORTECS T3 1,6 pm 50-2,1 mm; UPLC A: H2O + 0,05% HCOOH | B: MeCN + 0,04% HCOOH T: 45 °C | Flow: 0,9 ml / min 2% -> 99% B: 0 -> 2,0 min | 99% B: 2,0 -> 2,31): Rt 0.91 min., [M+H] 376.1 m / z.
[0545] Example 14 via pivaloyl protecting group route:
[0546] (3S)-11-hydroxy-13-[(1S)-1-(naphthalen-2-yl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03,8]tetradeca-10,13-diene-9, 12-dione
[0547] A mixture of NaH (412.00 mg; 10.30 mmol; 5.00 eq.) in DMF (5.00 ml) was treated with (1 S)-1 - (naphthalen-2-yl)ethan-1-ol (373.00 mg; 2.06 mmol; 1.00 eq.) for 15 min at 50°C under nitrogen atmosphere followed by the addition of (3S)-13-chloro-9,12-dioxo-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03,8]tetradeca-10,13-dien-11-yl 2,2-dimethylpropanoate (250.00 mg; 0.68 mmol; 0.33 eq.) and (3S)-13-chloro-9,12-dioxo-5-oxa-1 ,8,14-triazatricyclo[8.4.0.03,8]tetradeca-10,13-dien- 11-yl 2,2-dimethylpropanoate (504.00 mg; 1.38 mmol; 0.67 eq.) at 0°C. The resulting mixture was stirred for 20 min at room temperature under nitrogen atmosphere. The reaction was quenched by the addition of water at 0°C. The resulting mixture was extracted with EtOAc. The combined organic layers were washed with brine, dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The crude product was purified by column chromatography (XBridge Prep Phenyl OBD Column, 19*250 mm, 5 m; Mobile Phase A: Water, Mobile Phase B: ACN; Flow rate: 20 mL / min; Gradient: 45% B to 75% B in 8 min, 75% B; Wave Length: 254 nm; RT1 (min): 7) to afford (3S)-11 -hydroxy-13-[(1S)-1-(naphthalen-2- yl)ethoxy]-5-oxa-1 , 8, 14-triazatricyclo[8.4.0.03,8]tetradeca-10,13-diene-9, 12-dione (58.10 mg) as light yellow solid.
[0548] 1 H NMR (400 MHz, DMSO-d6) 11.59 (s, 1H), 7.95 - 7.85 (m, 4H), 7.62 - 7.55 (m, 1H), 7.55 - 7.45 (m, 2H), 6.02 (q, J = 6.5 Hz, 1 H), 4.29 - 4.20 (m, 1 H), 4.16 - 3.95 (m, 4H), 3.85 (t, J = 12.4 Hz, 1H), 3.49 - 3.37 (m, 1 H), 3.20 (t, J = 10.9 Hz, 1H), 3.04 - 2.92 (m, 1H), 1.68 (d, J = 6.5 Hz, 3H). LCMS (Column: HALO C18, 2 pm, 3.0 x 30 mm, Column Oven: 40C;Mobile phase A:Wa- ter / 0.1% FA; Mobile phase B:Acetonitrile / 0.1% FA; Flow rate: 1.5 mL / min; Gradient:5%B to 100%B in 2.0 min, hold 0.5 min; 254nm): purity 99.61 %, Rt 0.86 min., [M+H] 408.05.
[0549] Example 17 via benzyl protecting group route:
[0550] Intermediate in benzyl protecting group route (3S)-11-(benzyloxy)-13-[(1S)-1-(7-chloronaphtha- len-2-yl)ethoxy]-5-oxa-1 , 8, 14-tri azatri cyclo [8.4.0.03’8]]tetradeca-10,13-diene-9, 12-dione and (3S)-11 ,13-bis[(1S)-1-(7-chloronaphthalen-2-yl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]]tetradeca-10, 13-diene-9, 12-dione
[0551] (3S)-11 -(benzyloxy)- 13-chloro-5-oxa-1 ,8,14-triazatricyclo[8.4.0.03'8]]tetradeca-10, 13-diene-9, 12- dione (8.70 g; 23.0 mmol; 1 eq.) and (1S)-1-(7-chloronaphthalen-2-yl)ethan-1-ol (9.76 g; 2 eq.) were suspended in Tetrahydrofuran (175 ml). Potassium tert-butylate (5.95 g; 2.3 eq.) was added and the mixture was stirred at RT for 1 .5 h. Water was added and the mixture was extracted with EtOAc. The combined organic layers were washed with brine, dried over Na2SO4 and evaporated in vacuo to give 18,7 g of a mixture of (3S)-11-(benzyloxy)-13-[(1S)-1-(7- chloronaphthalen-2-yl)ethoxy]-5-oxa-1 ,8, 14-triazatricyclo[8.4.0.03'8]]tetradeca-10,13-diene-9, 12- dione (30.1 % content) and (3S)-11 ,13-bis[(1S)-1-(7-chloronaphthalen-2-yl)ethoxy]-5-oxa- 1 , 8, 14-tri azatri cyclo [8.4.0.03,8]]tetradeca-10,13-diene-9, 12-dione (23.4 % content) as an orange sirup. The crude product was directly used for the next step.
[0552] LCMS(Agilent 1200 Series, Chromolith HR RP-18e 50-4,6; 3.3ml / min; solvent A: Water + 0.1% TFA; solvent B: Acetonitrile + 0.1% TFA; 220 nm; 0 to 2,0 min: 1%B to 99%B; 2,0 to 2,5 min. 99%B): purity 30.1 %, Rt 1.74 min., [M+H - C12H10CI] 344.1 m / z and purity 23.4 %, Rt 1.97 min., [M+H - C12H10CI] 254.1 m / z.
[0553] Example 17 (3S)-13-[(1S)-1-(7-chloronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatri- cyclo[8.4.0.03’8]]tetradeca-10,13-diene-9, 12-dione
[0554] A 18.4 g mixture of (3S)-11-(benzyloxy)-13-[(1S)-1-(7-chloronaphthalen-2-yl)ethoxy]-5-oxa-
[0555] I , 8, 14-tri azatri cyclo [8.4.0.03’8]]tetradeca-10,13-diene-9, 12-dione (30.1 % content) and (3S)-
[0556] I I,13-bis [( 1 S)-1 -(7-chloronaphthalen-2-yl)ethoxy]-5-oxa-1 ,8, 14-tri azatri cyclop.4.0.03’8]]tetradeca-10,13-diene-9, 12-dione (23.4 % content) was dissolved in DMF (180 ml), lithium chloride (11.2 g; 25 eq.) was added and the mixture was stirred 100°C for 2.5 h. After cooling to RT, water was added, and the mixture was extracted with EtOAc. The combined organic layers were dried over Na2SO4, and the solvent removed in vacuo. The crude product was purified by column chromatography (Si-60, dichloromethane / methanol). The residue was triturated with ether and the resulting beige solid was isolated by filtration, washed with ether and dried in vacuo to give (3S)-13-[(1S)-1-(7-chloronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa- 1 , 8, 14-tri azatri cyclo [8.4.0.03’8]]tetradeca-10,13-diene-9, 12-dione (7.10 g) as beige solid.
