Production of protease-based protein biosensor capable of specifically quantifying methionine sulfoxide present in target protein, and use thereof
A recombinant protein-based fluorescent biosensor quantitatively measures methionine sulfoxide in target proteins, addressing the limitations of direct ROS measurement by quantifying methionine oxidation to diagnose and screen for oxidative stress-related diseases.
Patent Information
- Application Number
- PCT/KR2025/001907
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-16
- Filing Date
- 2025-02-10
- Publication Date
- 2025-08-21
AI Technical Summary
Existing methods for measuring reactive oxygen species (ROS) in biological samples are limited due to their instantaneous nature and reactivity, and direct measurement of ROS is challenging, necessitating indirect methods like quantifying methionine oxidation to assess oxidative stress.
Development of a recombinant protein-based fluorescent biosensor comprising a fluorescent protein, methionine sulfoxide reductase (Msr), an enterokinase cleavage site, thioredoxin protein, and protein G, which quantitatively measures methionine sulfoxide levels in target proteins through fluorescence changes.
The biosensor accurately and quantitatively measures methionine oxidation, enabling diagnosis of oxidative stress-related diseases and screening therapeutic agents by detecting specific fluorescence changes.
Smart Images

Figure KR2025001907_21082025_PF_FP_ABST
Abstract
Description
Fabrication of a protease-based protein biosensor capable of specifically quantifying methionine sulfoxide present in a target protein and its use
[0001] The present invention relates to the production of a protease-based protein biosensor capable of specifically quantifying methionine sulfoxide present in a target protein and its use, and more particularly, to a recombinant protein for a fluorescent biosensor for quantifying methionine sulfoxide present in a target protein composed of a fluorescent protein; Msr (Methionine sulfoxide reductase) protein; an enterokinase cleavage site; a thioredoxin protein; and protein G, a biosensor including the same, and a method for quantifying methionine sulfoxide in a target protein using the same.
[0002]
[0003] Living organisms are constantly exposed to the dangers of reactive oxygen species (ROS), generated by metabolic processes within the body or external environmental stressors. The problem with these ROS is that they damage macromolecules within the body, thereby contributing to disease and accelerating aging. Among these macromolecules, DNA, lipids, and proteins are among the most directly affected by ROS. Measuring the level of ROS in the body is crucial for the diagnosis and monitoring of various diseases, including aging, cancer, and cardiovascular disease.
[0004] Accordingly, research into techniques for measuring the amount of reactive oxygen species in living organisms has been conducted, leading to the development of methods utilizing fluorescent dyes such as DCFDA and DHE. However, because reactive oxygen species are generated instantaneously and react immediately with other macromolecules in living organisms, direct measurement of reactive oxygen species in general biological samples, excluding living cells, is limited.
[0005] Another method is being developed to measure the accumulation of substances oxidized by reactive oxygen species. In particular, methionine is an amino acid that is relatively easily oxidized compared to other amino acids because it has a sulfur atom in its side chain. For this reason, methionine always plays a leading role at the forefront of the battle against reactive oxygen species, and since it is not free from protein modification and loss of function due to reactive oxygen species, research has been developed to indirectly confirm the amount of reactive oxygen species by measuring the degree of oxidation of methionine residues.
[0006] Studies on measuring methionine oxidation have been conducted so far using LC-MS / MS and GC-MS / MS, and recently, a study on measuring methionine oxidation using a fluorescent biosensor has been published. Briefly, these technologies all utilize the circularly permuted yellow fluorescence protein (cpYFP), which has a fluorescence value that changes depending on its structure. One end of this fluorescent protein is linked to MsrA / MsrB, a yeast or bacterial methionine sulfoxide reductase, and the other end is linked to a thioredoxin (Trx) protein. When MsrA / MsrB reacts with a protein containing an oxidized methionine residue, the thioredoxin on the other end forms a disulfide bond through the reduction process of MsrA / MsrB. At this time, the distance between MsrA / MsrB and thioredoxin becomes closer, which causes a structural change in cpYFP, resulting in a change in the fluorescence value (Non-patent Document 0001). In another study, by attaching an immunoglobulin protein, protein G, together with a linker behind the thioredoxin portion of the fluorescent protein described above, and then attaching an antibody to the target protein, protein G binds to the antibody and recognizes it, thereby producing a method for quantitatively measuring methionine oxidation of a specific protein (Non-patent Document 0002).
[0007]
[0008] Meanwhile, enterokinase is a proteolytic enzyme produced by cells in the duodenum that recognizes and cleaves specific amino acid sequences. It is involved in digestion in humans, cattle, and other animals, and cleaves amino acid bonds following the Asp-Asp-Asp-Asp-Lys sequence. Because of this sequence-specific cleavage, it is used to cleave various fusion proteins.
[0009]
[0010] Prior art literature
[0011] Non-patent literature 1: Lionel Tarrago et al., Nature Chemical Biology, 11:332-338, 2015
[0012] Non-patent literature 2: Hae Min Lee et al., ACS Sens, 7(1):131-141, 2022
[0013] Non-patent literature 3: Guohong Zhang et al., Biochem Biophys Res Commun, 227(3):707-11, 1996
[0014]
[0015] Accordingly, in the present invention, by applying and developing the technology described above, we have made great efforts to develop a biosensor capable of quantitatively measuring methionine oxidation of a target protein with higher sensitivity than existing biosensors, and as a result, we have produced a recombinant protein for a fluorescent biosensor for quantitatively measuring methionine sulfoxide present in a target protein composed of a fluorescent protein; Msr (Methionine sulfoxide reductase) protein; an enterokinase cleavage site; a thioredoxin protein; and protein G, and completed the present invention.
[0016]
[0017] Accordingly, the purpose of the present invention is to provide a recombinant protein for a fluorescent biosensor for quantifying methionine-sulfoxide present in a target protein.
[0018] Another object of the present invention is to provide a biosensor comprising the recombinant protein and a method for quantifying methionine-sulfoxide in a target protein using the same.
[0019]
[0020] To achieve the above-mentioned purpose,
[0021] The present invention provides a recombinant protein for a fluorescent biosensor for quantifying methionine sulfoxide present in a target protein comprising a fluorescent protein; a methionine sulfoxide reductase (Msr) protein; an enterokinase cleavage site represented by the amino acid sequence of SEQ ID NO: 4; a thioredoxin protein; and protein G.
