Autoimmune disease therapy using engineered cells

Abstract

Provided are engineered cells, including induced pluripotent stem cells (iPSCs), primary immune cell, and hematopoietic cells derived therefrom, pharmaceutical compositions comprising said cells, and methods of use of same, wherein one or more genes are disrupted and / or transfected into said cells, such that ADCC activation exhibits an improved safety profile.

Description

AUTOIMMUNE DISEASE THERAPY USING ENGINEERED CELLSCROSS REFERENCE TO THE RELATED APPLICATIONS

[0001] The present disclosure is based upon and claims priority to International Application Application No. PCT / CN2024 / 079630, filed on March 01, 2024, the entire contents of which are incorporated herein by reference.FIELD

[0002] The present disclosure relates generally to the field of immunotherapies, and more specifically to engineered hematopoietic cells, e.g., natural killer (NK) cells or T cells, and uses thereof.BACKGROUND

[0003] Systemic lupus erythematosus (SLE) , commonly referred to as lupus, is a severe, life-threatening autoimmune disease involving autoreactive B cells, which cause damage to tissues or organs due to accumulation of autoreactive antibodies (auto-antibodies) . The transmembrane protein CD19 is a cell-surface antigen and biomarker for B cells. The use of anti-CD19-CAR-T cells can be used to deplete B cells, and thus is a potential therapeutic method for treating autoimmune diseases such as SLE. Anti-CD19-CAR-T cells eliminate CD19+B cells which produce auto-antibodies and induce SLE symptoms. Several anti-CD19-CAR-T cell and anti-BCMA-CAR-T cell (wherein BCMA is B-cell maturation antigen) therapies are registered in clinical trials around the world. In addition to SLE, anti-CD19-CAR-T cells are also applicable to other B cell-mediated autoimmune diseases, such as refractory antisynthetase syndrome and systemic sclerosis.

[0004] Natural killer (NK) cells are cytotoxic lymphocytes of the innate immune system whose natural function is to kill microbial-infected, virus-infected, and / or cancerous cells. Antibody-dependent cell-mediated cytotoxicity (ADCC) is a primary mechanism by which NK cells can target and lyse antibody-coated tumor cells or damaged autologous cells. Auto-antibodies can mistakenly target and attack a person’s own tissue and organs. In autoimmune diseases, auto-antibodies cause inflammation and damage to various organs of the body. Based on this, it is possible that adoptive NK cells can be activated by auto-antibodies in the B cell-driven autoimmune disease. NK cells are implicated in contributing to pathogenesis of immune-and autoimmune-disorders, such as SLE, rheumatoid arthritis (RA) , and multiple sclerosis (MS) .

[0005] Immune cells engineered with chimeric antigen receptor (CAR) constructs are widely applicable to cancer and autoimmune diseases. CAR constructs contain several domains, for example, i) an extracellular antigen-binding domain, ii) an extracellular hinge domain, iii) a transmembrane domain, and iv) intracellular signaling domain. The single-chain variable fragment (scFv) is commonly used as an extracellular binder for CAR. The scFv can also be a camelid VHH, an artificial designed ankyrin repeat protein (CARPin) or D-domain, or a ligand for complementary antigen binding such as IL13 for IL13R.

[0006] The first generation of CAR constructs contained an intracellular signaling domain CD3z, which is necessary for T cell activation. The second generation of CAR constructs contained a costimulatory domain in addition to the CD3z motif, which could be, for example, CD28, CD137 (41BB) , OX40, which are important for T cell activation or proliferation.

[0007] NK-specific costimulatory domains deriving from NK-activating receptors such as 2B4 and NKG2D can be used in CAR-NK design, and exhibit superior potency, as shown by 2B4 costimulatory domain enhancing cytotoxicity ability of anti-CD5 chimeric antigen receptor engineered natural killer cells against T cell malignancies by Wang, et al., J. Hematol. Oncol. 12 (1) : 49 (2019) , the contents of which are incorporated herein by reference. However, selective ADCC pathways available in CAR-NK therapies remains relatively unexplored. NK cells express Fc-gamma receptors (FcγR) , the most prominent of which is FcγRIII (CD16) , which engages with and lyses antibody-coated target cells. Other immune cells such as macrophages, neutrophils, and eosinophils also mediate ADCC function via different FcRs, such as CD64, CD32a, or CD89.

[0008] The process of preparing CAR-T cells is time-consuming, labor-intensive, and costly, resulting in limited availability of CAR-T cell therapies. CAR-NK therapies present similar hurdles and are relatively unexplored. Moreover, there is a concern that CAR-NK cells may stimulate or exacerbate autoimmune conditions. Better approaches to making CAR-NK cells and delivering them to patients are needed. BRIEF DESCRIPTION

[0009] iPSC-derived CAR-NK cells present opportunities for introduction of allogenenic cells, as well as introduction of autologous cells. However, there have been difficulties with inducing differentiation of iPSCs into the hematopoietic cells. Moreover, NK cells create a risk of inducing or exacerbating antibody-mediated autoimmune disease by causing ADCC of cells bound by autoantibodies associated with an autoimmune condition.

[0010] We have made NK cells having CD16 knocked out and having CAR-ADCC constructs, e.g., wherein the CD16 binding region is replaced with a binder specifically targeting the tumor antigen, such as a scFv, VHH or a antigen binding region linked to the transmembrane and effector domain derived from CD16, so that the cell-mediated cytotoxicity of the NK cells, rather than being activated by binding of CD16 to the Fc region of an antibody (ADCC) is activated by the CAR-ADCC construct. These NK cells will not exacerbate an antibody-mediated autoimmune condition, as the CAR-ADCC is not binding to the Fc region of an antibody.

[0011] In certain embodiments, the cells (e.g., primary immune cells, iPSCs or NK cells derived therefrom) lack a functional CD16, and express a CAR-ADCC construct capable of inducing cell-mediated cytotoxicity through a CAR-dependent pathway, wherein the CAR-ADCC construct comprises a recognition domain (e.g., scFv) binding to a B-cell antigen (e.g., binding to CLL1, CD19, CD20, or BCMA) , a hinge sequence (e.g., comprising a sequence derived from CD16a, CD8, or a combination thereof) , a transmembrane domain (TMD) sequence (e.g., comprising a sequence derived from CD16a, CD32a, CD8, or a combination thereof) , an intracellular domain (ICD) sequence (e.g., comprising a sequence derived from CD16a, CD32a, or a combination thereof, and an intracellular co-stimulatory region, (e.g., CD3z) ; e.g., a CAR-ADCC construct comprising a leader sequence, a scFv sequence, a hinge sequence, a TMD sequence, an ICD sequence, or a combination thereof, e.g., as listed in any of SEQ ID No. 1-11.

[0012] We have also found that disruption of select gene (s) in induced pluripotent stem cells (iPSCs) allows for continued differentiation of iPSCs into hematopoietic cells, e.g., NK cells or T cells. In the case of NK cells, we have found that selective knockouts can target B cells (e.g., using CARs targeting CD19, CD20, BMCA, and / or CLL1) without enhancing canonical antibody-dependent cell-mediated cytotoxicity (ADCC) , thereby treating B-cell mediated autoimmune diseases. For example, in CAR-NK cells targeting B-cells, genetic knockout of CD16 prevents potential ADCC-mediated toxicity of the CAR-NK cells without impacting the capacity of B cell depletion by NK cells or impacting the differentiation process from iPSC to NK. Such constructs are useful in treating auto-antibody mediated autoimmune diseases.

[0013] For example, engineered cells with one or more disrupted CD16 genes exhibit reduced activation of canonical ADCC pathways. In patients with auto-immune diseases, B cells producing auto-antibodies can lead to tissue damage and myriad resultant complications. Natural hematopoietic cells, e.g., NK cells, can be activated by said auto-antibodies. Herein, the disclosure relates, in part, to the development of engineered cells capable of minimizing or avoiding activation of canonical ADCC pathways in hematopoietic cells and the use of said engineered cells in the treatment of auto-immune diseases or conditions.

[0014] We have further discovered that engineered cells with disruption of select genes, such as CD16, allow for further introduction of chimeric antigen receptor (CAR) constructs, wherein the disruption of select genes does not interfere with CAR-induced CC activation. By reducing the activation of canonical ADCC pathways and introducing one or more desired CAR constructs capable of selective activation of ADCC, more effective CAR-cell therapies can be developed with improved safety profiles and reduced side effects. Such side effects include release of interferon-gamma (IFN-γ) and cytokine release syndrome (CRS) .

