Primer set, probe set, kit, and method for detecting methylation level of bladder cancer biomarker
By detecting the methylation sites of Twist1 and ZNF101 genes, combining specific primers and probes, high sensitivity and high specificity of early diagnosis of bladder cancer is achieved, solving the problem of non-invasiveness and insufficient accuracy of existing diagnostic methods, and reducing the incidence and mortality of bladder cancer.
Patent Information
- Application Number
- PCT/CN2025/070753
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-21
- Filing Date
- 2025-01-06
- Publication Date
- 2025-08-28
AI Technical Summary
The existing bladder cancer diagnosis methods have problems such as non-invasiveness, accuracy and sensitivity, and are especially difficult to detect effectively in early diagnosis.
The methylation sites of the Twist1 gene and ZNF101 gene were used as biomarkers. By detecting their methylation levels, combining specific primers and probes, non-invasive diagnosis of bladder cancer was performed using fluorescence quantitative PCR.
It has achieved high sensitivity and high specificity early diagnosis of bladder cancer, reducing the incidence and mortality rate of bladder cancer, simple operation, low cost, and easy sample collection, and is suitable for urine sample detection.
Smart Images

Figure CN2025070753_28082025_PF_FP_ABST
Abstract
Description
Primer sets, probe sets, kits and methods for detecting methylation levels of bladder cancer biomarkers Technical Field
[0001] The present invention relates to the field of biology, and in particular to a primer set, a probe set, a kit and a method for detecting the methylation level of a bladder cancer biomarker. Background Art
[0002] Bladder cancer is one of the most common malignancies worldwide, particularly in men. According to the World Health Organization (WHO), the global incidence of bladder cancer is on the rise, particularly in developing countries and regions. According to the International Agency for Research on Cancer (IARC), bladder cancer is the 15th most common cancer worldwide, with hundreds of thousands of new cases diagnosed each year. Bladder cancer is also a leading cause of cancer-related deaths.
[0003] Traditional methods for diagnosing bladder cancer include urine cytology, cystoscopy, and imaging studies. However, these methods have limitations and shortcomings. Although urine cytology is a noninvasive test, its accuracy and sensitivity are limited and are easily affected by sample collection and operator experience, making it particularly challenging for diagnosing early-stage bladder cancer. While cystoscopy has high diagnostic accuracy, its invasive nature and incompatibility with some patients limit its clinical application and also carry a certain risk of complications. Imaging studies can provide morphological information on bladder cancer tumors, but their accuracy for diagnosing early-stage lesions is limited and they cannot provide histological information. Therefore, to improve the early diagnosis rate and accuracy of bladder cancer, a noninvasive, highly accurate, sensitive, and specific diagnostic method is urgently needed to overcome the limitations and shortcomings of traditional diagnostic methods.
[0004] As an emerging non-invasive detection method, gene methylation technology assesses the expression status of tumor-related genes by analyzing DNA methylation patterns in body fluid samples, providing new possibilities for early diagnosis and disease monitoring of tumors. Changes in gene methylation are highly specific and stable in tumors, making them important biomarkers for tumor diagnosis and monitoring. In addition, non-invasive detection methods based on gene methylation technology can also provide a more convenient and comfortable diagnostic experience. By analyzing samples such as urine or blood, they avoid the invasive procedures of traditional diagnostic methods and provide patients with more acceptable diagnostic options. This is of great significance for improving the early diagnosis rate and accuracy of bladder cancer and monitoring of treatment effects.
[0005] Currently, the application of gene methylation technology in the diagnosis of bladder cancer remains to be studied. Summary of the Invention
[0006] The main purpose of the present invention is to provide a simple, rapid, low-cost, highly accurate and non-invasive method for detecting bladder cancer.
[0007] In order to achieve the above object, the present invention is implemented through the following technical solutions:
[0008] The inventors of the present invention discovered that the ZNF101 gene is significantly associated with bladder cancer. The degree of methylation at the gene's methylation sites is strongly correlated with the development of bladder cancer. However, no research has yet been found on the ZNF101 gene for bladder cancer detection. Therefore, the present invention is the first to use the ZNF101 gene as a biomarker for bladder cancer detection. Furthermore, the inventors discovered that combining the ZNF101 gene with the Twist1 gene as a biomarker for bladder cancer detection can significantly improve the accuracy, sensitivity, and specificity of detection, which is of great significance for the early diagnosis of bladder cancer.
[0009] In one aspect, the present invention provides a biomarker. According to an embodiment of the present invention, the biomarker includes Twist1 gene and ZNF101 gene.
[0010] The inventors of the present invention have discovered that the methylation levels of the Twist1 gene and the ZNF101 gene are significantly correlated with the occurrence of bladder cancer. By detecting the methylation levels of these two genes, bladder cancer can be accurately diagnosed with high accuracy, high sensitivity, and high specificity. In addition, the detection method is simple, rapid, low-cost, and easy to sample, which can achieve non-invasive early diagnosis of bladder cancer and has good application prospects.
[0011] Furthermore, the inventors proposed another biomarker, which includes methylation sites in the Twist1 gene target region and methylation sites in the ZNF101 gene target region; using GRCh38.p14 as the reference genome, the Twist1 gene target region is selected from the negative chain Chr7:19117910-19118035, and the ZNF101 gene target region is selected from the positive chain Chr19:19670694-19670850.
[0012] According to an embodiment of the present invention, the methylation site of the Twist1 gene target region is selected from at least one of the following: Chr7:19117910, Chr7:19117913, Chr7:19117918, Chr7:19117920, Chr7:19117925, Chr7:19117973, Chr7:19117987, Chr7:19118012 and Chr7:19118028; the methylation site of the ZNF101 gene target region is selected from at least one of the following: Chr19:19670699, Chr19:19670714, Chr19:19670729, Chr19:19670833 and Chr19:19670843.
