Crispr / CAS9 based treatment for protein mutations associated with multisystem proteinopathy

The CRISPR/Cas endonuclease system with guide RNA corrects heterozygous mutations by inducing double strand breaks for homology-directed repair, addressing inefficiencies and costs associated with exogenous templates, effectively treating diseases like inclusion body myopathy and frontotemporal dementia.

WO2025179278A1PCT designated stage Publication Date: 2025-08-28RES INST AT NATIONWIDE CHILDRENS HOSPITAL +4
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/017055
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-02-22
Filing Date
2025-02-24
Publication Date
2025-08-28

AI Technical Summary

Technical Problem

Existing CRISPR/Cas systems for correcting heterozygous mutations require exogenous DNA templates, which can cause cell death, loss of regenerative potential, and low editing efficiency, adding manufacturing and financial burdens.

Method used

A method using a CRISPR/Cas endonuclease system with a guide RNA that induces a double strand break in a mutant allele, initiating homology-directed repair without an exogenous DNA template, and generating a homozygous wild-type cell.

Benefits of technology

This approach efficiently corrects heterozygous mutations in various diseases, including inclusion body myopathy and frontotemporal dementia, by generating stable homozygous wild-type cells without the drawbacks of exogenous templates, enhancing editing efficiency and reducing costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000036_0001
    Figure IMGF000036_0001
  • Figure 00000066_0000
    Figure 00000066_0000
  • Figure 00000066_0001
    Figure 00000066_0001
Patent Text Reader