[0557] Several batches from above reaction were combined to 10.4 g and dissolved in DCM and the solvent was removed in vacuo. The solid was crystalised from diethyl ether. The product was purified by column chromatography (C18, gradient Water + 0,1% HCOOH --> ACN + 0,1% HCOOH). The organic phase was removed in vacuo and the pH adjusted to 8-9 by adding sat NaHCO3 and extracted with DCM. The combined organic layers were dried over Na2SO4 and the solvent removed in vacuo. The residue was crystallized from diethyl ether. The solids were isolated by filtration, washed with diethyl ether and dried in vacuo at 50°C to afford (3S)-13- [(1S)-1-(7-chloronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]]tetradeca-10,13-diene-9, 12-dione (8.10 g) as a light yellow solid.
[0558] LCMS (Agilent 1200 Series, Chromolith HR RP-18e 50-4,6; 3.3ml / min; solvent A: Water + 0.1% TFA; solvent B: Acetonitrile + 0.1% TFA; 220 nm; 0 to 2,0 min: 1%B to 99%B; 2,0 to 2,5 min. 99%B): purity 97.0%, Rt 1.56 min., [M+H - C12H10CI] 254.1 m / z. 1 H NMR (500 MHz, DMSO) d 8.05 (d, J = 2.2 Hz, 1 H), 8.01 - 7.89 (m, 3H), 7.62 (dd, J = 8.5, 1.8 Hz, 1 H), 7.51 (dd, J = 8.8, 2.2 Hz, 1H), 6.01 (q, J = 6.5 Hz, 1 H), 4.23 (dd, J = 13.0, 4.4 Hz, 1H), 4.15 - 3.95 (m, 4H), 3.84 (dd, J = 13.1, 11.8 Hz, 1 H), 3.44 (td, J = 12.1 , 2.9 Hz, 1 H), 3.25 - 3.15 (m, 1 H), 2.99 (ddd, J = 13.8, 12.3, 4.2 Hz, 1 H), 1.68 (d, J = 6.5 Hz, 3H).
[0559] Example 17 via benzoyl protecting group route: (3S)-13-[(1S)-1-(7-chloronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]]tetradeca-10, 13-diene-9, 12-dione
[0560] (3S)-13-chloro-9, 12-dioxo-5-oxa-1 ,8, 14-triazatricyclo[8.4.0.03'8]]tetradeca-10, 13-dien-11 -yl benzoate (2.15 g; 5.72 mmol; 1.0 eq.) and (1S)-1-(7-chloronaphthalen-2-yl)ethan-1-ol (1.30 g; 1.1 eq.) were suspended in Tetrahydrofuran (40 ml). Potassium tert-butylate (1 .61 g; 2.5 eq.) was added at RT and stirred for 2h. The mixture was diluted with water and adjusted to pH 5 and was extracted with EtOAc. The organic layer was washed with brine and dried over Na2SO4, filtered and further purified by prep. HPLC (C18, water 0.1 % HCOOH I CAN 0.1 % HCOOH) and column chromatography (DCM / MeOH). The beige foam was suspended in ether and the precipitate was filtered, washed with ether and dried under vacuum to give (3S)-13-[(1S)-1-(7- chloronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricyclo[8.4.0.03’8]]tetradeca-10,13- diene-9, 12-dione (810,00 mg) as beige solid.
[0561] Several batches from above reaction were combined to 6.95 g, dissolved in DCM and the solvent was removed in vacuo. The solid was crystallized from diethyl ether to give (3S)-13-[(1S)- 1-(7-chloronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricyclo[8.4.0.03’8]]tetradeca- 10,13-diene-9, 12-dione (6.5 g) as a light-yellow solid.
[0562] LCMS (Agilent 1200 Series, Chromolith HR RP-18e 50-4,6; 3.3ml / min; solvent A: Water + 0.1% TFA; solvent B: Acetonitrile + 0.1% TFA; 220 nm; 0 to 2,0 min: 1%B to 99%B; 2,0 to 2,5 min. 99%B): purity 100 %, Rt 1.57 min, [M+H - C12H10CI] 254 m / z; 1H NMR (500 MHz, DMSO) d 11.61 (s, 1 H), 8.05 (d, J = 2.2 Hz, 1 H), 8.00 - 7.88 (m, 3H), 7.62 (dd, J = 8.5, 1.7 Hz, 1H), 7.51 (dd, J = 8.8, 2.1 Hz, 1 H), 6.01 (q, J = 6.5 Hz, 1 H), 4.23 (dd, J = 13.0, 4.4 Hz, 1H), 4.17 - 3.94 (m, 4H), 3.90 - 3.78 (m, 1 H), 3.52 - 3.35 (m, 1H), 3.21 (t, J = 11.0 Hz, 1 H), 3.05 - 2.92 (m, 1H), 1.68 (d, J = 6.5 Hz, 3H).
[0563] Route B2:
[0564] Intermediate 5-(benzyloxy)-4-oxo-1 ,4-dihydropyridazine-3-carboxylic acid
[0565] To a solution of ethyl 5-(benzyloxy)-4-oxo-1,4-dihydropyridazine-3-carboxylate (20.00 g; 68.98 mmol; 1.00 eq.) in water (10 ml) / EtOH (100 ml) was added NaOH (8.28 g; 206.95 mmol; 3.00 eq.). The mixture was stirred at 75°C for 1h. The solvent was removed in vacuo and dissolved in water (110 ml_). The pH of the mixture was adjusted to 6 and filtered. The filter cake was washed with water and dried in vacuo to afford 5-(benzyloxy)-4-oxo-1,4-dihydropyridazine-3- carboxylic acid (16 g) as colourless solid.
[0566] LCMS (Acquity UPLC BEH C18, 1.7 pm, 2.1*50mm; Mobile Phase A1 : 0.02%NH40Ac in water; Mobile Phase B1 : acetonitrile): Rt 0.78 min. purity 73.8 %, [M+H] 427.0 m / z.