[0015] For example, in some embodiments, an iPSC cell undergoes disruption, e.g., CRISPR / Cas9-mediated disruption, of CD16 resulting in a double knock-out CD16- / -engineered cell, which is further modified with a transgene to express a desired CAR construct, such as an anti-CD19 or anti-BCMA CAR construct. In some embodiments, the CD16- / -engineered cell is further modified with one or more additional CAR constructs.

[0016] In some embodiments, the one or more CAR constructs introduced into the engineered cell comprise one or more single-chain variable fragment domain (scFv) , hinge domain, transmembrane domain (TMD) , intracellular domain (ICD) , and combinations thereof; optionally, the CAR construct may comprise one or more leader sequence domain, intracellular costimulatory segment domain, fluorescent marker domain, or combinations thereof. In some embodiments, the CAR construct domains are independently derived from a mammal, such as a human or such as a non-human, such as genes encoding CD8, CD16a, CD32a, or CD3z.

[0017] By “CAR-ADCC” is meant a construct comprising a antigen recognition domain operably linked to the signaling domain of a receptor providing Antibody-Dependent Cellular Cytotoxicity (ADCC) , e.g., operably linked to the signaling domain of one or more Fc receptors, for example operably linked to one or more signaling domains of an Fcγ receptor, such as CD16a and / or CD32, such that the binding of the CAR to a target (rather than the Fc receptor binding to the Fc region of an antibody) results in cellular cytotoxicity similar to the cellular cytotoxicity of canonical ADCC. In particular embodiments, the CAR constructs are CAR-ADCC constructs, e.g., comprising one or more single-chain variable fragment domain (scFv) , hinge domain, transmembrane domain (TMD) , and intracellular domain (ICD) , wherein the hinge domain, transmembrane domain (TMD) , and intracellular domain (ICD) are derived from CD16a and / or CD32, and the scFv binds to an antigen other than the Fc domain of an antibody, e.g., to a B-cell antigen.

[0018] In some embodiments, the engineered cell is a hematopoietic stem cell or a hematopoietic cell, such as an NK cell, T cell, B cell, macrophage, or monocyte, preferably an NK cell or T cell, more preferably an NK cell. In some embodiments, the engineered cell is the progeny of any of the above cells.

[0019] In some embodiments, the engineered cell is used in treating a disease, such as cancer or an auto-immune disease or condition, in a patient in need thereof, such as a human. In some embodiments, the engineered cell is used in treating cancer, e.g., blood cancer, lung cancer, colorectal cancer, pancreatic cancer, renal cell cancer, or breast cancer, e.g., acute myeloid leukemia, acute lymphoblastic leukemia, Burkitt lymphoma, non-Hodgkin’s lymphoma, chronic lymphocytic leukemia, chronic myelogenous leukemia. In alternative embodiments, the engineered cell is used in treating an auto-immune disease or condition, e.g., an auto-immune disease or condition requiring reduced levels of B cells, e.g., B cells expressing or overexpressing CLL1, CD20, BCMA, CD19, CD33, and / or CD70. In some embodiments, the auto-immune disease or condition comprises lupus, systemic lupus erythematosus, multiple sclerosis, systemic sclerosis, vasculitis, Crohn’s disease, Myasthenia Gravis, Stiff-Person syndrome, Sjogren’s syndrome, rheumatoid arthritis, or a pulmonary condition.

[0020] The present disclosure thus provides engineered cells, including engineered stem cells, e.g., induced pluripotent stem cells (iPSCs) and engineered hematopoietic cells, e.g., NK cells or T cells (which engineered hematopoietic cells may be the progeny of the engineered stem cells) , which have reduced expression of CD16 at the cell surface, such that canonical stimulation of antibody-dependent cell-mediated cytotoxicity (ADCC) is substantially reduced (e.g., wherein CD16is knocked out in the cell or an ancestor thereof) , and wherein iPSCs which are so engineered can differentiate into hematopoietic cells, e.g., NK cells or T cells, without restricting the ability of the engineered stem cells to differentiate into the desired hematopoietic cells. The disclosure also provides pharmaceutical compositions comprising such engineered hematopoietic cells, methods of producing such cells, and methods of treating disease, e.g., cancer or auto-immune disease or conditions, using such cells.

[0021] Further, more specific embodiments are set forth in the detailed description below, and in the Examples.BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 depicts the gene structure of CD16a.

[0023] Figure 2 depicts fluorescence-activated cell sorting (FACS) of ANB induced pluripotent stem cells (iPSCs) with double-knockout CD16a- / - (CD16KO) and wild type (WT) and isotype (ISO) controls.

[0024] Figure 3 depicts CD16a- / -cell cytotoxicity against Raji cells in vitro.

[0025] Figure 4 depicts antibody-dependent cell-mediated cytotoxicity (ADCC) -based side effect verification of CD16a- / -iPSCs.

[0026] Figure 5 depicts CAR-ADCC gene constructs.

[0027] Figure 6 depicts a flowchart summarizing the preparation of CAR-NK cells.

[0028] Figure 7 depicts CD16a-derived anti-CLL1 CAR expression in CAR-NK cells detected using FACS with FITC-labelled recombinant CLL1 protein.

[0029] Figure 8 depicts lysis of AML tumor cell line HL60 cells after treatment with CD16a-derived anti-CLL1 CAR-ADCC NK cells.

[0030] Figure 9 depicts CD32-derived anti-CLL1 CAR expression in CAR-NK cells detected using FACS with FITC-labelled recombinant CLL1 protein.

[0031] Figure 10 depicts lysis of AML tumor cell lines HL60 cells after treatment with CD32-derived anti-CLL1 CAR-ADCC NK cells.

[0032] Figure 11 depicts cytotoxicity of Super NK cells expressing anti-CD20 CAR-ADCC.

[0033] Figure 12 depicts ADCC mediated by hnCD16 of Super NK cells with rituximab.

[0034] Figure 13 depicts cytotoxicity of CAR-NK cells expressing SEQ ID NO. 10 and 11 compared to canonical 41BBZ-CAR as control against MM. 1R cells at varying effector cell: target cell ratios.

[0035] Figure 14 depicts cytotoxicity of CAR-NK cells expressing SEQ ID NO. 10 and 11 compared to canonical 41BBZ-CAR as control against MM. 1R cells over time.

[0036] Figure 15 depicts decreased levels of IFN-γ release from CAR-NK cells relative to canonical 41BBZ-CAR cells.

[0037] Figure 16 depicts improved cytotoxicity of CAR-NK cells expressing both a CD32a-derived anti-BCMA CAR-ADCC and an anti-CD19 41BBZ-CAR construct.DETAILED DESCRIPTION

[0038] The following description of different embodiments is merely exemplary in nature and is in no way intended to limit the present disclosure, its application, or uses. I. Definitions

[0039] As used herein, the following terms have the meanings ascribed to them unless specified otherwise.

[0040] As used herein, the term “immune cell” generally refers to a differentiated hematopoietic cell. Non-limiting examples of an immune cell can include an NK cell, a T-cell, a monocyte, an innate lymphocyte, a tumor-infiltrated lymphocyte, a macrophage, a granulocyte, etc.

[0041] As used herein, the terms “Natural Killer cell” or “NK cell” generally refer to a subset of peripheral blood lymphocytes defined by the typical expression of CD56 or CD16 and the absence of the T cell receptor, i.e., CD3. In some cases, NK cells that are phenotypically CD3-and CD56+, expressing at least one of NKG2C and CD57 (e.g., NKG2C, CD57, or both in same or different degrees) , and optionally, CD16, but lack expression of one or more of the following: PLZF, SYK, FceRγ, and EAT-2. In some cases, isolated subpopulations of CD56+NK cells can exhibit expression of CD16, NKG2C, CD57, NKG2D, NCR ligands, NKp30, NKp40, NKp46, activating and inhibitory KIRs, NKG2A, and / or DNAM-1.

[0042] As used herein, the terms “immune response” and immune cell “activation” generally refer to T-cell mediated, B-cell mediated, and / or NK-cell mediated immune responses from a host’s immune system to an object, e.g., a foreign object, e.g., an exogenous or allogeneic cell. An example of an immune response includes T-cell responses, e.g., cytokine production and cellular cytotoxicity, e.g., antibody-dependent cell-mediated cytotoxicity (ADCC) . In some cases, an immune response can be indirectly affected by T-cell activation, e.g., antibody production (humoral responses) and activation of cytokine responsive cells, such as macrophages. As used herein, “activation” in the context of NK cells generally refers to the induction of a typical immune response, e.g., degranulation of NK cells.