[0013] The inventors of the present invention have discovered that the methylation levels of the methylation sites in the Twist1 gene target region and the ZNF101 gene target region are significantly correlated with the incidence of bladder cancer. By detecting the methylation levels of the above-mentioned methylation sites, the purpose of accurately diagnosing bladder cancer can be achieved, with the advantages of high accuracy, high sensitivity and strong specificity.
[0014] In another aspect, the present invention provides the use of a reagent for detecting the aforementioned biomarkers in the preparation of a detection product. According to an embodiment of the present invention, the detection product is used to diagnose bladder cancer. Thus, the kit of the present invention can be used to detect methylation levels of the Twist1 and ZNF101 genes, thereby facilitating the diagnosis of bladder cancer.
[0015] It should be noted that the detection reagent of the present invention is not limited to be in liquid form.
[0016] According to an embodiment of the present invention, the reagent for detecting a biomarker includes a primer set and / or a probe set; the primer set includes: a first primer set, the nucleotide sequences of the primers in the first primer set are shown in SEQ ID NOs: 1 and 2, respectively; a second primer set, the nucleotide sequences of the primers in the second primer set are shown in SEQ ID NOs: 4 and 5, respectively; the probe set includes: a first probe, the nucleotide sequence of the first probe is shown in SEQ ID NO: 3; and a second probe, the nucleotide sequence of the second probe is shown in SEQ ID NO: 6.
[0017] GTTATTTCGGATGGGGTTGTTATC (SEQ ID NO.1)
[0018] CGACGAACGCGAAACGAT (SEQ ID NO.2)
[0019] ATCGTTTTTTGGGTTGCG (SEQ ID NO.3)
[0020] ATTGTCGTTAGTTGTGATTGC (SEQ ID NO.4)
[0021] TACAAACGTAAACCATCGC (SEQ ID NO.5)
[0022] TTGTATTGAACGATAGAGTGAGAT (SEQ ID NO.6)
[0023] According to an embodiment of the present invention, the 5' end of the first probe is labeled with a FAM fluorescent reporter group, and the 3' end is labeled with an MGB fluorescent quencher group; the 5' end of the second probe is labeled with a ROX fluorescent reporter group, and the 3' end is labeled with an MGB fluorescent quencher group.
[0024] According to an embodiment of the present invention, the detection product includes a test kit, a test strip or a chip.
[0025] According to an embodiment of the present invention, the detection method used by the detection product includes at least one of the following: methylation-specific PCR method, fluorescence quantitative PCR method, bisulfite sequencing method, methylation-specific microarray method, whole genome methylation sequencing method, pyrophosphate sequencing method, methylation-specific high-performance liquid chromatography method, digital PCR method, methylation-specific high-resolution melting curve method and methylation-sensitive restriction endonuclease method.
[0026] In yet another aspect, the present invention provides a primer set. According to an embodiment of the present invention, the primer set is used to detect the aforementioned biomarkers, and the primer set comprises: a first primer set, wherein the nucleotide sequences of the primers in the first primer set are shown in SEQ ID NOs: 1 and 2, respectively; and a second primer set, wherein the nucleotide sequences of the primers in the second primer set are shown in SEQ ID NOs: 4 and 5, respectively. Thus, the primer set of the present invention can be used to specifically amplify methylation sites of the Twist1 gene and the ZNF101 gene, thereby diagnosing bladder cancer.
[0027] In yet another aspect, the present invention provides a probe set. According to an embodiment of the present invention, the probe set is used to detect the aforementioned biomarkers, comprising: a first probe having a nucleotide sequence as shown in SEQ ID NO: 3; and a second probe having a nucleotide sequence as shown in SEQ ID NO: 6. Thus, the probe set of the present invention can be used to detect the Twist1 gene and the ZNF101 gene using fluorescent quantitative PCR, thereby diagnosing bladder cancer.
[0028] According to an embodiment of the present invention, the first probe is labeled with a FAM fluorescent reporter group at its 5' end and an MGB fluorescent quencher group at its 3' end; the second probe is labeled with a ROX fluorescent reporter group at its 5' end and an MGB fluorescent quencher group at its 3' end. Labeling different probes with different fluorescent groups facilitates multi-gene testing in the same reaction system, improving detection efficiency and reducing testing costs.
[0029] In yet another aspect, the present invention provides a kit. According to an embodiment of the present invention, the kit is used to detect the aforementioned biomarkers, and the kit comprises at least one of the following: the aforementioned primer set and the aforementioned probe set. Thus, the kit of the present invention can accurately detect methylation sites in the Twist1 and ZNF101 genes, thereby diagnosing bladder cancer.
[0030] According to an embodiment of the present invention, the kit further includes at least one of the following: a sample collection container, a nucleic acid extraction reagent, a methylation conversion reagent, a fluorescent quantitative PCR detection reagent, primers and probes for detecting the ACTB gene, such as one or more of a negative control, a positive control, a PCR Master Mix, a lysis buffer, proteinase K, a rinse solution, a bisulfite solution, and ddH2O. These reagents can all be purchased separately from commercial sources or prepared by the user, and thus can be incorporated into the kit according to actual needs.
[0031] According to an embodiment of the present invention, the capacity of the sample collection container is 1-10 mL.
[0032] According to an embodiment of the present invention, the 5' end of the probe for detecting the ACTB gene is labeled with a VIC fluorescent reporter group, and the 3' end is labeled with an MGB fluorescent quencher group.