Abstract

The present disclosure relates methods of using CRISPR / Cas systems to repair heterozygous mutations using an endogenous DNA template.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Docket No.10935-034WO1 CRISPR / CAS9 BASED TREATMENT FOR PROTEIN MUTATIONS ASSOCIATED WITH MULTISYSTEM PROTEINOPATHY CROSS-REFERENCE TO RELATED APPLICATION This PCT application claims priority to, and the benefit of, U.S. Provisional Patent Application No. 63 / 556,443, filed February 22nd, 2024, entitled “CRISPR / CAS9 BASED TREATMENT FOR VCP VALOSIN-CONTAINING PROTEIN MUTATIONS ASSOCIATED WITH MULTISYSTEM PROTEINOPATHY,” which is incorporated by reference herein in its entirety. REFERENCE TO SEQUENCE LISTING The sequence listing submitted on February 24th, 2025, as an .XML file entitled “10935- 034WO1_ST26” created on February 20th, 2025, and having a file size of 168,457 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5). FIELD The present disclosure relates methods of using CRISPR / Cas systems to repair heterozygous mutations using an endogenous DNA template. BACKGROUND Heterozygous mutations are the type of mutations that affect either single allele in an autosomal dominant inheritance, or both alleles in a biallelic autosomal recessive inheritance. These mutations can be corrected by using CRISPR via homology-directed repair (HDR) using an exogenous DNA template. Introducing exogenous HDR templates into the cells via electroporation, infection, lipofection or by viral delivery approaches can cause cell death, loss of regenerative potential and low editing efficiency and adds additional manufacturing and financial burdens. Therefore, there is a need to develop a novel approach to edit heterozygous mutations independent of an exogenous DNA donor template. SUMMARY The present disclosure provides methods of treating, preventing, ameliorating, repairing, correcting, reversing, or amending a heterozygous and / or a homozygous mutation, which causes a disease in a subject. Docket No.10935-034WO1 In some aspects, disclosed herein is a method of treating a subject with a disease caused by a heterozygous mutation, the method comprising obtaining a sample from the subject, isolating a cell from the sample, wherein the cell comprises the heterozygous mutation, introducing to the cell a CRISPR / Cas endonuclease system comprising a guide RNA (gRNA), wherein the gRNA induces a double strand break (DSB) in a mutant allele, initiates correction of the heterozygous mutation, and generates a homozygous wild-type cell, isolating one or more nucleic acids from the homozygous wild-type cell, sequencing the one or more nucleic acids to confirm correction of the heterozygous mutation, expanding the homozygous wild-type cell, and administering to the subject a pharmaceutically effective amount of a therapeutic composition comprising the one or more nucleic acids or the homozygous wild-type cell. In some aspects, disclosed herein is a method of repairing a heterozygous mutation in a nucleic acid sequence, the method comprising introducing into a cell a CRISPR / Cas endonuclease system comprising a guide RNA (gRNA), wherein the cell comprises the heterozygous mutation, and wherein the gRNA induces a double strand break (DSB) in a mutant allele, initiates repair of the heterozygous mutation, and generates a homozygous wild-type cell, isolating one or more nucleic acids from the homozygous wild-type cell, and sequencing the one or more nucleic acids to confirm repair of the heterozygous mutation. In some embodiments, the method of any preceding aspect further comprises correcting the heterozygous mutation without an exogenous DNA template. In some embodiments, the method of any preceding aspect further comprises a wild-type allele serving as an endogenous DNA template. In some embodiments, the method of any preceding aspect comprises the gRNA comprising one or more mutated nucleotides located within a protospacer adjacent motif (PAM) sequence. In some embodiments, the method of any preceding aspect comprises the gRNA comprising one or more mutated nucleotides located at least one nucleotide away from the PAM sequence (for example, the one or more mutated nucleotides are located 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides away from the PAM sequence). In some embodiments, the method of any preceding aspect comprises the CRISPR / Cas endonuclease system being introduced into a cell using a delivery method including, but not limited to an adeno-associated viral (AAV) vector or a nanoparticle. In some embodiments, the method of any preceding aspect comprises the DSB inducing homology-directed repair (HDR) of the heterozygous mutation. In some embodiments, the method further comprises introducing an HDR enhancer (including, but not limited to AZD7648 and / or IDT HDR enhancer version 2 (v2), or a variant Docket No.10935-034WO1 thereof) into the cell. In some embodiments, the method further comprises the disease including, but not limited to inclusion body myopathy, Paget disease, frontotemporal dementia, an encephalopathy, Charcot-Marie-Tooth disease, severe combined immunodeficiency (SCID), cystic fibrosis, Hutchinson-Gilford progeria syndrome, Nemaline myopathy, delayed developmental milestones, respiratory disorders, dilated cardiomyopathy, or a combination thereof. In some embodiments, the disease is inclusion body myopathy with early onset Paget disease and frontotemportal dementia (IBMPFD) comprising a heterozygous mutation in a Valosin Containing Protein (VCP) gene (such as, for example the VCP gene contains a substitution Arg155His mutation). In some embodiments, treating the IBMPFD comprises a gRNA comprising SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, or SEQ ID NO: 49 targets the substitution Arg155His mutation. In some embodiments, the disease is an early onset encephalopathy comprising a heterozygous mutation in a tubulin folding cofactor D (TBCD) gene (such as, for example the TBCD gene comprises a deletion mutation at nucleotide positions 2305-2307 and substitution Gly2991Ala mutation). In some embodiments, treating the early onset encephalopathy comprises a gRNA comprising SEQ ID NO: 83, SEQ ID NO: 84, or SEQ ID NO: 85 targets the deletion mutation at nucleotide positions 2305-2307. In some embodiments, treating the early onset encephalopathy comprises a gRNA comprising SEQ ID NO: 90 targets the substitution Gly2991Ala mutation. In some embodiments, the disease is Charot-Marie-Tooth disease and / or severe combined immunodeficiency disease (SCID) comprising a heterozygous mutation in an inositol 1,4,5 triphosphate receptor 3 (ITPR3) gene (such as, for example the heterozygous mutation in the ITPR3 gene comprises substitution Arg2524Cys mutation). In some embodiments, treating Charot-Marie-Tooth disease and / or SCID comprises a gRNA comprising SEQ ID NO: 95 targets the substitution Arg2524Cys mutation. In some embodiments, the disease is cystic fibrosis comprising a heterozygous mutation in a cystic fibrosis transmembrane conductance regulator (CFTR) gene (such as, for example the heterozygous mutation in the CFTR gene comprises a deletion mutation at nucleotide positions 1521-1523). In some embodiments, treating cystic fibrosis comprises a gRNA comprises SEQ ID NO: 100 or SEQ ID NO: 101 targets the deletion mutation at nucleotide positions 1521-1523. In some embodiments, the disease is Hutchinson-Gilford progeria syndrome comprising a heterozygous mutation in a laminin (LMNA) gene (such as, for example the heterozygous mutation in the LMNA gene comprises a dominant-negative C•G-to-T•A mutation). In some embodiments, Docket No.10935-034WO1 treating Hutchinson-Gilford progeria comprises a gRNA comprising SEQ ID NO: 106 and SEQ ID NO: 107 targets the dominant-negative C•G-to-T•A mutation. In some embodiments, the disease is a skeletal muscle myopathy. In some embodiments, the disease comprises a heterozygous mutation in an alpha-actin (α-ACTN) gene. In some embodiments, the heterozygous mutation comprises a substitution H40Y mutation. In some embodiments, a gRNA comprising CGTGGGCCGCCCCCGATACC, GGCTATGGTCCAGTCCGACG, GCTATGGTCCAGTCCGACGG, CTATGGTCCAGTCCGACGGG, or TATGGTCCAGTCCGACGGGG targets the substitution H40Y mutation. In some embodiments, the method of any preceding aspect comprises therapeutic composition includes, but is not limited to an adeno-associated viral (AAV) vector, a nanoparticle, an extracellular vesicle, a cell, or a combination thereof. In some embodiments, the one or more nucleic acids are sequenced using a sequencing modality including, but not limited to Sanger sequencing, Next-generation sequencing (NGS) Deep sequencing, or a variant thereof. In some embodiments, the subject is further administered an additional therapeutic agent. In some embodiments, the method prevents the disease when the subject is treated prior to the onset of symptoms. In some embodiments, the method of any preceding aspect is performed ex- vivo or in vitro. In some aspects, disclosed herein is a method of generating a homozygous mutation in a nucleic acid sequence, the method comprising isolating a cell from a sample, introducing into the cell to a CRISPR / Cas endonuclease system comprising a guide RNA (gRNA), wherein the nucleic acid sequence comprises a first heterozygous mutation in a first allele, and wherein the gRNA induces a double strand break (DSB) in a wild-type allele, initiates synthesis of a second heterozygous mutation in a second allele, and generates a homozygous mutant nucleic acid, and sequencing the nucleic acid to confirm generation of the homozygous mutant nucleic acid. In some embodiments, the method of any preceding aspect further comprises generating the homozygous mutant without an exogenous DNA template. In some embodiments, the method of any preceding aspect comprises a mutant allele serving as an endogenous DNA template. In some embodiments, the method of any preceding aspect comprises the gRNA comprising one or more mutated nucleotides located within a protospacer adjacent motif (PAM) sequence. In some embodiments, the method of any preceding aspect comprises the gRNA comprising one or more mutated nucleotides located at least one nucleotide away from the PAM sequence (for example, the one or more mutated nucleotides are located 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides away from the PAM sequence). Docket No.10935-034WO1 In some embodiments, the method of any preceding aspect comprises the CRISPR / Cas endonuclease system is introduced into a cell using a delivery method including, but not limited to an adeno-associated viral (AAV) vector or a nanoparticle. In some embodiments, the method of any preceding aspect comprises the DSB inducing homology-directed repair (HDR) of the heterozygous mutation. In some embodiments, the method of any preceding aspect further comprises introducing an HDR enhancer (including, but not limited to AZD7648 and / or IDT HDR enhancer version 2 (v2), or a variant thereof) into the cell. In some embodiments, the method of any preceding aspect comprises the one or more nucleic acids being sequenced using a sequencing modality including, but not limited to Sanger sequencing, Next-generation sequencing (NGS) Deep sequencing, or a variant thereof. In some embodiments, the method of any preceding aspect comprises a sample including, but is not limited to a tissue sample or a blood sample. In some embodiments, the method of any preceding aspect is performed ex vivo or in vivo. In some aspects, disclosed herein is a CRISPR / Cas system comprising a guide RNA (gRNA) sequence, wherein the gRNA targets a nucleic acid sequence without an exogenous DNA template, and wherein the gRNA induces a double strand break (DSB) in a first allele, initiates homology-directed repair (HDR) of the first allele, and generates a homozygous wild-type genotype. In some embodiments, the system comprises a second allele serving as an endogenous DNA template. In some embodiments, the system comprises the gRNA comprising one or more mutated nucleotides located within a protospacer adjacent motif (PAM) sequence. In some embodiments, the system comprises the gRNA comprising one or more mutated nucleotides located at least one nucleotide away from the PAM sequence (for example, the one or more mutated nucleotides are located 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides away from the PAM sequence). In some embodiments, the gRNA comprises SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 90, SEQ ID NO: 95, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 106, SEQ ID NO: 107, or a variant thereof. In some embodiments, the CRISPR / Cas endonuclease system is introduced into a cell using a delivery method including, but not limited to an adeno-associated viral (AAV) vector or a nanoparticle. BRIEF DESCRIPTION OF FIGURES Docket No.10935-034WO1 The accompanying figures, which are incorporated in and constitute a part of this specification, illustrate several aspects described below. Figures 1A, 1B, 1C, 1D, 1E, 1F, 1G, and 1H show the REMEDY results in highly efficient heterozygous mutation correction using HDR between homologous chromosomes and does not need an exogenous DNA template. Figure 1A shows a graphical representation of REMEDY. REMEDY corrected heterozygous mutations in VCP in mouse myoblasts (Figure 1B) and in human IBFMD patient derived skin fibroblasts measured by Sanger sequencing (Figure 1C). REMEDY corrected mutations in TBCD gene and the addition of HDR enhancer enhances the correction measured by Sanger sequencing (Figure 1D). NGS demonstrated similar correction rates detected by Sanger sequencing (Figures 1E and 1F). Single cell cloned REMEDY edited TBCD fibroblasts confirmed the sequencing results and showed the edits are stable after growing cells for 10 days (Figure 1G). Figure 1H shows the LAMP2 immunostaining images of untreated and REMEDY corrected heterozygous mutations in VCP patient iPSC derived myoblasts. Figures 2A, 2B, 2C, 2D, 2E, 2F, and 2G show that REMEDY corrects several heterozygous mutations in different cell types and diseases. REMEDY corrected heterozygous mutations in ITPR3 in human skin fibroblasts measured by NGS (Figures 2A and 2B); and in human airway epithelial cells with CTFR heterozygous mutation derived from a patient with cystic fibrosis (CF) (Figures 2C and 2D). REMEDY also corrected a heterozygous mutation in LMNA mutation skin fibroblasts isolated from a patient with progeria (Figures 2E and 2F). REMEDY corrected mutation in ACTA1 gene measured by Sanger sequencing (Figure 2G). Figure 3 shows the testing REMEDY in mouse cells to detect on-targets and off targets. In-PAM and near-PAM gRNA strategies (shown in Table 1) were tested in healthy mouse fibroblasts. Figure 4 shows the testing REMEDY in mouse cells to detect on-targets and off targets. In-PAM and near-PAM gRNA strategies (shown in Table 1) were tested in VCP mouse myoblasts. Figure 5 shows the testing of REMEDY in mouse cells were performed to study the on- targets and off-targets measured by Sanger sequencing and Deep sequencing. Figures 6A and 6B show the testing of allele specific gRNAs in VCP c.464G>A (p.Arg155His) patient derived human fibroblast targeting wildtype allele, VCP measured by Sanger sequencing and NGS. Figure 7 shows the testing of REMEDY in human patient derived skin fibroblast with heterozygous mutation in TBCD (P8M2). Efficiency of REMEDY studies by deep sequencing using In-PAM and near-PAM gRNAs treated with HDR enhancers. Docket No.10935-034WO1 Figure 8 also shows the testing of REMEDY in human patient derived skin fibroblast with heterozygous mutation in TBCD (P8M2). Efficiency of REMEDY studies by deep sequencing using In-PAM and near-PAM gRNAs treated with HDR enhancers. Figure 9 shows the Sanger sequencing data of the ITPR3 gene targeted in human skin fibroblasts with heterozygous mutation. Data was analyzed by ICE. Figure 10 shows that patient-derived fibroblasts carrying the R155H mutation were first used. The center panel shows achievements using Sanger sequencing. CRISPR edited VCP cells (center) show a decrease in the mutant (green) peak compared to the non-edited cells. Figure 11 shows the gRNAs designed and their specific PAM sequences. Figure 12 shows Sanger sequencing data showing the correction with gRNA 1,2,3 compared to VCP non-edited cells. Figure 13 shows the strategy tested in mouse myoblasts, the gRNAs designed, and their specific PAM sequences. Figure 14 shows that CRISPR edited myoblasts grown in culture and start forming myotubes. Figures 15A, 15B, 15C, 15D, and 15E show the visualization of Pre-Treatment and Post- Treatment Samples in IGV. While the pre-treatment sample shows only two alleles (wild-type and delGAG), the post-treatment sample exhibits replacement of most delGAG alleles, instead showing an assortment of other deletion sizes. The in-frame amino acid (AA) sequence for the gene TBCD at the position of interest is shown below (Figure 15A). Allele composition in pre- treatment and post-treatment samples. Figure 15B shows the pre-treatment sample shows a heterozygous state of the wild-type and delGAG alleles. Figure 15C shows the post-treatment, most delGAG allele reads are replaced with deletions of other sizes. Copy-Number Analysis of Chromosome 17. Blue background points show copy number calculated at a given location from post-treatment coverage depth, normalized against coverage of the pre-treatment sample. Yellow and red segments show the HiFiCNV-calculated copy state at a given position for the pre- and REMEDY treatment samples, respectively. Overlapping red and yellow segments show copy states which are consistent between both samples (Figure 15D). Figure 15E shows the loss-of- Heterozygosity Analysis of Chromosome 17. Black points show variant allele frequency called at a given position. Yellow bars show allelic spread (symmetric distance of calculated average from 0.5) for regions each representing 1% of the chromosome demonstrating that there is no detectable LOH. Figure 16 shows the testing of REMEDY in c.464G>A (p.Arg155His) patient iPSC derived myoblasts targeting mutant allele, VCP measured by NGS. Docket No.10935-034WO1 Figure 17 shows the Copy-Number Analysis of Chromosome 17. Blue background points show copy number calculated at a given location from post-treatment coverage depth, normalized against coverage of the pre-treatment sample. Yellow and red segments show the HiFiCNV- calculated copy state at a given position for the pre- and post-treatment samples, respectively. Overlapping red and yellow segments show copy states which are consistent between both samples. Figure 18 shows the Loss-of-Heterozygosity Analysis of Chromosome 12. Black points show variant allele frequency called at a given position. Yellow bars show allelic spread (symmetric distance of calculated average from 0.5) for regions each representing 1% of the chromosome. DETAILED DESCRIPTION The following description of the disclosure is provided as an enabling teaching of the disclosure in its best, currently known embodiment(s). To this end, those skilled in the relevant art will recognize and appreciate that many changes can be made to the various embodiments of the invention described herein, while still obtaining the beneficial results of the present disclosure. It will also be apparent that some of the desired benefits of the present disclosure can be obtained by selecting some of the features of the present disclosure without utilizing other features. Accordingly, those who work in the art will recognize that many modifications and adaptations to the present disclosure are possible and can even be desirable in certain circumstances and are a part of the present disclosure. Thus, the following description is provided as illustrative of the principles of the present disclosure and not in limitation thereof. Reference will now be made in detail to the embodiments of the invention, examples of which are illustrated in the drawings and the examples. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Terminology Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. The term “comprising” and variations thereof as used herein is used synonymously with the term “including” and variations thereof and are open, non-limiting terms. Although the terms “comprising” and “including” have been used herein to describe various embodiments, the terms “consisting essentially of” and “consisting of” can be used in place of “comprising” and “including” to provide for more specific embodiments and are also disclosed. As used in this Docket No.10935-034WO1 disclosure and in the appended claims, the singular forms “a”, “an”, “the”, include plural referents unless the context clearly dictates otherwise. The following definitions are provided for the full understanding of terms used in this specification. Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that when a value is disclosed that “less than or equal to” the value, “greater than or equal to the value” and possible ranges between values are also disclosed, as appropriately understood by the skilled artisan. For example, if the value “10” is disclosed the “less than or equal to 10”as well as “greater than or equal to 10” is also disclosed. It is also understood that the throughout the application, data is provided in a number of different formats, and that this data, represents endpoints and starting points, and ranges for any combination of the data points. For example, if a particular data point “10” and a particular data point 15 are disclosed, it is understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15 are considered disclosed as well as between 10 and 15. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed. “Optional” or “optionally” means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not. An "increase" can refer to any change that results in a greater amount of a symptom, disease, composition, condition, or activity. An increase can be any individual, median, or average increase in a condition, symptom, activity, composition in a statistically significant amount. Thus, the increase can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100% or more increase so long as the increase is statistically significant. A "decrease" can refer to any change that results in a smaller amount of a symptom, disease, composition, condition, or activity. A substance is also understood to decrease the genetic output of a gene when the genetic output of the gene product with the substance is less relative to Docket No.10935-034WO1 the output of the gene product without the substance. Also, for example, a decrease can be a change in the symptoms of a disorder such that the symptoms are less than previously observed. A decrease can be any individual, median, or average decrease in a condition, symptom, activity, composition in a statistically significant amount. Thus, the decrease can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100%, or more decrease so long as the decrease is statistically significant. “Composition” refers to any agent that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects, e.g., treatment of a disease, a disorder, or other undesirable physiological condition, and prophylactic effects, e.g., prevention of a disease, a disorder, or other undesirable physiological condition. The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically mentioned herein, including, but not limited to, a vector, polynucleotide, cells, salts, esters, amides, proagents, active metabolites, isomers, fragments, analogs, and the like. When the term “composition” is used, then, or when a particular composition is specifically identified, it is to be understood that the term includes the composition per se as well as pharmaceutically acceptable, pharmacologically active vector, polynucleotide, salts, esters, amides, proagents, conjugates, active metabolites, isomers, fragments, analogs, etc. A “therapeutic composition” refers to at least one substance, molecule, or compound suitable for administering to a subject, wherein the composition further includes a pharmaceutical carrier. A non-limiting example include a therapeutic composition comprises a nucleobase-poly- amino acid carrier and a sterile water-based solution. "Inhibit," "inhibiting," and "inhibition" mean to decrease an activity, response, condition, disease, or other biological parameter. This can include but is not limited to the complete ablation of the activity, response, condition, or disease. This may also include, for example, a 10% reduction in the activity, response, condition, or disease as compared to the native or control level. Thus, the reduction can be a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction below, above, or in between the given ranges as compared to native or control levels. By “reduce” or other forms of the word, such as “reducing” or “reduction,” means lowering of an event or characteristic (e.g., tumor growth). It is understood that this is typically in relation to some standard or expected value, in other words it is relative, but that it is not always necessary for the standard or relative value to be referred to. For example, “reduces tumor growth” means reducing the rate of growth of a tumor relative to a standard or a control. By “prevent” or other forms of the word, such as “preventing” or “prevention,” is meant to stop a particular event or characteristic, to stabilize or delay the development or progression of Docket No.10935-034WO1 a particular event or characteristic, or to minimize the chances that a particular event or characteristic will occur. Prevent does not require comparison to a control as it is typically more absolute than, for example, reduce. As used herein, something could be reduced but not prevented, but something that is reduced could also be prevented. Likewise, something could be prevented but not reduced, but something that is prevented could also be reduced. It is understood that where reduce or prevent are used, unless specifically indicated otherwise, the use of the other word is also expressly disclosed. The terms “treat,” “treating,” and grammatical variations thereof as used herein, include partially or completely delaying, alleviating, mitigating or reducing the intensity of one or more attendant symptoms of a disorder or condition and / or alleviating, mitigating or impeding one or more causes of a disorder or condition. Treatments according to the disclosure may be applied preventively, prophylactically, palliatively or remedially. Treatments are administered to a subject prior to onset (e.g., before obvious signs of any disease disclosed herein), during early onset (e.g., upon initial signs and symptoms of any disease disclosed herein), or after an established development of any disease disclosed herein. The term “subject” refers to any individual who is the target of administration or treatment. The subject can be a vertebrate, for example, a mammal. In one aspect, the subject can be human, non-human primate, bovine, equine, porcine, canine, or feline. The subject can also be a guinea pig, rat, hamster, rabbit, mouse, or mole. Thus, the subject can be a human or veterinary patient. The term “patient” refers to a subject under the treatment of a clinician, e.g., physician. The term “therapeutically effective amount” refers to the amount of the composition used is of sufficient quantity to ameliorate one or more causes or symptoms of a disease or disorder. Such amelioration only requires a reduction or alteration, not necessarily elimination. The term “treatment” refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder. Docket No.10935-034WO1 "Comprising" is intended to mean that the compositions, methods, etc. include the recited elements, but do not exclude others. "Consisting essentially of'' when used to define compositions and methods, shall mean including the recited elements, but excluding other elements of any essential significance to the combination. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants from the isolation and purification method and pharmaceutically acceptable carriers, such as phosphate buffered saline, preservatives, and the like. "Consisting of'' shall mean excluding more than trace elements of other ingredients and substantial method steps for administering the compositions provided and / or claimed in this disclosure. Embodiments defined by each of these transition terms are within the scope of this disclosure. The term “administer,” “administering”, or derivatives thereof refer to delivering a composition, substance, inhibitor, or medication to a subject or object by one or more the following routes: oral, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intra-joint, parenteral, intra-arteriole, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation or via an implanted reservoir. The term “parenteral” includes subcutaneous, intravenous, intramuscular, intra- articular, intra-synovial, intrasternal, intrathecal, intrahepatic, intralesional, and intracranial injections or infusion techniques. A "gene" refers to a polynucleotide containing at least one open reading frame that is capable of encoding a particular polypeptide or protein after being transcribed and translated. Any of the polynucleotides sequences described herein may be used to identify larger fragments or full-length coding sequences of the gene with which they are associated. A “chromosome” refers to a long DNA molecule comprising part or all of the genetic material of an organism. Most chromosomes comprise very long thin DNA strands coated with packaging proteins, including but not limited to histone proteins and other chaperone proteins, critical for binding and condensing the DNA strands into the tightly compacted chromosome structures. Such chromosomes are formed to maintain and preserve genetic stability and integrity. A “chromatid” refers to a complex of DNA and protein found in eukaryotic cells whose primary function is to package long DNA molecules into more compact, denser structures. This prevents the DNA strands from becoming tangled and plays additional roles in reinforcing the DNA during cell division, preventing DNA damage, and regulating gene expression and DNA replication. The primary protein components of chromatin are histone proteins comprising an octamer of two set of four histone core proteins (Histone H2A, Histone H2B, Histone H3, and Histone H4) binding to DNA and function as anchors around which the strands are wound. In Docket No.10935-034WO1 general, there are three levels of chromatin organization: 1) DNA wraps around histone proteins, forming nucleosomes also referred to as the “beads on a string” structure; 2) Multiple histones wrap into small (about 30 nanometer long) fiber comprising nucleosome arrays in the most compact form; and 3) Higher-level DNA supercoiling of the small fibers of structure 2) to form the final chromosomal structure. As used herein, an “allele” refers to one of two or more versions of a genetic sequence at a particular region on a chromosome. An individual inherits two alleles for every gene, one from each parent, that is one allele comes from the biological mother and another allele comes from the biological father, thus creating two copies of every gene. “Heterozygous” refers to having two different versions of a gene for a particular trait (such as, for example eye color, hair color, etc.), wherein each version is inherited from a parent. That is, one gene is inherited from the biological mother and a different version of the same gene is inherited from the biological father. A non-limiting example includes an individual that is heterozygous for eye color if they have both “E” and “e” alleles, wherein “E” encodes the brown eye color and “e” encodes blue eye color. “Homozygous” refers to having identical copies of the same gene for a particular trait (such as, for example eye color, hair color, etc.), wherein both copies are inherited from a parent. That is, the same version of the gene is inherited from a parent, wherein one allele is inherited from the biological mother and the same allele is inherited from the biological father. As used herein, a “mutation” refers to changing the structure of a gene, resulting in a variant form that may be transmitted to later generations. A mutation is caused by the alteration of single nucleotides in DNA, or the deletion, insertion, or rearrangement of larger sections of genes. A mutation can lead to the expression of a protein that has been changed physically or functionally leading to lethality, non-lethal dysfunction effects, or no effects. A “mutated gene” is a gene that has been altered through human intervention. Such a “mutated gene” has a sequence that differs from the sequence of the corresponding non- mutated gene by at least one nucleotide addition, deletion, or substitution. As used herein, “wild-type” refers to the genetic and physical characteristics of the typical form of a species as it occurs in nature. A wild-type or wild type characteristic is conceptualized as a product of the standard “normal” allele at a gene locus, in contrast to that produced by a non- standard “mutant” allele. As used herein a “viral vector” refers to a tool used in molecular biology to deliver genetic material (including DNA, RNA, and any other nucleic acid variations thereof) into a cell. This process is performed either inside a living organism or in cell culture. The viral genome is Docket No.10935-034WO1 engineered to incorporate a desired gene or gene product, and following transduction, or transfer, of the virus into the host, said gene or gene product is expressed within the host. A “nucleotide” is a compound consisting of a nucleoside, which consists of a nitrogenous base and a 5-carbon sugar, linked to a phosphate group forming the basic structural unit of nucleic acids, such as DNA or RNA. The four types of nucleotides are adenine (A), cytosine (C), guanine (G), and thymine (T), each of which are bound together by a phosphodiester bond to form a nucleic acid molecule. A “nucleic acid” is a chemical compound that serves as the primary information-carrying molecules in cells and make up the cellular genetic material. Nucleic acids comprise nucleotides, which are the monomers made of a 5-carbon sugar (usually ribose or deoxyribose), a phosphate group, and a nitrogenous base. A nucleic acid can also be a deoxyribonucleic acid (DNA) or a ribonucleic acid (RNA). A chimeric nucleic acid comprises two or more of the same kind of nucleic acid fused together to form one compound comprising genetic material. By the term “endogenous” it is meant a sequence or other molecule that naturally occurs in a cell or organism. In one aspect, an endogenous polynucleotide is normally found in the genome of a cell; that is, not heterologous. The terms “percent identity” and “% identity,” as applied to polynucleotide sequences, refer to the percentage of residue matches between at least two polynucleotide sequences aligned using a standardized algorithm. Such an algorithm may insert, in a standardized and reproducible way, gaps in the sequences being compared in order to optimize alignment between two sequences, and therefore achieve a more meaningful comparison of the two sequences. Percent identity for a nucleic acid sequence may be determined as understood in the art. (See, e.g., U.S. Pat. No.7,396,664, which is incorporated herein by reference in its entirety). A suite of commonly used and freely available sequence comparison algorithms is provided by the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST) (Altschul, S. F. et al. (1990) J. Mol. Biol.215:403410), which is available from several sources, including the NCBI, Bethesda, Md., at its website. The BLAST software suite includes various sequence analysis programs including “blastn,” that is used to align a known polynucleotide sequence with other polynucleotide sequences from a variety of databases. Also available is a tool called “BLAST 2 Sequences” that is used for direct pairwise comparison of two nucleotide sequences. “BLAST 2 Sequences” can be accessed and used interactively at the NCBI website. The “BLAST 2 Sequences” tool can be used for both blastn and blastp (discussed above). A “variant,” “mutant,” or “derivative” of a particular nucleic acid sequence may be defined as a nucleic acid sequence having at least 50% sequence identity to the particular nucleic acid Docket No.10935-034WO1 sequence over a certain length of one of the nucleic acid sequences using blastn with the “BLAST 2 Sequences” tool available at the National Center for Biotechnology Information's website. (See Tatiana A. Tatusova, Thomas L. Madden (1999), “Blast 2 sequences—a new tool for comparing protein and nucleotide sequences”, FEMS Microbiol Lett.174:247-250). In some embodiments a variant polynucleotide may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to a reference polynucleotide. As used herein, the term “guide polynucleotide”, relates to a polynucleotide sequence that can form a complex with a Cas endonuclease, including the Cas endonuclease described herein, and enables the Cas endonuclease to recognize, optionally bind to, and optionally cleave a DNA target site. The guide polynucleotide sequence can be a RNA sequence, a DNA sequence, or a combination thereof (a RNA-DNA combination sequence). A “pharmaceutically effective amount” of a drug necessary to achieve a therapeutic effect may vary according to factors such as the age, sex, and weight of the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily, or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. "Pharmaceutically acceptable carrier" (sometimes referred to as a “carrier”) means a carrier or excipient that is useful in preparing a pharmaceutical or therapeutic composition that is generally safe and non-toxic, and includes a carrier that is acceptable for veterinary and / or human pharmaceutical or therapeutic use. The terms "carrier" or "pharmaceutically acceptable carrier" can include, but are not limited to, phosphate buffered saline solution, water, emulsions (such as an oil / water or water / oil emulsion) and / or various types of wetting agents. As used herein, the term “carrier” encompasses any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations. The choice of a carrier for use in a composition will depend upon the intended route of administration for the composition. The preparation of pharmaceutically acceptable carriers and formulations containing these materials is described in, e.g., Remington's Pharmaceutical Sciences, 21st Edition, ed. University of the Sciences in Philadelphia, Lippincott, Williams & Wilkins, Philadelphia, PA, 2005. Examples of physiologically acceptable carriers include saline, glycerol, DMSO, buffers such as phosphate buffers, citrate buffer, and buffers with other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; Docket No.10935-034WO1 hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or nonionic surfactants such as TWEENTM(ICI, Inc.; Bridgewater, New Jersey), polyethylene glycol (PEG), and PLURONICSTM(BASF; Florham Park, NJ). To provide for the administration of such dosages for the desired therapeutic treatment, compositions disclosed herein can advantageously comprise between about 0.1% and 99% by weight of the total of one or more of the subject compounds based on the weight of the total composition including carrier or diluent. CRISPR / Cas Systems “CRISPR” (Clustered Regularly Interspaced Short Palindromic Repeats) loci refers to certain genetic loci encoding components of DNA cleavage systems, for example, used by bacterial and archaeal cells to destroy foreign DNA (Horvath and Barrangou, 2010, Science 327: 167-170; W02007025097, published 01 March 2007). A CRISPR locus can consist of a CRISPR array, comprising short direct repeats (CRISPR repeats) separated by short variable DNA sequences (called spacers), which can be flanked by diverse Cas (CRISPR-associated) genes. The term “Cas protein” refers to a polypeptide encoded by a Cas (CRISPR- associated) gene. A Cas protein includes proteins encoded by a gene in a cas locus and includes adaptation molecules as well as interference molecules. An interference molecule of a bacterial adaptive immunity complex includes endonucleases. A Cas endonuclease described herein comprises one or more nuclease domains. The present disclosure provides a Cas endonuclease including, but not limited to a Cas9 protein, a Casl2a (Cpfl) protein, a Cas12b (C2cl) protein, a Cas13a (C2c2) protein, a Cas12c (C2c3) protein, Cas3, Cas3-HD, Cas 5, Cas7, Cas8, Casl0, or any combinations or variants thereof. A Cas protein can further comprise a functional fragment or functional variant of a native Cas protein, or a protein that shares at least 30%, between 30% and 35%, at least 35%, between 35% and 40%, at least 40%, between 40% and 45%, at least 45%, between 45% and 50%, at least 50%, between 50% and 55%, at least 55%, between 55% and 60%, at least 60%, between 60% and 65%, at least 65%, between 65% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 85%, at least 85%, between 85% and 90%, at least 90%, between 90% and 95%, at least 95%, between 95% and 96%, at least 96%, between 96% and 97%, at least 97%, between 97% and 98%, at least 98%, between 98% and 99%, at least 99%, between 99% and 100%, or 100% sequence identity with at least 50, between 50 and 100, Docket No.10935-034WO1 at least 100, between 100 and 150, at least 150, between 150 and 200, at least 200, between 200 and 250, at least 250, between 250 and 300, at least 300, between 300 and 350, at least 350, between 350 and 400, at least 400, between 400 and 450, at least 500, or greater than 500 contiguous amino acids of a native Cas protein, and retains at least partial activity of the native sequence. A Cas endonuclease may also include a multifunctional Cas endonuclease. The term “multifunctional Cas endonuclease” and “multifunctional Cas endonuclease polypeptide” are used interchangeably herein and includes reference to a single polypeptide that has Cas endonuclease functionality (comprising at least one protein domain that can act as a Cas endonuclease) and at least one other functionality, such as but not limited to, the functionality to form a complex (comprises at least a second protein domain that can form a complex with other proteins). In one aspect, the multifunctional Cas endonuclease comprises at least one additional protein domain relative (either internally, upstream (5’), downstream (3’), or both internally 5’ and 3’, or any combination thereof) to those domains typical of a Cas endonuclease. In some aspects, disclosed herein is a CRISPR / Cas system comprising a guide RNA (gRNA) sequence, wherein the gRNA targets a nucleic acid sequence without an exogenous DNA template, and wherein the gRNA induces a double strand break (DSB) in a first allele, initiates homology-directed repair (HDR) of the first allele, and generates a homozygous wild-type genotype. In some embodiments, the CRISPR / Cas system comprises a Cas9 endonuclease, or a variant thereof. As used herein, the term "Cas9 protein" refers to, but is not limited to, Cas9 proteins, Cas9-type proteins encoded by Cas9 orthologs, and synthetic proteins of Cas9. The term "Cas9 protein" as used herein refers to a wild type Cas9 protein from CRISPR-Cas9 type II B systems, Cas9 protein modifications, Cas9 protein variants, Cas9 orthologs and combinations of the same. The term "dCas9" as used herein refers to Cas9 protein variants that are Cas9 proteins deactivated by nuclease, also referred to as "catalytically inactive Cas9 protein", or "enzymatically inactive Cas9". Various Cas9s and their relationship with each other can be found in Gasiunas, et al. (Gasiunas G., Young, J.K., Karvelis, T. et al. A catalogue of biochemically diverse CRISPR- Cas9 orthologs. Nat Commun 11, 55122020, hereby incorporated by reference in its entirety for its discussion concerning Cas9 molecules). In some embodiments, the Cas endonuclease is a Cas13 including, but not limited to any one of the four subtypes, Cas13a, Cas13b, Cas13c, Cas13d, or a variant thereof. In some embodiments, the system comprises a second allele serving as an endogenous DNA template. In some embodiments, the system comprises the gRNA comprising one or more Docket No.10935-034WO1 mutated nucleotides located within a protospacer adjacent motif (PAM) sequence. In some embodiments, the system comprises the gRNA comprising one or more mutated nucleotides located at least one nucleotide away from the PAM sequence (for example, the one or more mutated nucleotides are located 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides away from the PAM sequence). In some embodiments, the gRNA recognizes a target site sequence comprising the one or more mutated nucleotides, or the complementary sequence thereof. The terms “target site”, “target sequence”, “target site sequence,’’ target DNA”, “target locus”, “genomic target site”, “genomic target sequence”, “genomic target locus” and “protospacer”, are used interchangeably herein and refer to a polynucleotide sequence such as, but not limited to, a nucleotide sequence on a chromosome, episome, a locus, or any other DNA molecule in the genome (including chromosomal, chloroplastic, mitochondrial DNA, plasmid DNA) of a cell, at which a guide polynucleotide / Cas endonuclease complex can recognize, bind to, and optionally nick or cleave . The target site can be an endogenous site in the genome of a cell, or alternatively, the target site can be heterologous to the cell and thereby not be naturally occurring in the genome of the cell, or the target site can be found in a heterologous genomic location compared to where it occurs in nature. As used herein, terms “endogenous target sequence” and “native target sequence” are used interchangeable herein to refer to a target sequence that is endogenous or native to the genome of a cell and is at the endogenous or native position of that target sequence in the genome of the cell. A “protospacer adjacent motif” (PAM) herein refers to a short nucleotide sequence adjacent to a target sequence (protospacer) that is recognized (targeted) by the CRISPR / Cas endonuclease system described herein. The Cas endonuclease may not successfully recognize a target DNA sequence if the target DNA sequence is not followed by a PAM sequence. The sequence and length of a PAM herein can differ depending on the Cas protein or Cas protein complex used. The PAM sequence can be of any length including, but not limited to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleotides long. In some embodiments, the gRNA comprises SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 90, SEQ ID NO: 95, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 106, SEQ ID NO: 107, or a variant thereof. In some embodiments, the CRISPR / Cas endonuclease system is introduced into a cell using a delivery method including, but not limited to a viral vector, an extracellular vesicle, or a nanoparticle. In some embodiments, the viral vector includes, but is not limited to retroviral Docket No.10935-034WO1 vectors, adenoviral vectors, adeno-associated viral vectors, large payload viral vectors, or any variants thereof. In some embodiments, the nanoparticle of any preceding aspect is biocompatible and / or non-toxic to a subject. In some embodiments, the nanoparticle of any preceding aspect comprises a polymeric nanoparticle, a metallic nanoparticle (such as, for example gold (AU) nanoparticles), lipid nanoparticles (LNP), liposomes, and other biological nanomaterials. Retroviral Vectors A retrovirus is an animal virus belonging to the virus family of Retroviridae, including any types, subfamilies, genus, or tropisms. Retroviral vectors, in general, are described by Verma, I.M., Retroviral vectors for gene transfer. A retrovirus is essentially a package which has packed into it nucleic acid cargo. The nucleic acid cargo carries with it a packaging signal, which ensures that the replicated daughter molecules will be efficiently packaged within the package coat. In addition to the package signal, there are a number of molecules which are needed in cis, for the replication, and packaging of the replicated virus. Typically a retroviral genome, contains the gag, pol, and env genes which are involved in the making of the protein coat. It is the gag, pol, and env genes which are typically replaced by the foreign DNA that it is to be transferred to the target cell. Retrovirus vectors typically contain a packaging signal for incorporation into the package coat, a sequence which signals the start of the gag transcription unit, elements necessary for reverse transcription, including a primer binding site to bind the tRNA primer of reverse transcription, terminal repeat sequences that guide the switch of RNA strands during DNA synthesis, a purine rich sequence 5' to the 3' LTR that serve as the priming site for the synthesis of the second strand of DNA synthesis, and specific sequences near the ends of the LTRs that enable the insertion of the DNA state of the retrovirus to insert into the host genome. The removal of the gag, pol, and env genes allows for about 8 kb of foreign sequence to be inserted into the viral genome, become reverse transcribed, and upon replication be packaged into a new retroviral particle. This amount of nucleic acid is sufficient for the delivery of a one to many genes depending on the size of each transcript. It is preferable to include either positive or negative selectable markers along with other genes in the insert. Since the replication machinery and packaging proteins in most retroviral vectors have been removed (gag, pol, and env), the vectors are typically generated by placing them into a packaging cell line. A packaging cell line is a cell line which has been transfected or transformed with a retrovirus that contains the replication and packaging machinery, but lacks any packaging signal. When the vector carrying the DNA of choice is transfected into these cell lines, the vector containing the gene of interest is replicated and packaged into new retroviral particles, by the Docket No.10935-034WO1 machinery provided in cis by the helper cell. The genomes for the machinery are not packaged because they lack the necessary signals. Adenoviral Vectors The construction of replication-defective adenoviruses has been described (Berkner et al., J. Virology 61:1213-1220 (1987); Massie et al., Mol. Cell. Biol.6:2872-2883 (1986); Haj-Ahmad et al., J. Virology 57:267-274 (1986); Davidson et al., J. Virology 61:1226-1239 (1987); Zhang "Generation and identification of recombinant adenovirus by liposome-mediated transfection and PCR analysis" BioTechniques 15:868-872 (1993)). The benefit of the use of these viruses as vectors is that they are limited in the extent to which they can spread to other cell types, since they can replicate within an initial infected cell, but are unable to form new infectious viral particles. Recombinant adenoviruses have been shown to achieve high efficiency gene transfer after direct, in vivo delivery to airway epithelium, hepatocytes, vascular endothelium, CNS parenchyma and a number of other tissue sites (Morsy, J. Clin. Invest. 92:1580-1586 (1993); Kirshenbaum, J. Clin. Invest.92:381-387 (1993); Roessler, J. Clin. Invest.92:1085-1092 (1993); Moullier, Nature Genetics 4:154-159 (1993); La Salle, Science 259:988-990 (1993); Gomez-Foix, J. Biol. Chem. 267:25129-25134 (1992); Rich, Human Gene Therapy 4:461-476 (1993); Zabner, Nature Genetics 6:75-83 (1994); Guzman, Circulation Research 73:1201-1207 (1993); Bout, Human Gene Therapy 5:3-10 (1994); Zabner, Cell 75:207-216 (1993); Caillaud, Eur. J. Neuroscience 5:1287-1291 (1993); and Ragot, J. Gen. Virology 74:501-507 (1993)). Recombinant adenoviruses achieve gene transduction by binding to specific cell surface receptors, after which the virus is internalized by receptor-mediated endocytosis, in the same manner as wild type or replication-defective adenovirus (Chardonnet and Dales, Virology 40:462-477 (1970); Brown and Burlingham, J. Virology 12:386-396 (1973); Svensson and Persson, J. Virology 55:442-449 (1985); Seth, et al., J. Virol. 