[0043] As used herein, “canonical ADCC” refers to antibody-dependent cell-mediated cytotoxicity, wherein Fcγ receptors (e.g. CD16, also known as FcγRIII) on NK cells recognize and bind to the Fc domain of an antibody, such as IgG, which in turn is bound to the surface of a target cell, whereupon the NK cell releases cytotoxic factors that kill the target cell. In a CD16- / -NK cell, this canonical ADCC is disrupted.

[0044] In certain embodiments of the disclosure, the NK cells are engineered to express a “CAR-ADCC” construct, which provides a CAR-dependent cell-mediated cytotoxicity which is not antibody-mediated. In this embodiment of the disclosure, a chimeric antibody receptor (CAR) , upon binding to an antigen on a target cell, causes the NK cell to release cytotoxic factors that kill the target cell, similar to the release of cytotoxic factors that kill the target cell consequent to binding to the Fc region of an antibody in the case of ADCC.

[0045] As used herein, gene, DNA, and / or RNA “expression” is understood to refer to progression along the canonical pathway beginning with DNA, which may be transcribed into RNA, which may be translated into polypeptides / protein. “Overexpression” generally refers to an increased expression level of a polynucleotide and / or polypeptide sequence relative to its expression level in a wild-type state.

[0046] As used herein, an “engineered” cell is understood to mean a cell wherein the genome of the cell has a heterologous nucleic acid sequence or an altered nucleic acid sequence because of the application of genetic engineering techniques to the cell or an ancestor of the cell, such that the genome and gene expression of the engineered cell differs from the genome and gene expression of a normal, nonengineered cell. Genetic engineering techniques include DNA cloning technologies; transfection, transformation, and other gene transfer technologies; homologous recombination; site-directed mutagenesis; gene fusion; gene disruption; gene activation; and gene editing. In particular, an engineered cell includes, for example, a cell wherein (a) the genome of the cell (or an ancestor of the cell) has been genetically engineered to include a transgene (sometimes referred to as a “knock-in” ) and / or a heterologous promoter for an endogenous gene, and / or (b) the genome of the cell (or an ancestor of the cell) has been genetically engineered to have significantly reduced or eliminated expression of the functional protein expressed by the naturally occurring gene (e.g., using Crispr-Cas9, prime editing, base editing, gene disruption, or other gene editing approach, sometimes referred to as a “knock-out” ) .

[0047] The disclosure may refer to a coding sequence “operably linked to a heterologous promoter, ” meaning that the promoter is capable of driving expression of the coding sequence (i.e., is “operably linked” to the coding sequence) , but the coding sequence is not naturally associated with (i.e., is “heterologous” to) the promoter. Promoters for use in transgenes as described herein include, for example, constitutive promoters, such as viral promoters and synthetic promoters. For example, the CAG promoter is a strong synthetic promoter frequently used to drive high levels of gene expression in mammalian expression vectors. It is derived from the cytomegalovirus (CMV) early enhancer element [C] ; the promoter, the first exon and the first intron of chicken beta-actin gene [A] ; and the splice acceptor of the rabbit beta-globin gene [G] . Other strong constitutive promoters include the adenovirus major late promoter, the human cytomegalovirus immediate early promoter (hCMV-IE) , the SV40 and Rous Sarcoma virus promoters, the murine 3-phosphoglycerate kinase promoter, the translation elongation factor 1α (EF-1α) promoter, and the human ubiquitin C promoter. In certain embodiments, the coding sequence operably linked to a heterologous promoter is part of a transgene. In certain embodiments, the coding sequence is an endogenous coding region operably linked to a heterologous promoter to provide elevated or different expression relative to expression when under control of the natural promoter for the coding region.

[0048] The term "differentiation" generally refers to a process by which an unspecialized ( "uncommitted" ) or less specialized cell acquires the features of a specialized cell such as, e.g., an immune cell. A differentiated or differentiation-induced cell is one that has taken on a more specialized ( "committed" ) position within the lineage of a cell. The term "committed" generally refers to a cell that has proceeded in the differentiation pathway to a point where, under normal circumstances, it will continue to differentiate into a specific cell type or subset of cell types, and cannot, under normal circumstances, differentiate into a different cell type or revert to a less differentiated cell type.

[0049] The term "pluripotent" generally refers to the ability of a cell to form all lineages of the body or soma (i.e., the embryo proper) . For example, embryonic stem cells are a type of pluripotent stem cells that can form cells from each of the three germs layers, the ectoderm, the mesoderm, and the endoderm. Pluripotency can be a continuum of developmental potencies ranging from the incompletely or partially pluripotent cell (e.g., an epiblast stem cell) , which is unable to give rise to a complete organism to the more primitive, more pluripotent cell, which is able to give rise to a complete organism (e.g., an embryonic stem cell) .

[0050] The term "induced pluripotent stem cells" (iPSCs) generally refers to stem cells that are derived from differentiated cells (e.g., differentiated adult, neonatal, or fetal cells) that have been induced or changed (i.e., reprogrammed) into cells capable of differentiating into tissues of all three germ or dermal layers: mesoderm, endoderm, and ectoderm. The iPSCs produced do not refer to cells as they are found in nature. In some cases, iPSCs can be engineered to differentiation directly into committed cells (e.g., natural killer (NK) cells. In some cases, iPSCs can be engineered to differentiate first into tissue-specific stem cells (e.g., hematopoietic stem cells (HSCs) ) , which can be further induced to differentiate into committed cells (e.g., NK cells) .

[0051] The term "embryonic stem cell" (ESCs) generally refers to naturally occurring pluripotent stem cells of the inner cell mass of the embryonic blastocyst. Embryonic stem cells are pluripotent and give rise during development to all derivatives of the three primary germ layers: ectoderm, endoderm, and mesoderm. In some cases, ESCs can be engineered to differentiation directly into committed cells (e.g., NK cells) . In some cases, ESCs can be engineered to differentiate first into tissue-specific stem cells (e.g., HSCs) , which can be further induced to differentiate into committed cells (e.g., NK cells) .

[0052] The term "isolated stem cells" generally refers to any type of stem cells disclosed herein (e.g., ESCs, HSCs, mesenchymal stem cells (MSCs) , etc. ) that are isolated from a multicellular organism. For example, HSCs can be isolated from a mammal's body, such as a human body. In another example, an embryonic stem cells can be isolated from an embryo.

[0053] The term "isolated" generally refers to a cell or a population of cells, which has been separated from its original environment. For example, a new environment of the isolated cells is substantially free of at least one component as found in the environment in which the "un-isolated" reference cells exist. An isolated cell can be a cell that is removed from some or all components as it is found in its natural environment, for example, isolated from a tissue or biopsy sample. The term also includes a cell that is removed from at least one, some or all components as the cell is found in non-naturally occurring environments, for example, isolated from a cell culture or cell suspension.

[0054] The term "hematopoietic stem and progenitor cells, " "hematopoietic stem cells, " , "hematopoietic progenitor cells, " or "hematopoietic precursor cells, " as used interchangeably herein, generally refers to cells which are committed to a hematopoietic lineage but are capable of further hematopoietic differentiation (e.g., into NK cells) and include, multipotent hematopoietic stem cells (hematoblasts) , myeloid progenitors, megakaryocyte progenitors, erythrocyte progenitors, and lymphoid progenitors. Hematopoietic stem and progenitor cells (HSCs) are multipotent stem cells that give rise to all the blood cell types including myeloid (monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes / platelets, dendritic cells) , and lymphoid lineages (T cells, B cells, NK cells) . In some cases, HSCs can be CD34+hematopoietic cells capable of giving rise to both mature myeloid and lymphoid cell types including T cells, NK cells and B cells.

[0055] The term "immune cell" generally refers to a differentiated hematopoietic cell. Non-limiting examples of an immune cell can include an NK cell, a T cell, a monocyte, an innate lymphocyte, a tumor-infiltrating lymphocyte, a macrophage, a granulocyte, etc.

[0056] The term "gene" generally refers to a nucleic acid (e.g., DNA such as genomic DNA and cDNA) and its corresponding nucleotide sequence that is involved in encoding an RNA transcript. The term as used herein with reference to genomic DNA includes intervening, non-coding regions as well as regulatory regions and can include 5’ and 3’ ends. In some uses, the term encompasses the transcribed sequences, including 5’ and 3’ untranslated regions (5’ -UTR and 3’ -UTR) , exons and introns. In some genes, the transcribed region will contain "open reading frames" that encode polypeptides. In some uses of the term, a "gene" comprises only the coding sequences (e.g., an "open reading frame" or "coding region" ) necessary for encoding a polypeptide. In some cases, genes do not encode a polypeptide, for example, ribosomal RNA genes (rRNA) and transfer RNA (tRNA) genes. In some cases, the term "gene" includes not only the transcribed sequences, but in addition, also includes non-transcribed regions including upstream and downstream regulatory regions, enhancers, and promoters. A gene can refer to an "endogenous gene" or a native gene in its natural location in the genome of an organism. A gene can refer to an "exogenous gene" or a non-native gene. A non-native gene can refer to a gene not normally found in the host organism, but which is introduced into the host organism by gene transfer. A non-native gene can also refer to a gene not in its natural location in the genome of an organism. A non-native gene can also refer to a naturally occurring nucleic acid or polypeptide sequence that comprises mutations, insertions and / or deletions (e.g., non-native sequence) .