[0033] The sample collection container is used to collect a sample, which may be urine, sweat, blood, whole blood, serum, etc., preferably urine. The sample collection container may have a capacity of 1-10 mL or 1-3 mL. The kit of the present invention enables accurate testing of small amounts of sample, thereby reducing the difficulty of sample collection and facilitating testing. The material and shape of the sample collection container are not strictly limited and may be flexibly selected based on conventional practices in the art.
[0034] The nucleic acid extraction reagent is used to extract DNA, and specifically can be a conventional nucleic acid extraction reagent in the art.
[0035] Methylation conversion reagents can convert cytosine (C) in nucleic acid fragments to uracil (U), while 5-methylcytosine (5mC) remains unchanged. Furthermore, by designing primers specific to the methylation sequence, PCR amplification of the methylation site is performed. If an amplified fragment is obtained, it indicates that methylation is present at the site in the nucleic acid fragment; if no amplified fragment is obtained, it indicates that methylation is not present at the site in the nucleic acid fragment, thereby diagnosing bladder cancer. Specifically, the methylation conversion reagent can be a sulfite conversion reagent or an enzymatic conversion reagent.
[0036] Fluorescence quantitative PCR detection reagents can include PCR buffer, dNTPs, DNA polymerase, and other commonly used reagents for fluorescence quantitative PCR. Primers and probes for detecting the ACTB gene can contain sequences commonly used in the art and are used to detect the expression level of the ACTB control gene. The ACTB gene probe is labeled with a VIC fluorescent reporter group at its 5' end, enabling multiplex single-tube detection.
[0037] In addition, the present invention provides a method for using the aforementioned kit, comprising the following steps:
[0038] (1) Extract genomic DNA from the biological sample to be tested;
[0039] (2) sulfite conversion of the genomic DNA of the biological sample to be tested;
[0040] (3) Performing quantitative PCR detection of methylation on the sulfite-converted DNA using the primer set and probe set in the aforementioned kit;
[0041] (4) Analyze the test results.
[0042] In another aspect, the present invention provides a method for detecting methylation levels of bladder cancer biomarkers. According to an embodiment of the present invention, the method comprises: using the aforementioned primer set to detect the aforementioned biomarkers in a biological sample. Thus, the method of the present invention can accurately detect methylation levels of the bladder cancer genes Twist1 and ZNF101. This method can be used for diagnosing bladder cancer, as well as for non-diagnostic purposes, such as studying the physiology or pathology of bladder cancer and screening for therapeutic drugs for bladder cancer, thus having high application value.
[0043] According to an embodiment of the present invention, the method includes: detecting the aforementioned biomarkers in a biological sample using the aforementioned primer set and the aforementioned probe set.
[0044] In another aspect, the present invention provides a device for diagnosing bladder cancer. According to an embodiment of the present invention, the device comprises: a detection unit adapted to detect the methylation levels of the aforementioned biomarkers and obtain a detection result; and an analysis unit adapted to diagnose bladder cancer based on the detection result. Thus, the device of the present invention is simple and rapid to operate, has high detection accuracy, is low-cost, and facilitates sampling. It can achieve non-invasive early diagnosis of bladder cancer and has promising application prospects.
[0045] According to an embodiment of the present invention, the detection unit contains a detection device; the detection device includes a fluorescence quantitative PCR instrument.
[0046] According to an embodiment of the present invention, the detection unit further comprises a DNA extraction device for extracting DNA from a biological sample, including a centrifuge, a mixer, and the like.
[0047] According to an embodiment of the present invention, the analysis unit is suitable for diagnosing bladder cancer based on the following determination method: under the premise that the ACTB gene amplification curve is S-shaped and Ct(ACTB) ≤35, if the Twist1 gene target region amplification curve is S-shaped and Ct(Twist1) ≤37, it is determined that the Twist1 gene is methylated positive; if Ct(Twist1)>37 or there is no amplification curve in the Twist1 gene target region, it is determined that the Twist1 gene is methylated negative; under the premise that the ACTB gene amplification curve is S-shaped and Ct(ACTB) If the amplification curve of the ZNF101 gene target region is S-shaped and Ct(ZNF101) is ≤35, the ZNF101 gene is considered positive for methylation. If Ct(ZNF101) is greater than 38 or there is no amplification curve in the ZNF101 gene target region, the ZNF101 gene is considered negative for methylation. If at least one of the Twist1 gene and the ZNF101 gene is positive for methylation, the patient is diagnosed with bladder cancer. If both the Twist1 gene and the ZNF101 gene are negative for methylation, the patient is diagnosed with no bladder cancer. Specifically, the Ct value can be obtained using the software supporting the fluorescent quantitative PCR instrument.
[0048] In yet another aspect, the present invention provides an analysis system for diagnosing bladder cancer. According to an embodiment of the present invention, the analysis system for diagnosing bladder cancer includes: a data acquisition module configured to obtain detection results of the aforementioned biomarker methylation levels in a biological sample; and an analysis module configured to diagnose bladder cancer based on the detection results. Thus, the analysis system of the present invention can accurately diagnose bladder cancer.