51:650-655 (1984); Seth, et al., Mol. Cell. Biol. 4:1528-1533 (1984); Varga et al., J. Virology 65:6061-6070 (1991); Wickham et al., Cell 73:309-319 (1993)). A viral vector can be one based on an adenovirus which has had the E1 gene removed and these virons are generated in a cell line such as the human 293 cell line. In another preferred embodiment both the E1 and E3 genes are removed from the adenovirus genome. Adeno-associated viral vectors Another type of viral vector is based on an adeno-associated virus (AAV). This defective parvovirus is a preferred vector because it can infect many cell types and is nonpathogenic to humans. AAV type vectors can transport about 4 to 5 kb and wild type AAV is known to stably insert into chromosome 19. Vectors which contain this site specific integration property are preferred. An especially preferred embodiment of this type of vector is the P4.1 C vector produced Docket No.10935-034WO1 by Avigen, San Francisco, CA, which can contain the herpes simplex virus thymidine kinase gene, HSV-tk, and / or a marker gene, such as the gene encoding the green fluorescent protein, GFP. In another type of AAV virus, the AAV contains a pair of inverted terminal repeats (ITRs) which flank at least one cassette containing a promoter which directs cell-specific expression operably linked to a heterologous gene. Heterologous in this context refers to any nucleotide sequence or gene which is not native to the AAV or B19 parvovirus. Typically the AAV and B19 coding regions have been deleted, resulting in a safe, noncytotoxic vector. The AAV ITRs, or modifications thereof, confer infectivity and site-specific integration, but not cytotoxicity, and the promoter directs cell-specific expression. United states Patent No.6,261,834 is herein incorporated by reference for material related to the AAV vector. Large payload viral vectors Molecular genetic experiments with large human herpesviruses have provided a means whereby large heterologous DNA fragments can be cloned, propagated and established in cells permissive for infection with herpesviruses (Sun et al., Nature genetics 8: 33-41, 1994; Cotter and Robertson,.Curr Opin Mol Ther 5: 633-644, 1999). These large DNA viruses (herpes simplex virus (HSV) and Epstein-Barr virus (EBV), have the potential to deliver fragments of human heterologous DNA > 150 kb to specific cells. EBV recombinants can maintain large pieces of DNA in the infected B-cells as episomal DNA. Individual clones carried human genomic inserts up to 330 kb appeared genetically stable The maintenance of these episomes requires a specific EBV nuclear protein, EBNA1, constitutively expressed during infection with EBV. Additionally, these vectors can be used for transfection, where large amounts of protein can be generated transiently in vitro. Herpesvirus amplicon systems are also being used to package pieces of DNA > 220 kb and to infect cells that can stably maintain DNA as episomes. Other useful systems include, for example, replicating and host-restricted non-replicating vaccinia virus vectors. Methods of treating and / or repairing disease causing heterozygous mutations The present disclosure provides methods of treating, preventing, ameliorating, repairing, correcting, reversing, or amending a heterozygous mutation, which causes a disease in a subject. In some aspects, disclosed herein is a method of treating a subject with a disease caused by a heterozygous mutation, the method comprising obtaining a sample from the subject, isolating a cell from the sample, wherein the cell comprises the heterozygous mutation, introducing to the cell the CRISPR / Cas endonuclease system of any preceding aspect, wherein the CRISPR / Cas endonuclease system comprises a guide RNA (gRNA), wherein the gRNA induces a double strand Docket No.10935-034WO1 break (DSB) in a mutant allele, initiates correction of the heterozygous mutation, and generates a homozygous wild-type cell, isolating one or more nucleic acids from the homozygous wild-type cell, sequencing the one or more nucleic acids to confirm correction of the heterozygous mutation, expanding the homozygous wild-type cell, and administering to the subject a pharmaceutically effective amount of a therapeutic composition comprising the one or more nucleic acids or the homozygous wild-type cell. In some aspects, disclosed herein is a method of repairing a heterozygous mutation in a nucleic acid sequence, the method comprising introducing into a cell the CRISPR / Cas endonuclease system of any preceding aspect, wherein the CRISPR / Cas endonuclease system comprises a guide RNA (gRNA), wherein the cell comprises the heterozygous mutation, and wherein the gRNA induces a double strand break (DSB) in a mutant allele, initiates repair of the heterozygous mutation, and generates a homozygous wild-type cell, isolating one or more nucleic acids from the homozygous wild-type cell, and sequencing the one or more nucleic acids to confirm repair of the heterozygous mutation. In some embodiments, the method of any preceding aspect further comprises correcting the heterozygous mutation without an exogenous DNA template. In some embodiments, the method of any preceding aspect further comprises a wild-type allele serving as an endogenous DNA template. In some embodiments, the method of any preceding aspect comprises the gRNA comprising one or more mutated nucleotides located within a protospacer adjacent motif (PAM) sequence. In some embodiments, the method of any preceding aspect comprises the gRNA comprising one or more mutated nucleotides located at least one nucleotide away from the PAM sequence (for example, the one or more mutated nucleotides are located 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides away from the PAM sequence). In some embodiments, the method of any preceding aspect comprises the CRISPR / Cas endonuclease system being introduced into a cell using a delivery method including, but not limited to the viral vectors, nanoparticles, or extracellular vesicles of any preceding aspect. In some embodiments, the method of any preceding aspect comprises the DSB inducing homology- directed repair (HDR) of the heterozygous mutation. In some embodiments, the method further comprises introducing an HDR enhancer (including, but not limited to AZD7648 and / or IDT HDR enhancer version 2 (v2), or a variant thereof) into the cell. In some embodiments, the method further comprises the disease including, but not limited to inclusion body myopathy, Paget disease, frontotemporal dementia, an encephalopathy, Charcot- Docket No.10935-034WO1 Marie-Tooth disease, severe combined immunodeficiency (SCID), cystic fibrosis, Hutchinson- Gilford progeria syndrome, Neurofibromatosis type-1, familial hypercholesterolemia (FH), Tay- Sachs disease, Phenylketonuria (PKU), sickle cell anemia, hereditary hemochromatosis, Marfan syndrome, polycytic kidney disease, late onset glycogen storage disease type 2, Ehlers-Danlos syndromes (EDS), Williams-Beuren syndrome, microcephaly, myoclonus epilepsy, Wilson’s disease, Galaktokinase deficiency, Homocystinuria, recessive myotonia, ataxia-teleangiectasia, Nemaline myopathy, delayed developmental milestones, respiratory disorders, and dilated cardiomyopathy, or a combination thereof or a combination thereof. In some embodiments, the disease is inclusion body myopathy with early onset Paget disease and frontotemportal dementia (IBMPFD) comprising a heterozygous mutation in a Valosin Containing Protein (VCP) gene (such as, for example the VCP gene contains a substitution Arg155His mutation). In some embodiments, treating the IBMPFD comprises a gRNA comprising SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, or SEQ ID NO: 49 targets the substitution Arg155His mutation. In some embodiments, the disease is an early onset encephalopathy comprising a heterozygous mutation in a tubulin folding cofactor D (TBCD) gene (such as, for example the TBCD gene comprises a deletion mutation at nucleotide positions 2305-2307 and substitution Gly2991Ala mutation). In some embodiments, treating the early onset encephalopathy comprises a gRNA comprising SEQ ID NO: 83, SEQ ID NO: 84, or SEQ ID NO: 85 targets the deletion mutation at nucleotide positions 2305-2307. In some embodiments, treating the early onset encephalopathy comprises a gRNA comprising SEQ ID NO: 90 targets the substitution Gly2991Ala mutation. In some embodiments, the disease is Charot-Marie-Tooth disease and / or severe combined immunodeficiency disease (SCID) comprising a heterozygous mutation in an inositol 1,4,5 triphosphate receptor 3 (ITPR3) gene (such as, for example the heterozygous mutation in the ITPR3 gene comprises substitution Arg2524Cys mutation). In some embodiments, treating Charot-Marie-Tooth disease and / or SCID comprises a gRNA comprising SEQ ID NO: 95 targets the substitution Arg2524Cys mutation. In some embodiments, the disease is cystic fibrosis comprising a heterozygous mutation in a cystic fibrosis transmembrane conductance regulator (CFTR) gene (such as, for example the heterozygous mutation in the CFTR gene comprises a deletion mutation at nucleotide positions 1521-1523). In some embodiments, treating cystic fibrosis comprises a gRNA comprises SEQ ID NO: 100 or SEQ ID NO: 101 targets the deletion mutation at nucleotide positions 1521-1523. Docket No.10935-034WO1 In some embodiments, the disease is Hutchinson-Gilford progeria syndrome comprising a heterozygous mutation in a laminin (LMNA) gene (such as, for example the heterozygous mutation in the LMNA gene comprises a dominant-negative C•G-to-T•A mutation). In some embodiments, treating Hutchinson-Gilford progeria comprises a gRNA comprising SEQ ID NO: 106 and SEQ ID NO: 107 targets the dominant-negative C•G-to-T•A mutation. In some embodiments, the disease is a skeletal muscle myopathy. In some embodiments, the disease comprises a heterozygous mutation in an alpha-actin (α-ACTN) gene. In some embodiments, the heterozygous mutation comprises a substitution H40Y mutation. In some embodiments, a gRNA comprising CGTGGGCCGCCCCCGATACC, GGCTATGGTCCAGTCCGACG, GCTATGGTCCAGTCCGACGG, CTATGGTCCAGTCCGACGGG, or TATGGTCCAGTCCGACGGGG targets the substitution H40Y mutation. In some embodiments, the method of any preceding aspect comprises therapeutic composition includes, but is not limited to an adeno-associated viral (AAV) vector, a nanoparticle, an extracellular vesicle, a cell, or a combination thereof. The therapeutic composition may be administered in such amounts, time, and route deemed necessary in order to achieve the desired result. The exact amount of the therapeutic composition will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the disease, the particular therapeutic composition, its mode of administration, its mode of activity, and the like. The therapeutic composition is preferably formulated in dosage unit form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the therapeutic composition will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disease being treated and the severity of the disease symptoms; the activity of the therapeutic composition employed; the specific therapeutic composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific therapeutic composition employed; the duration of the treatment; drugs used in combination or coincidental with the specific therapeutic composition employed; and like factors well known in the medical arts. The therapeutic composition may be administered by any route deemed to produce the desired effect. In some embodiments, the therapeutic composition is administered via a variety of routes, including oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, subcutaneous, intraventricular, transdermal, interdermal, rectal, intravaginal, intraperitoneal, Docket No.10935-034WO1 topical (as by powders, ointments, creams, and / or drops), mucosal, nasal, buccal, enteral, sublingual; by intratracheal instillation, bronchial instillation, and / or inhalation; and / or as an oral spray, nasal spray, and / or aerosol. The exact amount of therapeutic composition required to achieve a therapeutically effective amount will vary from subject to subject, depending on species, age, and general condition of a subject, severity of the side effects, identity of the particular compound(s), mode of administration, and the like. The amount to be administered to, for example, a child or an adolescent can be determined by a medical practitioner or person skilled in the art and can be lower or the same as that administered to an adult. In one aspect, disclosed herein is therapeutic composition of any preceding aspect and a pharmaceutically acceptable carrier selected from an excipient, a diluent, a salt, a buffer, a stabilizer, a lipid, an emulsion, a nanoparticle, and a cream. One or more active agents can be administered in the “native” form or, if desired in the form of salts, esters, amides, prodrugs, or a derivative that is pharmacologically suitable. Salts, esters, amides, prodrugs, and other derivatives of the active agents can be prepared using standards procedures known to those skilled in the art of synthetic organic chemistry and described, for example, by March (1992) Advanced Organic Chemistry; Reactions, Mechanisms, and Structure, 4thEd. N.Y. Wiley-Interscience. In some embodiments, the one or more nucleic acids are sequenced using a sequencing modality including, but not limited to Sanger sequencing, Next-generation sequencing (NGS) Deep sequencing, or a variant thereof. In some embodiments, the subject is further administered an additional therapeutic agent, including but not limited to an antibiotic, an analgesic, an anti-inflammatory agent, a muscle relaxant, an anticoagulant, an antihistamine, an antihistamine, a diuretic, a sedative, an antiseptic, an antipyretic, or any combinations thereof. In some embodiments, the method prevents the disease when the subject is treated prior to the onset of symptoms. In some embodiments, the method of any preceding aspect is performed ex-vivo or in vitro. Methods of generating homozygous mutants The present disclosure provides methods of treating, preventing, ameliorating, repairing, correcting, reversing, or amending a homozygous mutation, which causes a disease in a subject. In some aspects, disclosed herein is a method of generating a homozygous mutation in a nucleic acid sequence, the method comprising isolating a cell from a sample, introducing into the cell to a CRISPR / Cas endonuclease system comprising a guide RNA (gRNA), wherein the nucleic acid sequence comprises a first heterozygous mutation in a first allele, and wherein the gRNA Docket No.10935-034WO1 induces a double strand break (DSB) in a wild-type allele, initiates synthesis of a second heterozygous mutation in a second allele, and generates a homozygous mutant nucleic acid, and sequencing the nucleic acid to confirm generation of the homozygous mutant nucleic acid. The present disclosure also provides methods of generating a model system, such as for example a murine model or primate model, comprising a homozygous mutation, wherein the model system is generated using the CRISPR / Cas endonuclease system of any preceding aspect. In some embodiments, the model system mimics or presents with at least one symptom of a disease selected from inclusion body myopathy, Paget disease, frontotemporal dementia, an encephalopathy, Charcot-Marie-Tooth disease, severe combined immunodeficiency (SCID), cystic fibrosis, Hutchinson-Gilford progeria syndrome, Neurofibromatosis type-1, familial hypercholesterolemia (FH), Tay-Sachs disease, Phenylketonuria (PKU), sickle cell anemia, hereditary hemochromatosis, Marfan syndrome, polycytic kidney disease, late onset glycogen storage disease type 2, Ehlers-Danlos syndromes (EDS), Williams-Beuren syndrome, microcephaly, myoclonus epilepsy, Wilson’s disease, Galaktokinase deficiency, Homocystinuria, recessive myotonia, ataxia-teleangiectasia, Hemophilia, Otospondylomegaepiphyseal dysplasia (OSMED), pulmonary arterial hypertension, Nemaline myopathy, delayed developmental milestones, respiratory disorders, and dilated cardiomyopathy, or a combination thereofor any combinations thereof. In some embodiments, the method of any preceding aspect further comprises generating the homozygous mutant without an exogenous DNA template. In some embodiments, the method of any preceding aspect comprises a mutant allele serving as an endogenous DNA template. In some embodiments, the method of any preceding aspect comprises the gRNA comprising one or more mutated nucleotides located within a protospacer adjacent motif (PAM) sequence. In some embodiments, the method of any preceding aspect comprises the gRNA comprising one or more mutated nucleotides located at least one nucleotide away from the PAM sequence (for example, the one or more mutated nucleotides are located 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides away from the PAM sequence). In some embodiments, the method of any preceding aspect comprises the CRISPR / Cas endonuclease system being introduced into a cell using a delivery method including, but not limited to the viral vectors, nanoparticles, or extracellular vesicles of any preceding aspect. In some embodiments, the method of any preceding aspect comprises the DSB inducing homology- directed repair (HDR) of the wild-type allele. In some embodiments, the method of any preceding aspect further comprises introducing an HDR enhancer (including, but not limited to AZD7648 and / or IDT HDR enhancer version 2 (v2), or a variant thereof) into the cell. Docket No.10935-034WO1 In some embodiments, the method of any preceding aspect comprises the one or more nucleic acids being sequenced using a sequencing modality including, but not limited to Sanger sequencing, Next-generation sequencing (NGS) Deep sequencing, or a variant thereof. In some embodiments, the method of any preceding aspect comprises a sample including, but is not limited to a tissue sample or a blood sample. In some embodiments, the method of any preceding aspect is performed ex vivo or in vivo. A number of embodiments of the disclosure have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims. By way of non-limiting illustration, examples of certain embodiments of the present disclosure are given below. EXAMPLES The following examples are set forth below to illustrate the compositions, devices, methods, and results according to the disclosed subject matter. These examples are not intended to be inclusive of all aspects of the subject matter disclosed herein, but rather to illustrate representative methods and results. These examples are not intended to exclude equivalents and variations of the present invention which are apparent to one skilled in the art. Example 1: REpair of heterozygous Mutations independent of Exogenous Donor template with high efficiencY (REMEDY) using allele specific CRISPR targeting and HDR enhancers Herein, the development of REMEDY (REpair of heterozygous Mutations independent of Exogenous Donor template with high efficiencY), a genome editing strategy that allows efficient repair of heterozygous mutations in human and mouse cells without necessitating an exogenous donor DNA template. Herein, in-PAM or near-PAM CRISPR strategies were used to induce a double-strand break (DSB) in mutant alleles. Following the DSB, the wild-type homologous chromosome itself serves as an endogenous DNA donor template and initiates the correction of the mutant allele. Concurrently treating the cells with HDR enhancers, such as AZD7648, further improved the efficiency of the correction. Utility of REMEDY is demonstrated in the context of five different diseases with heterozygous mutations such as IBMPFD, cystic fibrosis, progeria, ITPR3-associated combined immunodeficiency, ACTA1, and TBCD in human patient derived primary cells and complementary mouse model cell lines. Docket No.10935-034WO1 Heterozygous mutations affect either a single allele in dominant or sex-linked inheritance patterns, or both alleles in the case of biallelic autosomal recessive inheritance. These mutations can be corrected by clustered regularly interspaced short palindromic repeats (CRISPR) mediated homology-directed repair (HDR) and exogenous DNA templates. However, introducing exogenous HDR templates into the cells via electroporation, infection, lipofection, or by viral delivery approaches can lead to cell death, loss of regenerative potential, and adds additional manufacturing and financial burdens. Therefore, there is an essential need to develop an approach to efficiently edit heterozygous mutations independent of an exogenous DNA donor template. In G₀-phase in human cells, double-strand breaks (DSB) result in movement of the homologous chromosomes to the DSB site and formation of a transient contact. Other studies report that CRISPR-induced DSB triggers recombination between homologous chromosome arms in fly lines. Finally, homologous chromosome exchange has been reported in mouse cells with biallelic mutations. Therefore, it was contemplated that this homologous recombination mechanism between wild-type and mutant homologous chromosomes could be triggered in human and mouse cells that harbor heterozygous mutations. To initiate the HDR between the homologous chromosomes, a DSB is introduced only in the mutant allele. Mutant allele-specific targeting in heterozygous mutations can be achieved by designing gRNAs that contain mutated nucleotide(s) located near-PAM (within the 3’ seed sequence of the gRNA) or in-PAM sequence. Therefore, it was contemplated that an in-PAM or near-PAM gRNA design strategy would induce a targeted DSB only in the mutant allele and initiate the recruitment of the homologous healthy chromosome to serve itself as endogenous DNA donor template for correction of heterozygous mutations. This strategy does not require an exogenous DNA donor template for mutation correction. REMEDY corrects VCP gene mutations in mouse and patient derived cells of IBMPFD To test REMEDY, the present disclosure first focused on inclusion body myopathy with early-onset Paget disease and frontotemporal dementia (IBMPFD). The disease is caused by a missense mutation in Valosin Containing Protein (VCP) gene that has autosomal dominant inheritance pattern. Here, a mouse model of inclusion body myopathy with a heterozygous mutation in the VCP gene (c.464_465GG>AT; p.Arg155His) was used, one of the most frequent pathogenic variants in the VCP gene. Four mutant allele specific gRNAs were used (Table 1) to target the R155H mutation. No targeting in fibroblasts derived from healthy mice for gRNA2-4, however gRNA1 targeted the wild-type allele (Figure 3) and thus was not used for the downstream experiments. The mutant allele specific gRNAs 2-4 were then tested in VcpR155H / +mouse myoblasts. All three of the tested gRNAs resulted in complete (100%) targeting of mutant allele Docket No.10935-034WO1 determined by Sanger sequencing (Figure 4). A modest correction of the mutant allele without an exogenous DNA template was observed. The frequency of wild-type allele in the cells targeted by gRNA2 increased from normalized 50% to 58% as measured by next generation sequencing (NGS) and analyzed by CRISPResso2. Therefore, 8% of the cells were corrected to homozygous for the wild-type allele without an exogenous donor DNA template. Sanger sequencing electropherograms showed the highest frequency of wild-type nucleotides at the position achieved by the gRNA2 among all the other gRNAs tested (Figure 1B and Figure 5). The VCP mouse model has different base pair substitution than the human mutation (c.464_465GG>AT in mouse equal to c.464G>A in human) coding the same amino acid. To ensure that the REMEDY is not mutation and cell type specific, the human VCP heterozygous mutation c.464G>A (p.Arg155His) was then targeted with two different gRNAs targeting the mutant allele and screened these guides in IBMPFD patient derived fibroblasts. Sanger sequencing data showed an increase in the frequency of wild-type allele from 50% to 71% with gRNA1 and to 54% with gRNA2 without using an exogenous donor DNA template (Figure 1H and Figure 6A). To ensure that the REMEDY is not pathogenic allele specific, the wildtype allele of VCP c.464G was targeted with a gRNA that was designed specific to wild type allele and tested the guide in patient derived myoblasts and generated the homozygous mutation of VCP c.464G>A (p.Arg155His) with high efficiency (59% mutant allele) as analyzed by CRISPResso2 (Figure 6B and Table 9). Homology directed repair enhancers increase the efficiency of REMEDY The homology repair pathway takes place during the S and G2 phases when a DNA template is available such as a sister chromatid or an exogenous DNA template. It has been shown that HDR enhancers, such as IDT HDR enhancer and AZD7648, arrest or pause the cell cycle at G1 and S at high frequency. AZD7648-mediated cell cycle synchronization is reported to favor homology repair between homologous chromosomes that are in contact following CRISPR mediated DSB in the mutant chromosome. However, the exact mechanism remains to be verified. Since the REMEDY correction is regulated by HDR between homologous chromosomes, it was then contemplated that the addition of HDR enhancers such as IDT Alt-R HDR Enhancer V2 and AZD7648 as a DNA-PK inhibitor may further improve the efficiency of correction achieved by REMEDY. REMEDY was subsequently tested in IBMPFD. Since IBMPFD effects muscles, patient iPSC derived myoblasts were acquired and REMEMDY was tested on these cells. An increase in the wild-type allele frequency from 50 to 69% was observed using gRNA2 with AZD7648 (Figure 16). To evaluate whether this genetic Docket No.10935-034WO1 correction translated into phenotypic improvement, immunostaining was performed with antibodies against lysosome-associated membrane protein (LAMP2), a well-established marker of autophagy and observed a partial reduction in LAMP2 expression (Figure 1H). REMEDY corrects heterozygous mutations in tubulin folding cofactor D (TBCD) gene in patient derived fibroblasts REMEDY was further tested in the context of tubulin folding cofactor D (TBCD) in human patient-derived fibroblasts. Biallelic autosomal recessive mutations in this gene result in a rare early-onset encephalopathy with neurodevelopmental and neurodegenerative features. Skin biopsy samples were collected from two different patients, patient 1 mutation 2 (P1M2) (TBCD; c.2305-2307 del GAG p.E769del) and patient 8 mutation 2 (P8M2) (TBCD; c.2472-2A>G- intronic splice acceptor mutation). Specifically, allele specific gRNAs were designed for the mutant allele (Tables 2 and 3) and patient derived fibroblasts were electroporated with Cas9 / RNP targeting the mutant allele. In patient P1M2, an increase in percentage of wild-type allele was observed in the cells targeted by the mutant allele specific gRNA from 50% to 64% (Figure 1D), and in P8M2, REMEDY achieved 8% correction (Figures 7A and 7B) as measured by ICE and CRISPresso2. In P1M2, treating the cells with IDT Alt-R Enhancer V2 or AZD7648 post Cas9 / RNP electroporation resulted in a further increase in the frequency of the wild-type allele to 83% and to 82% in the cells, respectively, as measured by ICE . This means 30% of the cells have become homozygous for wild-type TBCD. NGS was performed and the data analyzed with CRISPResso2 and identified similar percentage of correction (22% wild-type homozygous TBCD)(Figure 1D and 1E). Single cell clones of the REMEDY corrected cells confirmed the correction of heterozygous mutation in TBCD To ensure the stability of the edits and to confirm that these findings are not related to sequencing artifacts, single cell cloning was performed in the patient derived fibroblasts that were targeted with allele specific gRNA3 and treated with HDR enhancer. Based on Sanger sequencing and NGS data, one out of five clones (20%) was found to be fully corrected to wild-type homozygous TBCD. This was confirmed by the Sanger sequencing of five single cell clones that were grown for more than 10 days (Figure 1E and 1G). The NGS and Sanger sequencing on P8M2 also showed enhanced correction after treating the cells with AZD7648 and IDT HDR enhancer (from 50% to 70%) along with REMEDY (Figure 7 and 8). Docket No.10935-034WO1 REMEDY corrected heterozygous mutation in ITPR3 gene REMEDY was tested on a heterozygous mutation in the inositol 1,4,5 triphosphate receptor 3 (ITPR3) which