[0567] Intermediate 5-(benzyloxy)-N-(2-hydroxyethyl)-N-methyl-4-oxo-1,4-dihydropyridazine-3-carbox- amide
[0568] A solution of 5-(benzyloxy)-4-oxo-1,4-dihydropyridazine-3-carboxylic acid (6.00 g; 17.98 mmol; 1.00 eq.), 2-(methylamino)ethan-1-ol (2.16 g; 28.77 mmol; 1.60 eq.) and Et3N (9.33 ml; 71.94 mmol; 4.00 eq.) in DMF (60 ml), Toluene (300 ml) was added HATU (10.26 g; 26.98 mmol; 1.50 eq.) at 25°C and stirred for 16 h. The solvent was removed in vacuo and the product purified by column chromatography (C-18 column, flow rate: 50 mL / min, 15%-95% acetonitrile in water) to give 5-(benzyloxy)-N-(2-hydroxyethyl)-N-methyl-4-oxo-1 ,4-dihydropyridazine-3-carboxamide (6000 mg) as colorless solid.
[0569] LCMS (LCMS-28; Column: Waters Xbridge C18, 3.5|lm, 3.0*30mm;LCMS28:5-95%: Flow Rate:2.0 mL / min; Analysis Time:2.5 min; MS scan range: 61-800; Mobil Phase A:0.02% NH4OAc in water; Mobil Phase B:ACN; Gradient: 0.1 min: 20 % B, 1.5 min: 95 % B, 1.5 min: 95% B, 3.0 min: 5% B, 3.0 min: 5% B;-): Rt: 0.738 min., (M+H) 304 m / z, purity 96%.
[0570] Intermediate 3-(benzyloxy)-6-methyl-4,5-dioxo-3H,4H,5H,6H,7H,8H-9A5-pyridazino[1,6-a]pyra- zin-9-ylium chloride
[0571] To a solution of 5-(benzyloxy)-N-(2-hydroxyethyl)-N-methyl-4-oxo-1,4-dihydropyridazine-3-car- boxamide (2600 mg; 8.23 mmol; 1.00 eq.), SOCI2 (3916 mg; 32.92 mmol; 4.00 eq.) in DCM (30 ml) the reaction mixture was stirred at 25°C for 60 min. The reaction mixture was concentrated in vacuo and ACN (30 ml) and TEA (1249.06 mg; 12.34 mmol; 1.50 eq.) was added and stirred at 25°C for 1 h.
[0572] The reaction solution was concentrated to give 3-(benzyloxy)-6-methyl-4,5-dioxo- 3H,4H,5H,6H,7H,8H-9A5-pyridazino[1 ,6-a]pyrazin-9-ylium chloride (2 g) as yellow oil. LCMS (LCMS-28; Column: Waters Xbridge C18, 3.5|lm, 3.0*30mm;LCMS28:5-95%: Flow Rate:2.0 mL / min; Analysis Time:2.5 min; MS scan range: 61-800; Mobil Phase A:0.02% NH4OAc in water; Mobil Phase B:ACN; Gradient: 0.1 min: 20 % B, 1.5 min: 95 % B, 1.5 min: 95% B, 3.0 min: 5% B, 3.0 min: 5% B;-): Rt: 0.861 min., (M+H) 286, purity 65.5%.
[0573] Intermediate 4-hydroxy-6-methyl-3H,5H,6H,7H,8H-pyridazino[1,6-a]pyrazine-3, 5-dione
[0574] To a stirred solution of 3-(benzyloxy)-6-methyl-4,5-dioxo-3H,4H,5H,6H,7H,8H-9A5-pyri- dazino[1 ,6-a]pyrazin-9-ylium (9.00 g; 27.84 mmol; 1.00 eq.) in TFA (100.00 ml). The resulting mixture was stirred for 5h at 35°C. The reaction was basified with saturated sodium bicarbonate to pH > 7 and filtered to give 4-hydroxy-6-methyl-3H,5H,6H,7H,8H-pyridazino[1,6-a]pyrazine- 3, 5-dione (4.0 g) as a yellow solid. LCMS(LCMS28 HCOOH, Chromolith HR RP-18e 50*4.6 mm;LCMS28,MS scan range:100- 1000; Mobil Phase A:0.05% HCOOH in water; Mobil Phase B:0.04% HCOOH and 1 % H2O in acetonitrile; Gradient: 5-95% in 3.0 min): Rt 0.36 min., [M+H] 196.0 m / z, purity 80%.
[0575] Intermediate 4-(benzyloxy)-6-methyl-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyrazine-3, 5-dione
[0576] To a solution of 4-hydroxy-6-methyl-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyrazine-3, 5-dione (1.00 g; 1.00 eq.) in DMF (50.00 ml) was added K2CO3 (1.70 g; 3.00 eq.) at 25°C over 10 min. After stirring at RT for 15 min, benzylbromide (1 .40 g; 2.00 eq.) was added dropwise. The mixture was stirred at 25°C for 2 h. Water (50 mL) was added and extracted with EtOAc. The organic layer was concentrated. The residue was purified by column chromatography (SiO2, hexanes- 100%EtOAc) to give 4-(benzyloxy)-6-methyl-3H,5H,6H,7H,8H-pyridazino[1,6-a]pyrazine-3, 5-dione (380 mg) as colorless solid.
[0577] LCMS(Chromolith HR RP-18e 50-4.6 mm.;LCMS14-3.0: 5-98%: Flow Rate:3.3 mL / min; Analysis Time:3.0 min; MS scan range: 61-800; Mobil Phase A:0.05% HCOOH in water; Mobil Phase B: acetonitrile; Gradient: 0.1 min: 30% B, 1.5 min: 98 % B,2.5 min: 98% B;): Rt 0.88 min, [M+H] 286.0 m / z, purity 93%.
[0578] Intermediate 4-(benzyloxy)-2-chloro-6-methyl-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyrazine-3,5- dione
[0579] To a solution of 4-(benzyloxy)-6-methyl-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyrazine-3, 5-dione (360 mg; 1.0 eq.) in DMF (10.00 ml) was added 1-chloropyrrolidine-2, 5-dione (391.76 mg; 2.50 eq.) at 25°C and heated to 100°C for 20 min. The precipitate was filtered and purified by column chromatography to afford 4-(benzyloxy)-2-chloro-6-methyl-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]py- razine-3, 5-dione (400 mg).
[0580] LCMS (Waters Xbridge C18, 3.5|lm, 3.0*30mm;LCMS28:5-95%: Flow Rate:2.0 mL / min; Analysis Time:2.5 min; MS scan range: 61-800; Mobil Phase A:0.02% NH4OAc in water; Mobil Phase B:ACN; Gradient: 0.1 min: 20 % B, 1.5 min: 95 % B, 1.5 min: 95% B, 3.0 min: 5% B, 3.0 min: 5% B;-): Rt 1.051 min, (M+H) 319.9 m / z, Purity: 97.6%.
[0581] The examples of Table 1 were prepared according to Scheme B and the procedures described for Examples 14 and 17 above, using appropriate starting materials.