[0049] According to an embodiment of the present invention, the analysis module is configured to diagnose bladder cancer based on the following judgment method: under the premise that the ACTB gene amplification curve is S-shaped and Ct(ACTB) ≤35, if the Twist1 gene target region amplification curve is S-shaped and Ct(Twist1) ≤37, it is judged that the Twist1 gene is methylated positive; if Ct(Twist1)>37 or there is no amplification curve in the Twist1 gene target region, it is judged that the Twist1 gene is methylated negative; under the premise that the ACTB gene amplification curve is S-shaped and Ct(ACTB) On the premise that the amplification curve of the target region of the ZNF101 gene is ≤35, if the amplification curve of the ZNF101 gene target region is S-shaped and Ct(ZNF101)≤38, the ZNF101 gene is judged to be positive for methylation; if Ct(ZNF101)>38 or there is no amplification curve of the target region of the ZNF101 gene, the ZNF101 gene is judged to be negative for methylation; when at least one of the Twist1 gene and the ZNF101 gene is positive for methylation, the patient is judged to have bladder cancer; when both the Twist1 gene and the ZNF101 gene are negative for methylation, the patient is judged to not have bladder cancer.
[0050] In another aspect, the present invention provides an electronic device. According to an embodiment of the present invention, the electronic device includes a memory and a processor. The memory stores a program executable on the processor. When executed by the processor, the program enables diagnosis of bladder cancer based on the methylation levels of the aforementioned biomarkers in a biological sample. Thus, the electronic device of the present invention can accurately diagnose bladder cancer. Specifically, the electronic device can be any intelligent terminal, including a fluorescence quantitative PCR instrument, a computer, a tablet computer, a computing cluster, or the like.
[0051] According to an embodiment of the present invention, when the program is executed by the processor, bladder cancer is diagnosed based on the following judgment method: under the premise that the ACTB gene amplification curve is S-shaped and Ct(ACTB) ≤35, if the Twist1 gene target region amplification curve is S-shaped and Ct(Twist1) ≤37, it is judged that the Twist1 gene is methylated positive; if Ct(Twist1)>37 or there is no amplification curve in the Twist1 gene target region, it is judged that the Twist1 gene is methylated negative; under the premise that the ACTB gene amplification curve is S-shaped and Ct(ACTB) On the premise that the amplification curve of the target region of the ZNF101 gene is ≤35, if the amplification curve of the ZNF101 gene target region is S-shaped and Ct(ZNF101)≤38, the ZNF101 gene is judged to be positive for methylation; if Ct(ZNF101)>38 or there is no amplification curve of the target region of the ZNF101 gene, the ZNF101 gene is judged to be negative for methylation; when at least one of the Twist1 gene and the ZNF101 gene is positive for methylation, the patient is judged to have bladder cancer; when both the Twist1 gene and the ZNF101 gene are negative for methylation, the patient is judged to not have bladder cancer.
[0052] In yet another aspect, the present invention provides a computer-readable storage medium. According to an embodiment of the present invention, the computer-readable storage medium stores one or more programs, which can be executed by one or more processors to diagnose bladder cancer based on the methylation levels of the aforementioned biomarkers in a biological sample. Thus, the computer-readable storage medium of the present invention can accurately diagnose bladder cancer.
[0053] According to an embodiment of the present invention, when the one or more programs are executed by one or more processors, the diagnosis of bladder cancer is based on the following judgment method: under the premise that the ACTB gene amplification curve is S-shaped and Ct(ACTB) ≤35, if the Twist1 gene target region amplification curve is S-shaped and Ct(Twist1) ≤37, it is judged that the Twist1 gene is methylated positive; if Ct(Twist1)>37 or there is no amplification curve in the Twist1 gene target region, it is judged that the Twist1 gene is methylated negative; under the premise that the ACTB gene amplification curve is S-shaped and Ct(ACTB) On the premise that the amplification curve of the target region of the ZNF101 gene is ≤35, if the amplification curve of the ZNF101 gene target region is S-shaped and Ct(ZNF101)≤38, the ZNF101 gene is judged to be positive for methylation; if Ct(ZNF101)>38 or there is no amplification curve of the target region of the ZNF101 gene, the ZNF101 gene is judged to be negative for methylation; when at least one of the Twist1 gene and the ZNF101 gene is positive for methylation, the patient is judged to have bladder cancer; when both the Twist1 gene and the ZNF101 gene are negative for methylation, the patient is judged to not have bladder cancer.
[0054] Compared with the prior art, the present invention has the following beneficial effects:
[0055] (1) Methylation abnormalities are an early event in the development of tumors. This invention can detect the methylation levels of the Twist1 and ZNF101 genes to diagnose early bladder cancer, effectively reducing the incidence and mortality of bladder cancer. The method is easy to use. After obtaining a urine sample collection tube, the user can complete the urine sample collection at home and then send it by express delivery to be tested by professionals.
[0056] (2) The diagnostic method provided by the present invention is completely non-invasive and uses urine as the test sample. Sampling is simple and easy to obtain, and will not cause any pain or impact to the patient, and is highly accepted by patients.
[0057] (3) The present invention can use 1-10 mL whole urine samples for detection and still achieve high levels of sensitivity and specificity, and is suitable for small volume sample detection.
[0058] (4) The present invention designed specific primers and probes and adopted a method for combined detection of Twist1 gene and ZNF101 gene methylation, which greatly improved the overall detection accuracy, sensitivity and specificity. The detection sensitivity was 95% and the specificity was 92.5%, avoiding the problems of low sensitivity and specificity in single gene methylation detection.
[0059] (5) Among the bladder cancer target genes used in the present invention, the Twist1 gene probe is labeled with FAM, the ZNF101 gene probe is labeled with ROX, and the control ACTB gene probe is labeled with VIC, which can realize multiple single-tube detection. Compared with single-plex detection, it reduces reagent consumption, reduces consumables costs, reduces the number of operating steps for experimental personnel, and reduces the experimental error rate.