[0022] According to a preferred embodiment of the present invention, the methionine-sulfoxide is methionine-S-sulfoxide or methionine-R-sulfoxide,
[0023] The recombinant protein for the fluorescent biosensor for the above methionine-S-sulfoxide quantification is composed of a fluorescent protein; an MsrA protein; an enterokinase cleavage site represented by the amino acid sequence of SEQ ID NO: 4; a thioredoxin protein; and protein G.
[0024] The recombinant protein for the fluorescent biosensor for quantifying the above methionine-R-sulfoxide may be composed of a fluorescent protein; an Msr B protein; an enterokinase cleavage site represented by the amino acid sequence of SEQ ID NO: 4; a thioredoxin protein; and protein G.
[0025] According to another preferred embodiment of the present invention, the MsrA protein may be represented by the amino acid sequence of SEQ ID NO: 2, and the MsrB protein may be represented by the amino acid sequence of SEQ ID NO: 17.
[0026] According to another preferred embodiment of the present invention, the fluorescent protein may be selected from the group consisting of green fluorescent protein (GFP), modified green fluorescent protein, enhanced green fluorescent protein (EGFP), red fluorescent protein (RFP), enhanced red fluorescent protein (ERFP), blue fluorescent protein (BFP), enhanced blue fluorescent protein (EBFP), yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (EYFP), cyan fluorescent protein (CFP), and enhanced cyan fluorescent protein (ECFP).
[0027] According to another preferred embodiment of the present invention, the thioredoxin (Trx) protein may be a thioredoxin 1 (Trx1) protein or a thioredoxin 3 (Trx 3) protein.
[0028] The above thioredoxin 1 (Trx1) protein may be represented by the amino acid sequence of SEQ ID NO: 5, and the above thioredoxin 3 (Trx 3) protein may be represented by the amino acid sequence of SEQ ID NO: 19.
[0029] According to another preferred embodiment of the present invention, the recombinant protein for a fluorescent biosensor for quantifying methionine-S-sulfoxide may be composed of a fluorescent protein; an MsrA protein represented by the amino acid sequence of SEQ ID NO: 2; an enterokinase cleavage site represented by the amino acid sequence of SEQ ID NO: 4; a thioredoxin 1 protein represented by the amino acid sequence of SEQ ID NO: 5; and a protein G represented by the amino acid sequence of SEQ ID NO: 7.
[0030] In addition, the present invention provides a polynucleotide encoding a recombinant protein for a fluorescent biosensor for quantifying methionine-sulfoxide present in the target protein.
[0031] In addition, the present invention provides a recombinant vector comprising the polynucleotide, and a recombinant strain transformed with the recombinant vector.
[0032]
[0033] To achieve other purposes,
[0034] The present invention provides a fluorescent biosensor for quantifying methionine-sulfoxide present in a target protein, comprising a recombinant protein for a fluorescent biosensor for quantifying methionine-sulfoxide present in the target protein.
[0035] In addition, the present invention provides a composition for quantitative detection of methionine-sulfoxide present in a target protein, comprising a recombinant protein for a fluorescent biosensor for quantitative detection of methionine-sulfoxide present in the target protein.
[0036]
[0037] In addition, the present invention comprises the steps of (a) treating a sample containing a target protein with a primary antibody against the target protein to bind the antibody to the target protein;
[0038] (b) a step of treating the recombinant protein for the fluorescent biosensor of the present invention to bind the protein G portion of the primary antibody and the recombinant protein; and
[0039] (c) a step of treating with enterokinase and then removing the cleaved recombinant protein for the fluorescent biosensor; and
[0040] (d) A method for quantitatively analyzing methionine sulfoxide present in a target protein is provided, comprising the step of measuring a fluorescence spectrum value for a recombinant protein for the remaining fluorescent biosensor.
[0041] According to a preferred embodiment of the present invention, the higher the methionine-sulfoxide content in the target protein, the higher the fluorescence spectrum value.
[0042] According to another preferred embodiment of the present invention, the method comprises a step of comparing a fluorescence spectrum value for the recombinant protein for the fluorescent biosensor with a fluorescence spectrum value for a normal control group, wherein the fluorescence spectrum value can be calculated as a fluorescence value through the following chemical formulas 1 to 3.
[0043] [Chemical Formula 1]
[0044] Fluorescence value = Ex:535nm / Em:507nm = 535nm value of the excitation spectrum (when the emission wavelength is fixed at 507nm)
[0045]
[0046] [Chemical Formula 2]
[0047] Fluorescence value = Ex:485nm / Em:535nm = 485nm value of the excitation spectrum (when the emission wavelength is fixed at 535nm)
[0048]
[0049] [Chemical Formula 3]
[0050] Fluorescence value = Ex:280nm / Em:510nm = 280nm value of the excitation spectrum (when the emission wavelength is fixed at 510nm)
[0051]
[0052] In addition, the present invention comprises the steps of (a) treating a biological sample separated from a test subject with a primary antibody for a target protein to bind the antibody to the target protein;
[0053] (b) a step of treating the recombinant protein for the fluorescent biosensor of the present invention to bind the protein G portion of the primary antibody and the recombinant protein; and
[0054] (c) a step of treating with enterokinase and then removing the cleaved recombinant protein for the fluorescent biosensor; and
[0055] (d) A method for providing information for diagnosing oxidative stress-related diseases through quantitative analysis of methionine-sulfoxide present in a target protein, including a step of measuring the fluorescence spectrum value for the remaining recombinant protein for a fluorescent biosensor and then measuring the fluorescence spectrum value for a normal control group.
[0056] According to a preferred embodiment of the present invention, the sample may be a cell, tissue, blood, plasma, serum, saliva or urine.
[0057] According to another preferred embodiment of the present invention, if the fluorescence spectrum value is higher than that of the normal control group, it may provide information that it is an oxidative stress-related disease.
[0058] According to another preferred embodiment of the present invention, the oxidative stress-related disease may be selected from the group consisting of cancer, stroke, myocardial infarction, angina pectoris, arteriosclerosis, infertility, hepatitis, osteoarthritis, acute coronary syndrome, cataract, aging, lipid metabolic disease, heart failure, hypertensive heart disease, arrhythmia, and aging.