[0582] Table 1
[0583]
[0584]
[0585]
[0586]
[0587] 1m / z values refer to [M+H]+if not specifically indicated otherwise.
[0588] 2Stereoinformation regarding the stereocenter at position 1 is assigned arbitrarily in both the structural formula and the IUPAC name.
[0589] Synthesis of Examples 62 and 65-68
[0590] Example 62 (3S)-11-hydroxy-13-[(naphthalen-2-yl)methanesulfonyl]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione
[0591] To a solution of (3S)-11 -hydroxy-13-{[(naphthalen-2-yl)methyl]sulfanyl}-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03,8]tetradeca-10,13-diene-9, 12-dione (100 mg; 0.20 mmol; 1.00 eq.) in THF (4.00 ml) was added oxone (1 .46 g; 2.02 mmol; 10.00 eq.) in H2O (2.00 ml) dropwise at room temperature. The resulting mixture was stirred for 2 h at 50 °C. The resulting mixture was filtered, the filter cake was washed with acetic acid. The filtrate was concentrated under reduced pressure. The residue was purified by column chromatography (Xselect CSH C18 OBD Column, 30*150 mm, 5 m; Mobile Phase A: Water(0.1% FA), Mobile Phase B: ACN; Flow rate: 60 mL / min mL / min; Gradient: 10% B to 40% B in 10 min; Wave Length: 254nm nm) to afford (3S)-11-hy- droxy-13-[(naphthalen-2-yl)methanesulfonyl]-5-oxa-1 ,8,14-triazatricyclo[8.4.0.03,8]tetradeca- 10,13-diene-9, 12-dione (37.40 mg) as off-white solid.
[0592] 1 H NMR (400 MHz, DMSO-d6) 7.94-7.82 (m, 2H), 7.57-7.49 (m, 2H), 7.42 (d, J = 8.7 Hz, 1 H), 5.14 - 5.01 (m, 2H), 4.48 (d, J = 12.3 Hz, 1 H), 4.18 - 3.97 (m, 5H), 3.53 - 3.42 (m, 1H), 3.24 (t, J = 10.6 Hz, 1 H), 2.99 (t, J = 13.0 Hz, 1H); LCMS (Poroshell HPH-C18;Solvent A: water + 6.5mM NH4HCO3+NH4OH(pH=10); Solvent B: ACN): purity 97.6 %, Rt 0.88 min, [M+H] 442.15.
[0593] Example 656-(cyclopropylmethyl)-4-hydroxy-2-{[methyl(naphthalen-2-yl)oxo-A6-sulfanyli- dene]amino}-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyrazine-3, 5-dione
[0594] To a mixture of 2-chloro-6-(cyclopropylmethyl)-3,5-dioxo-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]py- razin-4-yl benzoate (450.00 mg; 1.19 mmol; 1.00 eq.) and imino(methyl)(naphthalen-2-yl)- A6- sulfanone (272.00 mg; 1.33 mmol; 1.12 eq.) in toluene (5.00 ml) was added Pd(OAc)2 (75.00 mg; 0.32 mmol; 0.27 eq.), [2'-(diphenylphosphanyl)-[1 ,1'-binaphthalen]-2-yl]diphenylphosphane (27.00 mg; 0.04 mmol; 0.03 eq.) and Cs2CO3 (784.00 mg; 2.38 mmol; 2.01 eq.) at room temperature. The resulting mixture was stirred for 2 h at 135 °C. The reaction was diluted with water and extracted with EtOAc. The combined organic layers were washed with brine, dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated in vacuo. The residue was purified by column chromatography (silica gel, PE / EA) and purified by column chromatography (C18; mobile phase, CH3CN: water (c (NH4HCO3) = 0.01 M) = 0 to 50% gradient over 30 min) to afford 6-(cyclopropylmethyl)-4-hydroxy-2-{[methyl(naphthalen-2-yl)oxo-A6-sulfanyli- dene]amino}-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyrazine-3, 5-dione (157.90 mg) as light yellow solid.
[0595] 1 H NMR (400 MHz, DMSO-d6) S 11.45 (s, 1 H), 8.66 (d, J = 1.9 Hz, 1 H), 8.17 (dd, J = 13.0, 8.3 Hz, 2H), 8.07 (d, J = 7.9 Hz, 1H), 7.97 (dd, J = 8.7, 1.9 Hz, 1 H), 7.77 - 7.65 (m, 2H), 4.16 (ddd, J = 12.4, 7.2, 4.4 Hz, 1 H), 3.97 (td, J = 8.0, 3.8 Hz, 1H), 3.85 - 3.68 (m, 2H), 3.33 (d, J = 7.0 Hz, 2H), 1.01 (tt, J = 8.0, 5.0 Hz, 1 H), 0.51 - 0.43 (m, 2H), 0.31 - 0.23 (m, 2H). LCMS (Column: HALO C18, 2 pm, 3.0 x 30 mm, Column Oven: 40C;Mobile Phase A:6.5mM NH4HCO3+NH4OH(pH=10); Mobile Phase B: Acetonitrile; Flow rate: 1.5 mL / min; Gradient:5%B to 100%B in 3.0min, hold 0.6 min; 254nm): purity 99.58 %, Rt 0.73 min, [M+H] 439.1 m / z.
[0596] Example 66 (3S)-11 -hydroxy-13-{[(S)-methyl(naphthalen-2-yl)oxo-A6-sulfanylidene]amino}-5- oxa-1 , 8, 14-triazatricyclo[8.4.0.03,8]tetradeca-10,13-diene-9, 12-dione and
[0597] Example 67 (3S)-11 -hydroxy-13-{[(R)-methyl(naphthalen-2-yl)oxo-A6-sulfanylidene]amino}-5- oxa-1 , 8, 14-triazatricyclo[8.4.0.03,8]tetradeca-10,13-diene-9, 12-dione
[0598] To a mixture of (3S)-13-chloro-9,12-dioxo-5-oxa-1 ,8,14-triazatricyclo[8.4.0.03,8]tetradeca-10,13- dien-11-yl benzoate (200.00 mg; 0.52 mmol; 1.00 eq.) and imino(methyl)(naphthalen-2-yl)- A6- sulfanone (213.00 mg; 1.04 mmol; 2.00 eq.) in toluene (10.00 ml) was added Pd(OAc)2 (25.00 mg; 0.11 mmol; 0.20 eq.), [2'-(diphenylphosphanyl)-[1 ,1'-binaphthalen]-2-yl]diphenylphosphane (136.00 mg; 0.21 mmol; 0.40 eq.) and Cs2CO3 (341.00 mg; 1.04 mmol; 2.00 eq.) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 135 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by column chromatography (silica gel, DCM / MeOH) and column chromatography (XBridge Shield RP18 OBD Column19*250 mm, 5 m; Mobile Phase A: Water(0.1% FA), Mobile Phase B: ACN).