regulates intracellular calcium stores, and inherited pathogenic variants can cause Charcot-Marie-Tooth disease, demyelinating, type 1J and a severe combined immunodeficiency. Patient-derived fibroblasts were obtained and a gRNA was designed (Table 4) to target only the ITPR3 allele harboring the mutation (c.7570C>T, p. Arg2524Cys). REMEDY, with the addition of HDR enhancers, again was able to correct the heterozygous mutation in these cells with no need for exogenous DNA donor template, 50% to 62% with AZD7648 and 50% to 61% with IDT HDR enhancer V2 measured by NGS and analyzed by CRISPResso2 (Figures 2A and 2B) and Sanger following analysis by ICE (Figure 9). Since AZD7648 and IDT HDR enhancer V2 resulted in comparable efficacy and AZD7648 is used in clinical settings, the rest of the experiments were performed using only the AZD7648 DNA-PK inhibitor. It is worth mentioning that the ITPR3 pathogenic variant appears to confer a survival disadvantage to fibroblasts, compared to healthy control fibroblasts or those from patients with other inborn errors of immunity (IEIs; e.g. IPEX). Remedy corrected the most common heterozygous mutation in CFTR gene in CF patient derived bronchial epithelial cells To test whether REMEDY could be used for ex vivo cell therapy applications, where clinical implications could be transformative, human airway epithelial cells were collected from a patient with cystic fibrosis (CF). Allele-specific gRNAs were designed targeting a deletion of phenylalanine 508 (F508del) in CFTR gene (Table 5). A single heterozygous mutation impairs CFTR folding resulting in chloride channel dysfunction. Human bronchial epithelial cells (HBEC) harboring one copy of the F508del variant were electroporated with the Cas9 / RNP, treated the cells with AZD7468, and a significant increase in the frequency of wildtype allele was observed in the cells treated with gRNA1 from 50% to 86% and to 87% with gRNA2. Confirming REMEDY for genome editing free of an exogenous donor DNA template in a cell type that has therapeutic implications for ex vivo cell therapy (Figures 2C and 2D). REMEDY results in correction of human derived cells from Hutchinson–Gilford progeria syndrome (HGPS or progeria). Hutchinson–Gilford progeria syndrome (HGPS or progeria) is caused by a dominant- negative mutation in the LMNA gene (c.1824 C>T; p.G608G) which encodes nuclear Lamin A and Lamin C. In previous studies, base editing corrected this mutation in patient-derived Docket No.10935-034WO1 fibroblasts with an efficiency of 87–91% of the pathogenic allele. Herein, REMEDY was used to correct the same mutation in Progeria patient-derived fibroblasts and achieved highly efficient targeting of the mutated allele (100%) and achieved correction of the mutated allele (50% to 69% wild-type allele) in the cells treated with AZD7648 post allele specific CRISPR targeting without an exogenous DNA template (Figure 2E and Table 6). REMEDY corrected the autosomal dominant mutations in the skeletal muscle alpha (α)- actin (ACTA1) gene in iPSC cells The REMEDY approach was tested to correct autosomal dominant mutations in the skeletal muscle alpha (α)-actin (ACTA1) gene in patient derived iPSC cells. ACTA1 is the primary actin isoform found in skeletal muscles and thin filaments in the sarcomere, the basic unit of muscle contraction. Mutations in this gene are linked to disrupted actin polymerization and impaired interactions with other proteins such as myosin, ultimately leading to a severe Nemaline myopathy characterized by muscle weakness, delayed developmental milestones, respiratory difficulties, and dilated cardiomyopathy. For this experiment, allele-specific gRNAs were designed targeting the H40Y mutation in the ACTA1 gene (p. His42Try, c. CAC>TAC, 124C>T)(Table 10). REMEDY was applied in H40Y ACTA1 iPSC cells and analyzed with Sanger sequencing. Sequencing results demonstrated 82% correction of the mutant allele using gRNA2 while the wild-type allele remained unaffected (Figure 2G). These results confirm the efficacy of REMEDY in editing autosomal dominant mutations in ACTA1 without requiring an exogenous HDR template. This is important since many pathogenic mutations in the ACTA1 gene have been associated with NEM3 disease and having a simple and cost-effective gene editing platform will be crucial toward advancing therapeutic approaches. Furthermore, since there are six actin genes in human cells with ~90% sequence homology, using REMEDY ensures a highly specific genome-editing approach without relying on HDR templates to minimize the risk of off- target effects. PacBio sequencing did not show evidence of large-scale genomic alterations Cas9 mediated large DNA resection resulting in large-scale genomic alterations such as loss of heterozygosity (LOH) has been a concern surrounding the use of this technology. Additionally, DNA-PK inhibition may further increase the frequency of the LOH. Therefore, PacBio HiFi long-read sequencing was performed to evaluate such alterations after the use of REMEDY at the TBCD-P1M2 pathogenic allele target site (chr17: 82,924,980, TBCD; c.2305- 2307 delGAG p.E769delP1M2) in non-edited and REMEDY corrected patient derived iPSC cells. Docket No.10935-034WO1 PacBio HiFi sequencing was performed and the data were aligned to the human reference genome (GRCh38) using pbmm2 (v1.13.1). Overall, PacBio indicated no meaningful LOH effects near the target site(Table 13). In detail, manual inspection of reads at the target site confirmed the expected variant in the untreated sample in the heterozygous condition (Figure 15A). In the REMEDY, the treated sample showed the high efficiency of targeting the mutant allele as shown by Sanger sequencing and NGS (18 delGAG reads non edited vs. 2 delGAG reads in REMEDY treated).Therefore, two delGAG reads remained, as well as 5 reads containing short non-frame-shifting deletions of uncertain pathogenicity. The remaining altered reads contained either short frame-shifting deletions (8) or large deletions (2). A corrective effect is expected in 58-88% of the altered alleles observed (Figure 15B and 15C, Tables 11 and 12). DeepVariant analysis detected 33 phased heterozygous sites within 10kb of the target site in the untreated sample. In the treated sample, all sites remained heterozygous; only one (chr17: 82932762) showed any discrepancy, with 2 of 38 (5.3%) reads deviating from the expected allelic phasing. This represents only 0.2% of total reads and is unlikely to indicate any meaningful LOH effects near the target site (Table 13). No large-scale copy-number changes were observed in chromosome 17. Nine small focal gains or losses were detected, of which seven matched to the untreated comparator. One additional single-copy gain was detected on 17p (chr17:16752000-16844000) and a single-copy loss at the distal end of 17q (chr17:83234000-83256000) was instead called as a complete loss (Figure 15D); however, manual inspection of these regions in Integrative Genomics Viewer (IGV) showed no discernible differences between the treated and untreated samples. The degree of coverage variation observed across chromosome 17 was confirmed to be comparable to chromosome 12 (Figure 17). After filtering for appropriate coverage and appropriate allele frequency in the untreated comparator sample, 57481 variants were used to determine post-treatment loss-of-heterozygosity. Chromosome 17 heterozygosity bins deviated from the expected variant allele frequency (VAF) by 2.2% to 6.7%, comparable to the deviations observed in chromosome 12 (1.2% to 5.6%) (Figure 15E and Figure 18). Conclusion REMEDY can be used in basic science and pre-clinical studies for which a heterozygous mutation needs to be corrected. It can also be used to generate pathogenic homozygous mutations for in vitro studies if only wild-type allele is targeted, and the mutated homologous chromosome Docket No.10935-034WO1 is used as the endogenous HDR template. Additionally, REMEDY can treat patients with a wide variety of heterozygous mutations, especially if the correction can be performed ex vivo for cell therapy applications. REMEDY has several advantages over existing gene correction approaches. In the pre- clinical setting, high efficiency of correcting heterozygous mutations can be achieved by introducing donor DNA template to the cells; however, this can be cytotoxic given the initiation of DNA sensing mechanism. In the clinical setting, providing an exogenous DNA template is expensive and not widely accessible especially in low-middle income countries. Ongoing studies are assessing the range of correction that can be achieved by REMEDY, particularly in the context of different mutation types (single nucleotide polymorphisms vs. deletions of varying sizes). The allele specific gRNA approach used in REMEDY is another advantage of the method as it minimizes the number of off targets since it is designed to only target the mutant allele. However, the in-PAM or near-PAM gRNA design can also be a limitation if there are no PAM sequences in close vicinity of the mutation site. This problem can be potentially solved by changing the type of endonuclease that expands the range PAM sequences to initiate a DSB in the mutant allele. Tools such as AlleleAnalyzer (github.com / keoughkath / AlleleAnalyzer) can be used for allele-specific sgRNA design and for identifying endonucleases. Lastly, the addition of HDR enhancers improves efficiency of REMEDY. The direct comparison of two relevant enhancers validates this confirmation and enhances translation of our novel REMEDY approach. Herein, it is demonstrated that a new mechanism that overcomes many current barriers of gene editing by efficiently repairing heterozygous mutations without the necessity of exogenous donor DNA template. These findings are confirmed in 6 diseases, 2 species, and 3 cell types in the context of IBMPFD, TBCD, CF, Progeria, ITPR3, and ACTA1 which result from distinct molecular mechanisms, demonstrating the breadth of application of this technology. Methods: Patient Derived Fibroblasts The present disclosure was performed in compliance with the standards set by the National Institute of Health (NIH) and was reviewed and approved by the Institutional Review Board (IRB) at Nationwide Children’s Hospital (IRB number 14-00719). Written, informed consent was obtained from the participants prior to inclusion in the study. Samples from the participants were identified by numbers, not names. Patient derived human skin fibroblasts were collected under IRB and maintained in Dulbecco's modified Eagle's medium (DMEM, Gibco™, Catalog # Docket No.10935-034WO1 11960044) supplemented with GlutaMAX (Gibco™, Catalog #35050061) and 15% heat inactivated Fetal Bovine Serum (GenClone Catalog # 25-514H) FBS at 37°C and 5% CO2. Human primary Progeria dermal fibroblast cell lines were obtained from The Progeria Research Foundation (PRF) Cell and Tissue Bank. The HGPS cell lines were HGADFN367. Progeria fibroblasts were grown in DMEM media supplemented with GlutaMAX, 20% FBS, 1% Non- Essential Amino Acids (NEAA) (Thermo Fisher, Catalog # 11140050) and 1% Pen / Strep (Gibco™, Catalog # 15070-063). Mouse myoblasts and fibroblasts All animal experiments were performed in compliance with the standards set by the National Institute of Health (NIH) and were reviewed and approved by the Research Institute at Nationwide Children’s Hospital Animal Care and Use Committee (IACUC approval number: AR18-00123). All experiments were conducted in compliance with the ARRIVE guidelines. All mice were sacrificed in accordance with ethical standards; overdose of xylazine / ketamine anesthesia was used to euthanize the mice. Skeletal muscles were collected from one VcpR155H / +mouse after euthanasia (The Jackson Laboratory, Strain #:021968). Protocol was Shahini et al., 201831. Shortly, muscles were minced and seeded on a Matrigel (Corning, Catalog #354234) coated cell culture dish in proliferation medium for release of myoblasts (high glucose DMEM, 20% FBS (Thermo Fisher, Catalog #16000044), 10% horse serum (ThermoFisher, Catalog #26050070), 0.5% chicken embryo extract (Fisher Scientific, Catalog #NC9997754), 2.5 ng / ml bFGF (Peprotech, Catalog #450-33), 10 μg / ml gentamycin (Gibco, Catalog #15-710-064), 1% Antibiotic-Antimycotic (ThermoFisher, Catalog #15240062), and 2.5 μg / ml plasmocin prophylactic (Invivogen, ant- mpp). Released cells were pre-plated to purify myoblasts. Similarly, skin sample of one VcpR155H / +mouse was collected after mouse is euthanized and fibroblasts were released starting in one week. Cells were maintained as mentioned in the Patient-Derived Fibroblasts section. All animal experiments were performed according to the ethical guidelines approved by The Research Institute at Nationwide Children’s Hospital Animal Care and Use Committee (IACUC approval number: AR18-00123). Airway Epithelial cells Human bronchial epithelial cells (HBEC) were obtained from CF donor lungs through the Epithelial Cell Core at Nationwide Children’s Hospital. HBECs were cultured using Pneumacult- Ex Plus media with ROCK inhibitor (Y-27632) at 10 µM. Five days after seeding, the cells were Docket No.10935-034WO1 dissociated by treatment with TrypLE and resuspended in OPTI-MEM (Gibco™, Catalog #31985070) at a concentration of 5 million cells / ml. 6 µg of Cas9 and 3.2 µg of sgRNA were mixed and incubated for 10 minutes.20 µL of cells in OPTI-MEM were added to the Cas9 / sgRNA mixture and electroporated using a Lonza 4D nucleocuvette strips. The program CA-137 with buffer setting P3 (Lonza, Catalog# V4XP-3032) was used. Five days after editing, genomic DNA was isolated from HBECs. Exon 11 locus of CFTR was amplified using PCR with an annealing temperature of 58°C and extension time of 35 sec using Q5 polymerase. Patient derived iPSCs To generate patient derived iPSCs, peripheral blood mononuclear cells (PBMCs) were isolated under approved IRB. The PBMCs were then converted to iPSCs using Sendai virus reprogramming kit (Thermo Fisher, A16518) and maintained in supplemented STEMFLEX™ Medium (Thermo Fisher, A3349401) on plates coated with Vitronectin (VTN) Recombinant Human Protein, Truncated, 10mL (Thermo Fisher, A31804) at 37°C and 5% CO2. Single Cell Cloning Cells were detached and diluted to 1x104cells / ml in culture media. A suspension of 5 cells / mL was prepared from the 1x104cells / mL solution by adding 25 µL to 50 mL of culture media. 200 µL of the new dilution was added to each well of a 96 well plate. The plates were monitored for 7-10 days to assess for single cell colonies. Upon reaching an appropriate cell number, PCR was performed on the isolated DNA, purified, and sent for Sanger sequencing to validate a homogeneous population. Preparation of Allele specific gRNAs VCP, TBCD, CTFR, ACTA1, LMNA and ITPR3 gRNAs were designed by using online tool Benchling (https: / / benchling.com) and synthesized by Synthego as Synthetic gRNAs resuspended in TE buffer to achieve 100 µM working concentration. Performing allele specific CRISPR in mouse myoblasts and patient derived fibroblasts, iPSCs and myoblasts Fibroblast cells were detached at least 70% confluency using TrypLE Express Enzyme (Fisher Scientific, Catalog #12-604-021). The cells were collected and counted using trypan blue. A total of 1.0x105cells were used for electroporation. The cells were electroporated using the Cas9 / RNP as 2 μl of Alt-R™ S.p. Cas9 Nuclease V3, 500 µg (IDT, Catalog # 1081059) at 62 μM, Docket No.10935-034WO1 2 μl gRNA, and 1 μl of DPBS (Corning, Catalog # 21-031-CV). The control cells received 5 µL of DPBS. the prepared Cas9 / RNP was incubated at RT for 20 minutes. The cells were resuspended in 20 μl SE electroporation buffer (Lonza, Catalog #V4SC-1096). Resuspended cells were combined with the cas9 / RNP and loaded into the electroporation cuvette provided in the Lonza kit. The cuvette was placed into the Amaxa 4D-Nucleofector X Unit (Lonza, Catalog # AAF- 1003X). The cells were electroporated with the parameters of SE buffer and a pulse code of CD- 137. Post electroporation, the cells were rested for 1 minute at RT, then using prewarmed culture media the cells were transferred to 12 well plates containing the prepared media. Cells recovered in the incubator at 37°C, 5% CO2. hiPSCs derived myoblasts were obtained from VCP donor patients through the Cure VCP Disease Foundation. Cells were seeded onto 10 cm culture dishes coated with Collagen (Col I, Corning, Cat. 354236) and grown in Myoblast expansion medium (iXCells, Catalog # MD-0102A1) with 1% Pen / Strep (Gibco™, Catalog # 15070-063). Medium was changed every other day and cells were passaged once they reached 80-90% confluency using TrypLE (Gibco™ Catalog # 12604021). Human and mouse myoblasts were treated in a similar fashion with the only variation being 0.25x105cells were used per electroporation. Electroporation on iPSCs was performed using P4 electroporation buffer (Lonza, V4XP-4032) and a pulse code CA-137. Following electroporation, cells were cultured in supplemented STEMFLEX™ Medium (Thermo Fisher, A3349401) with 1X CultureSureTM CEPT Cocktail(1,000×) (FujiFilm, 033- 26071). Medium was changed 24-hours post electroporation. The medium was replaced with supplemented STEMFLEX™ Medium (Thermo Fisher, A3349401), without antibiotics, containing 1X Y27632 Rock Inhibitor (LC Labs, Y-5301). To enhance HDR we treated the post electroporation cells with 1 mM solution of AZD7648 (R&D Systems, Catalog # 7825 / 10) was prepared in DMSO. 1 μL AZD7648 was added per 1 mL of media. The IDT HDR enhancer V2 was used at concentration of 10 μM. The media containing AZD7648 and IDT HDR enhancer V2 were removed and replaced with fresh media 24 hours after the addition of the cells. DNA isolation and PCR Genomic DNA was isolated from edited and non-edited cells using DNeasy Blood & Tissue Kit (Qiagen, Catalog #69504). Isolated DNA was subjected to PCR amplification using the Platinum™ SuperFi II PCR Master Mix (Thermo Fisher, Catalog # 12368010). Following PCR, each sample was purified following the Qiagen QIAquick PCR Purification Kit (Qiagen, Catalog # 28104). Purified samples were run on Invitrogen™ E-Gel™ Agarose Gels with SYBR™ Safe DNA Gel Stain, 2% (Fisher Scientific, Catalog # A45205) using the E-Gel™ Power Docket No.10935-034WO1 Snap Electrophoresis System Starter Kit, SYBR Safe 2% (Thermo Fisher, Catalog # G8322ST) to validate the PCR product. All PCR primers- utilized for NGS and Sanger sequencing are described in Supplementary tables 11 and 12. Sanger Sequencing Purified PCR samples along with the corresponding primers were submitted to Azenta / Genewiz (www.genewiz.com) for Sanger sequencing. The received .ab1 files were analyzed using ICE (ice.synthego.com). Briefly, unaffected samples of cell types similar to the patient samples were used as the control sample by which the unedited patient sample and CRISPR / cas9 edited cells were compared to. The gRNA used during a KO needs to be changed to the WT sequence without the mutation present in the patient sample. NGS Deep Sequencing Purified PCR samples were sent to the Center for Computational & Integrative Biology at Massachusetts General Hospital (dnacore.mgh.harvard.edu). Samples were run on the Illumina MiSeq with 2x100bp reads. Data was analyzed through the CRISPResso2 (crispresso.pinellolab.org / ) data analysis tool. Briefly, the tool aligns each read to all allelic variants present in the controls and matches the read to the allele that is more similar. PacBio Sequencing Allele Assessment Reads at the target site were visualized using the Integrative Genomics Viewer (IGV) and manually tallied. Each read was assigned to one of the following categories: wild-type, ΔGAG, small non-frame-shifting deletion (<100 bp, multiple of 3bp), small frame-shifting deletion (<100 bp, not a multiple of 3bp), and large deletion (>=100bp). Local Loss-of-Heterozygosity To detect the presence of local heterozygosity potentially introduced around the edit-site, phased variant-calling was performed via DeepVariant (v1.6.0) on both samples. Phased heterozygous sites within 10kb of the target site were identified from the untreated sample. Findings at these sites were then analyzed in the treated sample, to detect any deviation from expected heterozygosity or disruption of allelic phasing. Docket No.10935-034WO1 Chromosomal CNV-LOH To detect large-scale loss-of-heterozygosity, DeepVariant results were compared across the length of chromosome 17. Sites with a VAF between 0.40 and 0.60 were identified in the untreated sample and filtered to those with at least 10 reads of support and not within 1 megabase of a centromere region. VAFs were then compared with the treated sample, accounting for the degree of error observed in the untreated comparator. These VAFs were then binned into equal regions each representing 1% of the chromosome’s length, averaged, and plotted. Post-treatment allele frequencies of sites found to be heterozygous in the comparator were plotted as supporting data. HiFiCNV (v1.0.0) was used to detect the presence of CNV events. The resulting copy- number estimates were plotted for both treated and untreated samples. Coverage metrics gathered by HiFiCNV were plotted as background supporting data. Identical analyses were also performed for non-targeted chromosome 12 for comparison. Immunofluorescence staining To detect the co-localization of Lamp2 and Desmin, iPSC derived myoblasts were transferred on coverslips, fixed in 4% paraformaldehyde, permeabilized with 0.1% Triton X-100 in PBS, and blocked with 1% bovine serum albumin with 10% normal goat serum and 0.1% Triton x-100. The cells were incubated with primary antibodies against LAMP2 in 1:100 dilution (Santa Cruz Biotechnology, Catalog # sc-18822) and Desmin in 1:200 dilution (Invitrogen, Catalog # MA5-16357) for 90 minutes. Afterwards, the cells were incubated with FITC (Thermo Fisher, Catalog# A11017) and Cy5 (Thermo Fisher, Catalog # A21244)-conjugated secondary antibodies in 1:500 dilution for both for 45 minutes and treated in ProLong Gold Antifade Reagent with DAPI (Invitrogen, Catalog# P36935). It will be apparent to those skilled in the art that various modifications and variations can be made in the present disclosure without departing from the scope or spirit of the invention. Other embodiments of the disclosure will be apparent to those skilled in the art from consideration of the specification and practice of the methods disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims. Docket No.10935-034WO1 TABLES Table 1. Targeting VCP c.464_465GG>AT in mouse myoblasts. Sequences SEQ ID NO. Mouse wildtype VCP 5’ GGAGATATTTTTCTTGTCCGGGGTGGGATGCGTGCTGTGG 42 3’ CCTCTATAAAAGAACAGGCCCCACCCTACGCACGACACC 43 Mouse mutant VCP – R155H 5’ GGAGATATTTTTCTTGTCCATGGTGGGATGCGTGCTGTGG 44 3’ CCTCTATAAAAGAACAGGTACCACCCTACGCACGACACC 45 gRNA1 ACCACCCTACGCACGACACC 46 gRNA2 GGAGATATTTTTCTTGTCCA 47 gRNA3 GATATTTTTCTTGTCCATGG 48 gRNA4 ATATTTTTCTTGTCCATGGT 49 Bold nucleotides indicates mutated or targeted nucleotides. Table 2. In-PAM or near-PAM gRNAs tested to target heterozygous mutation in TBCD (P1M2). Sequences SEQ ID NO. Wildtype Allele TBCD 5’ GCTGAGCTTCGGAACCCCGAGGAGATGACTCGCT 79 GTGGCTTCTCG 3’ CGACTCGAAGCCTTGGGGCTCCTCTACTGTGAGC 80 GACACCGAAGA Mutant Allele Patient1 mutation 2 (P1M2): 2305-2307 ΔGAG TBCD 5’ GCTGAGCTTCGGAACCCC….GAGATGACTCGCTG 81 TGGCTTCTCG Docket No.10935-034WO1 3’ CGACTCGAAGCCTTGGGG….CTCTACTGTGAGCG 82 ACACCGAAGA gRNA1 AACCCC….GAGATGACTCGCTGTGG 83 gRNA2 GG….CTCTACTGTGAGCGACACCGA 84 gRNA3 G….CTCTACTGTGAGCGACACCGAA 85 Bold nucleotides indicate deleted nucleotides. “….” indicates deletion region. Table 3. In-PAM or near-PAM gRNAs tested to target heterozygous mutation in TBCD (P8M2). Sequences SEQ ID NO. Wildtype Allele TBCD 5’ TTGTTAGCTCACACATTTTAAATTTCAGGATTTGCCAGA 86 CTGTTG 3’ CAACAGTCTGGCAAATCCTGAAATTTAAAATGTGTGAGC 87 TAACAA Mutant Patient 8 Mutation 2: 2472-2 A>G Allele TBCD 5’ TTGTTAGCTCACACATTTTAAATTTCgGGATTTGCCAGAC 88 TGTTG 3’ CAACAGTCTGGCAAATCCcGAAATTTAAAATGTGTGAGC 89 TAACAA gRNA AGCTCACACATTTTAAATTT (mutation in PAM) 90 Table 4. In-PAM or near-PAM gRNAs tested to target heterozygous mutation ITPR3 c.7570C>T, p. Arg2524Cys. Sequences SEQ ID NO. Wildtype Allele ITPR3 5’ TCGACACCTTCGCTGACCTGCGTAGTGA 91 GAAGCAGAAGAAGGAGGA Docket No.10935-034WO1 3’ AGCTGTGGAAGCGACTGGACGCATCACT 92 CTTCGTCTTCTTCCTCCT Mutant ITPR3 c.7570 C>T, p. Arg2524Cys Allele ITPR3 5’ TCGACACCTTCCGCTGACCTGTGTAGTGA 93 GAAGCAGAAGAAGGAGGA 3’ AGCTGTGGAAGCGACTGGACACATCACTC 94 TTCGTCTTCTTCCTCCT gRNA 1 TCTTCTGCTTCTCACTACAC 95 Bold nucleotides indicate mutated / targeted nucleotides Table 5. In-PAM or near-PAM gRNAs tested to target heterozygous mutation CFTR. Sequences SEQ ID NO. Wildtype Allele CFTR 5’ CACCATTAAAGAAAATATCATCTTTGGTGTTTCCTAT 96 GATGAATATGATGAATATAGA 3’ GTGGTAATTTCTTTTATAGTAGAAACCACAAAGGAT 97 ACTACTTATATCT Mutant F508del Mutation: 1521-1523 ΔCTT Allele CFTR 5’ CACCATTAAAGAAAATATCAT….TGGTGTTTCCTATG 98 ATGAATATAGA 3’ GTGGTAATTTCTTTTATAGTA….ACCACAAAGGATAC 99 TACTTATTATATCT gRNA1 ACCATTAAAGAAAATATCAT 100 (5’) Docket No.10935-034WO1 gRNA2 AATTTCTTTTATAGTA….ACCA 101 (3’) Bold nucleotides indicate deleted nucleotides. “….” indicates deletion region. Table 6. In-PAM or near-PAM gRNAs tested to target heterozygous mutation LMNA. Sequences SEQ ID NO. Human LMNA Wildtype 5’ AGCCCAGGTGGGCGGACCCATCTCCTCTGG 102 3’ TCGGGTCCACCCGCCTGGGTAGAGGAGACC 103 Human LMNA LMNA, c.1824 C>T; p.G608G Mutation 5’ AGCCCAGGTGGGTGGACCCATCTCCTCTGG 104 3’ TCGGGTCCACCCACCTGGGTAGAGGAGACC 105 gRNA1 CCACCCACCTGGGTAGAGGA 106 gRNA2 TCCACCCACCTGGGTAGAGG 107 Bold indicates mutated / targeted nucleotides. Table 7. Primers Used for Sanger Sequencing Sanger Sequencing Sequence SEQ ID NO. Primer VCP Mouse Forward CTTTCGGACACCCAGTGCTTG 60 Mouse Reverse TTACCCACTGAGCCATCTCACC 61 Human Forward TTGATGGGCTTCTGACATGTCA 62 Human Reverse AGTACTGGGATTACAGGTGTCA 63 TBCD P1M2 Forward GAGCTAAGCTTGCACCACGGCA 64 P1M2 Reverse TCCTCACTCTCGGCAGCTGCTT 65 P8M2 Forward GAGCTAAGCTTGCACCACGGCA 64 P8M2 Reverse TCCTCACTCTCGGCAGCTGCTT 65 Progeria LMNA Forward AAGCTTGCTCCCGTTCTCTCTT 66 LMNA Reverse GCAGTTCTGGGGGCTCTAAGAG 67 CTFR Forward CCTTCTACTCAGTTTTAGTC 68 Reverse TGGGTAGTGTGAAGGGTTCAT 69 Docket No.10935-034WO1 ITPR3 Forward AGGCCCTCATTTCCTTCTGC 70 Reverse ATCAAGTCATCAGCTCCGGG 71 Table 8. Primers Used for Next Generation Sequencing NGS Primer Sequence SEQ ID NO. VCP-NEO-NGS- TGGTCCTGTACTTGACACCTCT 72 Forward VCP-NEO-NGS-Reverse TCACCTCTCGCTTGATTGGCTC 73 P1M1-NGS-Forward GGCTGTGGTCTCAGGATCTTT 74 P1M1-NGS-Reverse TCACCATCCACGAGTCGAGATG 75 P1M2-NGS-Forward AGAGGAGCTGATCACGCAGTAC 76 P1M2-NGS-Reverse CCAGCTAACAAGCACTGATGGGT 77 ITPR3-NGS-Forward TGTGCTGAACCTCATCTTTGGG 78 ITPR3-NGS-Reverse CAAACCGCTACTGCCACTGG 108 Table 9. In-PAM or near-PAM gRNAs tested to target healthy and mutant allele in VCP c.464G>A (p.Arg155His) patient derived human fibroblasts. Table 10. In-PAM or near-PAM gRNAs tested to target heterozygous mutation ACTA1.