[0057] The term "expression" generally refers to one or more processes by which a polynucleotide is transcribed from a DNA template (such as into an mRNA or other RNA transcript) and / or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides can be collectively referred to as "gene product. " If the polynucleotide is derived from genomic DNA, expression can include splicing of the mRNA in a eukaryotic cell. "Up-regulated, " with reference to expression, generally refers to an increased expression level of a polynucleotide (e.g., RNA such as mRNA) and / or polypeptide sequence relative to its expression level in a wild-type state while "down-regulated" generally refers to a decreased expression level of a polynucleotide (e.g., RNA such as mRNA) and / or polypeptide sequence relative to its expression in a wild-type state. Expression of a transfected gene can occur transiently or stably in a cell. During "transient expression" the transfected gene is not transferred to the daughter cell during cell division. Since its expression is restricted to the transfected cell, expression of the gene is lost over time. In contrast, stable expression of a transfected gene can occur when the gene is co-transfected with another gene that confers a selection advantage to the transfected cell. Such a selection advantage may be a resistance towards a certain toxin that is presented to the cell.

[0058] The term "peptide, " "polypeptide, " or "protein, " as used interchangeably herein, generally refers to a polymer of at least two amino acid residues joined by peptide bond (s) . This term does not connote a specific length of polymer, nor is it intended to imply or distinguish whether the peptide is produced using recombinant techniques, chemical or enzymatic synthesis, or is naturally occurring. The terms apply to naturally occurring amino acid polymers as well as amino acid polymers comprising at least one modified amino acid. In some cases, the polymer can be interrupted by non-amino acids. The terms include amino acid chains of any length, including full length proteins, and proteins with or without secondary and / or tertiary structure (e.g., domains) . The terms also encompass an amino acid polymer that has been modified, for example, by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, oxidation, and any other manipulation such as conjugation with a labeling component. The terms "amino acid" and"amino acids, " as used herein, generally refer to natural and non-natural amino acids, including, but not limited to, modified amino acids and amino acid analogues. Modified amino acids can include natural amino acids and non-natural amino acids, which have been chemically modified to include a group or a chemical moiety not naturally present on the amino acid. Amino acid analogues can refer to amino acid derivatives. The term "amino acid" includes both D-amino acids and L-amino acids.

[0059] The term "derivative, " "variant, " or "fragment, " as used herein with reference to a polypeptide, generally refers to a polypeptide related to a wild type polypeptide, for example either by amino acid sequence, structure (e.g., secondary and / or tertiary) , activity (e.g., enzymatic activity) and / or function. Derivatives, variants, and fragments of a polypeptide can comprise one or more amino acid variations (e.g., mutations, insertions, and deletions) , truncations, modifications, or combinations thereof compared to a wild type polypeptide.

[0060] The terms “exogenous gene” or “transgene” refer to a gene which has been introduced into the cell or an ancestor thereof by genetic engineering, e.g., comprising a coding sequence for a protein of interest operably linked to a heterologous promoter. The exogenous genes used herein may be transiently expressed by viral vectors, e.g., adeno-associated vectors, but in particular embodiments herein, they are stably incorporated into the genome of the engineered cells. The exogenous genes herein may be associated with a selectable or screenable marker, for example a fluorescent marker such as blue fluorescent protein (BFP) . In certain embodiments, induced pluripotent stem cells (iPSCs) are stably transformed with the exogenous gene of interest, together with a selectable or screenable marker, and differentiated into hematopoietic cells, e.g., NK cells or T cells, which also express the exogenous gene, and which may be introduced into a patient as an allogeneic cell therapy.

[0061] As used herein, “treating” or “treatment” encompasses prophylaxis, mitigation, amelioration of symptoms, and / or delaying the progression of a disease or condition.

[0062] The present disclosure provides a population of induced pluripotent stem cells (iPSCs) and hematopoietic cells derived therefrom, pharmaceutical compositions comprising said cells, and methods of use of same wherein the cells are modified to (i) disrupted one or more genes and / or (ii) transfected with one or more genes, for preferential activation of CAR-dependent cell-mediated cytotoxicity over canonical ADCC pathways.

[0063] For example, the population of hematopoietic cells, pharmaceutical compositions, and methods disclosed are intended to reduce off-target ADCC activation of engineered cells, and / or to selectively activate ADCC pathways against desired pathogenic antibodies, cells, or tissues. In some embodiments, the off-target ADCC activation is through canonical CD16-mediated pathways. In some embodiments, the selective ADCC pathways against desired pathogenic antibodies, cells, or tissues are mediated by transfected genes, e.g., CAR constructs, e.g., anti-CLL1, anti-CD20, anti-BCMA, anti-CD19, anti-CD33, and / or anti-CD70 CAR constructs.

[0064] In some embodiments, the population of hematopoietic cells, pharmaceutical compositions, and methods disclosed are used to treat a subject in need thereof, e.g., a human, e.g., a human diagnosed with cancer and / or an auto-immune disease or condition. In some embodiments, the cancer or auto-immune disease or condition comprises B cells producing auto-antibodies, e.g., B cells expressing or overexpressing CLL1, CD20, BCMA, CD19, CD33, and / or CD70.

[0065] The present disclosure describes systems and methods for immunotherapies. Immune cells described herein, e.g., NK cells and / or T cells, can be engineered to exhibit selective activation of ADCC pathways, e.g., increased activation of ADCC in response to pathogenic B cell and / or auto-antibody accumulation and decreased activation of ADCC in response to canonical CD16 pathways. Immune cells can be engineered to exhibit reduced off-target effects as compared to a control cell. Immune cells can be engineered to effectively and specifically target diseased cells, e.g., cancer cells or auto-immune cells, that a control cell otherwise is insufficient or unable to target. The engineered immune cells disclosed herein can be engineered ex vivo, in vitro, and in some cases, in vivo. The engineered immune cells that are prepared ex vivo or in vitro can be administered to a subject in need thereof to treat a disease, e.g., myeloma, lymphoma, solid tumors, lupus, or auto-immune diseases or conditions. The engineered immune cells can be autologous to the subject. Alternatively, the engineered immune cells can be allogeneic to the subject.

[0066] For example, in certain embodiments, the disclosure provides engineered human cells (e.g., iPSCs or NK cells derived therefrom) that lack a functional CD16, and that express a CAR-ADCC construct capable of inducing cell-mediated cytotoxicity through a CAR-dependent pathway, wherein the CAR-ADCC construct comprises (i) means for binding to a B-cell antigen (e.g., binding to CLL1, CD19, CD20, or BCMA) ,  for example a recognition domain (e.g., scFv) from an antibody which binds a B-cell antibody; for example, selected from any of the scFv domains from SEQ ID Nos. 1-11; (ii) means for linking the binding means to a transmembrane domain, e.g. a hinge sequence  (e.g., comprising a sequence derived from CD16a, CD8, or a combination thereof) ; for example, selected from any the hinge regions depicted in SEQ ID Nos. 1-11; (iii) means for linking an extracellular region of the CAR-ADCC construct to an intracellular  region, e.g., a transmembrane domain (TMD) sequence (e.g., comprising a sequence derived from CD16a, CD32a, CD8, or a combination thereof) ; for example, selected from any the TMDs depicted in SEQ ID Nos. 1-11; (iv) means for activating release of cytotoxic factors that can kill the target cell, e.g., an  intracellular domain (ICD) sequence (e.g., comprising a sequence derived from CD16a, CD32a, or a combination thereof; for example, selected from any the ICDs depicted in SEQ ID Nos. 1-11; and (v) means for co-stimulation of the activating means, e.g., an intracellular co-stimulatory  region, (e.g., CD3z) ; for example, selected from any the co-stimulatory regions depicted in SEQ ID Nos. 1-11.

[0067] The disclosure thus provides engineered cells (Cell 1) [e.g., human cells, including (i) engineered stem cells, e.g., induced pluripotent stem cells (iPSCs) , and (ii) engineered hematopoietic cells, e.g., NK cells or T-cells (which engineered hematopoietic cells may be the progeny of the engineered stem cells) ] , which have reduced expression of CD16 at the cell surface, such that canonical  stimulation of antibody-dependent cell-mediated cytotoxicity (ADCC) is substantially reduced [e.g., wherein CD16is knocked out in the cell or an ancestor thereof] ; wherein iPSCs which are so engineered can differentiate into hematopoietic cells, e.g.,  NK cells or T-cells.