[0599] Both diastereoisomers were separated by prep-SFC (CHIRAL ART Cellulose-SB, 3*25 cm, 5 m; Mobile Phase A: CO2, Mobile Phase B: MEOH(0.1% 2M NH3-MEOH)). The collected fractions were neutralized to pH 7 with aq. NaHCO3 at 0°C, extracted with EA / MeOH, washed with brine, dried over anhydrous Na2SO4, then concentrated and lyophilization.
[0600] The sulfoximine stereocenter was arbitrarily assigned.
[0601] Example 66: (3S)-11 -hydroxy-13-{[(S)-methyl(naphthalen-2-yl)oxo-A6-sulfanylidene]amino}-5- oxa-1 , 8, 14-triazatricyclo[8.4.0.03,8]tetradeca-10,13-diene-9, 12-dione (35.40 mg) as brown solid. 1 H NMR (400 MHz, DMSO-d6) 5 8.69 (s, 1H), 8.16 -7.97(m, 4H), 7.77 - 7.66 (m, 3H), 4.22 - 3.97 (m, 6H), 3.80- 3.53(m, 4 H), 2.30 (s, 3H), 1.70 - 1.58 (m, 3H), 1.36- 1.04 (m, 6H), LCMS (HALO C18;Solvent A:Water / 0.1%FA, Solvent B:Acetonitrile / 0.1%FA): purity 96.4 %, Rt 0.67 min, [M+H] 441.15 m / z; HPLC (HALO C18;Solvent A: water + 0.1 % TFA; Solvent B: ACN + 0.1 % TFA): 4.28 min; SFC (CHIRAL ART Cellulose-SB 4.6*50mm,3pm; co-Solvent : MeOH): 1.598 min.
[0602] Example 67: (3S)-11 -hydroxy-13-{[(R)-methyl(naphthalen-2-yl)oxo-A6-sulfanylidene]amino}-5- oxa-1 , 8, 14-triazatricyclo[8.4.0.03,8]tetradeca-10,13-diene-9, 12-dione (25.7 mg) as brown solid. 1 H NMR (300 MHz, DMSO-d6) 8.65 (s, 1 H), 8.17 (s, 2H), 8.07 (s, 1 H), 7.97 (d, J = 8.4 Hz, 1H), 7.71 (s, 3H), 4.27 - 4.12 (m, 1H), 3.95 (s, 4H), 3.55 (s, 1H), 2.92 (s, 1 H), 2.29 (s, 1H), 1.52 -1.37 (m, 8H), 0.97 - 0.80 (m, 4H); LCMS (HALO C18;Solvent A: water + 0.1 % TFA; Solvent B: ACN + 0.1 % TFA;): purity 93.9 %, Rt 0.64 min., [M+H] 441.05 m / z; SFC (CHIRAL ART Cellulose-SB 4.6*50mm,3pm; co-Solvent : MeOH): 1.738 min.
[0603] Example 68: (3S)-11-hydroxy-13-[(naphthalen-2-yl)methanesulfinyl]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03,8]tetradeca-10,13-diene-9, 12-dione
[0604] A solution of (3S)-11 -hydroxy-13-{[(naphthalen-2-yl)methyl]sulfanyl}-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03,8]tetradeca-10,13-diene-9, 12-dione (43.00 mg; 0.09 mmol; 1.00 eq.) in THF (8.00 ml) was added oxone (63.00 mg; 0.09 mmol; 1.00 eq.) in water (2.00 ml) dropwise at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by column chromatography (C18 silica gel; mobile phase, ACN in water(FA), 2% to 20% gradient in 10 min; detector, UV 254 nm) to afford (3S)-11-hydroxy-13-[(naphthalen-2-yl)methanesulfinyl]-5-oxa-1 ,8,14- triazatricyclo[8.4.0.03,8]tetradeca-10,13-diene-9, 12-dione (21.8 mg) as off-white solid.
[0605] 1 H NMR (400 MHz, DMSO-d6) 8.09 - 8.01 (m, 1 H), 7.90 -7.80(m, 2H), 7.78 (s, 1 H), 7.62 - 7.49 (m, 2H), 7.32-7.25 (m, 1 H), 4.74 -4.71(m, 1 H), 4.47-4.31 (m, 1 H), 4.27-3.93 (m, 4H), 3.71- 3.53(m, 1 H), 3.30 - 3.19 (m, 1H), 3.02 (t, J = 13.0 Hz, 1 H); LCMS (HALO C18;Solvent A:Wa- ter / 0.1%FA, Solvent B:Acetonitrile / 0.1%FA): Rt 1.27 and 1.31 min., [M+H] 426.05 m / z.
[0606] BIOLOGICAL DATA FEN1 nuclease assay - determination of FEN1 inhibition (IC50 FEN1):
[0607] The IC50 values were determined by a biochemical FEN1 nuclease assay. FEN1 (Flap endonuclease 1) recognizes and cleaves 5' flap DNA structures. A mixture of FEN1 protein and the test substance were incubated at different concentrations with addition of fluorescently labelled 5’ Flap DNA substrate. Cleavage of the FAM / BHQ1 dual labelled 5’ Flap DNA substrate released the fluorescently tagged 5’ Flap causing an increase in fluorescent signal that is proportional to the amount of product generated. A single nucleotide 3’ flap was included in the substrate as this has been shown to be important for FEN1 substrate binding and cleavage.
[0608] In detail: The enzymatic FEN1 assay was carried out as Fluorescence Intensity (Fl) based 384- well assay. Purified human recombinant FEN1 (human FEN1 , full length, UniProt ID P39748, expressed in E. coli) was incubated in assay buffer for 30 minutes with the FEN1 inhibitor in various concentrations and without test substance as negative or neutral control. The assay buffer comprised 20 mM TRIS pH 7.5, 100 mM KCI, 5 mM MgCI2, 1 mM DTT, 0.01 % (v / v) IGEPAL® CA-630. The test-substance solutions were dispensed into the microtitre plates using a Hummingbird capillary pipettor (Hummingbird Nano). Reactions were initiated by the addition of FAM I BHQ1 dual labelled 5’ Flap DNA substrate (generated by annealing of oligo 1: [FAM]- CGAGGGCATTCTAACAGTCATAGCG, oligo 2: CTAAGTTCGTCAGGATTCCAC, and oligo 3: CGCTATGACTGTTAGAATGCTGGAATCCTGACGAACTTAG with dT-18 modified with BHQ1 (Integrated DNA Technologies)) in assay buffer. The pharmacologically relevant assay volume was 5 pl. The final concentrations in the assay during incubation of the reaction mixture were 0.03 - 0.04 nM FEN1 and 40 nM DNA substrate. After 60 min at room temperature, reactions were quenched by the addition of 3 pl of stop buffer (270 mM EDTA, 45 mM TRIS pH 7.5). The plates were analysed in a plate reader (PheraStar FSX, BMG LabTech) measuring fluorescence at 520 nm following excitation at 485 nm. The amount of product generated is directly proportional to the amounts of light emitted, i.e. the relative fluorescence units (RFU) at 520 nm. The measurement data were processed by means of the Genedata Screener software. In particular, IC50 values were determined by fitting a dose-response curve to the data points using nonlinear regression analysis.