[0002] Docket No.10935-034WO1 Table 11. Breakdown of alleles in pre-treatment and post-treatment samples. Counts and percentages are shown for each allelic category. Pre-Treatment Post-Treatment Type Count (#) Percent (%) Count (#) Percent (%) Wild-Type 20 52.6% 22 56.4% delGAG 18 47.4% 2 5.1% Small In-Frame 0 0 5 12.8% Small Out-of- Frame 0 0 8 20.5% Large 0 0 2 5.1% Total 38 - 39 - Table 12. Breakdown of alleles in pre-treatment and post-treatment samples. Definitions of each of the 5 categories considered are also shown. Categories can represent multiple allelic states. Type Description Wild-Type No deletion at chr17:82924983. Produces healthy, functional protein. Three-base in-frame deletion of Glutamic Acid, producing disease- delGAG causing protein. Small In- Frame 6-12 bp deletion without frameshift. May cause some form of disorder. Small Out- <100bp deletion, resulting in a non-functional protein. Does not cause of-Frame disorder. >=100bp deletion, resulting in a non-functional protein. Does not Large cause disorder. Table 13. Phasing of Heterozygous Alleles Near Target Site. Reference and alternate allele counts are given for each of 33 phased heterozygous loci within 10kb of the target site. “delGAG In- Phase” indicates which allele is expected on reads containing a GAG deletion or any observed post-REMEDY deletion variant. Only 0.2% of reads contained an allele that deviated from expectations. Untreated Untreated Treated Treated ΔGAG # # % Docket No.10935-034WO1 chr17 82917553 G T 24 16 20 15 Alt 35 0 0.0% chr17 82917651 A G 24 16 19 14 Alt 33 0 0.0% chr17 82917750 C G 16 21 14 20 Ref 34 0 0.0% chr17 82918404 C T 17 21 16 20 Ref 36 0 0.0% chr17 82918537 G A 16 21 15 20 Ref 35 0 0.0% chr17 82918990 T A 16 20 14 21 Ref 35 0 0.0% chr17 82919236 A G 15 20 14 20 Ref 34 0 0.0% chr17 82919244 G T 15 21 14 20 Ref 34 0 0.0% chr17 82919556 T A 15 21 14 20 Ref 34 0 0.0% chr17 82919677 C T 15 21 13 20 Ref 33 0 0.0% chr17 82919986 G A 14 21 16 20 Ref 36 0 0.0% chr17 82920940 C T 20 14 18 17 Alt 35 0 0.0% chr17 82921116 T C 14 20 17 18 Ref 35 0 0.0% chr17 82924342 T C 14 19 18 23 Ref 41 0 0.0% chr17 82924487 T A 16 19 17 21 Ref 38 0 0.0% chr17 82927573 G C 25 15 20 16 Alt 36 0 0.0% chr17 82928440 G T 17 23 18 20 Ref 38 0 0.0% chr17 82929368 T C 18 22 20 19 Ref 39 0 0.0% chr17 82929575 A G 18 21 20 19 Ref 39 0 0.0% chr17 82930288 A G 16 22 20 19 Ref 39 0 0.0% chr17 82931029 T C 15 22 21 22 Ref 43 0 0.0% chr17 82932386 C T 17 22 20 20 Ref 40 0 0.0% chr17 82932762 T C 19 21 20 18 Ref 38 2 5.3% chr17 82933259 C T 20 21 21 19 Ref 40 0 0.0% chr17 82933517 A G 19 21 19 18 Ref 37 0 0.0% chr17 82933584 C T 20 20 19 18 Ref 37 0 0.0% chr17 82933790 G T 20 20 19 18 Ref 37 0 0.0% chr17 82933799 T G 20 20 19 18 Ref 37 0 0.0% chr17 82933802 A G 20 20 18 17 Ref 35 0 0.0% Total - - - 581 671 566 628 - 1194 2 0.2%