[0059]
[0060] In addition, the present invention comprises the steps of (a) inducing oxidative stress in a sample containing a target protein containing a methionine residue, and then treating the candidate drug;
[0061] (b) a step of treating the sample with a primary antibody for the target protein to bind the antibody to the target protein;
[0062] (c) a step of treating the recombinant protein for the fluorescent biosensor of the present invention to bind the protein G portion of the primary antibody and the recombinant protein; and
[0063] (d) a step of treating with enterokinase and then removing the cleaved recombinant protein for the fluorescent biosensor; and
[0064] (d) A method for screening a therapeutic agent for an oxidative stress-related disease is provided, comprising the step of measuring a fluorescence spectrum value for the remaining recombinant protein for a fluorescent biosensor and then comparing the fluorescence spectrum value with that for a control group that was not treated with the candidate drug.
[0065] According to a preferred embodiment of the present invention, if the fluorescence spectrum value of the candidate drug treated is lower than that of the control group, the candidate drug can be selected as a treatment agent for an oxidative stress-related disease.
[0066]
[0067] The biosensor according to the present invention can accurately and quantitatively measure the degree of oxidation of methionine residues in a specific protein rather than the entire protein through detection of specific fluorescence changes, and thus can be used as a fluorescent biosensor for diagnosing oxidative stress diseases. In addition, the degree of aging can be determined by measuring the degree of oxidation, and thus can be usefully utilized for diagnosing aging and related diseases.
[0068]
[0069] Figure 1 is a schematic diagram showing the genetic sequence composition of a recombinant protein for a protease-based fluorescent biosensor capable of quantitatively measuring methionine sulfoxide of a target protein, and a schematic diagram of an expression vector including the genetic sequence thereof.
[0070]
[0071] Figure 2 is a schematic diagram showing the operating principle of the fluorescent biosensor of the present invention.
[0072] Figure 2a is a schematic diagram showing a fluorescent biosensor in a fully reduced state binding to a target protein and its corresponding antibody.
[0073] Figure 2b is a schematic diagram showing the process when a fluorescent biosensor reduces methionine-S-sulfoxide (MetSO) of a target protein to methionine (Met), thereby creating a disulfide bond between MsrA and Trx1, and then cutting the cleavage site through enterokinase.
[0074] Figure 2c is a schematic diagram showing the experimental process when applying the characteristics of the fluorescent biosensor of the present invention to an ELISA experiment.
[0075]
[0076] Figure 3 is a graph showing the spectroscopic characteristics of the recombinant protein for the fluorescent biosensor of the present invention expressed in E. coli, including the excitation spectrum, emission spectrum, and standard curve for the fluorescence value according to the concentration of the fluorescent biosensor.
[0077] Figure 3a shows the excitation spectrum results for the wavelength range from 420 nm to 600 nm when 507 nm is fixed as the emission wavelength for the oxidized (blue line) and reduced (pink line) fluorescent biosensor.
[0078] Figure 3b is an emission spectrum result for the wavelength range from 420 nm to 600 nm when 535 nm light is fixed as the excitation wavelength.
[0079] Figure 3c is a standard curve for the fluorescence value for the concentration of the fluorescent biosensor, which is a curve drawn using the value of the emission wavelength of 535 nm when light of a wavelength of 485 nm is given as the excitation wavelength.
[0080]
[0081] Figure 4 shows the SDS-PAGE results confirming the operation of the cut portion of the fluorescent biosensor. The fluorescent biosensor is approximately 75 kDa in size and is divided into 50 kDa and 25 kDa fragments when cut.
[0082]
[0083] Figure 5 is data measuring the degree of methionine oxidation of a target protein when oxidation of the target protein was induced with hydrogen peroxide.
[0084] Figure 5a is an SDS-PAGE result that confirms the difference in migration according to the degree of oxidation of methionine after treating methionine-rich protein IDLO (Hypothetical protein, Accession number: YP_155605) with hydrogen peroxide at various concentrations with a size of 17 kDa.
[0085] Figure 5b shows the results of confirming the difference in the degree of oxidation of methionine through changes in the fluorescence value of a fluorescent biosensor after treating IDLO protein with hydrogen peroxide at different concentrations.
[0086]
[0087] Hereinafter, the present invention will be described in detail.
[0088]
[0089] Recombinant proteins for fluorescent biosensors for methionine sulfoxide quantification
[0090] The present invention relates to a recombinant protein for a fluorescent biosensor for quantifying methionine sulfoxide present in a target protein, which is composed of a fluorescent protein; a methionine sulfoxide reductase (Msr) protein; an enterokinase cleavage site represented by the amino acid sequence of SEQ ID NO: 4; a thioredoxin protein; and protein G.
[0091]
[0092] In the present invention, the fluorescent protein may be selected from the group consisting of green fluorescent protein (GFP), modified green fluorescent protein, enhanced green fluorescent protein (EGFP), red fluorescent protein (RFP), enhanced red fluorescent protein (ERFP), blue fluorescent protein (BFP), enhanced blue fluorescent protein (EBFP), yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (EYFP), cyan fluorescent protein (CFP), and enhanced cyan fluorescent protein (ECFP).
[0093] In the present invention, enhanced green fluorescent protein (EGFP) was used. EGFP protein is a protein that has a fluorescence that is approximately 35 times brighter by mutating the chromophore of the GFP protein, and is widely used as a reporter protein because it has greater sensitivity than GFP.
[0094] In the present invention, when the methionine-sulfoxide is methionine-S-sulfoxide, the Msr protein may be MsrA protein, and when the methionine-sulfoxide is methionine-R-sulfoxide, the Msr protein may be MsrB protein.
[0095] Methionine is an amino acid that contains a sulfur element and is easily oxidized by reactive oxygen species to form methionine sulfoxide. At this time, two stereoisomers, methionine-R-sulfoxide and methionine-S-sulfoxide, can be produced. In the body, there are several types of Msr (methioninesulfoxide reductase) proteins that reduce methionine sulfoxide back to methionine in response to this oxidative stress. Among them, MsrA reduces methionine-S-sulfoxide within proteins or in a free state, and MsrB reduces methionine-R-sulfoxide within proteins.
[0096] Therefore, the recombinant protein of the present invention can be produced by selecting Msr protein or Trx protein depending on the type of methionine-sulfoxide.
[0097] Specifically, the recombinant protein for a fluorescent biosensor for quantifying methionine-S-sulfoxide may be composed of a fluorescent protein; an MsrA protein; an enterokinase cleavage site represented by the amino acid sequence of SEQ ID NO: 4; a thioredoxin protein; and protein G.