[0609] EXO1 nuclease assay - determination of EXO1 inhibition (IC50 EXO1):
[0610] The IC50 values were determined by a biochemical EXO1 nuclease assay. EXO1 (Exonuclease 1) exhibits both 5' to 3' exonuclease as well as endonuclease activity. A mixture of EXO1 protein and the test substance were incubated at different concentrations with addition of fluorescently labelled 5’ pseudo Y DNA substrate. Cleavage of a FAM / BHQ1 dual labelled pseudo Y DNA substrate released the fluorescently tagged oligonucleotide causing an increase in fluorescent signal that is proportional to the amount of product generated.
[0611] In detail: The enzymatic EXO1 assay was carried out as Fluorescence Intensity (Fl) based 384- well assay. Purified human recombinant EXO1 (human EXO1, full length, UniProt ID Q9UQ84, expressed in E. coli) was incubated in assay buffer for 30 minutes with the EXO1 inhibitor in various concentrations and without test substance as negative or neutral control. The assay buffer comprised 20 mM TRIS pH 7.5, 5 % (v / v) Glycerol, 5 mM MgCI2, 1 mM DTT, 0.01% (v / v) IGEPAL® CA-630. The test-substance solutions were dispensed into the microtitre plates using a Hummingbird capillary pipettor (Hummingbird Nano). Reactions were initiated by the addition of FAM I BHQ1 dual labelled pseudo Y DNA substrate (generated by annealing of oligo 1 : CTAAGTTCGTCAGGATTCCACACAG-[FAM], oligo 2: CGCTATGACTGTTAGAATGCT-[BHQ]- GGAATCCTGACGAACTTAG (Integrated DNA Technologies)) in assay buffer. The pharmacologically relevant assay volume was 5 pl. The final concentrations in the assay during incubation of the reaction mixture were 1.2 - 1 .6 nM EXO1 and 40 nM DNA substrate. After 60 min at room temperature, reactions were quenched by the addition of 3 pl of stop buffer (270 mM EDTA, 45 mM TRIS pH 7.5). The plates were analysed in a plate reader (PheraStar FSX, BMG LabTech) measuring fluorescence at 520 nm following excitation at 485 nm. The amount of product generated is directly proportional to the amounts of light emitted, i.e. the relative fluorescence units (RFU) at 520 nm. The measurement data were processed by means of the Genedata Screener software. In particular, IC50 values were determined by fitting a dose-response curve to the data points using nonlinear regression analysis.
[0612] IC50 = half-maximum inhibitory concentration
[0613] FAM = Carboxyfluorescein
[0614] BHQ1 = Black Hole Quencher 1
[0615] TRIS = Tris(hydroxymethyl)aminomethane
[0616] KCL = potassium chloride
[0617] MgCh = magnesium chloride
[0618] DTT = dithiothreitol
[0619] EDTA = ethylenediamine tetraacetate
[0620] RT = room temperature
[0621] Results
[0622] The results are summarized in Table Ex-1 below, wherein the following classifications were applied.
[0623] FEN1 IC50: A: IC50 < 100 nm; B: 100 nM < I C50 < 1000 nM; C: 1000 nM < I C50 < 10000 nM;
[0624] D: 10000 nM < IC50 < 100 pM
[0625] EXO1 IC50: A: IC50 < 100 nm; B: 100 nM < IC50 < 1000 nM; C: 1000 nM < IC50 < 10000 nM;
[0626] D: 10000 nM < IC50 < 100 pM
[0627] Table Ex-1
Claims
CLAIMS1. A compound of formula (I)or a stereoisomer, tautomer, A / -oxide, or pharmaceutically acceptable salt thereof; whereinX is CHR2, andY is O, S, NH, S(=O), S(=O)2, C(=O), or CHR2; orX is S(=O), S(=O)2, or C(=O), andY is O, S, NH, or CHR2, orX is O, S, NH, andY is S(=O), S(=O)2, or C(=O), or CHR2; or the moiety R1-X-Y- is R1-S(=O)(R2)=N-;R1is phenyl, a 5- or 6-membered aromatic heterocyclyl, or an 8- to 10-membered aromatic carbobicyclyl or heterobicyclyl, wherein the aforementioned heterocyclic and heterobicy- clic rings independently comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxi- dized, and wherein each of the aforementioned aromatic rings is independently unsubstituted or substituted with one or more, same or different, substituents Rx;R2is H, Ci-C4-alkyl, or Ci-C4-haloalkyl;R3is CrC4-alkyl, CrC4-haloalkyl, CrC4-alkoxy-Ci-C4-alkyl, or a 3- to 7-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl, carbocyclyl-Ci-C2-alkyl, heterocyclyl, or heterocyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic rings independently comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different, substituents RY; andR4is H; or R4and R3together with the atoms to which they are bonded form a fused 5- to 7-membered saturated heterocyclyl, wherein the aforementioned heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S- atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned heterocyclic rings is independently unsubstituted or substituted with one or more, same or different, substituents Rz; and whereinRxis halogen, CN, Ci-C4-alkyl, Ci-C4-alkoxy, or a 5- or 6-membered aromatic carbocyclyl, carbocyclyl-Ci-C2-alkyl, carbocyclyloxy, heterocyclyl, heterocyclyl-Ci-C2-alkyl, or hetero- cyclyloxy, wherein the aforementioned heterocyclic rings independently of each other comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized;RYis Ci-C2-alkyl; andRzis Ci-C2-alkyl.
2. The compound according to claim 1 , wherein the compound is a compound of formula (IA) or (IB)3. The compound according to claim 1 or 2, wherein the compound is a compound of formula (IA)and wherein preferablyR2is H, Ci-C2-alkyl, or Ci-C2-haloalkyl.
4. The compound according to any one of claims 1 to 3, wherein the compound is a compound of formula (IA*)and wherein preferablyR2is H, Ci-C2-alkyl, or Ci-C2-haloalkyl.
5. The compound according to any one of claims 1 to 4, whereinY is O or S, preferably O.
6. The compound according to any one of claims 1 to 5, whereinR1is phenyl, a 6-membered aromatic heterocyclyl, or a 10-membered aromatic car- bobicyclyl or heterobicyclyl, wherein the aforementioned heterocyclic and heterobicyclic rings independently comprise one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each of the aforementioned aromatic rings is independently unsubstituted or substituted with one or more, same or different, substituents Rx; and wherein preferablyR1is phenyl, pyridinyl, naphtalenyl, quinolinyl, or isoquinolinyl, wherein each of the aforementioned aromatic rings is independently unsubstituted or substituted with one or more, same or different, substituents Rx.