[0003] Docket No.10935-034WO1 SEQUENCES Sequence Name Sequence SEQ ID NO cystic fibrosis, Primer AGGCAAGTGAATCCTGAGCG for Exon 11 locus of CFTR 1 rare early-onset A---GATGACTCGCTGTGGCT encephalopathy, Non- Edited, TCBD, 2305- 2307 ΔGAG 47.29% (21130 reads) 2 rare early-onset AGGAGATGACTCGCTGTGGCT encephalopathy, Non- Edited, TCBD, 2305- 2307 ΔGAG 46.43% (20746 reads) 3 rare early-onset AG---ATGACTCGCTGTGGCT encephalopathy, gRNA3 + HDR Enhancer - 9.96% (4326 reads) 4 rare early-onset AG-------ACTCGCTGTGGCT encephalopathy, gRNA3 + HDR Enhancer - 2.64% (1146 reads) 5 rare early-onset AGA----GACTCGCTGTGGCT encephalopathy, gRNA3 + HDR Enhancer - 1.95% (847 reads) 6 rare early-onset AGAT--TGACTCGCTGTGGCT encephalopathy, gRNA3 + HDR Enhancer - 1.34% (584 reads) 7 rare early-onset AAG----------CTGTGGCT encephalopathy, gRNA3 + HDR Enhancer - 0.79% (345 reads) 8 rare early-onset AGGAGATGACTTGCTGTGGCT encephalopathy, gRNA3 + HDR Enhancer - 0.78% (339 reads) 9 rare early-onset AACCCCGAGGAGATGACTCGCTGTG encephalopathy, G TCBD; 2305-2307 ΔGAG, Non-Edited 10 Docket No.10935-034WO1 rare early-onset AACCCCGAGGAGATGACTCGCTGTG encephalopathy, G Wildtype TCBD; 2305-2307 ΔGAG 11 rare early-onset AACCCCGAAGCCACTCCCCGTGGCT encephalopathy, T Clone 2 TCBD; 2305- 2307 ΔGAG 12 rare early-onset AACCCCCAAGACATGACTCGCTGTG encephalopathy, GC Clone 3 TCBD; 2305- 2307 ΔGAG 13 rare early-onset AACCCCGATGTGACTTCTCGTTGGG encephalopathy, GC Clone 4 TCBD; 2305- 2307 ΔGAG 14 rare early-onset CTGACCTGCGTAGTGAGAAG encephalopathy, sgRNA Non-edited reference 15 rare early-onset CTGACCTGTG-AGTGAGAAG encephalopathy, Non- edited sgRNA - 4.95% (6804 reads) 16 rare early-onset CTGACCTG-----TGAGAAG encephalopathy, gRNA 1.70% (2302 reads) 17 rare early-onset CTGACCTGTGTAGTGAGAAG encephalopathy, gRNA + AZD7648 17.55% (86705 reads) 18 cystic fibrosis, TGGCACCATTAAAGAAAATATCATT Wildtype CFTRGGT19cystic fibrosis, CACCATTAAAGAAAATATCATCGTT F508 / TGGdelG20cystic fibrosis, TGGCACCATTAAAGAAAATATCATC gRNA1TTT21cystic fibrosis, TGGCACCATTAAAGAAAATATCATC gRNA1 + AZD7648TTTGGTG22cystic fibrosis, TGGCACCATTAAAGAAAATATCATC gRNA2TTTGGT23Progeria, Wildtype CCCAGGTGGGCGGACCCATCTCCTC LMNAT24Progeria, c.1824 C>T; CCCAGGTGGGTGGACCCATCTCCTC p.G608GT25CCCAGGTGGGGGGACCCATCTCCTC Progeria, gRNAT26 Docket No.10935-034WO1 IBMPFD, Wildtype CCCACCCCGGACAAGAAAAATATCT VCPCCT27CCACAGCACGCATCCCCCCCGAACA IBMPFD, gRNA1AAA28ACGCATCCCACCCCGGACAAGCCCC IBMPFD, gRNA2CTA29AGCACGCATCCCACCCCGGACAAGA IBMPFD, gRNA3AAA30CAGCACGCATCCCACCCCGGACAAG IBMPFD, gRNA4AAA31IBMPFD, VCP CCCACCCCGGACAAGAAAAATCTCT mutantCCT32IBMPFD, gRNA3- CCCACCCCGGACAAAAAAAATATCT VCP mutant 33 IBMPFD, gRNA4- CCCACCCCGGACAAAAAAAATATCT VCP mutantCCT34IBMPFD, Wild type GAGATATTTTTCTTGTCCGGGGTGG VCP referenceGATGCGTGCTGTGGA35IBMPFD, VCP GAGATATTTTTCTTGTCCATGGTGGG 49.16% (42475 reads)ATGCGTGCTGTGGA36IBMPFD, VCP GAGATATTTTTCTTGTCCGGGGTGG 0.30% (258 reads)GATGCGTGCAGTGGA37IBMPFD, VCP GAGATATTTTTCTTGTCCATGGTGGG 0.25% (217 reads)ATGCGTGCAGTGGA38IBMPFD, gRNA2- AGATATTTTTCTTGTTCCATGGTGGG VCP mutant 7.39% ATGCGTGCTGTGGA (4211 reads) 39 IBMPFD, gRNA2- GAGATATTTTTCTTGTTCCATGGGGG VCP mutant 2.33% ATGCGTGCTGTGGA (1327 reads) 40 IBMPFD, gRNA2- GAGATATTTTTCTTGTCATG- VCP mutant 1.69% GTGGGATGCGTGCTGTGGA (965 reads) 41 IBMPFD, Mouse GGAGATATTTTTCTTGTCCGGGGTG wildtype VCP 5'GGATGCGTGCTGTGG42IBMPFD, Mouse CCTCTATAAAAGAACAGGCCCCACC wildtype VCP 3'CTACGCACGACACC43IBMPFD, Mouse GGAGATATTTTTCTTGTCCATGGTGG mutant VCP - R155H GATGCGTGCTGTGG 5' 44 IBMPFD, Mouse CCTCTATAAAAGAACAGGTACCACC mutant VCP - R155H CTACGCACGACACC 3' 45IBMPFD, gRNA1ACCACCCTACGCACGACACC46IBMPFD, gRNA2GGAGATATTTTTCTTGTCCA47 Docket No.10935-034WO1IBMPFD, gRNA3GATATTTTTCTTGTCCATGG48IBMPFD, gRNA4ATATTTTTCTTGTCCATGGT49IBMPFD, gRNA3- GAGATATTTTTCTTGTCCAATGGTGG VCP mutant 10.71% GATGCGTGCTGTGG (14022 reads) 50 IBMPFD, gRNA3- GAGATATTTTTCTTGTCCTG- VCP mutant 2.35% GTGGGATGCGTGCTGTGGA (3070 reads) 51 IBMPFD, gRNA3- GAGATATTTTTCTTGTCCAG-- VCP mutant 2.14% TGGGATGCGTGCTGTGGA (2806 reads) 52 IBMPFD, gRNA4- GAGATATTTTTCTTGTCCATTGGTGG VCP mutant 22.29% GATGCGTGCTGTGG (33180 reads) 53 IBMPFD, gRNA4- GAGATATTTTTCTTGTCCAG- VCP mutant 4.27% GTGGGATGCGTGCTGTGGA (6362 reads) 54 IBMPFD, gRNA4- GAGATATTTTTCTTGTCCGG-- VCP mutant 1.33% TGGGATGCGTGCTGTGGA (1981 reads) 55 IBMPFD, VCP GGAGACATTTTTCTTGTCCGTGGTGG c.464G>AGATGC56IBMPFD, VCP GGAGACATTTTTCTTGTCCATGGTGG c.464G>A gRNA1GATGC57rare early-onset ACATTTTAAATTTCAGGATT encephalopathy, Non- Edited wildtype TBCD (P8M2) - 48.72% (60694 reads) 58 rare early-onset ACATTTTAAATTTCGGGATT encephalopathy, Non- Edited TBCD (P8M2) - 48.08% (59888 reads) 59 IBMPFD, VCP CTTTCGGACACCCAGTGCTTG Mouse-Fwd 60 IBMPFD, VCP TTACCCACTGAGCCATCTCACC Mouse-Rev 61 IBMPFD, VCP TTGATGGGCTTCTGACATGTCA Human-FWD 62 IBMPFD, VCP AGTACTGGGATTACAGGTGTCA Human-Rev 63 rare early-onset GAGCTAAGCTTGCACCACGGCA encephalopathy, TBCD P1M2-Fwd 64 rare early-onset TCCTCACTCTCGGCAGCTGCTT encephalopathy, TBCD P1M2-Rev 65 Docket No.10935-034WO1 Progeria, LMNA- AAGCTTGCTCCCGTTCTCTCTT Fwd 66Progeria, LMNA-RevGCAGTTCTGGGGGCTCTAAGAG67cystic fibrosis, CTFR CCTTCTACTCAGTTTTAGTC Forward 68 cystic fibrosis, CTFR TGGGTAGTGTGAAGGGTTCAT Reverse 69 Charcot-Marie-Tooth AGGCCCTCATTTCCTTCTGC disease, ITPR3 Forward 70 Charcot-Marie-Tooth ATCAAGTCATCAGCTCCGGG disease, ITPR3 Reverse 71 IBMPFD, VCP-NEO- TGGTCCTGTACTTGACACCTCT NGS-Fwd 72 IBMPFD, VCP-NEO- TCACCTCTCGCTTGATTGGCTC NGS-Rev 73 rare early-onset GGCTGTGGTCTCAGGATCTTT encephalopathy, P1M1-NGS-Fwd 74 rare early-onset TCACCATCCACGAGTCGAGATG encephalopathy, P1M1-NGS-Rev 75 rare early-onset AGAGGAGCTGATCACGCAGTAC encephalopathy, P1M2-NGS-Fwd 76 rare early-onset CCAGCTACAAGCACTGATGGGT encephalopathy, P1M2-NGS-Rev 77 Charcot-Marie-Tooth TGTGCTGAACCTCATCTTTGGG disease, ITPR3-NGS- FP 78 rare early-onset GCTGAGCTTCGGAACCCCGAGGAGA encephalopathy, TGACTCGCTGTGGCTTCTCG Wildtype Allele TBCD 5' 79 rare early-onset CGACTCGAAGCCTTGGGGCTCCTCT encephalopathy, ACTGTGAGCGACACCGAAGA Wildtype Allele TBCD 3'' 80 rare early-onset GCTGAGCTTCGGAACCCC …... encephalopathy, GAGATGACTCGCTGTGGCTTCTCG Mutant Allele TBCD Patient 1 mutation 2: 2305-2307 ΔGAG 5' 81 rare early-onset CGACTCGAAGCCTTGGGG…...CTCTA encephalopathy, CTGTGAGCGACACCGAAGA Mutant Allele TBCD Patient 1 mutation 2: 2305-2307 ΔGAG 3' 82 Docket No.10935-034WO1 rare early-onset AACCCC…...GAGATGACTCGCTGTG encephalopathy, G Mutant Allele TBCD Patient 1 mutation 2: 2305-2307 ΔGAG gRNA1 83 rare early-onset GG…...CTCTACTGTGAGCGACACCG encephalopathy, A Mutant Allele TBCD Patient 1 mutation 2: 2305-2307 ΔGAG gRNA2 84 rare early-onset G…...CTCTACTGTGAGCGACACCGA encephalopathy, A Mutant Allele TBCD Patient 1 mutation 2: 2305-2307 ΔGAG gRNA3 85 rare early-onset TTGTTAGCTCACACATTTTAAATTTC encephalopathy, AGGATTTGCCAGACTGTTG Wildtype Allele TBCD 5' 86 rare early-onset CAACAGTCTGGCAAATCCTGAAATT encephalopathy, TAAAATGTGTGAGCTAACAA Wildtype Allele TBCD 3'' 87 rare early-onset TTGTTAGCTCACACATTTTAAATTTC encephalopathy, gGGATTTGCCAGACTGTTG Mutant Allele TBCD Patient 8 mutation 2: 2472-2 A>G 5' 88 rare early-onset CAACAGTCTGGCAAATCCcGAAATT encephalopathy, TAAAATGTGTGAGCTAACAA Mutant Allele TBCD Patient 8 mutation 2: 2472-2 A>G 3' 89 rare early-onset AGCTCACACATTTTAAATTT encephalopathy, Mutant Allele TBCD Patient 8 mutation 2: 2472-2 A>G gRNA 90 Charcot-Marie-Tooth TCGACACCTTCGCTGACCTGCGTAG disease, Wildtype TGAGAAGCAGAAGAAGGAGGA Allele ITPR35' 91 Charcot-Marie-Tooth AGCTGTGGAAGCGACTGGACGCATC disease, Wildtype ACTCTTCGTCTTCTTCCTCCT Allele ITPR33'' 92 Docket No.10935-034WO1 Charcot-Marie-Tooth TCGACACCTTCGCTGACCTGTGTAGT disease, Mutant GAGAAGCAGAAGAAGGAGGA Allele ITPR3 c.7570C>T, p. Arg2524Cys 5' 93 Charcot-Marie-Tooth AGCTGTGGAAGCGACTGGACACATC disease, Mutant ACTCTTCGTCTTCTTCCTCCT Allele ITPR3 c.7570C>T, p. Arg2524Cys 3' 94 Charcot-Marie-Tooth TCTTCTGCTTCTCACTACAC disease, Mutant Allele ITPR3 c.7570C>T, p. Arg2524Cys gRNA1 95 cystic fibrosis, CACCATTAAAGAAAATATCATCTTT Wildtype Allele GGTGTTTCCTATGATGAATATAGA CFTR 5' 96 cystic fibrosis, GTGGTAATTTCTTTTATAGTAGAAAC Wildtype Allele CACAAAGGATACTACTTATATCT CFTR 3'' 97 cystic fibrosis, CACCATTAAAGAAAATATCAT…TGG Mutant Allele TGTTTCCTATGATGAATATAGA F508del Mutation: 1521-1523 ΔCTT 5' 98 cystic fibrosis, GTGGTAATTTCTTTTATAGTA…ACC Mutant Allele ACAAAGGATACTACTTATATCT F508del Mutation: 1521-1523 ΔCTT 3' 99 cystic fibrosis, ACCATTAAAGAAAATATCAT Mutant Allele F508del Mutation: 1521-1523 ΔCTT gRNA1 (5') 100 cystic fibrosis, AATTTCTTTTATAGTA…ACCA Mutant Allele F508del Mutation: 1521-1523 ΔCTT gRNA2 (3') 101 Progeria, Wildtype AGCCCAGGTGGGCGGACCCATCTCC Allele LMNA 5'TCTGG102Progeria, Wildtype TCGGGTCCACCCGCCTGGGTAGAGG Allele LMNA 3''AGACC103Progeria, Mutant AGCCCAGGTGGGTGGACCCATCTCC Allele LMNA, c.1824 TCTGG C>T;p.G608G 5' 104 Progeria, Mutant TCGGGTCCACCCACCTGGGTAGAGG Allele LMNA,AGACC105 Docket No.10935-034WO1 c.1824 C>T;p.G608G 3' Progeria, Mutant CCACCCACCTGGGTAGAGGA Allele LMNA, c.1824 C>T;p.G608G gRNA1 106 Progeria, Mutant TCCACCCACCTGGGTAGAGG Allele LMNA, c.1824 C>T;p.G608G gRNA2 107 Charcot-Marie-Tooth CAAACCGCTACTGCCACTGG disease, ITPR3-NGS- RP 108 CtaatgaagggcactctctaatgaGCTTGGCATTT IBMPFD, VCP WT GACCCCAGGGTCTGATGAGTTCTCA allele amino acid R – CTTTGTCTTGTAGTTGACACCTCTAA 7755 - 7850 CTGTGCTTG 109 IBMPFD, VCP WT GattacttcccgtgatagattactCGAACCGTAAA allele amino acid R – ACTGGGGTCCCAGACTACTCAAGAG 7755 – 7850 TGAAACAGAACATCAACTGTGGAGA complimentary strand TTGACACGAAC 110 TTGCTCTCGCAGGAGACATTTTTCTT GTCCATGGTGGGATGCGTGCTGTGG IBMPFD, mutant AGTTCAAAGTGGTGGAAACAGATCC allele amino acid H TAGCCCTTATTGCATTGTTG 111 AACGAGAGCGTCCTCTGTAAAAAGA IBMPFD, mutant ACAGGTACCACCCTACGCACGACAC allele amino acid H CTCAAGTTTCACCACCTTTGTCTAGG complimentary strand ATCGGGAATAACGTAACAAC 112 IBMPFD, 897-16133: GDIFLVHGGMRAVEFKVVETDPSPYC Region 5 aa 149-176IV113ACACAGTGATCCACTGCGAAGGGGA IBMPFD, VCP WT GCCTATCAAACGAGAGGTGAGTTTT allele amino acid R – CTCCCTGATTCCAGTATCCGATTTTA 7857 - 7952 TGATTACTCAGTGTGGCATC 114 TGTGTCACTAGGTGACGCTTCCCCTC IBMPFD, VCP WT GGATAGTTTGCTCTCCACTCAAAAG allele amino acid R – AGGGACTAAGGTCATAGGCTAAAAT 7857 – 7952 ACTAAGAGTCACACCGTAG complimentary strand 115 IBMPFD, 897-16133: DTVIHCEGEPIKRE Region 5 aa 179-192 116 Docket No.10935-034WO1 IBMPFD, VCP GAGACATTTTTCTTGTCCGTGGTGGG c.464G>AAT117IBMPFD, VCP GAGACATTTTTCTTGTCCATGGTGGG c.464G>A gRNA1AT118IBMPFD, VCP GAGACATTTTTCTTGTCCGTGGGGG c.464G>A gRNA3GAT119GTATTGCTTTGTATTATAGGAGATAT IBMPFD, mutant TTTTCTTGTCCATGGTGGGATGCGTG allele amino acid H – CTGTGGAGTTCAAAGTTGTAGAGAC 7146 - 7240 AGATCCCAGCCCTTACT 120 IBMPFD, mutant CATAACGAAACATAATATCCTCTAT allele amino acid H – AAAAAGAACAGGTACCACCCTACGC 7146 – 7240 ACGACACCTCAAGTTTCAACATCTC Complimentary TGTCTAGGGTCGGGAATGA strand 121 IBMPFD, 368-20017: GDIFLVHGGMRAVEFKVVETDPSPY Region 5 aa 149-173 122 GCTCCAGACACAGTGATCCACTGTG IBMPFD, mutant AGGGGGAGCCAATCAAGCGAGAGG allele amino acid H – TGAGTTACTCCCTAATCCCAGTTCAC 7249 - 7341 GGTTTTATTTGGCTTtttat 123 CGAGGTCTGTGTCACTAGGTGACAC IBMPFD, mutant TCCCCCTCGGTTAGTTCGCTCTCCAC allele amino acid H – TCAATGAGGGATTAGGGTCAAGTGC 7249 – 7341 CAAAATAAACCGAAaaat complimentary strand 124 IBMPFD, 368-20017: APDTVIHCEGEPIKRE Region 5 aa 177-192 125