[0068] For example, the disclosure provides: 1.1. Cell 1 wherein the engineered cells are induced pluripotent stem cells (iPSCs) . 1.2. Cell 1 wherein the engineered cells are derived from induced pluripotent stem  cells (iPSCs) . 1.3. Cell 1, wherein the engineered cells are primary cells. 1.4. Cell 1 or 1.2 wherein the engineered cells are hematopoietic cells. 1.5. Cell 1.3 wherein the engineered cells are hematopoietic stem cells. 1.6. Cell 1.3 wherein the engineered cells are natural killer (NK) cells. 1.7. Cell 1.3 wherein the engineered cells are T cells. 1.8. Any foregoing engineered cells, wherein one or more gene encoding CD16 is  knocked-out or disrupted, such that said gene does not express functional proteins, e.g., capable of binding an antibody Fc so as to induce ADCC. 1.9. Any foregoing engineered cells, wherein one or more gene encoding CD16 is  knocked-out or disrupted, wherein the one or more gene is knocked-out or disrupted by means of CRISPR / Cas9 targeted disruption of the gene or genes encoding CD16, e.g., wherein the CD16 gene is disrupted in the Exon2 region, e.g., wherein the sgRNA and PAM sequences used by the CRISPR / Cas9-based method comprise GCTGCCACATGATGCCACAC (SEQ ID No. 15) and TGG, respectively. 1.10. Any foregoing engineered cells, wherein expression of CD16 gene is disrupted  such that the amount of CD16 proteins on the cell-surface is reduced by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%relative to a control, e.g., in an in vitro assay as described in the Examples below, e.g., relative to isogenic cells without the gene disruption. 1.11. Any foregoing engineered cells, wherein antibody-dependent cell-mediated  cytotoxicity (ADCC) activated by a canonical CD16 signaling pathway is reduced by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%relative to a control, e.g., in an in vitro assay as described in the Examples below, e.g., relative to isogenic cells without the gene disruption. 1.12. Any foregoing engineered cells comprising a transgene, said transgene  comprising a coding region for a chimeric antigen receptor (CAR) construct. 1.13. The engineered cells of Cell 1.11, wherein the transgene is operably linked to a  heterologous promoter, wherein expression of the transgene does not interfere with the differentiation of iPSCs comprising the transgene into selected hematopoietic cells, e.g., NK cells or T cells. 1.14. The engineered cells of Cell 1.11 or 1.12, wherein the CAR construct expresses a  CAR receptor on the surface of the engineered cell. 1.15. The engineered cells of any of Cell 1.11-1.13, wherein the CAR construct  comprises a leader sequence, a scFv sequence, a hinge sequence, a transmembrane domain (TMD) sequence, and an intracellular domain (ICD) sequence. 1.16. The engineered cells of Cell 1.14, wherein the scFv sequence comprises a  receptor sequence complementary to a surface protein on a target cell, e.g., a tumor cell or a B cell, e.g., a B cell expressing auto-antibodies. 1.17. The engineered cells of Cell 1.14 or 1.15, wherein the scFv sequence comprises  an anti-CLL1 sequence, an anti-CD20 sequence, an anti-BCMA VHH sequence, an anti-CD19 sequence, or a combination thereof. 1.18. The engineered cells of any of Cell 1.14-1.16, wherein the hinge sequence  comprises a sequence derived from CD16a, CD8, or a combination thereof. 1.19. The engineered cells of any of Cell 1.14-1.17, wherein the TMD sequence  comprises a sequence derived from CD16a, CD32a, CD8, or a combination thereof. 1.20. The engineered cells of any of Cell 1.14-1.18, wherein the ICD sequence  comprises a sequence derived from CD16a, CD32a, or a combination thereof. 1.21. The engineered cells of any of Cell 1.11-1.19, wherein the CAR construct further  comprises an intracellular co-stimulatory region, e.g., CD3z. 1.22. The engineered cells of any of Cell 1.11-1.20, wherein the CAR constructs  comprise a leader sequence, a scFv sequence, a hinge sequence, a TMD sequence, an ICD sequence, or a combination thereof as listed in SEQ ID No. 1-11. 1.23. The engineered cells of any of Cell 1.11-1.21, wherein the engineered cells  expressing CAR constructs are capable of cell-mediated cytotoxicity through a CAR-dependent pathway. 1.24. The engineered cells of any of Cell 1.11-1.22, wherein the engineered cells  expressing CAR constructs can provide cell-mediated cytotoxicity through a CAR-dependent pathway rather than a canonical ADCC pathway. 1.25. The engineered cells of any of Cell 1.11-1.23, wherein the engineered cells  produce less interferon-gamma (IFN-γ) during CAR-dependent cell-mediated cytoxicity activation relative to cells undergoing canonical ADCC activation. 1.26. Any foregoing engineered cells comprising two or more transgenes, said  transgenes comprising coding regions for two or more CAR constructs. 1.27. The engineered cells of Cell 1.25, wherein the engineered cells express the two or  more CAR constructs simultaneously, e.g., wherein both CAR construct protein products are present on the cell surface. 1.28. Any foregoing engineered cells wherein the cells are CAR-NK cells or CAR-T  cells. 1.29. Any foregoing engineered cells wherein the heterologous promoter is a  constitutive promoter, e.g., selected from the CAG promoter, the adenovirus major late promoter, the human cytomegalovirus immediate early promoter (hCMV-IE) , the SV40 and Rous Sarcoma virus promoters, the murine 3-phosphoglycerate kinase promoter, the translation elongation factor 1α (EF-1α) promoter, and the human ubiquitin C promoter; e.g., the CAG promoter. 1.30. Any foregoing engineered cells wherein the exogenous gene is stably  incorporated into the genome of the engineered cell. 1.31. Any foregoing engineered cells wherein the cells or their progeny, when  engrafted into a recipient, remain in circulation for at least 15 days, e.g., at least 30 days, e.g., at least 60 days. 1.32. Any foregoing engineered cells, wherein the cells or their progeny do not exhibit  significant levels of off-target effects, e.g., canonical ADCC activity not at the site of interest. 1.33. The foregoing engineered cells which are iPSCs or NK cells derived from said  iPSCs. 1.34. Any foregoing engineered cells which are iPSCs, NK cells, T cells, B cells,  macrophages, monocytes, cardiomyocytes, islet cells, neural cells, endothelial cells; for example iPSCs, and NK cells, T cells, B cells, macrophages, monocytes, cardiomyocytes, islet cells, neural cells, or endothelial cells derived from said iPSCs; for example NK cells derived from said iPSCs. 1.35. Any foregoing engineered cells which are Primary and stem cell derived NK, T  cell, B cells, macrophages, monocytes, cardiomyocytes, islet cells, neural cells, or endothelial cells. 1.36. Any foregoing engineered cells which lack a functional CD16, and which express  a CAR-ADCC construct capable of inducing cell-mediated cytotoxicity through a CAR-dependent pathway, wherein the CAR-ADCC construct comprises a recognition domain (e.g., scFv) binding to a B-cell antigen (e.g., binding to CLL1, CD19, CD20, or BCMA) , a hinge sequence (e.g., comprising a sequence derived from CD16a, CD8, or a combination thereof) , a transmembrane domain (TMD) sequence (e.g., comprising a sequence derived from CD16a, CD32a, CD8, or a combination thereof) , an intracellular domain (ICD) sequence (e.g., comprising a sequence derived from CD16a, CD32a, or a combination thereof, and an intracellular co-stimulatory region, (e.g., CD3z) ; e.g., a CAR-ADCC construct comprising a leader sequence, a scFv sequence, a hinge sequence, a TMD sequence, an ICD sequence, or a combination thereof, e.g., as listed in any of SEQ ID No. 1-11. 1.37. Any foregoing engineered cell, wherein the cell further comprises at least one  feature selected from the group consisting of: (i) a killing enhancing component, or the nucleotide coding sequence thereof; eg. a  chimeric antigen receptor (CAR) or a T cell receptor (TCR) ; (ii) a persistence component, or the nucleotide coding sequence thereof; (iii) a hypo-immunity regulator, or the nucleotide coding sequence thereof; (iv) a safety switch component, or the nucleotide coding sequence thereof; 1.38. Any foregoing engineered cells for use in treating a disease or condition in a  patient in need thereof. 1.39. The foregoing engineered cells wherein the patient is a human. 1.40. Any foregoing engineered cells wherein the transgenes are derived from  mammalian genes, e.g., human, monkey, cattle, dog, mouse, or rat, preferably human or monkey. 1.41. Any foregoing engineered cells in a pharmaceutical composition comprising the  engineered cells in a pharmaceutically acceptable carrier, suitable for administration by injection, e.g., via intravenous, intramuscular, intraperitoneal, intrathecal, or intraosseous injection. 1.42. Any foregoing engineered cells for use in treating cancer, e.g., comprising  administering a composition comprising any foregoing cells to a patient in need thereof. 1.43. Any foregoing engineered cells for use in treating cancer, e.g., blood cancer, lung  cancer, colorectal cancer, pancreatic cancer, renal cell cancer, or breast cancer, e.g., acute myeloid leukemia, acute lymphoblastic leukemia, Burkitt lymphoma, Non-Hodgkin lymphoma, chronic lymphocytic leukemia, chronic myelogenous leukemia. 1.44. Any foregoing engineered cells for use in treating an auto-immune disease or  condition, e.g., comprising administering a composition comprising any foregoing cells to a patient in need thereof. 1.45. Any foregoing engineered cells for use in treating an auto-immune disease or  condition mediated by B cells, e.g., B cells in circulation and / or in bone marrow, e.g., B cells expressing CLL1, CD20, BCMA, CD19, CD33, and / or CD70. 1.46. Any foregoing engineered cells for use in treating an auto-immune disease or  condition, wherein the auto-immune disease or condition comprises lupus, systemic lupus erythematosus, multiple sclerosis, systemic sclerosis, vasculitis, Crohn’s disease, Myasthenia Gravis, Stiff-Person syndrome, Sjogren’s syndrome, rheumatoid arthritis, or a pulmonary condition. 1.47. Any foregoing engineered cells for use in treating cancer or auto-immune disease  or condition with multiple on-demand administrations. 1.48. Any foregoing engineered cells for use in treating blood cancer or a solid tumor,  e.g., myeloma or lymphoma, e.g., comprising administering a composition comprising iPSCs, differentiated immune cells (e.g., NK cells, T cells, B cells, NKT cells, macrophages, or monocytes) , or differentiated immune cells derived from said iPSCs. 1.49. Any forgoing engineered cells for use in treating an autoimmune disease, e.g.,  comprising administering a composition comprising iPSCs, differentiated immune cells (e.g., NK cells, T cells, B cells, NKT cells, macrophages, or monocytes) , or differentiated immune cells derived from said iPSCs. 1.50. Any foregoing engineered cells for use in treating diabetes, e.g., comprising  administering a composition comprising iPSCs, islet cells, or islet cells derived from said iPSCs. 1.51. Any foregoing engineered cells for use in regenerative medicine treatments, e.g.,  cardiomyocyte transplantation for heart injury or failure, islet cell transplantation for diabetes, neural progenitor cell transplantation for stroke or central nervous system disorders / injury, e.g., comprising administering a composition comprising iPSCs, NK cells, T cells, B cells, macrophages, monocytes, cardiomyocytes, islet cells, neural cells, neural progenitor cells, endothelial cells, mesenchymal cells, or are said cells derived from said iPSCs. 1.52. Any foregoing engineered cells for use in the manufacture of a medicament for  use in treating cancer or an auto-immune disease or condition, e.g., comprising administering a composition comprising any foregoing cell to a patient in need thereof. 1.53. The progeny of any foregoing engineered cells. 1.54. A pharmaceutical composition comprising engineered cells according to any of  the foregoing engineered cells in a pharmaceutically acceptable carrier suitable for injection, e.g., suitable for intravenous infusion, e.g., for use in treating a disease or condition in a human patient, e.g., for use in treating cancer or an auto-immune disease or condition.