[0098] In addition, the recombinant protein for a fluorescent biosensor for quantifying methionine-R-sulfoxide can be composed of a fluorescent protein; Msr B protein; an enterokinase cleavage site represented by the amino acid sequence of SEQ ID NO: 4; a thioredoxin protein; and protein G, and can quantify methionine-R-sulfoxide present in a target protein.
[0099] More specifically, the MsrA protein may be represented by the amino acid sequence of SEQ ID NO: 2, and the MsrB protein may be represented by the amino acid sequence of SEQ ID NO: 17.
[0100] In the present invention, the thioredoxin (Trx) protein may be a thioredoxin 1 (Trx1) protein or a thioredoxin 3 (Trx 3) protein, and the Trx1 protein may be represented by the amino acid sequence of SEQ ID NO: 5, and the Trx 3 protein may be represented by the amino acid sequence of SEQ ID NO: 19. In addition, protein G may be represented by the amino acid sequence of SEQ ID NO: 7.
[0101]
[0102] In a specific embodiment of the present invention, yeast-derived MsrA, a linker, and an enterokinase cleavage site were linked to the C-terminus of enhanced green fluorescent protein (EGFP), and then yeast-derived thioredoxin 1 (Trx1) and streptococcus-derived protein G were sequentially linked (Fig. 1).
[0103] Yeast-derived MsrA reduces methionine-S-sulfoxide, an oxide of methionine present in proteins, and Cys25 and Cys176 present in MsrA are oxidized to form a disulfide bond.
[0104] Trx1 plays a role in reducing MsrA that has been oxidized by methionine-S-sulfoxide. At this time, Cys30 present in Trx1 attacks and reduces the disulfide bond formed in MsrA, and then a new disulfide bond is created between Cys25 of MsrA and Cys30 of Trx1. Originally, Trx1 restores the function of MsrA by breaking the disulfide bond formed between MsrA and Trx1 at Cys33, but through genetic manipulation, cysteine at position 33 was changed to serine to prevent this process from occurring.
[0105] Regarding the linker between MsrA and Trx1 and the linker between Trx1 and protein G, the two linkers were designed to allow MsrA to stably act on the substrate, and the former was designed to work well with Trx1.
[0106] Protein G is an immunoglobulin-binding protein that binds to the Fab and Fc regions of mammalian antibodies of the IgG type, making it a useful protein for purifying antibodies. In the present invention, an antibody that specifically binds to a target protein is attached, and then a biosensor is bound to the antibody using protein G, enabling it to react with the target protein.
[0107] EGFP protein is a fluorescent protein and serves as a reporter protein in the present invention. Methionine oxidation of a protein can be quantitatively measured by measuring the final level of EGFP fluorescence.
[0108] The enterokinase cleavage site between MsrA and Trx1 allows each biosensor region to be linked and expressed. When the biosensor reacts with a substrate and is treated with enterokinase, the enterokinase cleavage site is cleaved. In the oxidized biosensor, MsrA and Trx1 form a disulfide bond and remain connected, whereas in the unoxidized biosensor, they are cleaved, and the EGFP and MsrA in front of the cleavage site are separated. The fluorescence level of the remaining EGFP was measured to quantitatively determine the methionine oxidation of the target protein (Fig. 2).
[0109] Using genetic recombination technology, the protein genes described above (SEQ ID NO: 9) were linked into a single long sequence and then inserted into the pET-21a and pET-28a cloning vectors. Based on the base sequence represented by SEQ ID NO: 16, EGFP (SEQ ID NO: 9) has a base sequence of 1 to 717 bp, yeast-derived MsrA (SEQ ID NO: 10) has a base sequence of 718 to 1269 bp, the linker (SEQ ID NO: 11) and enterokinase cleavage site (SEQ ID NO: 12) have a base sequence of 1270 to 1359 bp, yeast-derived Trx1 (SEQ ID NO: 13) has a base sequence of 1360 to 1668 bp, another linker (SEQ ID NO: 14) has a base sequence of 1669 to 1767 bp, and protein G (SEQ ID NO: 15) has a base sequence of 1768 to 1929 bp.
[0110]
[0111] In another aspect, the present invention relates to a polynucleotide encoding a recombinant protein for a fluorescent biosensor for quantifying methionine-sulfoxide present in the target protein.
[0112] In the present invention, the term "polynucleotide" generally refers to a nucleic acid molecule, deoxyribonucleotide or ribonucleotide, or an analog thereof, separated into any length. In some embodiments, the polynucleotide of the present invention can be prepared by (1) in vitro amplification such as polymerase chain reaction (PCR) amplification; (2) cloning and recombination; (3) purification such as digestion and gel electrophoresis separation; and (4) synthetically such as chemical synthesis, and preferably, the isolated polynucleotide is prepared by recombinant DNA technology.
[0113]
[0114] In another aspect, the present invention relates to a recombinant vector comprising the polynucleotide.
[0115] The "vector" used in the present invention refers to a gene construct that is an expression vector capable of expressing a target protein in a suitable host cell and includes essential regulatory elements operably linked to enable expression of a gene insert. Here, "operably linked" means that a gene requiring expression and its regulatory sequence are functionally linked to each other to enable gene expression, and a "regulatory element" includes a promoter for performing transcription, an arbitrary operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. Such vectors may be, but are not limited to, plasmid vectors, cosmid vectors, bacteriophage vectors, viral vectors, etc., and one or more known vectors may be used as long as they can express the above-mentioned genes. As a specific example, the vector may be pNB181 (pET22B(+) based plasmid; AmpR ampicillin selection marker; T7 promoter / lac operator / ribosome binding site (RBS) / T7 transcription terminator).
[0116] The "recombinant vector" used in the present invention, after being transformed into a suitable host cell, can replicate independently of the host cell's genome or can be incorporated into the genome itself. In this case, the "suitable host cell" may include an origin of replication, a specific base sequence from which replication is initiated, as long as the vector is replicable.
[0117]
[0118] In another aspect, the present invention relates to a polynucleotide encoding a recombinant protein for the fluorescent biosensor, or a recombinant strain transformed with a recombinant vector comprising the polynucleotide.
[0119] In the present invention, the term "recombinant strain" means a cell transformed by introducing a vector having a polynucleotide encoding one or more target proteins into a host cell as a transformant, and methods for producing a transformant by introducing an expression vector into a host cell include the calcium phosphate method or the calcium chloride / rubidium chloride method described in the literature (Sambrook, J., et al., Molecular Cloning, A Laboratory Manual (2nd edition), Cold Spring Harbor Laboratory, 1. 74, 1989), electroporation, electroinjection, chemical treatment methods such as PEG, and methods using a gene gun, etc.