Claims

Docket No.10935-034WO1 CLAIMS What is claimed is:

1. A method of treating a subject with a disease caused by a heterozygous mutation, the method comprising: a) obtaining a sample from the subject, b) isolating a cell from the sample, wherein the cell comprises the heterozygous mutation, c) introducing to the cell a CRISPR / Cas endonuclease system comprising a guide RNA (gRNA), wherein the gRNA induces a double strand break (DSB) in a mutant allele, initiates correction of the heterozygous mutation, and generates a homozygous wild-type cell, d) isolating one or more nucleic acids from the homozygous wild-type cell, e) sequencing the one or more nucleic acids to confirm correction of the heterozygous mutation, f) expanding the homozygous wild-type cell, and g) administering to the subject a pharmaceutically effective amount of a therapeutic composition comprising the one or more nucleic acids of step d) or the homozygous wild-type cell of step f).

2. The method of claim 1, further comprising correcting the heterozygous mutation without an exogenous DNA template.

3. The method of claim 1 or 2, wherein a wild-type allele serves as an endogenous DNA template.

4. The method of any one of claims 1-3, wherein the gRNA comprises one or more mutated nucleotides located within a protospacer adjacent motif (PAM) sequence.

5. The method of any one of claims 1-3, wherein the gRNA comprises one or more mutated nucleotides located at least one nucleotide away from the PAM sequence.

6. The method of claim 5, wherein the one or more mutated nucleotides are located 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides away from the PAM sequence.

7. The method of any one of claims 1-6, wherein the CRISPR / Cas endonuclease system is introduced into the cell using an adeno-associated viral (AAV) vector or a nanoparticle.Docket No.10935-034WO1 8. The method of any one of claims 1-7, wherein the DSB induces homology-directed repair (HDR) of the heterozygous mutation.

9. The method of any one of claims 1-8, further comprising introducing an HDR enhancer into the cell.

10. The method of claim 9, wherein the HDR enhancer comprises AZD7648 and / or IDT HDR enhancer version 2 (v2), or a variant thereof.

11. The method of any one of claims 1-10, wherein the disease comprises inclusion body myopathy, Paget disease, frontotemporal dementia, an encephalopathy, Charcot-Marie-Tooth disease, severe combined immunodeficiency (SCID), cystic fibrosis, Hutchinson-Gilford progeria syndrome, Nemaline myopathy, delayed developmental milestones, respiratory disorders, and dilated cardiomyopathy, or a combination thereof.

12. The method of any one of claims 1-11, wherein the disease is inclusion body myopathy with early onset Paget disease and frontotemportal dementia (IBMPFD).

13. The method of claim any one of claims 1-12, wherein the disease comprises a heterozygous mutation in a Valosin Containing Protein (VCP) gene.

14. The method of claim 13, wherein the heterozygous mutation in the VCP gene is a substitution Arg155His mutation.

15. The method of any one of claims 1-14, wherein a gRNA comprising SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, or SEQ ID NO: 49 targets the substitution Arg155His mutation.

16. The method of any one of claims 1-15, wherein the disease is an early onset encephalopathy.

17. The method of any one of claims 1-16, wherein the disease comprises a heterozygous mutation in a tubulin folding cofactor D (TBCD) gene.

18. The method of claim 17, wherein the heterozygous mutation in the TBCD gene comprises a deletion mutation at nucleotide positions 2305-2307 and substitution Gly2991Ala mutation.Docket No.10935-034WO1 19. The method of any one of claims 1-18, wherein a gRNA comprising SEQ ID NO: 83, SEQ ID NO: 84, or SEQ ID NO: 85 targets the deletion mutation at nucleotide positions 2305-2307.

20. The method of any one of claims 1-19, wherein a gRNA comprising SEQ ID NO: 90 targets the substitution Gly2991Ala mutation.

21. The method of any one of claims 1-20, wherein the disease is Charot-Marie-Tooth disease and SCID.

22. The method of any one of claims 1-21, wherein the disease comprise a heterozygous mutation in an inositol 1,4,5 triphosphate receptor 3 (ITPR3) gene.

23. The method of claim 22, wherein the heterozygous mutation in the ITPR3 gene comprises substitution Arg2524Cys mutation.

24. The method of any one of claims 1-23, wherein a gRNA comprising SEQ ID NO: 95 targets the substitution Arg2524Cys mutation.

25. The method of any one of claims 1-24, wherein the disease is cystic fibrosis.

26. The method of any one of claims 1-25, wherein the disease comprises a heterozygous mutation in a cystic fibrosis transmembrane conductance regulator (CFTR) gene.

27. The method of claim 26, wherein the heterozygous mutation in the CFTR gene comprises a deletion mutation at nucleotide positions 1521-1523.

28. The method of any one of claims 1-27, wherein a gRNA comprises SEQ ID NO: 100 or SEQ ID NO: 101 targets the deletion mutation at nucleotide positions 1521-1523.

29. The method of any one of claims 1-28, wherein the disease is a Hutchinson-Gilford progeria syndrome.Docket No.10935-034WO1 30. The method of any one of claims 1-29, wherein the disease comprises a heterozygous mutation in a laminin (LMNA) gene.

31. The method of claim 30, wherein the heterozygous mutation in the LMNA gene comprises a dominant-negative C•G-to-T•A mutation.

32. The method of any one of claims 1-31, wherein a gRNA comprising SEQ ID NO: 106 and SEQ ID NO: 107 targets the dominant-negative C•G-to-T•A mutation.

33. The method of any one of claims 1-32, wherein the disease is a skeletal muscle myopathy.

34. The method of any one of claims 1-33, wherein the disease comprises a heterozygous mutation in an alpha-actin (α-ACTN) gene.

35. The method of claim 34, wherein the heterozygous mutation comprises a substitution H40Y mutation.

36. The method of any one of claims 1-35, wherein a gRNA comprising CGTGGGCCGCCCCCGATACC, GGCTATGGTCCAGTCCGACG, GCTATGGTCCAGTCCGACGG, CTATGGTCCAGTCCGACGGG, or TATGGTCCAGTCCGACGGGG targets the substitution H40Y mutation.

37. The method of any one of claims 1-36, wherein the therapeutic composition comprises an adeno-associated viral (AAV) vector, a nanoparticle, an extracellular vesicle, a cell, or a combination thereof.

38. The method of any one of claims 1-37, wherein the one or more nucleic acids are sequenced using Sanger sequencing, Next-generation sequencing (NGS) Deep sequencing, or a variant thereof.

39. The method of any one of claims 1-38, wherein the subject is further administered an additional therapeutic agent.Docket No.10935-034WO1 40. The method of any one of claims 1-39, wherein the method prevents the disease when the subject is treated prior to the onset of symptoms.

41. A method of repairing a heterozygous mutation in a nucleic acid sequence, the method comprising: a) introducing into a cell a CRISPR / Cas endonuclease system comprising a guide RNA (gRNA), wherein the cell comprises the heterozygous mutation, and wherein the gRNA induces a double strand break (DSB) in a mutant allele, initiates repair of the heterozygous mutation, and generates a homozygous wild-type cell, b) isolating one or more nucleic acids from the homozygous wild-type cell, and c) sequencing the one or more nucleic acids to confirm repair of the heterozygous mutation.

42. The method of claim 41, further comprising correcting the heterozygous mutation without an exogenous DNA template.

43. The method of claim 41 or 42, wherein a wild-type allele serves as an endogenous DNA template.

44. The method of any one of claims 41-43, wherein the gRNA comprises one or more mutated nucleotides located within a protospacer adjacent motif (PAM) sequence.

45. The method of any one of claims 41-43, wherein the gRNA comprises one or more mutated nucleotides located at least one nucleotide away from the PAM sequence.

46. The method of claim 45, wherein the one or more mutated nucleotides are located 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides away from the PAM sequence.

47. The method of any one of claims 41-46, wherein the CRISPR / Cas endonuclease system is introduced into the cell using an adeno-associated viral (AAV) vector or a nanoparticle.

48. The method of any one of claims 41-47, wherein the DSB induces homology-directed repair (HDR) of the heterozygous mutation.Docket No.10935-034WO1 49. The method of any one of claims 41-48, wherein the heterozygous mutation causes a disease selected from inclusion body myopathy, Paget disease, frontotemporal dementia, an encephalopathy, Charcot-Marie-Tooth disease, severe combined immunodeficiency (SCID), cystic fibrosis, Hutchinson-Gilford progeria syndrome, or a combination thereof.

50. The method of any one of claims 41-49, wherein the disease is inclusion body myopathy with early onset Paget disease and frontotemportal dementia (IBMPFD).

51. The method of claim any one of claims 41-50, wherein the disease comprises a heterozygous mutation in a Valosin Containing Protein (VCP) gene.

52. The method of claim 51, wherein the heterozygous mutation in the VCP gene is a substitution Arg155His mutation.

53. The method of any one of claims 41-52, wherein a gRNA comprising SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, and SEQ ID NO: 49 targets the substitution Arg155His mutation.

54. The method of any one of claims 41-53, wherein the disease is an early onset encephalopathy.

55. The method of any one of claims 41-54, wherein the disease comprises a heterozygous mutation in a tubulin folding cofactor D (TBCD) gene.

56. The method of claim 55, wherein the heterozygous mutation in the TBCD gene comprises a deletion mutation at nucleotide positions 2305-2307 and substitution Gly2991Ala mutation.

57. The method of any one of claims 41-56, wherein a gRNA comprising SEQ ID NO: 83, SEQ ID NO: 84, and SEQ ID NO: 85 targets the deletion mutation at nucleotide positions 2305-2307.

58. The method of any one of claims 41-57, wherein a gRNA comprising SEQ ID NO: 90 targets the substitution Gly2991Ala mutation.

59. The method of any one of claims 41-58, wherein the disease is Charot-Marie-Tooth disease and SCID.Docket No.10935-034WO1 60. The method of any one of claims 41-59, wherein the disease comprise a heterozygous mutation in an inositol 1,4,5 triphosphate receptor 3 (ITPR3) gene.

61. The method of claim 60, wherein the heterozygous mutation in the ITPR3 gene comprises substitution Arg2524Cys mutation.

62. The method of any one of claims 41-61, wherein a gRNA comprising SEQ ID NO: 95 targets the substitution Arg2524Cys mutation.

63. The method of any one of claims 41-62, wherein the disease is cystic fibrosis.

64. The method of any one of claims 41-63, wherein the disease comprises a heterozygous mutation in a cystic fibrosis transmembrane conductance regulator (CFTR) gene.

65. The method of claim 64, wherein the heterozygous mutation in the CFTR gene comprises a deletion mutation at Phe508.

66. The method of any one of claims 41-65, wherein a gRNA comprises SEQ ID NO: 100 and SEQ ID NO: 101 targets the deletion mutation at Phe508.

67. The method of any one of claims 41-66, wherein the disease a Hutchinson-Gilford progeria syndrome.

68. The method of any one of claims 41-67, wherein the disease comprises a heterozygous mutation in a laminin (LMNA) gene.

69. The method of claim 68, wherein the heterozygous mutation in the LMNA gene comprises a dominant-negative C•G-to-T•A mutation.

70. The method of any one of claims 41-69, wherein a gRNA comprising SEQ ID NO: 106 or SEQ ID NO: 107 targets the dominant-negative C•G-to-T•A mutation.

71. The method of any one of claims 41-70, wherein the disease is a skeletal muscle myopathy.Docket No.10935-034WO1 72. The method of any one of claims 41-71, wherein the disease comprises a heterozygous mutation in an alpha-actin (α-ACTN) gene.

73. The method of claim 72, wherein the heterozygous mutation comprises a substitution H40Y mutation.

74. The method of any one of claims 41-73, wherein a gRNA comprising CGTGGGCCGCCCCCGATACC, GGCTATGGTCCAGTCCGACG, GCTATGGTCCAGTCCGACGG, CTATGGTCCAGTCCGACGGG, or TATGGTCCAGTCCGACGGGG targets the substitution H40Y mutation.

75. The method of any one of claims 41-74, further comprising introducing an HDR enhancer into the cell.

76. The method of claim 75, wherein the HDR enhancer comprises AZD7648 and / or IDT HDR enhancer version 2 (v2), or a variant thereof.

77. The method of any one of claims 41-76, wherein the one or more nucleic acids are sequenced using Sanger sequencing, Next-generation sequencing (NGS) Deep sequencing, or a variant thereof.

78. The method of any one of claims 41-77, wherein the method is performed ex-vivo or in-vitro.

79. A method of generating a homozygous mutation in a nucleic acid sequence, the method comprising: a) isolating a cell from a sample, b) introducing into the cell to a CRISPR / Cas endonuclease system comprising a guide RNA (gRNA), wherein the nucleic acid sequence comprises a first heterozygous mutation in a first allele, and wherein the gRNA induces a double strand break (DSB) in a wild-type allele, initiates synthesis of a second heterozygous mutation in a second allele, and generates a homozygous mutant nucleic acid, and c) sequencing the nucleic acid to confirm generation of the homozygous mutant nucleic acid.Docket No.10935-034WO1 80. The method of claim 79, further comprising generating the homozygous mutant without an exogenous DNA template.

81. The method of claim 79 or 80, wherein a mutant allele serves as an endogenous DNA template.

82. The method of any one of claims 79-81, wherein the gRNA comprises one or more mutated nucleotides located within a protospacer adjacent motif (PAM) sequence.

83. The method of any one of claims 79-81, wherein the gRNA comprises one or more mutated nucleotides located at least one nucleotide away from the PAM sequence.

84. The method of claim 83, wherein the one or more mutated nucleotides are located 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides away from the PAM sequence.

85. The method of any one of claims 79-84, wherein the CRISPR / Cas endonuclease system is introduced into the cell using an adeno-associated viral (AAV) vector or a nanoparticle.

86. The method of any one of claims 79-85, wherein the DSB induces homology-directed repair (HDR) of the wild-type allele.

87. The method of any one of claims 79-86, further comprising introducing an HDR enhancer into the cell.

88. The method of claim 87, wherein the HDR enhancer comprises AZD7648 and / or IDT HDR enhancer version 2 (v2), or a variant thereof.

89. The method of any one of claims 79-88, wherein the one or more nucleic acids are sequenced using Sanger sequencing, Next-generation sequencing (NGS) Deep sequencing, or a variant thereof.

90. The method of any one of claims 89, wherein the sample is a tissue sample or a blood sample.

91. The method of any one of claims 79-90, wherein the method is performed ex-vivo or in-vitro.Docket No.10935-034WO1 92. A CRISPR / Cas system comprising a guide RNA (gRNA) sequence, wherein the gRNA targets a nucleic acid sequence without an exogenous DNA template, and wherein the gRNA induces a double strand break (DSB) in a first allele, initiates homology-directed repair (HDR) of the first allele, and generates a homozygous wild-type genotype.

93. The CRISPR / Cas system of claim 92, wherein a second allele serves as an endogenous DNA template.

94. The CRISPR / Cas system of claim 92 or 93, wherein the gRNA comprises one or more mutated nucleotides located within a protospacer adjacent motif (PAM) sequence.

95. The CRISPR / Cas system of claim 92 or 93, wherein the gRNA comprises one or more mutated nucleotides located at least one nucleotide away from the PAM sequence.

96. The method of claim 95, wherein the one or more mutated nucleotides are located 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides away from the PAM sequence.

97. The CRISPR / Cas system of any one of claims 92-96, wherein the gRNA comprises SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 90, SEQ ID NO: 95, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 106, or SEQ ID NO:

107.

98. The CRISPR / Cas system of any one of claims 92-97, wherein the CRISPR / Cas endonuclease system is introduced into a cell using an adeno-associated viral (AAV) vector or a nanoparticle.

Citation Information

Patent Citations

  • Systems and methods for treating alpha 1-antitrypsin (A1AT) deficiency

    US20200216843A1

  • Human gene correction

    US20210130849A1