[0060] Additional aspects and advantages of the present invention will be set forth in part in the description which follows and, in part, will be obvious from the description which follows, or may be learned by practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS
[0061] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the following description of the embodiments with reference to the accompanying drawings, in which:
[0062] Figure 1 shows the ROC curve of the Twist1 gene detection results;
[0063] FIG2 shows the ROC curve of the ZNF101 gene detection results. DETAILED DESCRIPTION
[0064] Below, the scheme of the present invention will be explained in conjunction with embodiment.It will be understood by those skilled in the art that the following examples are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention.In the embodiment, if specific technology or conditions are not indicated, the technology or conditions described in the literature in this area or the product instructions are used.The reagents or instruments used are not indicated by the manufacturer, and are all conventional products that can be obtained by commercial purchase.
[0065] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood to indicate or imply relative importance or implicitly specify the number of the technical features indicated. Therefore, features defined as "first" or "second" may explicitly or implicitly include one or more of such features. Furthermore, in the description of the present invention, unless otherwise specified, "plurality" means two or more.
[0066] The endpoints of the ranges and any values disclosed herein are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.
[0067] In this document, the terms “include” or “comprising” are open expressions, that is, including the contents specified in the present invention, but not excluding other contents.
[0068] As used herein, the term "methylation" refers to a form of chemical modification of DNA that can alter genetic expression without changing the DNA sequence. DNA methylation occurs when a methyl group is covalently attached to the 5th carbon position of cytosine in genomic CpG dinucleotides by the enzyme DNA methyltransferase. DNA methylation can alter chromatin structure, DNA conformation, DNA stability, and the way DNA interacts with proteins, thereby controlling gene expression.
[0069] In this article, the term "methylation level" refers to whether the cytosine in one or more CpG dinucleotides in a DNA sequence is methylated, or the frequency / ratio / percentage of methylation. It represents both a qualitative and quantitative concept. In practical applications, different detection indicators can be used to compare DNA methylation levels according to the actual situation. For example, in some cases, the comparison can be based on the Ct value of the sample test; in some cases, the ratio of gene methylation in the sample can be calculated, that is, the number of methylated molecules / (number of methylated molecules + number of unmethylated molecules) × 100, and then compared; in some cases, statistical analysis and integration of various indicators are also performed to obtain the final judgment indicator.
[0070] In this article, the term "probe" refers to an oligonucleotide sequence containing a fluorescent reporter group at the 5' end and a fluorescent quencher group at the 3' end. When the probe binds to the corresponding site on the DNA, the probe will not emit fluorescence because of the presence of a quencher group near the fluorescent group. During the amplification process, if the probe binds to the amplified chain, the 5'-3' exonuclease activity of DNA polymerase (such as Taq enzyme) will digest the probe, and the fluorescent group will be away from the quencher group, and its energy will not be absorbed, thus generating a fluorescent signal. After each PCR cycle, the fluorescent signal also has a synchronous exponential growth process, just like the target fragment.
[0071] As used herein, the term "memory" refers to any computer program product, device, and / or system (e.g., a disk, an optical disk, a memory, a programmable logic system (PLD)) for providing machine instructions and / or data to a programmable processor, including a machine-readable medium that receives machine instructions as machine-readable signals. The memory can be implemented in the form of a read-only memory (ROM), a static storage device, a dynamic storage device, or a random access memory (RAM). The memory can store operating devices and other applications. When the technical solutions provided in the embodiments of this specification are implemented through software or firmware, the relevant program code is stored in the memory and is called by the processor to execute the embodiment of the present application for diagnosing bladder cancer based on the methylation level of biomarkers in a biological sample.
[0072] In this document, a processor can be a general-purpose processor or a dedicated processor. For example, it can be a baseband processor or a central processing unit (CPU). A baseband processor can be used to process communication protocols and communication data, while a CPU can be used to control communication equipment (e.g., base stations, baseband chips, terminal devices, terminal device chips, DUs or CUs), execute computer programs, and process computer program data. The processor can be implemented in an integrated circuit (IC), analog IC, radio frequency integrated circuit (RFIC), mixed-signal IC, application-specific integrated circuit (ASIC), printed circuit board (PCB), electronic device, etc. The processor and transceiver can also be manufactured using various IC process technologies, such as complementary metal oxide semiconductor (CMOS), n-type metal oxide semiconductor (NMOS), positive channel metal oxide semiconductor (PMOS), bipolar junction transistor (BJT), bipolar CMOS (BiCMOS), silicon germanium (SiGe), gallium arsenide (GaAs), etc.
[0073] As used herein, a computer-readable storage medium can be any available medium that can be accessed by a computer, or a data storage device such as a server or data center that contains one or more available media. Available media can include magnetic media (e.g., floppy disks, hard disks, magnetic tapes), optical media (e.g., digital video discs (DVDs)), or semiconductor media (e.g., solid-state drives (SSDs)).
[0074] Below, the scheme of the present invention will be explained in conjunction with embodiment.It will be understood by those skilled in the art that the following examples are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention.In the embodiment, if specific technology or conditions are not indicated, the technology or conditions described in the literature in this area or the product instructions are used.The reagents or instruments used are not indicated by the manufacturer, and are all conventional products that can be obtained by commercial purchase.
[0075] Example 1
[0076] In this example, the methylation level of bladder cancer urine sediment cells was detected according to the following method:
[0077] 1. Urine sample collection
[0078] Urine samples were collected from 40 patients with bladder cancer confirmed by pathological examination and 40 patients without bladder cancer undergoing routine physical examinations in a hospital in Shanghai. The collection volume of each urine sample was above 10 mL. The collection process of all samples was approved by the ethics committee, and all volunteers signed informed consent forms. All samples were anonymized.