[0069] The disclosure further provides a pharmaceutical composition comprising engineered cells according to any of Cell 1, et seq., in a pharmaceutically acceptable carrier suitable for injection, e.g., suitable for intravenous infusion. For example, the pharmaceutically acceptable carrier suitable for intravenous infusion may be an isotonic saline solution, e.g., 0.9%w / v saline solution, lactated Ringer’s solution, or an isotonic solution formulated for cell culture or therapy, e.g., an isotonic solution comprising physiologically acceptable levels of sodium chloride, dextrose, electrolytes, albumin, and optionally a cryopreservative [e.g. comprising 31.25% (v / v) of Plasma-Lyte A, 31.25% (v / v) of 5%Dextrose / 0.45%sodium chloride, 10%Dextran 40 (LMD)  / 5%Dextrose, 20% (v / v) of 25%Human Serum Albumin (HSA) , and 7.5% (v / v)  dimethylsulfoxide (DMSO) ] . In certain embodiments, the pharmaceutical composition is frozen during storage and thawed upon administration to the patient. The engineered cells according to any of Cell 1, et seq. include, for example, engineered cells wherein the cells are autologous or allogeneic with respect to the patient and wherein the cells or their progeny, when engrafted into a recipient, remain in circulation for at least 15 days, e.g., for at least 30 days, e.g., for at least 60 days.

[0070] In a further embodiment, the disclosure provides a method of making hematopoietic cells wherein (i) one or more genes is disrupted in said cells and / or (ii) one or more genes is transfected into said cells, e.g., such that selective ADCC activation is more prominent than off-target canonical ADCC activation pathways, comprising culturing a population of engineered induced pluripotent stem cells (iPSCs) , e.g., according to Cell 1.1, under conditions which induce differentiation of the engineered iPSCs into engineered hematopoietic cells, e.g., engineered cells according to any of Cell 1, et seq.; e.g., wherein the one or more genes disrupted in said cells comprises CD16; and / or wherein the one or more genes transfected into said cells comprise one or more CAR constructs; e.g., wherein the hematopoietic cells are NK cells and the conditions which induce differentiation of the iPSCs into hematopoietic cells are conditions which further induce differentiation into NK cells; or wherein the hematopoietic cells are T cells and the conditions which induce differentiation of the iPSCs into hematopoietic cells are conditions which further induce differentiation into T cells.

[0071] In a further embodiment, the disclosure provides a method of treating a disease or condition, e.g., characterized by abnormal B cell activity, comprising administering a composition comprising any Cell 1, et seq. to a patient in need thereof, wherein the disease or condition is a. cancer, e.g., blood cancer (e.g., myeloma or lymphoma) , lung cancer, colorectal  cancer, pancreatic cancer, renal cell cancer, or breast cancer, e.g., acute myeloid leukemia, acute lymphoblastic leukemia, Burkitt lymphoma, Non-Hodgkin lymphoma, chronic lymphocytic leukemia, chronic myelogenous leukemia; b. an auto-immune disease or condition, e.g., an auto-immune disease or condition  mediated by B cells, e.g., B cells in circulation and / or in bone marrow, e.g., B cells expressing CLL1, CD20, BCMA, CD19, CD33, and / or CD70; e.g., selected from lupus, systemic lupus erythematosus, multiple sclerosis, systemic sclerosis, vasculitis, Crohn’s disease, Myasthenia Gravis, Stiff-Person syndrome, Sjogren’s syndrome, rheumatoid arthritis, or a pulmonary condition; c. a condition requiring replacement or regeneration of depleted cells, e.g., wherein the  method comprises cardiomyocyte transplantation for heart injury or failure, islet cell transplantation for diabetes, or neural progenitor cell transplantation for stroke or central nervous system disorders / injury; for example, wherein the cells are selected from iPSCs and hematopoietic cells, for  example NK cells; for example, wherein the cells are autologous or allogeneic with respect to the patient, e.g., wherein the cells are allogeneic NK cells. EXAMPLES Example 1: Construct iPSC-derived NK cells with genetic knockout of CD16a

[0072] A cell with a CD16a double knockout is generated by disrupting the corresponding gene exon (Exon2) using CRISPR / Cas9-based gene targeting in an ANB clone. ANB is a natural killer (NK) cell line without any gene edits, which is derived from an induced pluripotent stem cell (iPSC) line. ANB is expanded upon activation by feeder cells in medium with 200IU IL2. Figure 1 depicts the gene structure of CD16a, including Exon2 which was disrupted using the shown sgRNA and PAM. The CD16a-disrupted ANB clones are derived from CD16a-disrupted iPSCs and are screened and verified by genomic PCR and Sanger sequencing. Thus, ANB CD16a- / -are obtained with a premature termination codon in each allele. Figure 2 depicts fluorescence-activated cell sorting (FAC) analysis of the resultant ANB CD16a- / -cells in comparison with wild type (WT) and isotype (ISO) controls, indicating a significant disruption in CD16expression and reduction to baseline detection in the knockout cells. Example 2: ANB CD16a- / -eliminates ADCC activity, but does not influence NK function or  differentiation

[0073] The double knockout of CD16a in ANB CD16a- / -cells displays no effect on the differentiation process of iPSCs into NK cells, as shown in Table 1. Notably, the CD16a- / -cells exhibit high cell viability of 97.45%as determined using an acridine orange / propidium iodide (AO / PI) detection system, iPSC pluripotency with 99%expression of stem cell markers TRA-1-81 and SSEA4 as monitored by FACS, and successful differentiation with high expression levels of CD34 and CD56. Table 1. CD16a- / -cells show no effect of double knockout on differentiation of iPSCs into NK  cells

[0074] Further, it is demonstrated that in vitro cytotoxicity against target cells remains efficacious in the CD16a- / -cells. Figure 3 depicts CD16a- / -cells cytotoxicity against Raji cells in vitro.