[0120] The host cell may be a mammalian cell or a bacterium, and preferably may be any one selected from the group consisting of Escherichia spp. bacteria, Bacillus spp. bacteria, Corynebacterium spp. bacteria, cyanobacteria spp. bacteria, Schizosaccharomyces spp. yeast, Kluyveromyces spp. yeast, and fungi. More preferably, in the present invention, Escherichia coli, which is a bacterium of the genus Escherichia, was used.
[0121]
[0122] Fluorescent biosensor for quantifying methionine sulfoxide
[0123] In another aspect, the present invention relates to a fluorescent biosensor for quantifying methionine-sulfoxide present in a target protein, comprising a recombinant protein for a fluorescent biosensor for quantifying methionine-sulfoxide present in the target protein.
[0124] In another aspect, the present invention relates to a composition for quantitative detection of methionine-sulfoxide present in a target protein, comprising a recombinant protein for a fluorescent biosensor for quantitative detection of methionine-sulfoxide present in the target protein.
[0125]
[0126] Method for quantitative analysis of methionine sulfoxide
[0127] In another aspect, the present invention comprises the steps of: (a) treating a sample containing a target protein with a primary antibody against the target protein to bind the antibody to the target protein;
[0128] (b) a step of treating the recombinant protein for the fluorescent biosensor of the present invention to bind the protein G portion of the primary antibody and the recombinant protein; and
[0129] (c) a step of treating with enterokinase and then removing the cleaved recombinant protein for the fluorescent biosensor; and
[0130] (d) A method for quantitatively analyzing methionine sulfoxide present in a target protein, comprising the step of measuring a fluorescence spectrum value for a recombinant protein for a remaining fluorescent biosensor.
[0131] In the present invention, the higher the methionine-sulfoxide content in the target protein, the higher the fluorescence spectrum value can be, and a step of comparing the fluorescence spectrum value for the recombinant protein for the fluorescent biosensor with the fluorescence spectrum value for a normal control group is included, wherein the fluorescence spectrum value can be calculated as a fluorescence value through the following chemical formulas 1 to 3. In addition, the methionine-sulfoxide content in the target protein can be quantified using the following chemical formula and standard curve.
[0132]
[0133] [Chemical Formula 1]
[0134] Fluorescence value = Ex:535nm / Em:507nm = 535nm value of the excitation spectrum (when the emission wavelength is fixed at 507nm)
[0135]
[0136] [Chemical Formula 2]
[0137] Fluorescence value = Ex:485nm / Em:535nm = 485nm value of the excitation spectrum (when the emission wavelength is fixed at 535nm)
[0138]
[0139] [Chemical Formula 3]
[0140] Fluorescence value = Ex:280nm / Em:510nm = 280nm value of the excitation spectrum (when the emission wavelength is fixed at 510nm)
[0141]
[0142] Diagnosis of oxidative stress-related diseases through quantitative analysis of methionine sulfoxide.
[0143] In another aspect, the present invention comprises the steps of: (a) treating a biological sample separated from a test subject with a primary antibody against a target protein to bind the antibody to the target protein;
[0144] (b) a step of treating the recombinant protein for the fluorescent biosensor of the present invention to bind the protein G portion of the primary antibody and the recombinant protein; and
[0145] (c) a step of treating with enterokinase and then removing the cleaved recombinant protein for the fluorescent biosensor; and
[0146] (d) A method for providing information for diagnosing oxidative stress-related diseases through quantitative analysis of methionine-sulfoxide present in a target protein, comprising the steps of measuring the fluorescence spectrum value for the remaining recombinant protein for a fluorescent biosensor and then measuring the fluorescence spectrum value for a normal control group.
[0147] In the present invention, the sample may be a cell, tissue, blood, plasma, serum, saliva or urine.
[0148] In the present invention, if the fluorescence spectrum value is higher than that of the normal control group, it can provide information that it is an oxidative stress-related disease, and the fluorescence spectrum value can be measured by the method described in the above <Methionine-sulfoxide quantitative analysis method>.
[0149] In the present invention, the oxidative stress-related disease may be selected from the group consisting of cancer, stroke, myocardial infarction, angina pectoris, arteriosclerosis, infertility, hepatitis, osteoarthritis, acute coronary syndrome, cataract, aging, lipid metabolic disease, heart failure, hypertensive heart disease, arrhythmia, and aging.
[0150]
[0151] Methods for screening therapeutic agents for oxidative stress-related diseases
[0152] In another aspect, the present invention comprises the steps of: (a) inducing oxidative stress in a sample comprising a target protein containing a methionine residue, and then treating the sample with a candidate drug;
[0153] (b) a step of treating the sample with a primary antibody for the target protein to bind the antibody to the target protein;
[0154] (c) a step of treating the recombinant protein for the fluorescent biosensor of the present invention to bind the protein G portion of the primary antibody and the recombinant protein; and
[0155] (d) a step of treating with enterokinase and then removing the cleaved recombinant protein for the fluorescent biosensor; and
[0156] (d) A method for screening a therapeutic agent for an oxidative stress-related disease, comprising the step of measuring a fluorescence spectrum value for the remaining recombinant protein for a fluorescent biosensor and then comparing the fluorescence spectrum value with that for a control group that was not treated with the candidate drug.
[0157] In the present invention, if the fluorescence spectrum value of the candidate drug treated is lower than that of the control group, the candidate drug can be selected as a treatment agent for an oxidative stress-related disease, and the fluorescence spectrum value can be measured by the method described in the above <Methionine-sulfoxide quantitative analysis method>.
[0158]
[0159] Hereinafter, the present invention will be described in more detail through examples.
[0160] These examples are intended solely to illustrate the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.
[0161]
[0162] Example 1: Preparation of recombinant proteins for fluorescent biosensors
[0163] 1-1: Gene recombination encoding a recombinant protein for a fluorescent biosensor
[0164] In the present invention, [pEGFP-N1 plasmid including a gene encoding EGFP (SEQ ID NO: 9)], [pUC57-amp plasmid including a gene encoding MsrA (SEQ ID NO: 10), a gene encoding linker 1 (SEQ ID NO: 11), and a gene encoding an enterokinase cleavage site (SEQ ID NO: 12)], [tpMetSOG in pET His6 TEV LIC cloning vector including a gene encoding thioredoxin 1 (Trx1) (SEQ ID NO: 13), a gene encoding linker 2 (SEQ ID NO: 14), and a gene encoding protein G (SEQ ID NO: 15)] were prepared for the genetic recombination process.