[0079] 2. DNA extraction from urine samples
[0080] Urine DNA was extracted using the nucleic acid extraction reagent (Shanghai Ruiyi Biotechnology Co., Ltd., Shanghai Minjibei 20230565) as follows:
[0081] (1) Add 30 μL of lysis buffer C solution, 2 mL of urine, and 100 μL of lysis buffer B to a clean centrifuge tube in sequence, place it on a constant temperature mixer at 60°C and 1200 rpm and shake for 20 minutes. After incubation, place the centrifuge tube in an ice bath for 5-10 minutes.
[0082] (2) During the incubation process, prepare the lysis buffer / magnetic bead mixture according to the table below and mix well.
[0083] Table 1 Reaction system
[0084] Reagent volume Lysis buffer A 2 mL Isopropanol 0.5 mL Magnetic beads 30 μL Total volume 2.53 mL
[0085] (3) Add the lysate / magnetic bead mixture prepared in step (2) to the sample tube in step (1). Vortex for 1 minute, then mix by inverting or using a blender for 5-10 minutes to keep the magnetic beads suspended.
[0086] (4) Place the centrifuge tube on a magnetic rack and let it stand until the magnetic beads are adsorbed on the magnetic rack and the solution in the tube becomes clear. Then flip the centrifuge tube to rinse the remaining magnetic beads on the bottle cap. Let it stand for about 1 minute and then discard the solution.
[0087] (5) Add 1 mL of washing buffer A to the centrifuge tube (please check whether anhydrous ethanol has been added before use), shake and mix thoroughly, and then transfer the suspension to a new 1.5 mL centrifuge tube.
[0088] (6) Place the centrifuge tube on a magnetic rack and let it stand for 1 minute, then discard the solution.
[0089] (7) Add 1 mL of wash buffer A to the centrifuge tube (please check whether anhydrous ethanol has been added before use), vortex for 5 seconds, and place on a constant temperature mixer at 25°C and 1500 rpm for 2 minutes.
[0090] (8) Place the centrifuge tube on a magnetic rack and let it stand for 1 minute, then discard the solution.
[0091] (9) Add 1 mL of wash buffer B to the centrifuge tube (please check whether anhydrous ethanol has been added before use), vortex for 5 seconds, and place on a constant temperature mixer at 25°C and 1500 rpm for 2 minutes.
[0092] (10) Place the centrifuge tube on a magnetic rack and let it stand for 1 minute, then discard the solution.
[0093] (11) Repeat steps (9) and (10).
[0094] (12) After a brief centrifugation, re-fix the tube on the magnetic rack and use a pipette to remove the solution at the bottom of the tube. Open the lid and leave it at room temperature for 5-10 minutes to allow the ethanol to evaporate completely (observe with the naked eye that the surface of the magnetic beads becomes matte and the beads are not dry and cracked).
[0095] (13) Add 50 μL of sample eluent to the centrifuge tube and vortex to fully suspend the magnetic beads in the eluent. Then place the centrifuge tube on a constant temperature mixer at 25°C and 1500 rpm for 10 minutes.
[0096] (14) Fix the centrifuge tube on the magnetic rack and let it stand for 2 minutes. After the magnetic beads are completely adsorbed on the side wall of the centrifuge tube, use a pipette to transfer the eluate to a new centrifuge tube to obtain the DNA solution.
[0097] 3. Urine DNA sulfite conversion
[0098] The DNA solution obtained in step 2 above was subjected to sulfite conversion using the EZ-96 DNA Methylation-lightning MagPrep Kit (Cat. No. D5047) produced by ZYMO Research to obtain sulfite-converted DNA. The specific steps are as follows.
[0099] (1) Add 130 μL of CT Conversion Reagent to the 20 μL urine DNA solution extracted above, mix well, and centrifuge.
[0100] (2) Carry out the conversion reaction according to the conversion conditions in the following table:
[0101] Table 2 Reaction procedure
[0102] 98℃10min54℃1h
[0103] (3) First add 600µL of M-Binding Buffer and 10µL of MagBinding (magnetic beads) into the centrifuge tube and mix by inverting.
[0104] (4) Transfer the transformed sample in step (2) to a centrifuge tube containing M-Binding Buffer and magnetic beads, shake and mix thoroughly, and incubate at room temperature for 5-10 minutes. During this period, invert or shake every 2-3 minutes to mix thoroughly to keep the magnetic beads in suspension.
[0105] (5) After incubation, centrifuge at low speed and place the centrifuge tube on a magnetic stand for magnetic separation for 3 minutes, then carefully remove the supernatant.
[0106] (6) Remove the centrifuge tube from the magnetic rack, add 400µL M-Washing Buffer, shake to resuspend the magnetic beads, centrifuge briefly at low speed, place the centrifuge tube on the magnetic rack for magnetic separation for 3 minutes, and carefully remove the supernatant.
[0107] (7) Remove the centrifuge tube from the magnetic stand, add 200 µL of L-Desulphonation Buffer, resuspend the magnetic beads by shaking, and incubate at room temperature for 20 min. During this period, shake or oscillate every 5 min to keep the magnetic beads suspended.
[0108] (8) Turn on the constant temperature shaking incubator, set the temperature to 55°C, and do not shake.
[0109] (9) After step (7) incubation is completed, centrifuge briefly, place the centrifuge tube on a magnetic stand for magnetic separation for 3 minutes, and carefully remove the supernatant.
[0110] (10) Remove the centrifuge tube, add 400µL M-Washing Buffer, shake to resuspend the magnetic beads, centrifuge briefly at low speed, place the centrifuge tube on a magnetic stand for magnetic separation for 3 minutes, and carefully remove the supernatant.