[0075] However, CD16a- / -double knockout eliminates ADCC function and associated effects from NK cells in patients’ antibodies. Figure 4 depicts reduced levels of CD107a, a marker of degranulation of activated NK cells, in the CD16a- / -cells compared to controls. This provides initial proof of concept of the improved safety profile, i.e., reduced off-target activity, of NK cells modified with the CD16a- / -double knockout.

[0076] Example 3: Preparing CAR-NK cells

[0077] Preparation of lentiviral vector (s)

[0078] A series of CAR constructs are designed for insertion into a lentiviral plasmid with a hEF1a promoter by Gibson Assembly. A blue fluorescence protein (BFP) gene is fused to the 3’-terminus of the CAR constructs using a self-cleavable T2A linker. The vector is transformed into a TOP10 Escherichia coli strain, which is screened by ampicillin exposure to obtain positive clones. The plasmid is then extracted and the clone isolated by enzyme digestion, so that the desired lentiviral vector is obtained. Figure 5 schematically depicts the designed CAR-ADCC constructs.

[0079] The CAR-ADCC constructs depicted in Figure 5 are more thoroughly depicted, for example, by the sequences of Table 2. For example, in certain embodiments, the binding regions of the CAR-ADCC are selected from (i) the anti-CLL1 scFv from U.S. Patent No. 11,014,989 (incorporated herein by references) , e.g., SEQ ID NO 58; (ii) the anti-CD20 scFv from CN Patent No. 113056283A (incorporated herein by reference, e.g. SEQ ID NO 8; (iii) the anti-CD20 scFv from U.S. Patent Application No. 2023 / 212255 A1 (incorporated herein by reference) , e.g., SEQ ID NO 16; and (iv) the anti-BCMA tandem VHH from the anti-BCMA binder of LCAR-B38M of U.S. Patent Application 2021 / 128618 A1 (incorporated herein by reference) . Table 2. Sequences of CAR-ADCC constructs.

[0080] Preparation of lentivirus

[0081] Following isolation of the desired lentiviral vectors containing the designed constructs, 293T cells are evenly distributed in 10cm petri dishes at about 1x107cells per dish in DMEM with 10%FBS. After 16-20 hours, the DNA-PEI mixture is prepared. In the DNA-PEI mixture, 30 μL PEI-PRO is added to 470 μL Opti-MEM followed by mixing and vortexing. Then, 5 μg of lentiviral plasmid, 2.5 μg PSPX2 (packaging plasmid) , and 2.5 μg VSVG plasmid is added to 500 μL Opti-MEM followed by vortexing. The DNA mixture is then added to the PEI-PRO mixture dropwise before further vortexing and letting the mixture stand for 15-20 minutes. Then 1 mL of the DNA-PEI mixture is transferred into a dish of 293T cells. The cells are incubated for 8 hours at 37℃with 5%CO2in the incubator before replacing the media with fresh media. The supernatant is collected after 48 hours and 72 hours following transfection and filtered with PES membrane (0.45 μm) . The lentivirus particles are concentrated using polyethylene glycol 6000 precipitation. The lentivirus titer is determined using FACS.

[0082] Production of CAR-NK cells

[0083] iPSC-derived ANB NK cells (iNK) or iPSC-derived anti-CD19 CAR-NK cells (clone OI42) are expanded with the feeder cells from above. The NK cells are infected at day 4 of expansion.

[0084] The concentrated virus obtained above is melted on ice, diluted in 100 μL media, then added into a 96-well flat plate which has been coated by retronectin at 4℃for 4-16 hours. The MOI (i.e., the multiplicity of infection, or ratio of virus particles to host cells) is 5. The 96-well plate is incubated for 4 hours.

[0085] After incubation, the density of NK cells is adjusted to 3×106 / mL. 100 μL of the cell suspension is added into the 96-well plate containing the 100 μL lentivirus, while 8 μg / mL polybrene is added at the same time. The 96-well plate is centrifuged at 1,000g for 60 minutes at 32℃before transferring the 96-well plate to the incubator. The next day, all NK cells are concentrated and resuspended with fresh media. Then, 2-fold aAPC MZ10 is added for the next round of expansion. Fresh media is added every 2-3 days to maintain effective IL-2 and nutrient levels. Flow cytometry analysis is performed after 72 hours, and BFP-positive CAR-NK cells are sorted by flow cytometry after 7 days for further expansion with APC. Figure 6 depicts a flowchart summarizing the process of preparing CAR-NK cells.

[0086] Example 4: Evaluating specificity of CAR-ADCC-induced killing in vitro

[0087] CAR-NK cells are developed using the processes of the Examples above, wherein the CAR-NK cells express anti-CLL1 (aCLL1) . The anti-CLL1 expression is confirmed using FACS and exposure to a fluorescently-labelled recombinant CLL1 protein. CAR-NK cells expressing CAR constructs of SEQ ID No. 1 and SEQ ID No. 2 (see Table 2) are produced, along with a control aCLL1 scFv-CD8hinge-CD8TMD-41BBZ CAR control. Figure 7 depicts the results of the FACS analysis, including the CLL1 protein binding by the engineered NK cells via the introduced anti-CLL1 CAR constructs.

[0088] The specificity of anti-CLL1 CAR-ADCC NK cells binding and lysing AML tumor cell line HL60 (highly expressing CLL1) is evaluated by a serial killing assay by Live-Cell Analysis System. In this assay, 1.5×104tumor cells, HL60-GFP, and 1.5×104CAR-NK cells are evenly distributed in a fibronectin-coated 96-well plate. Fluorescence and bright field microscopy images are captured every 3 hours over 1-3 days. Data captured from wells only containing tumor cells is used as baseline. The collected data are normalized to time=0hr and then to the tumor-only sample.

[0089] The anti-CLL1 CAR-ADCC NK cells exhibit antigen-specific killing against HL60 cells through activation of the ADCC signaling pathway. Figure 8 depicts the lysis of said HL60 cells after treatment with anti-CLL1 CAR-ADCC NK cells. Notably, the CAR-NK cells expressing the construct with SEQ ID NO. 1, comprising the aCLL1 scFv and the CD16a-derived hinge, transmembrane domain (TMD) , and intracellular domain (ICD) , selectively lyses the HL60 cells to a degree comparable to the control.

[0090] Anti-CLL1 CAR-ADCC NK cells expressing the constructs of SEQ ID NO. 3, 4, 5, and 6 are also produced and evaluated as above. Figure 9 depicts the results of FACS analysis, wherein binding of fluorescently-labelled CLL1 protein by the engineered cells indicates anti-CLL1 CAR expression. Further, the antigen-specific killing of HL60 cells through activation of the ADCC signaling pathway by the anti-CLL1 CAR-ADCC NK cells expressing SEQ ID NO. 3, 4, 5, and 6 is evaluated. Figure 10 depicts the lysis of said HL60 cells after treatment with anti-CLL1 CAR-ADCC NK cells. The positive control QN023a is used, which is a CAR-NK with high anti-tumor efficacy. Notably, all tested CAR-NK cells expressing the anti-CLL1 constructs perform comparably well to the positive control, as shown in Figure 10.

[0091] Example 5: Comparing specificity of CAR-ADCC cytotoxicity and hnCD16-mediated ADCC function in vitro.