7. The compound according to any one of claims 1 to 6, whereinRxis Cl, F, CN, Ci-C2-alkyl, CrC2-alkoxy, phenyl, benzyl, or phenoxy.
8. The compound according to any one of claims 1 to 7, whereinR2is C C2-alkyl, or C C2-haloalkyl; and wherein preferablyR2is CH3or CF3.
9. The compound according to any one of claims 1 to 8, whereinR3is Ci-C4-alkyl, Ci-C2-haloalkyl, Ci-C2-alkoxy-Ci-C4-alkyl, phenyl, or a 3- to 6-membered saturated carbocyclyl-Ci-C2-alkyl or heterocyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxi- dized, and wherein each of the aforementioned groups is independently unsubstituted or substituted with one or more, preferably one, same or different substituents RY; andR4is H; or R4and R3together with the atoms to which they are bonded form a fused 6-membered saturated heterocyclyl, wherein the aforementioned heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein the aforementioned heterocyclic ring is independently unsubstituted or substituted with one or more, preferably one, same or different substituents Rz.
10. The compound according to any one of claims 1 to 9, whereinR4and R3together with the atoms to which they are bonded form a fused 6-membered saturated heterocyclyl, wherein the aforementioned heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein the aforementioned heterocyclic ring is independently unsubstituted or substituted with one or more, preferably one, same or different substituents Rz.
11. The compound according to any one of claims 1 to 10, wherein the fused saturated heterocyclyl formed by R4and R3together with the atoms to which they are bonded is a morpholinyl of the following structure:wherein the wavy lines indicate the connections to the remainder of the molecule; and wherein preferably the fused saturated heterocyclyl formed by R4and R3together with the atoms to which they are bonded is a morpholinyl of the following structure:wherein the wavy lines indicate the connections to the remainder of the molecule.
12. The compound according to any one of claims 1 to 11 , wherein the compound of formula (I) is selected from the group consisting of:4-hydroxy-6-methyl-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyra- zine-3, 5-dione;4-hydroxy-6-methyl-2-[(naphthalen-2-yl)methoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyrazine-3,5-dione;4-hydroxy-6-methyl-2-[(1 R)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyridazino[1,6-a]pyra- zine-3, 5-dione;2-[(1S)-1-(1-chloronaphthalen-2-yl)ethoxy]-4-hydroxy-6-methyl-3H,5H,6H,7H,8H-pyridazino[1,6- a]pyrazine-3, 5-dione;4-hydroxy-6-methyl-2-[(1S)-1-(quinolin-7-yl)ethoxy]-3H,5H,6H,7H,8H-pyridazino[1,6-a]pyrazine- 3,5-dione;6-(cyclopropylmethyl)-4-hydroxy-2-[(1R)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;4-hydroxy-6-methyl-2-[(1 R)-1-(quinolin-7-yl)ethoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyrazine-3,5-dione;6-(cyclopropylmethyl)-4-hydroxy-2-[(naphthalen-2-yl)methoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6- a]pyrazine-3, 5-dione;6-(cyclopropylmethyl)-4-hydroxy-2-[(1R)-1-(quinolin-7-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;6-(cyclopropylmethyl)-4-hydroxy-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;2-[(1S)-1-(1-chloronaphthalen-2-yl)ethoxy]-6-(cyclopropylmethyl)-4-hydroxy-3H,5H,6H,7H,8H- pyridazino[1,6-a]pyrazine-3, 5-dione;6-(cyclopropylmethyl)-4-hydroxy-2-[(1S)-1-(quinolin-7-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;(3S)-11 -hydroxy-13-[(1R)-1-(naphthalen-2-yl)ethoxy]-5-oxa-1 , 8, 14-tri azatri cyclop.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;(3S)-11-hydroxy-13-[(1S)-1-(naphthalen-2-yl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;(3S)-13-[(1S)-1-(1-chloronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;(3S)-13-[(1 R)-1-(1-chloronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;(3S)-13-[(1S)-1-(7-chloronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;(3S)-13-[(1 R)-1-(7-chloronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;(3S)-11 -hydroxy-13-[(1 R)-1 -(quinolin-7-yl)ethoxy]-5-oxa-1 ,8, 14-triazatricyclo[8.4.0.03'8]tetradeca- 10,13-diene-9, 12-dione;4-hydroxy-2-[(1S)-1-phenylethoxy]-6-(propan-2-yl)-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyrazine-3,5-dione;4-hydroxy-2-[(1 R)-1-phenylethoxy]-6-(propan-2-yl)-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyrazine-3,5-dione;6-(1-cyclopropylethyl)-4-hydroxy-2-[(1 R)-1-phenylethoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]py- razine-3, 5-dione;6-(1-cyclopropylethyl)-4-hydroxy-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;6-(1-cyclopropylethyl)-4-hydroxy-2-[(1 R)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;4-hydroxy-2-[(1 R)-1-(naphthalen-2-yl)ethoxy]-6-[1-(oxan-4-yl)ethyl]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;4-hydroxy-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-6-[1-(oxan-4-yl)ethyl]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;4-hydroxy-6-[1-(oxan-4-yl)ethyl]-2-[(1 R)-1-phenylethoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]py- razine-3, 5-dione;4-hydroxy-6-[1-(oxan-4-yl)ethyl]-2-[(1S)-1-phenylethoxy]-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]py- razine-3, 5-dione;6-(1-cyclopropylethyl)-4-hydroxy-2-[(1S)-1-phenylethoxy]-3H,5H,6H,7H,8H-pyridazino[1,6-a]py- razine-3, 5-dione;(3S)-13-[1-(7-fluoronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;(3S)-13-[1-(6-fluoronaphthalen-2-yl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;(3S)-11 -hydroxy-13-[(1 R)-1 -(quinolin-2-yl)ethoxy]-5-oxa-1 ,8, 14-triazatricyclo[8.4.0.03’8]tetradeca- 