[0111] (11) Repeat step (10) once.
[0112] (12) After discarding the supernatant, centrifuge again and place the centrifuge tube on a magnetic rack to remove as much residual liquid as possible without sucking up the magnetic beads.
[0113] (13) After opening the centrifuge tube, place it in a 55°C constant temperature oscillating incubator to dry. The drying standard is that the color of the magnetic beads can be observed to change from bright black to reddish brown.
[0114] (14) After drying, add 50 μL of elution buffer, resuspend the magnetic beads, and place them in a 55°C constant temperature shaking incubator at 1500 rpm for 4 minutes. After completion, place them on a magnetic stand for magnetic separation, and transfer the supernatant containing DNA to a new centrifuge tube to obtain sulfite-converted DNA for subsequent detection.
[0115] 4. qPCR detection
[0116] (1) Primer and probe information
[0117] The sequences of the Twist1 gene detection primers and probes, the ZNF101 gene detection primers and probes, and the internal reference gene ACTB detection primers and probes are shown in Table 3. The Twist1 gene detection primers and probes can be used to specifically amplify the methylation sites of the target region of the Twist1 gene, where the target region is the negative strand Chr7:19117910-19118035 using GRCh38.p14 as the reference genome, and the methylation sites are Chr7:19117910, Chr7:19117913, Chr7:19117918, Chr7:19117920, Chr7:19117925, Chr7:19117973, Chr7:19117987, Chr7:19118012, and Chr7:19118028. ZNF101 gene detection primers and probes can be used to specifically amplify the methylation sites of the target region of the ZNF101 gene, where the target region is the positive strand Chr19:19670694-19670850 with GRCh38.p14 as the reference genome, and the methylation sites are Chr19:19670699, Chr19:19670714, Chr19:19670729, Chr19:19670833 and Chr19:19670843.
[0118] Table 3 Primer and probe sequence information
[0119]
[0120] Note: The double-underlined CG positions in the above primer and probe sequences are the methylation sites detected for Twist1 and ZNF101 genes.
[0121] (2) Perform methylation quantitative PCR on the sulfite-converted DNA obtained in step 3 using the primers and probes in the above kit.
[0122] 1) In this example, single-tube multiplex detection of the Twist1, ZNF101, and ACTB genes in the same sample was performed. Specifically, in addition to the necessary reaction components and template, primer pairs and probes for all target genes and internal reference genes were added to a single PCR tube. The PCR reaction setup was as shown in Table 1-2, and PCR amplification was performed according to the amplification protocol shown in Table 1-3. A premix of PCR primers and probes for the three genes was prepared. The premix included: 0.1 μM Twist1 gene detection probe, 0.3 μM Twist1 gene forward primer, 0.3 μM Twist1 gene reverse primer; 0.1 μM ZNF101 gene detection probe, 0.3 μM ZNF101 gene forward primer, 0.3 μM ZNF101 gene reverse primer; and 0.1 μM ACTB gene detection probe, 0.3 μM ACTB gene forward primer, and 0.3 μM ACTB gene reverse primer.
[0123] 2) The PCR reaction system is shown in Table 4.
[0124] Table 4 Reaction system
[0125]
[0126] 3) The PCR amplification procedure is shown in Table 5.
[0127] Table 5 PCR amplification program
[0128] 4) The prepared reaction system was amplified using an ABI7500 instrument.
[0129] 5) PCR analysis:
[0130] a. Baseline and threshold line adjustment:
[0131] After PCR is completed, the baseline is adjusted for each gene individually. The fluorescence value 1-2 cycles before the minimum Ct value of the sample in a PCR is set as the baseline value. The threshold is set at the inflection point of the S-shaped amplification curve to obtain the Ct value of each gene in the sample.
[0132] b. Sample validity confirmation:
[0133] ① The VIC channel amplification curve of the internal reference gene ACTB must be S-shaped and the Ct value must be ≤35, and the sample is valid;
[0134] ② If the VIC channel amplification curve of the internal reference gene ACTB is S-shaped, the Ct value is greater than 35, or there is no amplification curve, the sample is invalid.
[0135] c. Confirmation of target gene methylation:
[0136] ① When the amplification curve of the Twist1 gene FAM channel is S-shaped and the Ct value is ≤37, the sample is considered to be Twist1 gene methylation positive; when the Ct value is greater than 37 or there is no amplification curve, the sample is considered to be Twist1 gene methylation negative;
[0137] ② When the amplification curve of the ZNF101 gene FAM channel is S-shaped and the Ct value is ≤38, the sample is considered to be ZNF101 gene methylation positive; when the Ct value is greater than 38 or there is no amplification curve, the sample is considered to be ZNF101 gene methylation negative;
[0138] 6) Under the premise that the sample is valid, interpret its test results:
[0139] ① When at least one of the Twist1 gene and the ZNF101 gene of the sample to be tested is methylated positive, the sample is diagnosed as a bladder cancer positive sample;
[0140] ② When both the Twist1 gene and the ZNF101 gene of the sample to be tested are methylation-negative, the sample is diagnosed as a bladder cancer-negative sample.
[0141] 5. Sample test results
[0142] (1) A total of 80 samples were tested and analyzed using Twist1 gene and ZNF101 gene alone as biomarkers, and Twist1 and ZNF101 genes combined as biomarkers.
[0143] (2) The test results are shown in Figures 1, 2 and Table 6. When the Twist1 gene is used alone as a biomarker, its sensitivity for detecting bladder cancer is 87.5%, its specificity is 95%, and its area under the receiver operating characteristic curve is 0.955. When the ZNF101 gene is used alone as a biomarker, its sensitivity for detecting bladder cancer is 82.5%, its specificity is 92.5%, and its area under the receiver operating characteristic curve is 0.926. When the Twist1 and ZNF101 genes are used together as biomarkers, their sensitivity for detecting bladder cancer is 95%, and their specificity is 92.5%.