[0165] Each plasmid was amplified using PCR (polymerase chain reaction) as a template, and three genes were obtained, including EGFP, MsrA / linker / enterokinase cleavage site, and Trx1 / linker / protein G.
[0166] The above process was performed by adding sterile water, 10X PCR buffer, dNTPs, forward / reverse primers for each template (Table 1), and nPfu polymerase in order of increasing amount to a 0.2 ml PCR tube, and then spinning down at 100 xg for about 3 seconds using a centrifuge to remove any substances adhering to the tube wall. After gently mixing the substances well, PCR was performed according to the experimental protocol. The PCR reaction conditions for each gene part were as follows: initial denaturation at 95 ° C for 2 minutes, followed by 32 cycles of denaturation at 95 ° C for 30 seconds, annealing at 54 ° C for 45 seconds, and elongation for 42 seconds, and then elongation at 72 ° C for 5 minutes.
[0167]
[0168] Primer sequence Primer sequence (5' -> 3') SEQ ID NO: EGFP Forward AAAAAAGCTAGCATGGTGAGCAAGGGCGAG SEQ ID NO: 21 Reverse GCGACGACATCTTGTACAGC SEQ ID NO: 22 MsrA Forward GCTGATACAAGATGTCGTCGC SEQ ID NO: 23 Reverse AGCAATGCAGAGTCGAATTCG SEQ ID NO: 24 trx1 Forward ATGGGTTACTCAATTCAAAACTGCCAG SEQ ID NO: 25 Reverse ACTCGAGTTCAGTAACTGTAAAGGTCTTAGTCGCA SEQ ID NO: 26
[0169] First, the Trx1 1 / linker / protein G portion was inserted into the MCS of the pET21a plasmid through a genetic cloning process. Then, the EGFP gene and the MsrA / linker / enterokinase cleavage site gene were sequentially linked through a genetic recombination process and inserted into the pET21a plasmid into which Trx1 / linker / protein G had been previously inserted, finally connecting all genes (SEQ ID NO: 16). Finally, the base sequence of the recombinant plasmid was analyzed and confirmed, and it was named "pGACTLG."
[0170]
[0171] 1-2: Production and purification of recombinant proteins
[0172] Using the vector generated through the genetic recombination process in the above <Example 1-1>, transformed E. coli was produced, and a recombinant protein biosensor was expressed in large quantities from this E. coli. Subsequently, a fluorescent biosensor protein was purified through affinity chromatography using a His-tag. The amino acid sequence of the fluorescent biosensor protein is shown in Table 2 below.
[0173]
[0174] Amino acid sequence of fluorescent biosensor proteinSequence numberEGFPMVSKGEELFT GVVPILVELD GDVNGHKFSV SGEGEGDATY GKLTLKFICT TGKLPVPWPT LVTTLTYGVQ CFSRYPDHMK QHDFFKSAMP EGYVQERTIF FKDDGNYKTR AEVKFEGDTL VNRIELKGID FKEDGNILGH KLEYNYNSHN VYIMADKQKN GIKVNFKIRH NIEDGSVQLA DHYQQNTPIG DGPVLLPDNH YLSTQSALSK DPNEKRDHMV LLEFVTAAGI TLGMDELYKSequence number 1MsrAMSSLISKTIK YDPAKDKLIT LACGCFWGTE HMYRKYLNDR IVDCKVGYAN GEESKKDSPS SVSYKRVCGG DTDFAEVLQV SYNPKVITLR ELTDFFFRIH DPTTSNSQGP DKGTQYRSGLFAHSDADLKE LAKIKEEWQP KWGNKIATVI EPIKNFYDAE EYHQLYLDKN PQGYACPTHY LREM SEQ ID NO: 2 MsrBMKSKKMSDES NDVKWNDALT PLQLMVLRDK ATERPNTGAY LHTNESGVYH CANCDRPLYS SKAKFDARCG WPAFYEEVSP GAITYHRDNS LMPARVEICC ARCGGHLGHV FEGEGWKQLL NLPKDTRHCV NSASLNLKKDSQ ID NO: 17 Linker GGGGSGGGGS GGGGS SEQ ID NO: 3 Enterokinase cleavage site DDDDKDDDDK DDDDKSQ ID NO: 4 Trx1MVTQFKTASE FDSAIAQDKL VVVDFYATWC GPSKMIAPMI EKFSEQYPQA DFYKLDVDEL GDVAQKNEVS AMPTLLLFKN GKEVAKVVGA NPAAIKQAIA ANA SEQ ID NO: 5Trx3MSSYTSITKL TNLTEFRNLI KQNDKLVIDF YATWCGPSKM MQPHLTKLIQ AYPDVRFVKC DVDESPDIAK ECEVTAMPTF VLGKDGQLIG KIIGANPTAL EKGIKDL SEQ ID NO: 19Linker LAEAAAKEAAAKEAAAKEAA AKAAAGHGSS MTTSEQ ID NO: 6protein GYKLILNGKTL KGETTTEAVD AATAEKVFKQ YANDNGVDGE WTYDDATKTF TVTESEQ ID NO: 7fluorescent biosensor protein MVSKGEELFT GVVPILVELD GDVNGHKFSV SGEGEGDATY GKLTLKFICT TGKLPVPWPT LVTTLTYGVQ CFSRYPDHMK QHDFFKSAMP EGYVQERTIF FKDDGNYKTR AEVKFEGDTL VNRIELKGID FKEDGNILGH KLEYNYNSHN VYIMADKQKN GIKVNFKIRH NIEDGSVQLA DHYQQNTPIG DGPVLLPDNH YLSTQSALSK DPNEKRDHMV LLEFVTAAGI TLGMDELYKM SSLISKTIKY DPAKDKLITL ACGCFWGTEH MYRKYLNDRI VDCKVGYANG EESKKDSPSS VSYKRVCGGD TDFAEVLQVS YNPKVITLRE LTDFFFRIHD PTTSNSQGPD KGTQYRSGLFAHSDADLKEL AKIKEEWQPK WGNKIATVIE PIKNFYDAEE YHQLYLDKNP QGYACPTHYL REMGGGGSGG GGSGGGGSDD DDKDDDDKDD DDKMVTQFKT ASEFDSAIAQ DKLVVVDFYA TWCGPSKMIA PMIEKFSEQY PQADFYKLDV DELGDVAQKN EVSAMPTLLL FKNGKEVAKV VGANPAAIKQ AIAANALAEA AAKEAAAKEA AAKEAAAKAA AGHGSSMTTY KLILNGKTLK GETTTEAVDA ATAEKVFKQY ANDNGVDGEW TYDDATKTFT VTELEHHHHH H sequence number 8
[0175]
[0176] Specifically, strains having a fluorescent biosensor protein were secured through a process of transforming the prepared E. coli strain with the above pGACTLG vector and then inducing expression.