[0092] NK cells expressing SEQ ID NO. 7, 8, 9 ( “Super” NKs) are prepared as above. Super NK cells overexpress human hnCD16a and have strong ADCC activity in combination with rituximab, an anti-CD20 antibody. The hnCD16a used are high affinity and non-cleavable mutants, namely F158V and S197P as discussed in U.S. Patent Application Publication 2021 / 163622 A1, herein incorporated by reference in full. The CD20+tumor cell line Raji is labeled using 2 μM CFSE at 37℃for 30 minutes before washing twice with PBS. The CFSE-labelled Raji are seeded with or without anti-CD20 CAR Super NK cells, and incubated for 4 hours at 37℃. The CFSE+ / PI+populations are detected using flow cytometry. Figure 11 depicts the results of the cytotoxicity challenge to Raji cells, wherein the anti-CD20 Super CAR-NK cells display effective cytotoxicity against the Raji cells. Figure 12 depicts cytotoxicity against Raji cells via ADCC, and the increase in ADCC activation with respect to rituximab in the presence of the Super NK cells. These data show that the CAR-ADCC cells provide comparable anti-tumor activity to the hnCD16-rituximab induced ADCC.

[0093] Example 6: CD32a-derived CAR-ADCC constructs have potent cytotoxicity and improved safety profile.

[0094] CAR-ADCC NK cells with CD32a-derived anti-BCMA construct expression is produced as above. CAR-ADCC NK cells expressing SEQ ID NO. 10 and 11 display comparable cytotoxicity against MM. 1R cells as canonical 41BBZ-CAR construct, as depicted in Figures 13 and 14. Figure 13 depicts the CAR-NK cells displaying similar cytotoxicity to the 41BBZ-CAR cells against MM. 1R cells with similar effector cell: target cell ratios. Figure 14 depicts the CAR-NK cell cytotoxicity against MM. 1R cells over time. However, despite demonstrating comparable cytotoxicity, the CAR-NK cells display lower levels of interferon-gamma (IFN-γ) release, as shown in Figure 15. High levels of IFN-γ release is associated with cytokine release syndrome (CRS) in clinical trials, especially for CAR-T or CAR-NK cells at high doses.

[0095] Example 7: Bispecific CAR-NK cells expressing a CD32a-derived CAR-ADCC and a canonical 41BBZ-CAR exhibit stronger anti-tumor capacity than a single canonical 41BBZ-CAR.

[0096] Lentiviruses carrying a transgene of a CD32a-derived anti-BCMA CAR-ADCC construct (SEQ ID NO. 11) are introduced to OI42 cells, as above. OI42 cells are iPSC-derived NK cells expressing an anti-CD19 41BBZ-CAR (OI42) . Thus, CAR-NK cells expressing both a CD32a-derived anti-BCMA CAR-ADCC and an anti-CD19 41BBZ-CAR are obtained. These dual-construct CAR-NK cells exhibit improved cytotoxicity over the unmodified OI42 cells, as depicted in Figure 16.

Claims

1.Engineered cells having reduced activation of antibody-dependent cell-mediated cytotoxicity (ADCC) through canonical pathways.2.The engineered cells of Claim 1, wherein the reduced activation of ADCC through canonical pathways is induced by disruption of CD16, or FcR, including CD16a, CD64, CD32a, CD32c, CD89; e.g., wherein the CD16 gene is disrupted in the Exon2 region; e.g., wherein the disruption of one or more gene comprises a CD16 double knock-out (CD16- / -) .3.The engineered cells of any of the preceding claims, wherein the engineered cells further comprise one or more transgene; e.g., a transgene comprising one or more coding region for one or more chimeric antigen receptor (CAR) construct.4.The engineered cells of Claim 3, wherein the CAR construct comprises one or more scFv sequence, hinge sequence, transmembrane domain (TMD) , intracellular domain (ICD) , or a combination thereof; optionally, wherein the CAR construct further comprises one or more leader sequence, intracellular costimulatory domain, fluorescent marker, or a combination thereof.5.The engineered cells of Claim 4, wherein the CAR construct comprises one or more scFv sequence comprising a sequence encoding a receptor complementary to a surface protein on a target cell, e.g., a tumor cell, a B cell, a T cell or any other human cells, e.g., a B cell expressing auto-antibodies; e.g., wherein the scFv sequence comprises one or more anti-CLL1 sequence, anti-CD20 sequence, anti-BCMA sequence, anti-CD19 sequence, anti-CD33 sequence, or a combination thereof.6.[Corrected under Rule 26, 14.05.2025]The engineered cells of any of claims 4 or 5,wherein the hinge sequence comprises a sequence derived from a mammalian gene, e.g., a human gene, e.g., CD16a, CD8, or a combination thereof;wherein the TMD sequence comprises a sequence derived from a mammalian gene, e.g., a human gene, e.g., CD16a, CD32a, CD8, or a combination thereof; andwherein the ICD sequence comprises a sequence derived from a mammalian gene, e.g., a human gene, e.g., CD16a, CD32a, or a combination thereof.7.The engineered cells of any of claims 4–6 wherein the one or more CAR construct comprise one or more leader sequence, scFv sequence, hinge sequence, TMD sequence, ICD sequence, or a combination thereof as listed in SEQ ID No. 1-11.8.The engineered cells of any of the preceding claims, wherein the engineered cells express one or more CAR constructs mentioned in claim 4 capable of activating cell-mediated cytotoxicity.9.The engineered cells of any preceding claim which lack a functional CD16, and which express a CAR-ADCC construct capable of inducing cell-mediated cytotoxicity through a CAR-dependent pathway, wherein the CAR-ADCC construct comprises a recognition domain (e.g., scFv) binding to a cell antigen (e.g., binding to CLL1, CD19, CD20, CD33 or BCMA) , a hinge sequence (e.g., comprising a sequence derived from CD16a, CD8, CD32a, CD32c, CD64, CD89, or a combination thereof) , a transmembrane domain (TMD) sequence (e.g., comprising a sequence derived from CD16a, CD32a, CD32c, CD64, CD89, CD8, or a combination thereof) , an intracellular domain (ICD) sequence (e.g., comprising a s, equence derived fromCD32a, CD32c, or FcεRγ, the signaling molecule of CD16a, CD64 and CD89, or a combination thereof, and an intracellular co-stimulatory region, (e.g., CD3z) ; e.g., a CAR-ADCC construct comprising a leader sequence, a scFv sequence, a hinge sequence, a TMD sequence, an ICD sequence, or a combination thereof, e.g., as listed in any of SEQ ID No. 1-11.10.[Corrected under Rule 26, 14.05.2025]The engineered cells of any of the preceding claims, wherein the cell further comprises at least one feature selected from the group consisting of:(i) a killing enhancing component, or the nucleotide coding sequence thereof; eg. a chimeric antigen receptor (CAR) or a T cell receptor (TCR) ;(ii) a persistence component, or the nucleotide coding sequence thereof;(iii) a hypo-immunity regulator, or the nucleotide coding sequence thereof;(iv) a safety switch component, or the nucleotide coding sequence thereof.11.Use of the engineered cells of any of the preceding claims in treating a disease or condition in a patient in need thereof; e.g., wherein the patient is a human; e.g., wherein the disease or condition is cancer or an auto-immune disease or condition; e.g., comprising administering a composition comprising primary immune cells, differentiated immune cells (e.g., NK cells, T cells, B cells, macrophages, or monocytes) , iPSCs or differentiated immune cells derived from said iPSCs.12.A pharmaceutical composition comprising the engineered cells of any of the preceding claims, and a pharmaceutically acceptable carrier or diluent; e.g., a pharmaceutical composition suitable for administration by injection; e.g., via intravenous, intramuscular, intraperitoneal, intrathecal, or intraosseous injection.13.A method for treating a disease or condition in a patient in need thereof, comprising administering to the patient in need thereof an effective amount of the engineered cells of any of Claims 1-10, or the pharmaceutical composition of Claim 12;wherein the disease or condition is cancer, e.g., blood cancer, lung cancer, colorectal cancer, pancreatic cancer, renal cell cancer, or breast cancer; e.g., acute myeloid leukemia, acute lymphoblastic leukemia, Brukitt lymphoma, non-Hodgkin’s lymphoma, chronic lymphocytic leukemia, or chronic myelogenous leukemia; orwherein the disease or condition is an auto-immune disease or condition, e.g., wherein the treatment of said auto-immune disease or condition requires reducing levels of B cells; e.g., B cells in circulation and / or in bone marrow; e.g., B cells expressing or overexpressing CLL1, CD20, BCMA, CD19, CD33, and / or CD70; e.g., wherein the auto-immune disease or condition comprises lupus, systemic lupus erythematosus, multiple sclerosis, systemic sclerosis, vasculitis, Crohn’s disease, Myasthenia Gravis, Stiff-Person syndrome, Sjogren’s syndrome, rheumatoid arthritis, or a pulmonary condition.14.A method of making the hematopoietic cells according to any of claims 1-10, comprising culturing the iPSCs according to any of claims 1-10 under conditions which induce differentiation of the iPSCs into hematopoietic cells.

Images