[0144] Note: Sensitivity (True Positive Rate) = Number of True Positives / (Number of True Positives + Number of False Negatives) * 100%. This refers to the degree of accurate diagnosis of patients, that is, the percentage of patients who are actually diagnosed with the disease.
[0145] Specificity (true negative rate) = number of true negatives / (number of true negatives + number of false positives) * 100%. This refers to the degree to which non-disease patients are correctly identified, that is, the percentage of patients who are actually disease-free but are correctly diagnosed as disease-free.
[0146] From the above results, it can be seen that when Twist1 and ZNF101 genes are used together as biomarkers for detection, the detection rate of bladder cancer can be significantly improved while maintaining high specificity. Therefore, the performance of dual-gene combined detection is better than that of single-gene detection.
[0147] The detection method provided by the present invention not only has the advantages of high sensitivity and strong specificity, but is also simple, fast, low-cost, and non-invasive. Even when tested in a small sample volume of 2 mL, high sensitivity and specificity can still be achieved. Therefore, it has great application value in the early screening and diagnosis of bladder cancer.
[0148] Table 6 Test results of 80 samples
[0149]
[0150]
[0151]
[0152]
[0153] Note: "Undetermined" means there is no amplification curve for the target gene, no Ct value calculation is performed, and the methylation test result of the target gene is negative.
[0154] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.
Claims
1. Use of a reagent for detecting a biomarker in preparing a detection product, characterized in that: The detection product is used to diagnose bladder cancer; The biomarkers include methylation sites in the target region of the Twist1 gene and methylation sites in the target region of the ZNF101 gene; Taking GRCh38.p14 as the reference genome, the target region of the Twist1 gene was selected from the negative chain Chr7: 19117910-19118035, and the target region of the ZNF101 gene was selected from the positive chain Chr19: 19670694-19670850; The reagents for detecting biomarkers include a primer set and a probe set; The primer set includes: a first primer set, wherein the nucleotide sequences of the primers in the first primer set are shown in SEQ ID NOs: 1 and 2, respectively; a second primer set, wherein the nucleotide sequences of the primers in the second primer set are shown in SEQ ID NOs: 4 and 5, respectively; The probe set includes: A first probe, the nucleotide sequence of which is shown in SEQ ID NO: 3; a second probe, the nucleotide sequence of which is shown in SEQ ID NO: 6; The 5' end of the first probe is labeled with a FAM fluorescent reporter group, and the 3' end is labeled with an MGB fluorescent quencher group; The 5' end of the second probe is labeled with a ROX fluorescent reporter group, and the 3' end is labeled with an MGB fluorescent quencher group.
2. The use according to claim 1, characterized in that The detection products include test kits, test strips or chips.
3. A primer set and a probe set, characterized in that: The primer set and probe set are used to detect biomarkers, and the biomarkers include methylation sites in the target region of the Twist1 gene and methylation sites in the target region of the ZNF101 gene; Taking GRCh38.p14 as the reference genome, the target region of the Twist1 gene was selected from the negative chain Chr7: 19117910-19118035, and the target region of the ZNF101 gene was selected from the positive chain Chr19: 19670694-19670850; The primer set includes: a first primer set, wherein the nucleotide sequences of the primers in the first primer set are shown in SEQ ID NOs: 1 and 2, respectively; a second primer set, wherein the nucleotide sequences of the primers in the second primer set are shown in SEQ ID NOs: 4 and 5, respectively; The probe set includes: A first probe, the nucleotide sequence of which is shown in SEQ ID NO: 3; a second probe, the nucleotide sequence of which is shown in SEQ ID NO: 6; The 5' end of the first probe is labeled with a FAM fluorescent reporter group, and the 3' end is labeled with an MGB fluorescent quencher group; The 5' end of the second probe is labeled with a ROX fluorescent reporter group, and the 3' end is labeled with an MGB fluorescent quencher group.
4. A kit, characterized in that The kit is used to detect biomarkers, which include methylation sites in the target region of the Twist1 gene and methylation sites in the target region of the ZNF101 gene; Taking GRCh38.p14 as the reference genome, the target region of the Twist1 gene was selected from the negative chain Chr7: 19117910-19118035, and the target region of the ZNF101 gene was selected from the positive chain Chr19: 19670694-19670850; The kit comprises the primer set and probe set according to claim 3.
5. The kit according to claim 4, characterized in that The kit further comprises at least one of the following: a sample collection container, a nucleic acid extraction reagent, a methylation conversion reagent, a fluorescent quantitative PCR detection reagent, a primer for detecting the ACTB gene, and a probe for detecting the ACTB gene.
6. The kit according to claim 5, characterized in that The sample collection container has a capacity of 1 to 10 mL; The 5' end of the probe for detecting the ACTB gene is labeled with a VIC fluorescent reporter group, and the 3' end is labeled with an MGB fluorescent quencher group.
Citation Information
Patent Citations
Marker for predicting stomach cancer prognosis and method for predicting stomach cancer prognosis
CN103459597A
Human TWIST1 / Vimentin gene methylation detection marker and kit
CN105274100A
Novel gene diagnosis kit for bladder cancer and application of novel gene diagnosis kit
CN110283914A
Bladder cancer maker set and application thereof
CN110343762A
Primer group, probe group, kit and method for detecting methylation level of bladder cancer biomarker
CN117757947A