10,13-diene-9, 12-dione;(3S)-11 -hydroxy-13-[(1S)-1-(quinolin-2-yl)ethoxy]-5-oxa-1 , 8, 14-tri azatri cyclo [8.4.0.03'8]tetradeca- 10,13-diene-9, 12-dione;(3S)-11-hydroxy-13-[(1S)-1-(4-methylphenyl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;(3S)-11 -hydroxy-13-[1-(isoquinolin-3-yl)ethoxy]-5-oxa-1 , 8, 14-triazatricyclo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;(3S)-11 -hydroxy-13-[1-(quinolin-3-yl)ethoxy]-5-oxa-1 ,8.14-triazatricyclo[8.4.0.038]tetradeca-10,13-diene-9, 12-dione;(3S)-11 -hydroxy-13-[1-(quinolin-6-yl)ethoxy]-5-oxa-1 ,8.14-triazatricyclo[8.4.0.038]tetradeca-10,13-diene-9, 12-dione;(3S)-11 -hydroxy-13-[1-(quinolin-7-yl)ethoxy]-5-oxa-1 , 8,14-triazatricyclo[8.4.0.038]tetradeca-10,13-diene-9, 12-dione;(3S)-11 -hydroxy-13-[1-(isoquinolin-7-yl)ethoxy]-5-oxa-1 , 8, 14-triazatricyclo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;(3S)-11 -hydroxy-13-[(1 R)-1 -(isoquinolin-6-yl)ethoxy]-5-oxa-1 ,8, 14-tri azatri cyclop.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;(3S)-11-hydroxy-13-[(1S)-1-(isoquinolin-6-yl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;(3S,7S)-11-hydroxy-7-methyl-13-[(1S)-1-(naphthalen-2-yl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;(3S)-11 -hydroxy-13-[(1S)-1-(pyridin-4-yl) ethoxy]-5-oxa-1 , 8, 14-triazatricyclo[8.4.0.03i8]tetradeca- 10,13-diene-9, 12-dione;(3S)-13-[(1S)-1-(2-fluorophenyl)ethoxy]-11-hydroxy-5-oxa-1,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;(3S)-13-[(1S)-1-(4-fluorophenyl)ethoxy]-11-hydroxy-5-oxa-1,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;(3S)-11-hydroxy-13-[(1S)-1-(3-methylphenyl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;4-hydroxy-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-6-phenyl-3H,5H,6H,7H,8H-pyridazino[1 ,6-a]pyra- zine-3, 5-dione;(3S)-13-(benzyloxy)-11 -hydroxy- 5-oxa-1 ,8,14-triazatricyclo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;4-hydroxy-6-(2-methoxyethyl)-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;4-hydroxy-6-(2-methoxyethyl)-2-[(1 R)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;4-hydroxy-6-(3-methoxypropyl)-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;4-hydroxy-6-(3-methoxypropyl)-2-[(1 R)-1-(naphthalen-2-yl)ethoxy]-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;3-[(1S)-1-{[(3S)-11 -hydroxy-9, 12-dioxo-5-oxa-1 , 8, 14-triazatricyclo[8.4.0.03’8]tetradeca-10,13- dien-13-yl]oxy}ethyl]benzonitrile;(3S)-13-[(1S)-1-(3-chlorophenyl)ethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;(3S)-11-hydroxy-13-[(1S)-1-(3-phenoxyphenyl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;(3S)-11-hydroxy-13-[(1S)-1-(3-methoxyphenyl)ethoxy]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;(3S)-13-[(1S)-1-(3-fluorophenyl)ethoxy]-11-hydroxy-5-oxa-1,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;(3S)-11 -hydroxy-13-[(1S)-1-(2-phenoxyphenyl)ethoxy]-5-oxa-1 , 8, 14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;(3S)-13-[1-(7-chloronaphthalen-2-yl)-2,2,2-trifluoroethoxy]-11-hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;(3S)-13-[(1 S)-1 -{[1 , 1 '-biphenyl]-3-yl}ethoxy]-11 -hydroxy-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;(3S)-11 -hydroxy-13-{[(naphthalen-2-yl)methyl]sulfanyl}-5-oxa-1 , 8, 14-triazatricy- clo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;(3S)-11-hydroxy-13-[(naphthalen-2-yl)methanesulfonyl]-5-oxa-1 ,8,14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione;2-[(1S)-1-(7-chloronaphthalen-2-yl)ethoxy]-4-hydroxy-6-(2,2,2-trifluoroethyl)-3H,5H,6H,7H,8H- pyridazino[1,6-a]pyrazine-3, 5-dione;4-hydroxy-2-[(1S)-1-(naphthalen-2-yl)ethoxy]-6-(2,2,2-trifluoroethyl)-3H,5H,6H,7H,8H-pyri- dazino[1 ,6-a]pyrazine-3, 5-dione;6-(cyclopropylmethyl)-4-hydroxy-2-{[methyl(naphthalen-2-yl)oxo-A6-sulfanylidene]amino}- 3H,5H,6H,7H,8H-pyridazino[1,6-a]pyrazine-3, 5-dione;(3S)-11 -hydroxy-13-{[methyl(naphthalen-2-yl)oxo-A6-sulfanylidene]amino}-5-oxa-1 ,8, 14-triazatri- cyclo[8.4.0.03'8]tetradeca-10, 13-diene-9, 12-dione;(3S)-11 -hydroxy-13-{[(S)-methyl(naphthalen-2-yl)oxo-A6-sulfanylidene]amino}-5-oxa-1 , 8, 14- triazatricyclo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;(3S)-11 -hydroxy-13-{[(R)-methyl(naphthalen-2-yl)oxo-A6-sulfanylidene]amino}-5-oxa-1 , 8, 14- triazatricyclo[8.4.0.03’8]tetradeca-10,13-diene-9, 12-dione;(3S)-11 -hydroxy-13-[(naphthalen-2-yl)methanesulfinyl]-5-oxa-1 , 8, 14-triazatricy- clo[8.4.0.03'8]tetradeca-10,13-diene-9, 12-dione; and(3S)-11 -hydroxy-13-[(1S)-1-phenylethoxy]-5-oxa-1 , 8, 14-triazatricyclo[8.4.0.038]tetradeca-10, 13- diene-9, 12-dione.
13. A pharmaceutical composition comprising a pharmaceutically effective amount of the compound according to any one of claims 1 to 12 and optionally a pharmaceutically acceptable carrier, diluent or excipient.
14. A compound according to any one of claims 1 to 12 or a pharmaceutical composition according to claim 13 for use in medicine.
15. A compound according to any one of claims 1 to 12 or a pharmaceutical composition according to claim 13 for use in the treatment of cancer, preferably for use in the treatment of a cancer selected from bladder cancer, breast cancer, colorectal cancer, gastric cancer, liver cancer, lung cancer, pancreatic cancer, prostate cancer, gynaecological cancer, in particular ovarian cancer, and head and neck cancer.
Citation Information
Patent Citations
Cyclic n-hydroxy imides as inhibitors of flap endonuclease and uses thereof
WO2006014647A2
3-hydroxy-quinazoline-2,4-dione derivatives and their use as nuclease modulators
WO2017051251A1
DIHYDROTHIENO[3,2-b]PYRIDINE COMPOUNDS
WO2019067442A1