[0177] All purification processes were performed using a fast protein liquid chromatography (FPLC) system. The strains were grown in 6 ℓLB broth media, protein expression was induced, and then the cells were precipitated by centrifugation. The precipitated bacterial cells were dissolved in a lysis solution (50 mM Tris-HCl, 150 mM NaCl, 2 mM beta mercaptoethanol, pH 8) and sonicated using a sonicator at 4°C. The homogenate was centrifuged at 14,000 × g, and only the supernatant was filtered through a 0.45 ㎛ filter, and then attached to a Ni-NTA resin at a speed of 2.5 ㎖ per minute. Afterwards, the protein was eluted using an elution solution (50 mM Tris-HCl, 150 mM NaCl, 2 mM beta mercaptoethanol, 500 mM imidazole pH 8) with a gradient of imidazole concentration from 0 to 500 mM. The presence or absence of protein was confirmed by SDS-PAGE using a 12% polyacrylamide gel, and then concentrated using a 50 ml centrifugal filter.
[0178]
[0179] Example 2: Operation verification and fluorescence characteristic analysis of a fluorescent biosensor
[0180] The purified fluorescent biosensor protein is diluted to a concentration of 20 μM, then treated with DTT (dithiothreitol), a substance that reduces and breaks disulfide bonds, to a concentration of 10 mM (final concentration) and reacted at room temperature for 30 minutes. Through this process, the fluorescent biosensor is completely reduced.
[0181] To remove the reducing agent DTT, a desalting column was performed according to the experimental protocol. The reduced fluorescent biosensor was diluted to a concentration of 5 μM, and then the reduced fluorescent biosensor was treated with the oxidizing agent N-acetyl methionine sulfoxide and the reducing agent GSH, respectively, and reacted at 37°C for 30 min. After the reaction, the fluorescence spectra of the completely oxidized and reduced fluorescent biosensors were measured. The emission value was set at 507 nm, and the excitation spectrum was measured. For the emission spectrum, the excitation wavelength was measured at 535 nm, which had the highest value in the excitation spectrum (Fig. 3a and Fig. 3b).
[0182] In addition, in order to measure the fluorescence value according to the concentration of the fluorescent biosensor based on the previously measured fluorescence spectrum, the fluorescent protein diluted to 5 μM was serially diluted and the fluorescence for each dilution was measured. The emission wavelength of 535 nm was measured at an excitation wavelength of 485 nm, and the concentration value of the dilution was corrected using Nanodrop for more accurate concentration measurement. Using this, a standard curve according to the fluorescence value according to the concentration of the fluorescent biosensor was obtained (Fig. 3c).
[0183]
[0184] Example 3: Confirmation of cleavage by enterokinase
[0185] To confirm the cleavage of the fluorescent biosensor of the present invention by enterokinase, the fluorescent biosensor was prepared in a completely reduced state using DTT at a concentration of 5 μM. N-acetyl methionine sulfoxide was treated to a final concentration of 100 μM, 50 μM, 10 μM, and 5 μM, and the reaction was incubated at 37°C for 30 minutes. 1 μg of enterokinase was treated and reacted for another 30 minutes. Then, SDS-PAGE was performed using SDS sample buffer, which does not affect disulfide bonds. For comparison, a reaction was prepared by treating glutathione at a final concentration of 5 mM.
[0186] The SDS-PAGE results show that as the concentration of N-acetyl methionine sulfoxide decreases, the amount of the truncated fluorescent biosensor (approximately 50 kDa in size) increases. In other words, it was confirmed that the fluorescent biosensor of the present invention was cleaved by enterokinase (Fig. 4).
[0187]
[0188] Example 4: Confirmation of the degree of oxidation of purified methionine-rich proteins
[0189] To verify whether the fluorescent biosensor of the present invention can measure the oxidation level of a specific protein, IDLO, one of the methionine-rich proteins, was purified and prepared.
[0190] First, purified IDLO protein was prepared at 1 mM and reacted with hydrogen peroxide at concentrations of 0 mM, 10 mM, 20 mM, 30 mM, and 40 mM for 2 hours at room temperature to vary the degree of oxidation. After confirming that the oxidized IDLO protein migrated differently on SDS-PAGE (Fig. 5a), the degree of oxidation was measured using the oxidized methionine quantification method using 5 μM of the fluorescent biosensor of the present invention.
[0191]
[0192] As a result, as shown in Fig. 5b, when the degree of methionine oxidation of the target protein was measured using the fluorescent biosensor of the present invention, it was confirmed that the measured fluorescence value increased as the degree of oxidation increased due to an increase in the concentration of hydrogen peroxide.
[0193]
[0194] The biosensor according to the present invention can accurately and quantitatively measure the degree of oxidation of methionine residues in a specific protein, and thus can be used as a fluorescent biosensor for diagnosing oxidative stress diseases. In addition, the degree of aging can be determined by measuring the degree of oxidation, and thus can be usefully utilized for diagnosing aging and related diseases.
Claims
1. Fluorescent protein; Msr (Methionine sulfoxide reductase) protein; An enterokinase cleavage site represented by the amino acid sequence of sequence number 4; thioredoxin protein; and A recombinant protein for a fluorescent biosensor for quantifying methionine-sulfoxide present in a target protein, comprising protein G.
2. In paragraph 1, Methionine sulfoxide is methionine-S-sulfoxide or methionine-R-sulfoxide. The recombinant protein for the fluorescent biosensor for the above methionine-S-sulfoxide quantification is composed of a fluorescent protein; an MsrA protein; an enterokinase cleavage site represented by the amino acid sequence of SEQ ID NO: 4; a thioredoxin protein; and protein G. A recombinant protein for a fluorescent biosensor for quantifying methionine-R-sulfoxide, characterized in that the recombinant protein comprises a fluorescent protein; an Msr B protein; an enterokinase cleavage site represented by the amino acid sequence of SEQ ID NO: 4; a thioredoxin protein; and protein G.
3. In paragraph 2, A recombinant protein for a fluorescent biosensor for quantifying methionine-sulfoxide present in a target protein, characterized in that the MsrA protein is represented by the amino acid sequence of SEQ ID NO: 2 and the MsrB protein is represented by the amino acid sequence of SEQ ID NO:
17.
4. In paragraph 1, A recombinant protein for a fluorescent biosensor for quantifying methionine-sulfoxide present in a target protein, characterized in that the fluorescent protein is selected from the group consisting of green fluorescent protein (GFP), modified green fluorescent protein, enhanced green fluorescent protein (EGFP), red fluorescent protein (RFP), enhanced red fluorescent protein (ERFP), blue fluorescent protein (BFP), enhanced blue fluorescent protein (EBFP), yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (EYFP), cyan fluorescent protein (CFP), and enhanced cyan fluorescent protein (ECFP).
5. In paragraph 1, The above thioredoxin (Trx) protein is thioredoxin 1 (Trx1) protein or thioredoxin 3 (Trx 3) protein. The above thioredoxin 1 (Trx1) protein is represented by the amino acid sequence of sequence number 5. A recombinant protein for a fluorescent biosensor for quantifying methionine-sulfoxide present in a target protein, characterized in that the above thioredoxin 3 (Trx 3) protein is represented by the amino acid sequence of sequence number 19.
6. A polynucleotide encoding a recombinant protein for a fluorescent biosensor for quantifying methionine-sulfoxide present in a target protein of any one of claims 1 to 5.
7. A recombinant vector comprising a polynucleotide encoding a recombinant protein for a fluorescent biosensor for quantifying methionine-sulfoxide present in a target protein of any one of claims 1 to 5.
8. A polynucleotide encoding a recombinant protein for a fluorescent biosensor for quantifying methionine-sulfoxide present in a target protein of any one of claims 1 to 5, or a recombinant strain transformed with a recombinant vector containing the same.
9. A fluorescent biosensor for quantifying methionine-sulfoxide present in a target protein, comprising a recombinant protein for a fluorescent biosensor for quantifying methionine-sulfoxide present in a target protein of any one of claims 1 to 5.
10. A composition for quantitative detection of methionine-sulfoxide present in a target protein, comprising a recombinant protein for a fluorescent biosensor for quantitative detection of methionine-sulfoxide present in a target protein of any one of claims 1 to 5. 11.(a) A step of treating a sample containing a target protein with a primary antibody against the target protein to bind the antibody to the target protein; (b) a step of treating a recombinant protein for a fluorescent biosensor for quantifying methionine-sulfoxide present in a target protein of any one of claims 1 to 5, thereby binding the protein G portion of the recombinant protein to the primary antibody; and (c) a step of treating with enterokinase and then removing the cleaved recombinant protein for the fluorescent biosensor; and (d) a step of measuring the fluorescence spectrum value for the remaining recombinant protein for the fluorescent biosensor, A method for quantitatively analyzing methionine sulfoxide present in a target protein, characterized in that the higher the methionine sulfoxide content in the target protein, the higher the fluorescence spectrum value. 12.(a) A step of treating a biological sample separated from a test subject with a primary antibody for a target protein to bind the antibody to the target protein; (b) a step of treating a recombinant protein for a fluorescent biosensor for quantifying methionine-sulfoxide present in a target protein of any one of claims 1 to 5, thereby binding the protein G portion of the recombinant protein to the primary antibody; and (c) a step of treating with enterokinase and then removing the cleaved recombinant protein for the fluorescent biosensor; and (d) measuring the fluorescence spectrum value for the remaining recombinant protein for the fluorescent biosensor, and then including the fluorescence spectrum value step for the normal control, A method for providing information for diagnosing an oxidative stress-related disease through quantitative analysis of methionine-sulfoxide present in a target protein, characterized in that if the fluorescence spectrum value is higher than that of a normal control group, information is provided indicating that the disease is oxidative stress-related. 13.(a) A step of inducing oxidative stress in a sample containing a target protein containing a methionine residue, and then treating the sample with a candidate drug; (b) a step of treating the sample with a primary antibody for the target protein to bind the antibody to the target protein; (c) a step of treating a recombinant protein for a fluorescent biosensor for quantifying methionine-sulfoxide present in a target protein of any one of claims 1 to 5, thereby binding the protein G portion of the recombinant protein to the primary antibody; and (d) a step of treating with enterokinase and then removing the cleaved recombinant protein for the fluorescent biosensor; and (d) a step of measuring the fluorescence spectrum value for the remaining recombinant protein for the fluorescent biosensor and then comparing it with the fluorescence spectrum value for the control group that was not treated with the candidate drug; A method for screening a therapeutic agent for an oxidative stress-related disease, characterized in that if the fluorescence spectrum value of the candidate drug treated is lower than that of the control group, the candidate drug is selected as a therapeutic agent for an oxidative stress-related disease.
14. In any one of paragraphs 11 to 13, The above fluorescence spectrum value is characterized in that the value is calculated as a fluorescence value through the following chemical formulas 1 to 3: [Chemical Formula 1] Fluorescence value = Ex:535nm / Em:507nm = 535nm value of the excitation spectrum (when the emission wavelength is fixed at 507nm) [Chemical Formula 2] Fluorescence value = Ex:485nm / Em:535nm = 485nm value of the excitation spectrum (when the emission wavelength is fixed at 535nm) [Chemical Formula 3] Fluorescence value = Ex:280nm / Em:510nm = 280nm value of the excitation spectrum (when the emission wavelength is fixed at 510nm).
15. In paragraph 12 or 13, A method characterized in that the above oxidative stress-related disease is selected from the group consisting of cancer, stroke, myocardial infarction, angina pectoris, arteriosclerosis, infertility, hepatitis, osteoarthritis, acute coronary syndrome, cataract, aging, lipid metabolic disease, heart failure, hypertensive heart disease, arrhythmia, and aging.
Citation Information
Patent Citations
Method of purifying recombinant fused protein and method of producing protein using the same
EP1441030A1
luciferase biosensor
JP2007508014A
Lift of foot treatment medical device for convenience
KR1020230165929A
A nail care method that uses scissors to cut dead skin cell of eponychium
KR102565825B1
Hermetic cable harnes
KR102672718B1